Jawed et al.

, Int J Med Lab Res 2016, 1(2): 24-28

ISSN 2456-4400

RESEARCH ARTICLE INTERNATIONAL JOURNAL OF MEDICAL LABORATORY RESEARCH

(IJMLR)
UTILITY OF LAMP ASSAY IN EARLY DETECTION OF DENGUE VIRUS
INFECTION
Prof. Uma Bhardwaj1, Binish Jawed2, Mukta Sehgal2

1
Professor, Biochemistry, MaharajVinayak Global University, Jaipur, Rajasthan, India -302028
2
Ph.D. Scholar, Clinical Biochemistry, Dr. Dangs Lab LLP, New Delhi, India -110016

Received:22 Nov, 2016/Accepted:3 Dec, 2016

Abstract:In the present day vector born dengue infection has become a major public health concern.
Early and accurate detection during the acute phase has crucial for management and prevention of
disease. RT-LAMP can be utilized in disease diagnosis as it a highly sensitive and specific method.A
genotype specific reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay was
developed in this study and we evaluated its sensitivity and specificity in comparison to NS1 antigen and
RT-PCR assay.Serological and RT-LAMP were performed on a total of 343 serum samples of clinically
suspected dengue patient. Further RT-LAMP positive serum sample were confirmed by Real Time PCR
(RT-PCR) method.A total of 32 % (n=109) dengue positive case, 79 %, 27% and 11% positive for NS1
antigen, IgM and IgG antibody respectively. 83% serum samples were positive for RT-LAMP and 76%
was common positive for NS1 Ag and RT-LAMP assay. All RT-LAMP positive samples were also
positive for RT-PCR.Developed RT-LAMP assay in this study shows strength of agreement in
comparison to others serological assays.It can be utilized in early, rapid, and sensitive detection of dengue
infection in resource limited areas of country.
Key words: Reverse Transcription-Loop-Mediated Isothermal Amplification, Dengue shock syndrome,
Dengue haemorrhagic fever, Enzyme linked immunosorbent assay.
INTRODUCTION:
after complete onset of disease. Unavailability of
In current scenario dengue has becomes a major dengue vaccine and specific medication, precise
public health problem in tropical and subtropical diagnosis become a very important in
countries 14,2. Every year a very large population preparedness and prevention of disease. Virus
of India is affected by dengue virus infection isolation, serology, antigen and molecular
transmitted through Aedes detection methods are available for dengue
mosquito.Antigenically different four genotypes infection confirmation4,5. Various commercially
(DEN 1,2,3 & 4) produce either an available tests are quite competitive in detection
asymptomatic or a moderate febrile infection of dengue antibody in human plasma/serum6,7.
such as dengue fever (DF) or severe fetal Suggestive diagnosis can be made on the basis
stage,dengue haemorrhagic fever (DHF) and of virus specific captured IgM and IgG enzyme
dengue shock syndrome (DSS)1,3. In this linked immunosorbent assay (ELISA) but it
situation, early and accurate diagnosis play a requires continuous monitoring of antibody titer
very important role in disease management and from acute phase to convalescent phase of
patient relief. High grade fever is a first clinical patient sera9. Cross reactivity of dengue
presentation of infection which is followed by a antibodies with otherflavivirus specific IgG
prompt reduction in platelet count which occurs antibodies is yet again a major drawback. Cell

*Corresponding Author:
Binish Jawed, Ph.D. Scholar,
Dr. Dangs Lab LLP, C2/1, SDA, New Delhi, India -110016

www.ijmlr.com/IJMLR© All right are reserved

24
 Jawed et al., Int J Med Lab Res 2016, 1(2): 24-28
ISSN 2456-4400

culture remains a gold standard for virus The aim of present study is to demonstrate the
detection although it requires more than 7 days feasibility of reverse transcription-loop-mediated
to complete the test. Recently, two different isothermal amplification (RT-LAMP) assay for
methods widely adopted for the dengue testing, clinical diagnosis of dengue virus infection.
proven as most consistent. It includesNS1 Originally LAMP technique was introduced by
antigen detection by ELISA and automated real- Netomi et al(2000) is very sensitive, efficient,
time PCR assay for dengue genomic detection in and easy to perform nucleic acid based
patient serum in acute phase of infection8,10,11. laboratory diagnostic method without any
Many researchers have found the advantage of specific instrument. Continuous amplification
Real time PCR over conventional RT-PCR in under isothermal condition produces large
term of quantitation, higher sensitivity, low rate amount of target DNA as well as higher
of contamination and performance. Though, all concentration of the by-product magnesium
PCR based testing requires a higher accuracy pyrophosphate, which makes reaction volume
instrument and particularized Standard operating turbid and easily visible to naked eyes.
procedure and good financial resources.

