Journal of Medical Microbiology (2014), 63, 13861394 DOI 10.1099/jmm.0.

076646-0

Emergence of carbapenem-resistant Acinetobacter

baumannii as the major cause of ventilator-
associated pneumonia in intensive care unit patients
at an infectious disease hospital in southern Vietnam
Nguyen Thi Khanh Nhu,1,2 Nguyen Phu Huong Lan,1,3
James I. Campbell,1,4 Christopher M. Parry,1,4,5 Corinne Thompson,1,4
Ha Thanh Tuyen,1 Nguyen Van Minh Hoang,1 Pham Thi Thanh Tam,1
Vien Minh Le,1,6 Tran Vu Thieu Nga,1 Tran Do Hoang Nhu,1
Pham Van Minh,1 Nguyen Thi Thu Nga,1 Cao Thu Thuy,1 Le Thi Dung,3
Nguyen Thi Thu Yen,3 Nguyen Van Hao,2 Huynh Thi Loan,3
Lam Minh Yen,3 Ho Dang Trung Nghia,1,2,7 Tran Tinh Hien,1
Louise Thwaites,1,4 Guy Thwaites,1,4 Nguyen Van Vinh Chau2
and Stephen Baker1,4,8
Correspondence 1
The Hospital for Tropical Diseases, Wellcome Trust Major Overseas Programme,
Stephen Baker Oxford University Clinical Research Unit, Ho Chi Minh City, Vietnam
[email protected] 2
School of Chemistry and Molecular Biosciences, The University of Queensland,
Brisbane, Queensland, Australia
3
The Hospital for Tropical Diseases, Ho Chi Minh City, Vietnam
4
Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, UK
5
Clinical Sciences, Liverpool School of Tropical Medicine, Liverpool, UK
6
Division of Infectious Diseases, Department of Medicine, University of California San Francisco,
CA, USA
7
Pham Ngoc Thach University of Medicine, Ho Chi Minh City, Vietnam
8
The London School of Hygiene and Tropical Medicine, London, UK

Ventilator-associated pneumonia (VAP) is a serious healthcare-associated infection that affects up

to 30 % of intubated and mechanically ventilated patients in intensive care units (ICUs) worldwide.
The bacterial aetiology and corresponding antimicrobial susceptibility of VAP is highly variable, and
can differ between countries, national provinces and even between different wards in the same
hospital. We aimed to understand and document changes in the causative agents of VAP and their
antimicrobial susceptibility profiles retrospectively over an 11 year period in a major infectious
disease hospital in southern Vietnam. Our analysis outlined a significant shift from Pseudomonas
aeruginosa to Acinetobacter spp. as the most prevalent bacteria isolated from quantitative tracheal
aspirates in patients with VAP in this setting. Antimicrobial resistance was common across all
bacterial species and we found a marked proportional annual increase in carbapenem-resistant
Acinetobacter spp. over a 3 year period from 2008 (annual trend; odds ratio 1.656, P50.010). We
further investigated the possible emergence of a carbapenem-resistant Acinetobacter baumannii
clone by multiple-locus variable number tandem repeat analysis, finding a blaOXA-23-positive strain
that was associated with an upsurge in the isolation of this pathogen. We additionally identified a
single blaNDM-1-positive A. baumannii isolate. This work highlights the emergence of a
Received 14 April 2014 carbapenem-resistant clone of A. baumannii and a worrying trend of antimicrobial resistance in the
Accepted 17 July 2014 ICU of the Hospital for Tropical Diseases in Ho Chi Minh City, Vietnam.

Abbreviations: CI, confidence interval; HIV, human immunodeficiency virus; ICU, intensive care unit; MDR, multidrug-resistant; MLVA, multiple-locus
variable number tandem repeat analysis; OR, odds ratio; VAP, ventilator-associated pneumonia; VNTR, variable number tandem repeat.

076646 G 2014 The Authors Printed in Great Britain

1386 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/).
 Carbapenem-resistant Acinetobacter baumannii in Vietnam