MATERIAL & METHOD: LAMP designer 1.14 based on 3’ UTR

nucleotide sequence of each dengue virus
Clinical sample genotype (GeneBank accession number;
DENV1- NC_001477, DENV2- NC_001474,
A total of 343 serum sample were collected from
DENV3- NC_001475, DEN4- NC_002640)
clinically suspected patients of dengue infection.
according to described criteria of Notomi et. al.
All samples undergo the captured IgM, IgG and
Table 1. The RT-LAMP assay were performed
NS1 antigen testing. Dengue IgM and NS1
in total volume 25 µl of each reaction mixture
positive serum were evaluated for RT-LAMP
using Loopamp DNA amplification kit, 25 pmol
assay. Age and gender details of patients were
of each inner primer (FIP, BIP) and loop
not included in presented study. Healthy
primers; 3.0 pmol of outer primers; 1.5 µl of
volunteer samples (n=20) were collected as
fluorescent dye (Eiken chemical Co. ltd. Japan).
negative control for RT-LAMP assay.
The reaction tube was incubated at standardized
Serological testing constant temperature (640C) for 60 minutes in
heating block. The positive reaction tube colour
Panbio Dengue IgM/IgG (Standard Diagnostic turns to green and fluorescent under the UV
Inc, Rebublic of Korea) microwell plate ELISA light as well as negative remains orange and
test kit was used for dengue specific IgM and non-fluorescent (Figure1). The positive and
IgG antibodies estimation and PlateliaTM Dengue negative control were put simultaneously with
NS1Ag (Manufacturer, Bio-Rad, France)dengue each set of amplification.
ELISA kit for NS1 antigen. Procedure followed
as per manufactur’s protocol. Specificity and sensitivity of RT-LAMP assay
Nucleic acid extraction and RT-LAMP assay
Each primer set of DENV RT-LAMP were
200 µl serum samples were used for nucleic acid assessed withChikungunya and Japenese
extraction by Roche High Pure Viral Nucleic encephalitis virus, which are also endemic at the
acid kit (Roche diagnostic GmbH, Germany) time of study and sensitivity were evaluated by
following the manufacturer protocol. All nucleic serial dilution of viral RNA. All NS1 Ag and
acid extractionwas carried out manually and RT-LAMP positive samples were confirmed by
RNA stored at -700C until used. The RT-LAMP RT-PCR kit Fast track diagnostics,
primer were designed by PREMIER Biosoft Luxembourg.

www.ijmlr.com/IJMLR© All right are reserved

25
 Jawed et al., Int J Med Lab Res 2016, 1(2): 24-28
ISSN 2456-4400

Table 1: Dengue primer sets for RT-LAMP assay; Forward outer primer(F3), Backward outer primer (B3),
Forward inner primer (FIP), Backward inner primer (BIP), Forward Loop primer (LoopF) and Backward
Loop primer (LoopB).

Genotype Genome Position Primer Sequence (5’-3’)

3’ (UTR)
DENV-1 10274 – 10735(462bp) F3 AACAAGGCAAGAAGTCAGG
B3 CCTCTAACCACTAGTCTGCTA
FIP(F1c+F2) GGCTTTCGGCCTGACTTCAAGCCATAGCACGGTAAGA
BIP(B1c+B2) AAGCCGTGCTGCCTGTAGATGCGTACAGCTTCCATG
LoopF GGCTCACAGGCAGCATAG
LoopB CTCCATCGTGGGGATGTAAA
DENV-2 10273 – 10723(451bp) F3 AAACTATGCAGCCTGTAGC
B3 TTCTGTGCCTGGAATGATG
FIP(F1c+F2) TGCTGCGATTTGTAAGGGAGGCATGGAAGCTGTACGCAT
BIP(B1c+B2) GATGAAGCTGTAGTCTCGCTGGTTCCCAGCGTCAATATGC
LoopF TCTCCTCTAACCGCTAGTCC
LoopB AGGACTAGAGGTTAGAGGAGAC
DENV-3 10268 – 10707 (439bp) F3 CGTTAAAAGAAGAAGTCAGGC
B3 CAGCAGGATCTCTGGTCT
FIP(F1c+F2) GGTCTCCTCTAACCGCTAGTCTGTGGGGACGTAAAACCTG
BIP(B1c+B2) CATGACACAACGCAGCAGCGTCTCCTCTAACCTCTAGTCC
LoopF TGCGTACAGCTTCCACAG
LoopB GGAAGCTGTACCTCCTTGC
DENV-4 10266 – 10649(383bp) F3 GCGTGGCATATTGGACTAG
B3 CAACAACACCAATCCATCTTG
FIP(F1c+F2) ACCTCTAGTCCTTCCACCAGGCATCACTGATAAAACGCAGC
BIP(B1c+B2) AACAGCATATTGACGCTGGGAACTGTGCCTGGATTGATGTT
LoopF GTACAGCTTCCTCCTGGC
LoopB GAGATCCTGCTGTCTCTGC