INTRODUCTION METHODS
Ventilator-associated pneumonia (VAP) is a common Study site and patients. This retrospective study was an analysis of
healthcare-associated infection among patients in intensive routine laboratory data of diagnostic tests performed as standard-of-
care units (ICUs) who have endotracheal intubation or a care. The data were anonymized before analysis and individual patient
consent was not required. The site of the study was the Hospital for
tracheostomy for mechanical ventilation. VAP is the most Tropical Diseases in Ho Chi Minh City in the south of Vietnam. The
commonly acquired infection in ICUs worldwide, affecting Hospital for Tropical Diseases is a 550-bed hospital that serves as a
an estimated 1030 % of ventilated patients (Bantar et al., primary and secondary facility for the surrounding local population in
2008). The contribution of VAP to mortality in intubated Ho Chi Minh City, and a tertiary referral centre for infectious diseases
patients is highly variable (Melsen et al., 2009), ranging for the 17 southern provinces of the country; it has a catchment
from 20 to 70 %, depending on the location and the study population of ~40 million people. Nearly 70 % of the admissions to
the Hospital for Tropical Diseases are resident in Ho Chi Minh City,
population (Davis, 2006; Rosenthal et al., 2011). VAP
with the remainder resident in the surrounding provinces. Patients
prolongs the required duration of mechanical ventilation, without infectious diseases, including those with surgical requirements,
increases the stay of the patient in an ICU and, when tuberculosis, cancer, primary haematological disorders or immuno-
multidrug-resistant (MDR) organisms are present, increases suppression [other than human immunodeficiency virus (HIV)
the cost of treatment because of the need for expensive, non- infection], are generally referred to other healthcare settings in the city.
first-line antimicrobials (van Nieuwenhoven et al., 2004; All data originated from patients admitted onto the ICU ward
Warren et al., 2003). (a 30-bed ward for critically ill patients). The ward admits patients
with a range of severe conditions, including septic shock, septicaemia,
There is a pronounced association between the aetiology of tetanus, acute respiratory failure, dengue haemorrhagic fever and those
VAP and national economic development (Alp & Voss, transferred from clinical wards requiring critical care for infectious
2006; Joseph et al., 2010). In Europe and the USA, the diseases. The present study was performed with data recorded in the
principal organism associated with VAP is Staphylococcus hospital database. The criteria for analysis were: admission to the ICU,
aureus (Chastre et al., 2014; Gaynes & Edwards, 2005; intubated for mechanical ventilation (due to respiratory failure) with a
Joseph et al., 2010; Lee et al., 2013). However, in Asia and tracheal aspirate collected because of suspected VAP. VAP was defined
as pneumonia where the patient was on mechanical ventilation for .2
Latin America, the Gram-negative organisms Pseudomonas
calendar days on the date of event, with the day of ventilator placement
aeruginosa, Acinetobacter spp. and Klebsiella pneumoniae being day 1, and the ventilator was in place on the date of the event or
predominate (Chawla, 2008; Gales et al., 2002). Whilst the the day before. If the patient was admitted or transferred to the ICU on
geographical and temporal distribution of the infecting a ventilator, the day of admission was considered as day 1. We analysed
bacteria are variable, the causative agents of VAP are the distribution of bacteria in tracheal aspirates collected from those
united in their ability to become resistant to a range of patients between 2000 and 2010. Patients known to be sero-positive for
antimicrobials, presumably selected by the sustained use HIV were excluded.
of the same antimicrobial(s) within the healthcare setting Microbial identification and antimicrobial susceptibility test-
in which they circulate. Now, ICUs worldwide are ing. The tracheal aspirates were collected according to the local
highly accustomed to VAP caused by meticillin-resistant standard operating procedures of the Hospital for Tropical Diseases.
Staphylococcus aureus, MDR P. aeruginosa and highly Patients were pre-oxygenated. Briefly, a standard 500 mm, 14-gauge
resistant A. baumannii (Ayraud-Thevenot et al., 2012; tracheal aspiration catheter (Argyle Sherwood Medical) was attached
Gaynes & Edwards, 2005; NNIS System 2004; Tadros et al., to a 20 ml syringe filled with 20 ml sterile saline. The distal end was
lubricated with sterile gel, introduced via the tracheostomy or
2013). Studies in VAP patients in ICUs have demonstrated
endotracheal tube and advanced until significant resistance was
that the rapid initiation of antimicrobial therapy active encountered. The saline was instilled over 1015 s, the tube then
against the infecting organism improves outcome (Koenig & withdrawn 1020 mm, the saline was immediately reaspirated and
Truwit, 2006). Correspondingly, a delay in appropriate the catheter was then removed. Between 5 and 10 ml of fluid was
antimicrobials is associated with a disease of increased recovered. No further aspiration was attempted during removal of the
severity and mortality (Morrow et al., 2009). Surveillance of catheter to avoid contamination with tracheal secretions. Samples
the aetiologies of VAP and their changing antimicrobial were transported to the microbiology laboratory, placed in a fridge at
4 uC and processed within 2 h of collection. The tracheal aspirate
susceptibility profiles aids the development of appropriate samples were examined by a Gram stain, and the aspirate fluid
management and treatment guidelines. was diluted 1 : 1 with Sputasol (Oxoid) and incubated at 37 uC, with
periodic agitation, until liquefaction. The sample was then diluted
We aimed to describe and understand the aetiology and
(1 : 1, 1021 and 1022) using Maximum Recovery Diluent (Oxoid),
the changing antimicrobial susceptibility patterns of the and 20 ml 1 : 1 diluent was inoculated onto blood agar and chocolate
bacteria causing VAP on an ICU ward in an infectious agar base plates. Additionally, 20 ml of the 1021 and 1022 dilutions
disease hospital in southern Vietnam. We retrospectively was plated onto MacConkey media and blood agar base (all media
gathered microbial culture data from tracheal aspirates were supplied by Oxoid Unipath). Inoculated media were incubated
taken from patients with suspected VAP admitted onto the at 37 uC, and examined after 24 and 48 h of incubation. The
ICU ward at the Hospital for Tropical Diseases in Ho Chi threshold used to discriminate between infection and colonization
was 16105 c.f.u. ml21 (i.e. .20 colonies on either media from the
Minh City, Vietnam between 2000 and 2010. We report a 1022 dilution). Colonies above this threshold were identified using an
significant shift from P. aeruginosa to Acinetobacter spp. over in-house bacteriological identification (biochemical short-set) kit
the period of investigation, which was associated with the and/or by API 20E and API 20NE kits following the manufacturers
emergence of a clone of carbapenem-resistant A. baumannii. guidelines (bioMerieux).

http://mic.sgmjournals.org 1387
N. T. K. Nhu and others

Antimicrobial susceptibilities were tested at the time of isolation by subjected to three multiplex PCR amplifications (in a total volume
the modified BauerKirby disc diffusion method, as recommended by of 50 ml), in which the annealing temperature was set at 50 uC.
the Clinical and Laboratory Standards Institute guidelines (CLSI, The primers and PCR conditions for each of the multiplex PCR
2012). MuellerHinton agar and antimicrobial discs were purchased amplifications are listed in Table 1. The sizes of the amplicons at each
from Unipath. Escherichia coli ATCC 25922 and Staphylococcus aureus locus were determined by capillary electrophoresis fragment analysis
ATCC 25923 were used as control strains for these assays. The using an ABI 3130 XL capillary electrophoresis system (Applied
inhibitory zone sizes were recorded and interpreted according to Biosystems). For fragment analysis, 0.5 ml PCR amplicons were mixed
current Clinical and Laboratory Standards Institute breakpoint with 9.25 ml Hi-di Formamide and 0.25 ml GeneScan 500 LIZ size
guidelines (CLSI, 2012). standard (Applied Biosystems). The mixture was incubated for 3 min
at 95 uC, chilled for 10 min and analysed. Resulting fragment analysis
Antimicrobial susceptibility testing was dependent on the bacterial
data were analysed using GeneMapper v4.0 (Applied Biosystems).
species. For Acinetobacter spp., Pseudomonas spp. and Enterobac-
Further, to determine the number of repeating units, the differently
teriaceae, piperacillin/tazobactam (100/10 mg), imipenem (10 mg),
sized amplicons at each locus were sequenced. PCR amplicons were
amikacin (30 mg), ofloxacin (5 mg), ceftriaxone (30 mg) and ceftazi-
purified using a PCR purification kit (Qiagen) and sequenced using a
dime (30 mg) were assayed throughout the study period; from 2005
BigDye Terminator Sequencing kit (Applied Biosystems). All data were
onward, ticarcillin/clavulanic acid (75/10 mg) and cefepime (30 mg)
analysed using a numeric coefficient in BioNumerics software (Applied
were also assayed. The susceptibility and resistance breakpoints against
Maths) and phylogenetic trees were reconstructed in Dendroscope
imipenem and meropenem were 1 and 4 mg l21, respectively. For
v2.3.
Staphylococcus spp. and Streptococcus spp., co-trimoxazole (1.25/
23.75 mg), penicillin (10 mg), vancomycin (30 mg), rifampicin (5 mg),
gentamicin (10 mg) and meticillin (5 mg, from 2000 to 2004) or
oxacillin (1 mg, from 2005 to 2010) were assayed. RESULTS
Data collection and statistical analysis. Patients admitted to the
General observations
hospital ICU during the study period who had a tracheal aspirate
performed for suspected VAP were included in this retrospective Over the 11 year study period, 515 individual patients
study. A member of the hospital staff routinely recorded the date of admitted to the ICU at the Hospital for Tropical Diseases
tracheal aspirate, the patients age and sex, the number of tracheal
with suggestive features of VAP had at least one tracheal
aspirates collected, the result of the culture (whether positive or
negative and whether a significant result as a consequence of bacterial aspirate specimen taken for microbiological investigation.
concentration), and the susceptibility of the isolate to commonly used From these 515 patients with suspected VAP, microbiolo-
antimicrobial agents. Data from these records were subsequently gical data were retrieved from 492. In total, 372 patients
entered into Excel (Microsoft). Trends over the 11 year period, (76 %) had a least one potential bacterial pathogen isolated
including the proportion of cultured isolates by year and the at concentration of 105 c.f.u. ml21 in their tracheal
antimicrobial susceptibility patterns, were evaluated by logistic aspirate sample. Of these patients, 277 (74 %) were male.
regression; odds ratios (ORs) are shown in per unit of time (per
year). All statistical analysis was performed using Stata version 11
The vast majority of the VAP patients were adults (median
(StataCorp); P0.05 was considered statistically significant. age 51 years, range 291 years), with children under the age
of 16 years accounting for only 6 % of the total (this reflects
Molecular characterization of Acinetobacter spp. DNA was the catchment of the hospital, as children are more likely
extracted from the 34 Acinetobacter spp. isolate cultures from the to be admitted other healthcare settings in Ho Chi
tracheal aspirate samples taken in 2010 using the Wizard Genomic Minh City). As the paediatric patients constituted 6 %
DNA Extraction kit (Promega). The quality and concentration of the
(30 patients) of the patient data for this study, analysis was
DNA were assessed using a NanoDrop Bioanalyzer spectropho-
tometer (Thermo Scientific). Genomic DNA from all strains was performed globally and not stratified by age.
standardized to a concentration of 25 ng ml21 for further use.
The presence of four main groups of carbapenem-hydrolysing b- Bacteriology of tracheal aspirates
lactamases (carbapenemases) in carbapenem-resistant Acinetobacter
spp. isolates was determined by using a previously described multiplex Over the 11 year period, 765 tracheal aspirate samples
PCR method (Woodford et al., 2006). PCR amplifications were were obtained from the 492 suspected VAP patients with
performed using four primer pairs that were specific for blaOXA-51-like, available data. At least one potential bacterial pathogen
blaOXA-23-like, blaOXA-24-like and blaOXA-58-like in 20 ml reaction was isolated at a concentration of 105 c.f.u. ml21 in 608
volumes, containing 1 ml template genomic DNA, 0.2 mM each primer, (80 %) tracheal aspirate samples from 372 patients. The
2 U Taq polymerase, 200 mM each deoxynucleoside triphosphate and
total number of significant isolates was 696, indicating
1.5 mM MgCl2 in 16 PCR buffer (all PCR reagents were supplied by
Bioline). The selected isolates were also subjected to PCR amplification that the VAP patients were infected with a mean of 1.9
for the detection of the blaNDM-1 gene using a previously described significant bacteria [i.e. 696 unique bacteria (distinguished
method with an annealing temperature of 59 uC (Nordmann et al., by antimicrobial susceptibility profile if same species) were
2011). All PCR amplifications were visualized on 1 % agarose gels and isolated from the tracheal aspirates of 372 patients].
photographed under UV light after staining with ethidium bromide;
amplicons were compared with the predicted sizes and DNA The bacterial pathogens isolated from significant tracheal
sequenced using an ABI3700 sequencer as described below. aspirate specimens from the suspected VAP patients from
The 34 selected strains of Acinetobacter were genotyped using
2000 to 2010, along with their corresponding time trends
the MLVA [multiple-locus variable number tandem repeat (VNTR) [ORs and P values for annual trend, with 95 % confidence
analysis] method with some modifications (Pourcel et al., 2011). intervals (CIs)], are outlined in Table 2. Gram-negative
Briefly, genomic DNA from each of the 34 Acinetobacter spp. was organisms predominated, accounting for 89 % of isolates

1388 Journal of Medical Microbiology 63

 Carbapenem-resistant Acinetobacter baumannii in Vietnam

Table 1. PCR amplification primers used for Acinetobacter spp. MLVA genotyping

PCR Primer Sequence (5A3) Label

Multiplex 1 Abaum_3530_L TGCAACCGGTATTCTAGGAAC VIC

Abaum_3530_R CCTTGAACAACATCGATTACTGGA
Abaum_3002_L GACTGAAGCAAGACTAAAACGT FAM
Abaum_3002_R TCTGGGCAGCTTCTTCTTGAGC
Abaum_1988_L GGCAAGGCATGCTCAAGGGCC FAM
Abaum_1988_R CAGTAGACTGCTGGTTAATGAG
Multiplex 2 Abaum_0845_L AATTTTAATTCCAAATTGCTCC FAM
Abaum_0845_R ACTTAAAATCGCATTTTTATCA
Abaum_2396_L CAAGTCCAATCAACTCATGATG VIC
Abaum_2396_R CTCCTGTAAGTGCTGTTCAGCC
Abaum_3468_L CAGAAGTCACTGCATCTGCAAC NED
Abaum_3468_R CGGTTGAAATTTTTTATAATGAAG
Multiplex 3 Abaum_2240_L CCCGCAGTACATCATGGTTC FAM
Abaum_2240_R AGAACATGTATACGCAACTG
Abaum_0826_L TGACTACTGAAACAGTTTTTG FAM
Abaum_0826_R ATGATTGTACCGAGTAAAAGA