RESULT:

A total of 109(32%)dengue infection positive confirmed dengue infection in human serum.

case,87 (79%) NS1 antigen,30 (27%) IgM Out of 109 samples 91 (83%) were positive for
antibody and 12 (11%) IgG antibodywere found. RT-LAMP assay and 83 (76%) were common
11% and 9% samples were only positive for IgM positive for NS1 Ag and RT-LAMP assay. The
and IgG respectively, 16% were positive for sensitivity,specificity, positive predictive value
both NS1 Ag and IgM Ab.Both NS1 Ag and (PPV) and negative predictive value (NPV) of
IgM positive sample (n=99) were consider as NS1 antigen were 95%, 99.59%, 98% and 98%

www.ijmlr.com/IJMLR© All right are reserved

26
 Jawed et al., Int J Med Lab Res 2016, 1(2): 24-28
ISSN 2456-4400

with RT-LAMP. All RT-LAMP samples were 18% positive for DENV-4, which was greater
positive for RT-PCR. Out of 91 RT-LAMP than DENV-1 (9%) and 2(2%).
positive; 71% were positive for DENV-2 and

Table2: No. of dengue serum sample tested positive by different method

Assay Positive Negative Total
NS1 Ag 87 256 343
ELISA IgM Ab 30 313 343
IgG Ab 12 313 343
RT-LAMP 91 252 343
RT-PCR 91 252 343

Figure1: Naked eye visualization of RT-LAMP assay result; Positive and negative result in white light (A), UV lamp (B)

DISCUSSION:
In current scenario accuratediagnostic methods study, RT-LAMP assay was developed by a set
play a very imperative role in disease of different primers, targeted 3’ untaranslated
management. Dengue diagnosis in febrile illness region (3’UTR) of globally reported four dengue
has been a challenge for health care service virus strains. No cross reactivity was found with
providers. Capture IgM and IgG are most other closely related species. RT-LAMP assay
commonly available serological techniques for shows higher sensitivity (100%) and specificity
diagnosis of primary and secondary denguevirus (100%) than others serological assays. The RT-
infection buthigh cross reactivity with other LAMP assay can be used in combination with
flavivirus specific antibodies made difficult other serological assays in resource limited areas
definite diagnosis of infection. Dengue NS1 for immediate arbitration and prevention of
antigen ELISA assay emerge as easy, sensitive further spread of dengue.
and specific serological test for dengue detection
over the antibody testingbut somewhere it also CONCLUSION:
compromises the authenticity of testing12. On the basis of obtained results in this study,
Genome based detection i.e. Real Time PCR RT-LAMP assay can be a potential alternate
technique shows improved clinical sensitivity molecular diagnostic method for routine
and promised result in case of viral screening of dengue infection in fibril stage. It
infection13.Loop mediated isothermal can be utilized as an early, rapid, cost effective
amplification can be a simple, rapid, sensitive and highly sensitive tool for dengue diagnosis in
and specific alternate method of RT-PCR. In this resource limited remote areas of country.

www.ijmlr.com/IJMLR© All right are reserved

27
 Jawed et al., Int J Med Lab Res 2016, 1(2): 24-28
ISSN 2456-4400

REFERENCES: Respiratory Specimens from aPatient Who Had

Recently Traveled from a Region WhereDengue
1. World Health Organization. 2009. Dengue: Virus Infection Is Endemic; JOURNAL OF
guidelines for diagnosis,treatment, prevention and CLINICAL MICROBIOLOGY, May 2007, p.
control. WHO, Geneva, Switzerland. 1523–1527.
2. Monath TP: Dengue: the risk to developed and 10. Callahan, J. D., S. J. Wu, A. Dion-Schultz, B.
developing countries. Proc Natl AcadSci USA E. Mangold, L. F. Peruski, D. M. Watts, K. R.
1994, 91:2395-2400. Porter, G. R. Murpgy, W. Suharyono, C. C. King,
3. Chaturvedi UC, Agarwal R, Elbishbishi EA, C. G. Hayes, and J. J. Temenak. 2001.
Mustafa AS. Cytokine cascade in dengue Development and evaluation of serotypeand
haemorrhagic fever: implications for pathogenesis. group-specific fluorogenic reverse transcriptase
FEMS Immunol Med Microbiol. PCR (TaqMan) assays for dengue virus. J. Clin.
2000;28:183e188. Microbiol. 39:4119–4124.

4. 4. Guzman, M. G., and G. Kouri. 2004. Dengue 11. Drosten, C., S. Gottig, S. Schilling, M. Asper,
diagnosis, advances and challenges. Int. J. Infect. M. Panning, H. Schmitz, and S. Gunther. 2002.
Dis. 8:69–80. Rapid detection and quantitation of RNA of Ebola
and Marburg viruses, Lassa virus, Crimean-Congo
5. Innis, B. L., A. Nisalak, S. Nimmannitya, S. hemorrhagic fever virus, Rift valley fever virus,
Kusalerdchariya, V. Chongswasdi, S. Suntayakorn, dengue virus, and Yellow fever virus by real-time
P. Puttisiri, and C. H. Hoke. 1989. An enzyme- reverse transcription-PCR. J. Clin. Microbiol.
linked immunoassay to characterize dengue 40:2323–2330.
infections where dengue and Japanese encephalitis
co-circulate. Am. J. Trop. Med. Hyg. 40:418–427. 12. Pei-Yun Shu, Li-Kuang Chen Shu-Fen Chang,
Yi-Yun Yueh, Ling Chow, Li-Jung Chien, Chuan
6. Dussart P, Petit L, Labeau B, Bremand L, Leduc Chin, Ting-Hsiang Lin, and Jyh-Hsiung Huang;
A, et al.: Evaluation of Two New Commercial Comparison of Capture Immunoglobulin M (IgM)
Tests for the Diagnosis of Acute Dengue Virusn and IgG Enzyme-Linked Immunosorbent Assay
Infection Using NS1 Antigen Detection in Human (ELISA) and Nonstructural Protein NS1 Serotype-
Serum. PLoSNegl Trop Dis 2008, 2:e280. Specific IgG ELISA for Differentiation of Primary
and Secondary Dengue Virus
7. Lapphra K, Sangcharaswichai A,
Infections;CLINICAL AND DIAGNOSTIC
Chokephaibulkit K, Tiengrim S, Piriyakarnsakul
LABORATORY IMMUNOLOGY, July 2003, p.
W, et al.: Evaluation of an NS1 antigen detection
622–630.
for diagnosis of acute dengue infection in patients
with acute febrile illness. DiagnMicrobiol Infect 13. Jesse J. Waggoner,a Janaki Abeynayake,b
Dis 2008, 60:387-391. Malaya K. Sahoo,b Lionel Gresh,c Yolanda
Tellez,d Karla Gonzalez,d Gabriela Ballesteros,d
8. Houng, H. H., D. Hritz, and N. Kanesa-thasan.
Frances P. Guo,b Angel
2000. Quantitative detection of dengue 2 virus
Balmaseda,dKumuduKarunaratne,e Eva Harris,f
using fluorogenic RT-PCR based on 3-noncoding
Benjamin A. Pinskya,b; Comparison of the FDA-
sequence. J. Virol. Methods 86:1–11.
Approved CDC DENV-1-4 Real-Time Reverse
9. Norma P. Tavakoli, Ellis H. Tobin, Susan J. Transcription-PCR with a Laboratory-Developed
Wong, Alan P. Dupuis II, Bernadette Glasheen, Assay for Dengue Virus Detection and Serotyping;
Laura D. Kramer, and Kristen A. Journal of Clinical Microbiology p. 3418–3420.
Bernard,Identification of Dengue Virus in
14. Guzman MG, Kouri G: Dengue: an update.
Lancet Infect Dis 2002, 2:33-42.

CONFLICT OF INTEREST: Authors declared no conflict of interest.

www.ijmlr.com/IJMLR© All right are reserved

28
 Jawed et al., Int J Med Lab Res 2016, 1(2): 24-28
ISSN 2456-4400

www.ijmlr.com/IJMLR© All right are reserved

29