(annual range 8496 %). The most frequently cultured and 8.25 % of all bacterial isolates, respectively. The
genus of bacteria were Acinetobacter spp. (30.4 %, n5206), proportion of S. pneumonia over the 11 years of study
followed by P. aeruginosa (26.4 %, n5186), K. pneumoniae declined (OR 0.842, P50.028, 95 % CI 0.720.98), whilst
(17 %, n5118), Staphylococcus spp. (8.3 %, n553) and Staphylococcus aureus isolates demonstrated a marginal
Streptococcus pneumoniae (3.1 %, n524) (Table 2). The proportional annual increase (OR 1.117, P50.021, 95 % CI
annual prevalence rank of these aetiological agents changed 1.021.23) (Fig. 1a, Table 2).
several times between 2000 and 2007. In 2001, 2003, 2004
and 2006, the most prevalent isolates were P. aeruginosa,
Antimicrobial susceptibility of isolated bacteria
whereas K. pneumonia predominated in 2002 (Fig. 1a,
Table 2). There was a subsequent shift in 2007 when The antimicrobial susceptibility profiles of the isolated
Acinetobacter spp. became the most common group of potential pathogens exhibited substantial differences and
pathogens isolated from patients with suspected VAP at the were highly variable over the study period (Table 3). There
Hospital for Tropical Diseases (Fig. 1a) a trend that was a decline in the proportion of P. aeruginosa and K.
continued until 2010. pneumoniae exhibiting antimicrobial resistance for all tested
antimicrobials with the exception of piperacillin/tazobac-
In the initial 8 years of the time series, the annual proportion
tam, ticarcillin/clavulanic acid and cefepime. A. baumannii
of Acinetobacter spp. was ~29 % of all isolates. This
demonstrated the most marked increase in resistance to the
proportion dropped to 23 % in 2008, and then increased
majority of antimicrobials tested. In 2010, ~86 % (30/35) of
over the next 2 years to 35 and 45 % in 2009 and 2010,
all isolated Acinetobacter spp. were resistant to all assayed
respectively. Over the entire 11 year period, the proportion
antimicrobials, including aminoglycosides, cephalosporins
of Acinetobacter spp. isolates increased by 6.6 % annually
and carbapenems (Table 3). Logistic regression demon-
(OR 1.066, P50.022, 95 % CI 1.021.12). From 2008 to
strated that there was a significant annual increase in the
2010, the proportional annual increase of Acinetobacter spp.
proportion of Acinetobacter spp. showing resistance to
was 10 times higher at 66 % (OR 1.656, P50.010, 95 % CI
piperacillin/tazobactam and carbapenems, increasing by
1.132.43). In contrast, P. aeruginosa demonstrated a 9 %
.50 % per year (Table 3). Furthermore, Acinetobacter spp.
annual decrease (OR 0.917, P50.004, 95 % CI 0.860.97)
also exhibited an increase in resistance to the two additional
over the entire study period. This pattern of declining
antimicrobials that were used for susceptibility testing from
P. aeruginosa was influenced by a marked drop from 2007
2005 onwards, with a proportional resistance increase of
onwards, corresponding with a 25 % annual proportional
100 % per year against cefepime and ticarcillin/clavulanic
reduction (OR 0.752, P50.003, 95 % CI 0.620.91) over the
acid. The only exception to the increasing trend of Acineto-
final 4 years of the study. K. pneumoniae was a significant
bacter spp. antimicrobial resistance was ofloxacin, which
VAP pathogen, yet was also associated with a significant
displayed a proportional decrease by 11 % annually over
annual decline.
the 11 years (OR 0.89, P50.012, 95 %CI 0.810.97).
Gram-positive pathogens causing VAP in ICU patients at We additionally observed a substantial increase in the
the Hospital for Tropical Diseases were less common, and proportion of imipenem-resistant Acinetobacter spp. (Fig.
only Streptococcus pneumoniae and Staphylococcus aureus 1b), increasing by 52 % annually over the study period.
were longitudinally isolated and identified, comprising 3.13 Imipenem was approved for empirical use for the treatment

http://mic.sgmjournals.org 1389
N. T. K. Nhu and others

DOther Gram-negative bacteria include Proteus spp., Alcaligenes spp., Citrobacter spp., Providencia spp., Serratia spp., Escherichia coli, Enterobacter spp., Burkholderia spp., Chryseobacterium sp.,
of VAP in this ICU in 2008. Imipenem resistance increased

1.011.12

,0.001 0.830.94

0.860.97

0.720.98

1.021.23

,0.001 1.181.23
P value* 95 % CI proportionally by more than three times annually between
2008 and 2010 (OR 3.27, P50.005, 95 %CI 1.437.49). This
increasing resistance to carbapenems was not observed
in other Gram-negative organisms. Only one imipenem-
0.022

0.004

0.028

0.021
resistant K. pneumoniae was isolated during the study
period (Fig. 1b).
1.066

0.873

0.917

0.842

1.117

1.207
OR*

Carbapenem-resistant A. baumannii
Table 2. Bacterial pathogens isolated from intubated patients in ICU patients at the Hospital for Tropical Diseases in Ho Chi Minh City, Vietnam

[n (%)]

(30.4)

(17.0)

(26.4)

(14.8)
Mean

(3.1)

(8.3)
We hypothesized that the increase in imipenem-resistant
19

11

17

11
2

5 Acinetobacter spp. was a result of selection of a specific A.

baumannii clone containing several oxacillinase/carbape-
[n (%)]

(45.5)

(10.4)

(11.7)

(22.1)
nemase genes. To test this hypothesis, we investigated 34 of
2010

(2.6)

(7.8)
35

17
8

the 35 available Acinetobacter spp. isolated from patients

in 2010, screening them for blaOXA-51, blaOXA-23, blaOXA-24,
[n (%)]

blaOXA-58 and blaNDM-1, and by performing MLVA to

(34.6)

(12.7)

(21.8)

(16.6)

(14.5)
2009

(0.0)
19

12
7

investigate their relative genetic relationship. All five

carbapenem-resistance-associated genes were detected in
[n (%)]

at least one strain and the majority of strains were PCR

(23.1)

(23.1)

(32.9)
2008

(7.7)

(3.9)

(9.6)
12

12

17
4

amplification-positive for more than one of the resistance

loci, and 27 isolated were identified as A. baumannii
by blaOXA-51 amplification (Fig. 2a). The most prevalent
[n (%)]

(27.1)

(18.6)

(22.0)

(22.1)
2007

(3.4)

(6.8)
16

11

13

13

gene alongside blaOXA-51 was blaOXA-23, accounting for

2

68 % (23/34) of the Acinetobacter spp. isolates from 2010

(Fig. 2a). We noted an association between the presence
[n (%)]

(26.7)

(10.0)

(35.0)

(15.0)

(13.3)
2006

(0.0)

of blaOXA-51 and blaOXA-23 and a MIC.32 mg ml21 against

16

21
6

imipenem (P,0.0001; Fishers exact test). Furthermore,

we also detected the coexistence of blaOXA-51, blaOXA-58
[n (%)]

(38.9)

(30.6)

(13.9)
2005

(8.3)

(2.8)

(5.6)

and blaNDM-1 in one unique isolate (AB 205; MLVA10),

14

11
3

which exhibited a MIC.32 mg ml21 against imipenem,

and high-level resistance to both third- and fourth-
[n (%)]

(27.1)

(16.1)

(30.5)
2004

(2.5)

(6.8)

generation cephalosporins (Fig. 2). Of the Acinetobacter

(17)
32

19

36

20
3

spp. that were susceptible to imipenem, these were mainly

non-A. baumannii, and six out of eight isolates possessed
[n (%)]

(25.3)

(22.8)

(32.9)

at least one oxacillinase gene, the majority being PCR

2003

(1.3)

(2.5)

(12)
20

18

26

10
1

amplification-positive for blaOXA-58. With an arbitrary

cutoff of 90 % identity over the eight selected VNTR loci,
[n (%)]

MLVA analysis classified the 34 isolates of Acinetobacter

(23.2)

(29.3)

(26.8)
2002

(9.8)

(3.7)

(7.2)
19

24

22

spp. into 11 discrete clusters; the A. baumannii isolates

fell in seven of the clusters (Fig. 2b). The MLVA clusters
were practically concordant with the presence of the
[n (%)] [n (%)]

(27.9)

(21.3)

(32.8)

Haemophilus spp. and Stenotrophomonas maltophilia.

2001

(8.2)

(4.9)

(4.8)
17

13

20

various combinations of oxacillinase genes. Notably, one

clone with .95 % identity (MLVA6) contained 21 out of
23 isolates harbouring both the blaOXA-51 and blaOXA-23
(35.3)

(29.4)

(23.5)

(11.8)
(0.0)

(0.0)
2000

genes (MIC.32 mg ml21) (Fig. 2b). The one exception was

6

strain AB 216, which was PCR amplification-positive for

*Determined by logistic regression.

both blaOXA-51 and blaOXA-23, but remained susceptible to

Other Gram-negative bacteriaD

imipenem.
Streptococcus pneumoniae

Staphylococcus aureus

DISCUSSION
Acinetobacter spp.

K. pneumoniae

Here, we show a series of significant changes in the

P. aeruginosa

prevalence of differing bacterial pathogens, and their

Pathogen

corresponding antimicrobial susceptibility profiles, causing

VAP over 11 years in one ICU ward in Ho Chi Minh City,
Vietnam. We found that the most common pathogens

1390 Journal of Medical Microbiology 63

 Carbapenem-resistant Acinetobacter baumannii in Vietnam

(a) 50 (b)

80

40

Proportion of resistant isolates (%)

Proportion of isolates (%)

60
30

40
20

20
10

0 0
2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010
Year Year

Fig. 1. The changing aetiology of pathogens isolated from tracheal aspirates in ICU patients at the Hospital for Tropical
Diseases in Ho Chi Minh City, Vietnam. (a) Proportion of selected bacterial isolates cultured from tracheal aspirates from 2000
to 2010. Black line, Acinetobacter spp.; grey line, K. pneumoniae; dashed black line, Streptococcus pneumoniae; dotted black
line, Staphylococcus spp.; dotted grey line, Pseudomonas aeruginosa. (b) Histogram showing the proportion of Acinetobacter
spp. (dark grey), Pseudomonas aeruginosa (light grey) and K. pneumoniae (black) cultured from tracheal aspirates showing
resistance to imipenem from 2000 to 2010.

causing VAP in this setting were P. aeruginosa, K. responsible for 46 % of all cases of VAP. This increased
pneumoniae, Acinetobacter spp. and Staphylococcus aureus, rate of isolation followed the introduction of imipenem
which is broadly consistent with other locations. The as empirical treatment for VAP in 2008. Prior to 2008,
striking finding was the emergence of Acinetobacter spp. as imipenem-resistant Acinetobacter spp., except for a small
the most commonly isolated pathogen causing VAP in our increase in 2003/2004, comprised ~10 % of all Acinetobacter
ICU. Whilst the emergence of Acinetobacter spp. (specif- spp. By 2010, this proportion was almost 80 %. In contrast,
ically A. baumannii) has been observed in other locations the proportion of P. aeruginosa and K. pneumoniae isola-
in Asia, such as Malaysia, Pakistan, India and Thailand tions declined with a fall in resistance to imipenem. Only
(Chawla, 2008; Lagamayo, 2008), the abruptness of the one imipenem-resistant K. pneumoniae was isolated over the
rise is of greatest concern. By 2010, Acinetobacter spp. were whole study period, suggesting that carbapenem-resistant

Table 3. Percentage of bacterial isolates eliciting resistance to selected antimicrobials from tracheal aspirates in ICU patients at the
Hospital for Tropical Diseases in Ho Chi Minh City, Vietnam

Antimicrobial 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 OR P value 95 %CI

Piperacillin/tazobactam NA 0.0 36.8 45.0 46.9 92.9 37.5 62.5 58.3 89.5 97.1 1.51 ,0.001 1.331.71
Ticarcillin/clavulanic acid NA NA NA NA NA 42.9 25.0 62.5 66.7 84.2 97.1 2.09 ,0.001 1.562.80
Ceftriaxone 100.0 70.6 89.5 95.0 93.8 92.9 6.3 68.8 100.0 100.0 97.1 1.07 0.304 0.941.20
Ceftazidime 83.3 64.7 73.7 65.0 68.8 78.6 12.5 62.5 75.0 94.7 97.1 1.15 0.008 1.041.27
Cefepime NA NA NA NA NA 28.6 50.0 37.5 58.3 94.7 97.1 2.25 ,0.001 1.653.06
Imipenem 0.0 0.0 15.8 45.0 28.1 21.4 6.3 12.5 41.7 89.5 88.6 1.52 ,0.001 1.351.72
Amikacin 33.3 52.9 79.0 60.0 59.4 85.7 50.0 50.0 75.0 73.7 94.3 1.16 0.003 1.051.29
Ofloxacin 83.3 47.1 36.8 65.0 59.4 71.4 50.0 43.8 58.3 47.4 22.9 0.89 0.012 0.810.97

NA, Not applicable.

http://mic.sgmjournals.org 1391
N. T. K. Nhu and others

(a) 25 Histogram showing the number of Acinetobacter spp. (n534)

producing PCR amplicons for OXA-51, OXA-58, OXA-23, OXA-
20 24 and combinations thereof. Carbapenem-resistant isolates, dark
grey; carbapenem-sensitive isolates, light grey. (b) Dendrogram
created by MLVA using eight VNTR loci from 34 Acinetobacter
No. of isolates

15 spp. strains isolated in the ICU in 2010. The strain numbers are
shown to the left of the dendrogram and the scale at the top of the
10 diagram shows the percentage MLVA identity. Associated
metadata data include the presence (black) or absence (white)
of the OXA-51, OXA-58, OXA-23, OXA-24 and NDM-1 genes by
5 PCR amplification, susceptibility to imipenem (IMP-R: susceptible,
white; resistant, grey) and MLVA group (.90 % MLVA identity).
0
OXA-51 OXA-58 OXA-51 OXA-51 OXA-51 OXA
and and and not
OXA-23 OXA-24 OXA-58 detected
K. pneumoniae is not yet a problem in Vietnam, unlike other
OXA gene combination
locations in Asia (Balm et al., 2013; Hu et al., 2013).
OX -51
3
OXA-24
ND 58
1

Identity by MLVA (%)

R
OXA-2

(b)
M-

VA We hypothesized that a carbapenem-resistant A. bauman-

A-

P-
A

ML
OX

40 50 60 70 80 100
IM

nii clone had been introduced and then maintained on

AB 121 1 the ICU. Although our genotyping data were restricted to
AB 152 1 MLVA analysis and not whole-genome sequencing, which
AB 131 2 has been shown to be the gold standard in Acinetobacter
AB 231 3 spp. subtyping (Rolain et al., 2013; Snitkin et al., 2013),
AB 216 4 we were able to define several groups and the one A.
AB 226 4 baumannii major clone (.90 % MLVA identification) we
AB 214 4 named MLVA6. MLVA6 isolates were consistently resistant
AB 204 5 to imipenem and harboured the blaOXA-23 gene. The
AB 165 6 presence of the blaOXA-23 gene in carbapenem-resistant A.
AB 173 6 baumannii has been commonly reported in Asia and Latin
AB 186 6 America (Gales et al., 2002; Mendes et al., 2009). These
AB 188 6 genotyping data strongly support our hypothesis, and we
AB 190 6
further suggest that the MLVA6 clone was introduced onto
AB 191 6
the ICU before the empirical use of imipenem and then
AB 196 6 maintained by sustained usage. We additionally identified
AB 208 6 seven independent strains harbouring the blaOXA-58 gene,
AB 224 6 although the presence of this carbapenemase gene alone, or
AB 235 6 in combination with blaOXA-51, was generally not sufficient
AB 193 6 to induce carbapenem resistance. Notably, we identified
AB 182 6 one A. baumannii isolate that was PCR amplification (and
AB 202 6 sequence)-positive for blaNDM-1 (AB 205). Isolate AB 205
AB 128 6 was resistant additionally to third- and fourth-generation
AB 215 6 cephalosporins, thus confirming the phenotype associated
AB 238 6 with blaNDM-1. The blaNDM-1 gene has been identified in
AB 219 6 Vietnam previously, but was associated with clinical and
AB 225 6 environmental isolates of K. pneumoniae (Hoang et al.,
AB 194 6 2013; Isozumi et al., 2012). We have not, as yet, isolated a
AB 230 6 blaNDM-1-positive K. pneumoniae clone on our ICU, but to
AB 212 6 our knowledge this is the first report of a blaNDM-1-positive
AB 168 7 A. baumannii from Vietnam.
AB 206 8
AB 174 9 The emergence of carbapenem-resistant A. baumannii in
AB 205 10 our ICU raises the question of antimicrobial therapy on the
AB 211 11 ward and plans for elimination. Following the emergence
of carbapenem-resistant A. baumannii in our ICU, therapy
for VAP has been modified to incorporate the polymyxin,
Fig. 2. The distribution of OXA genes in 34 Acinetobacter spp. colistin. Colistin is being used increasingly for the treatment
isolated from tracheal aspirates in ICU patients at the Hospital for of VAP and appears to be, at least currently, efficacious
Tropical Diseases in Ho Chi Minh City, Vietnam in 2010. (a) (Aydemir et al., 2013; Jean & Hsueh, 2011). We predict that,

1392 Journal of Medical Microbiology 63

 Carbapenem-resistant Acinetobacter baumannii in Vietnam

similar to the emergence of resistance to carbapenems, trend in the ICU of this infectious disease hospital. Future
colistin resistance will emerge here, have a similar impact on investigations should focus on optimizing the antimicrobial
clonal selection (Rolain et al., 2013) and leave us with therapy of patients with VAP caused by these resistant A.
effectively untreatable A. baumannii infections. baumannii strains.
The observed changes in VAP pathogens likely reflect
differing antimicrobial usage practices, and other demo- ACKNOWLEDGEMENTS
graphic and economic shifts, that Vietnam has experienced
over the last 1015 years. Indeed, these demographic and The authors wish to thank all the staff of the ICU at the Hospital for
economic changes have had other dramatic impacts on Tropical Diseases for assisting in sample and data collection and
patient care, and Ms Song Chau for her on-going efforts. This work
infectious disease dynamics in Vietnam over this period, as was supported by the Wellcome Trust of the UK, through core
have been observed in enteric infections and bacteraemia funding (089276/2/09/2) and through the VIZIONS Hospital Disease
in the same healthcare setting over a similar time period Surveillance Consortium (WT/093724/Z/10/Z). S. B. is a Sir Henry
(Nga et al., 2012; Vinh et al., 2009). Although this changing Dale Fellow, jointly funded by the Wellcome Trust/The Royal Society
disease epidemiology in Vietnam has resulted in some (100087/Z/12/Z).
instances of bacteria causing severe infections replaced by
pathogens that are more commonly found in developed
countries and associated with less severe disease (Nga et al., REFERENCES
2012), antimicrobial resistance and MDR bacterial patho- Alp, E. & Voss, A. (2006). Ventilator associated pneumonia and
gens and commensals have become commonplace (Holt infection control. Ann Clin Microbiol Antimicrob 5, 7.
et al., 2013; Vien et al., 2012). Access to antimicrobial
Aydemir, H., Akduman, D., Piskin, N., Comert, F., Horuz, E., Terzi, A.,
agents is unrestricted in animals and humans in Vietnam, Kokturk, F., Ornek, T. & Celebi, G. (2013). Colistin vs. the combination
and we suggest that the overuse of, and sustained exposure of colistin and rifampicin for the treatment of carbapenem-resistant
to, antimicrobials is driving the selection of MDR bacteria Acinetobacter baumannii ventilator-associated pneumonia. Epidemiol
with a substantial spread and prolonged circulation of Infect 141, 12141222.
antimicrobial-resistant organisms in the human population Ayraud-Thevenot, S., Huart, C., Mimoz, O., Taouqi, M., Laland, C.,
in the community and, as observed here, in healthcare Bousseau, A. & Castel, O. (2012). Control of multi-drug-resistant
settings. Acinetobacter baumannii outbreaks in an intensive care unit: feasibility
and economic impact of rapid unit closure. J Hosp Infect 82, 290292.
This study has limitations. The data were retrieved from Balm, M. N. D., Ngan, G., Jureen, R., Lin, R. T. P. & Teo, J. W. P. (2013).
microbiological records and contemporaneous clinical data OXA-181-producing Klebsiella pneumoniae establishing in Singapore.
were not recorded. It is not possible to determine how BMC Infect Dis 13, 58.
many patients had a confirmed radiological pneumonia or Bantar, C., Famiglietti, A., Radice, M., Quinteros, M., Antimicrobial
simply tracheobronchitis, and we have no data on changes Committee & SIR Participants Group (2008). A 7-year national
in disease outcome or the association of the duration of survey on bacterial resistance in bronchoalveolar lavage from patients
ventilation or hospital stay with the isolated pathogens. hospitalized in Argentina. Diagn Microbiol Infect Dis 60, 6569.
Prospective studies combining microbiological analysis Chastre, J., Blasi, F., Masterton, R. G., Rello, J., Torres, A. & Welte, T.
with surveillance of patient outcomes and other end-points (2014). European perspective and update on the management of
associated with disease severity are needed. However, a nosocomial pneumonia due to methicillin-resistant Staphylococcus
aureus after more than 10 years of experience with linezolid. Clin
notable strength of this study is that the amalgamated Microbiol Infect 20 (Suppl 4), 1936.
data were collected over an extended period by the same
Chawla, R. (2008). Epidemiology, etiology, and diagnosis of hospital-
clinical team using the same routine sample collection and acquired pneumonia and ventilator-associated pneumonia in Asian
microbiological methods. Our analysis was performed on countries. Am J Infect Control 36 (Suppl), S93S100.
data retrieved from a single ICU ward in an infectious CLSI. (2012). Performance Standards for Antimicrobial Susceptibility
disease hospital in southern Vietnam. Although it may not Testing; 20th Informational Supplement M100-S20. Wayne, PA:
be wholly generalizable to other ICUs in Vietnam or across Clinical and Laboratory Standards Institute.
south-east Asia we suggest that our results indicate the Davis, K. A. (2006). Ventilator-associated pneumonia: a review.
broad consequence of the changing demographic structures J Intensive Care Med 21, 211226.
and antimicrobial usage practices typical of these locations. Gales, A. C., Sader, H. S. & Jones, R. N. (2002). Respiratory tract
In conclusion, in this retrospective analysis of bacterial pathogens isolated from patients hospitalized with suspected pneu-
monia in Latin America: frequency of occurrence and antimicrobial
pathogens isolated from quantitative tracheal aspirates susceptibility profile: results from the SENTRY Antimicrobial
from ICU patients with suspected VAP in an infectious Surveillance Program (19972000). Diagn Microbiol Infect Dis 44,
disease hospital in southern Vietnam over an 11 year 301311.
period we found several shifts in the prevalence of specific Gaynes, R., Edwards, J. R. & National Nosocomial Infections
VAP pathogens. In the latter part of the study the dominant Surveillance System (2005). Overview of nosocomial infections
pathogen was a carbapenem-resistant A. baumannii and caused by gram-negative bacilli. Clin Infect Dis 41, 848854.
strain analysis indicated the emergence of a carbapenem- Hoang, T. H., Wertheim, H., Minh, N. B., Duong, T. N., Anh,
resistant clone of A. baumannii, thus highlighting a worrying D. D., Phuong, T. T. L., Son, T. H., Izumiya, H., Ohnishi, M. & other

http://mic.sgmjournals.org 1393
N. T. K. Nhu and others

authors (2013). Carbapenem-resistant Escherichia coli and Klebsiella Nordmann, P., Poirel, L., Carrer, A., Toleman, M. A. & Walsh, T. R.
pneumoniae strains containing New Delhi metallo-beta-lactamase (2011). How to detect NDM-1 producers. J Clin Microbiol 49, 718
isolated from two patients in Vietnam. J Clin Microbiol 51, 373374. 721.
Holt, K. E., Thieu Nga, T. V., Thanh, D. P., Vinh, H., Kim, D. W., Vu Tra, Pourcel, C., Minandri, F., Hauck, Y., DArezzo, S., Imperi, F.,
M. P., Campbell, J. I., Hoang, N. V. M., Vinh, N. T. & other authors Vergnaud, G. & Visca, P. (2011). Identification of variable-number
(2013). Tracking the establishment of local endemic populations of an tandem-repeat (VNTR) sequences in Acinetobacter baumannii and
emergent enteric pathogen. Proc Natl Acad Sci U S A 110, 17522 interlaboratory validation of an optimized multiple-locus VNTR
17527. analysis typing scheme. J Clin Microbiol 49, 539548.
Hu, L., Zhong, Q., Tu, J., Xu, Y., Qin, Z., Parsons, C., Zhang, B., Hu, X., Rolain, J.-M., Diene, S. M., Kempf, M., Gimenez, G., Robert, C. &
Wang, L. & other authors (2013). Emergence of blaNDM-1 among Raoult, D. (2013). Real-time sequencing to decipher the molecular
Klebsiella pneumoniae ST15 and novel ST1031 clinical isolates in mechanism of resistance of a clinical pan-drug-resistant Acinetobacter
China. Diagn Microbiol Infect Dis 75, 373376. baumannii isolate from Marseille, France. Antimicrob Agents Chemother
Isozumi, R., Yoshimatsu, K., Yamashiro, T., Hasebe, F., Nguyen, 57, 592596.
B. M., Ngo, T. C., Yasuda, S. P., Koma, T., Shimizu, K. & Arikawa, J. Rosenthal, V. D., Udwadia, F. E., Munoz, H. J., Erben, N., Higuera, F.,
(2012). blaNDM-1-positive Klebsiella pneumoniae from environment, Abidi, K., Medeiros, E. A., Fernandez Maldonado, E., Kanj, S. S. &
Vietnam. Emerg Infect Dis 18, 13831385. other authors (2011). Time-dependent analysis of extra length of stay
Jean, S.-S. & Hsueh, P.-R. (2011). Current review of antimicrobial and mortality due to ventilator-associated pneumonia in intensive-
treatment of nosocomial pneumonia caused by multidrug-resistant care units of ten limited-resources countries: findings of the
pathogens. Expert Opin Pharmacother 12, 21452148. International Nosocomial Infection Control Consortium (INICC).
Joseph, N. M., Sistla, S., Dutta, T. K., Badhe, A. S. & Parija, S. C. Epidemiol Infect 139, 17571763.
(2010). Ventilator-associated pneumonia: a review. Eur J Intern Med Snitkin, E. S., Zelazny, A. M., Gupta, J., Palmore, T. N., Murray, P. R.,
21, 360368. Segre, J. A. & NISC Comparative Sequencing Program (2013).
Koenig, S. M. & Truwit, J. D. (2006). Ventilator-associated pneumonia: Genomic insights into the fate of colistin resistance and Acinetobacter
diagnosis, treatment, and prevention. Clin Microbiol Rev 19, 637657. baumannii during patient treatment. Genome Res 23, 11551162.
Lagamayo, E. N. (2008). Antimicrobial resistance in major pathogens Tadros, M., Williams, V., Coleman, B. L., McGeer, A. J., Haider, S., Lee,
of hospital-acquired pneumonia in Asian countries. Am J Infect Control C., Iacovides, H., Rubinstein, E., John, M. & other authors (2013).
36 (Suppl), S101S108. Epidemiology and outcome of pneumonia caused by methicillin-
Lee, M. S., Walker, V., Chen, L. F., Sexton, D. J. & Anderson, D. J.
resistant Staphylococcus aureus (MRSA) in Canadian hospitals. PLoS
(2013). The epidemiology of ventilator-associated pneumonia in a
ONE 8, e75171.
network of community hospitals: a prospective multicenter study. van Nieuwenhoven, C. A., Buskens, E., Bergmans, D. C., van Tiel,
Infect Control Hosp Epidemiol 34, 657662. F. H., Ramsay, G. & Bonten, M. J. M. (2004). Oral decontamination is
Melsen, W. G., Rovers, M. M. & Bonten, M. J. M. (2009). Ventilator- cost-saving in the prevention of ventilator-associated pneumonia in
associated pneumonia and mortality: a systematic review of obser- intensive care units. Crit Care Med 32, 126130.
vational studies. Crit Care Med 37, 27092718. Vien, T. M., Minh, N. N. Q., Thuong, T. C., Khuong, H. D., Nga, T. V. T.,
Mendes, R. E., Bell, J. M., Turnidge, J. D., Castanheira, M. & Jones, Thompson, C., Campbell, J. I., de Jong, M., Farrar, J. J. & other
R. N. (2009). Emergence and widespread dissemination of OXA-23, authors (2012). The co-selection of fluoroquinolone resistance genes
-24/40 and -58 carbapenemases among Acinetobacter spp. in Asia in the gut flora of Vietnamese children. PLoS ONE 7, e42919.
Pacific nations: report from the SENTRY Surveillance Program. Vinh, H., Nhu, N. T. K., Nga, T. V. T., Duy, P. T., Campbell, J. I., Hoang,
J Antimicrob Chemother 63, 5559. N. V. M., Boni, M. F., My, P. V. T., Parry, C. & other authors (2009). A
Morrow, B. M., Argent, A. C., Jeena, P. M. & Green, R. J. (2009). changing picture of shigellosis in southern Vietnam: shifting species
Guideline for the diagnosis, prevention and treatment of paediatric dominance, antimicrobial susceptibility and clinical presentation.
ventilator-associated pneumonia. S Afr Med J 99, 255267. BMC Infect Dis 9, 204.
NNIS System (2004). National Nosocomial Infections Surveillance Warren, D. K., Shukla, S. J., Olsen, M. A., Kollef, M. H., Hollenbeak,
(NNIS) System Report, data summary from January 1992 through C. S., Cox, M. J., Cohen, M. M. & Fraser, V. J. (2003). Outcome and
June 2004, issued October 2004. Am J Infect Control 32, 470485. attributable cost of ventilator-associated pneumonia among intensive
Nga, T. V. T., Parry, C. M., Le, T., Lan, N. P. H., Diep, T. S., Campbell, care unit patients in a suburban medical center. Crit Care Med 31,
J. I., Hoang, N. V. M., Dung, T., Wain, J. & other authors (2012). The 13121317.
decline of typhoid and the rise of non-typhoid salmonellae and fungal Woodford, N., Ellington, M. J., Coelho, J. M., Turton, J. F., Ward, M. E.,
infections in a changing HIV landscape: bloodstream infection trends Brown, S., Amyes, S. G. B. & Livermore, D. M. (2006). Multiplex PCR
over 15 years in southern Vietnam. Trans R Soc Trop Med Hyg 106, for genes encoding prevalent OXA carbapenemases in Acinetobacter
2634. spp. Int J Antimicrob Agents 27, 351353.

1394 Journal of Medical Microbiology 63