Scribd
Upload
201 views10 pages

Perl Tutorial

This document contains a Perl tutorial covering various tasks for working with DNA/RNA sequences including: storing sequences in variables; concatenating sequences; transcribing DNA to RNA; calculating the reverse complement of a sequence; reading protein sequences from files; determining nucleotide frequencies using regular expressions and loops; and writing results to files. The tutorial provides code examples for each task and discusses concepts like using variables, file I/O, pattern matching, and conditional logic.

Uploaded by

Jessica Mitchell
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
201 views10 pages

Perl Tutorial

This document contains a Perl tutorial covering various tasks for working with DNA/RNA sequences including: storing sequences in variables; concatenating sequences; transcribing DNA to RNA; calculating the reverse complement of a sequence; reading protein sequences from files; determining nucleotide frequencies using regular expressions and loops; and writing results to files. The tutorial provides code examples for each task and discusses concepts like using variables, file I/O, pattern matching, and conditional logic.

Uploaded by

Jessica Mitchell
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 10

Perl

tutorial

Working with DNA Sequences

#!/usr/bin/perl -w
# Storing DNA in a variable, and printing it out
# First we store the DNA in a variable called $DNA

$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Next, we print the DNA onto the screen

print $DNA;

# Finally, we'll specifically tell the program to exit.

exit;

Concatenating the DNA sequences

#!/usr/bin/perl -w
# Concatenating DNA
# Store two DNA fragments into variables called $DNA1
#and $DNA2

$DNA1 = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';
$DNA2 = 'ATAGTGCCGTGAGAGTGATGTAGTA';

# Print the DNA onto the screen

print "Here are the original two DNA fragments:\n\n";


print $DNA1, "\n";
print $DNA2, "\n\n";

# Concatenate the DNA fragments into a third variable and


#print them Using "string interpolation"
$DNA3 = "$DNA1$DNA2";
print "Here is the new DNA of the two fragments

version 1):\n\n";
print "$DNA3\n\n";

# An alternative way using the "dot operator":


# Concatenate the DNA fragments into a third variable and
# print them

$DNA3 = $DNA1 . $DNA2;


print "Here is the concatenation of the first two fragments
(version 2):\n\n";
print "$DNA3\n\n";

# Print the same thing without using the variable $DNA3

print "Here is the concatenation of the first two fragments


(version 3):\n\n";
print $DNA1, $DNA2, "\n";
exit;

TRANSCRIPTION: DNA -> RNA

#!/usr/bin/perl -w

# Transcribing DNA into RNA


# The DNA

$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen


print "Here is the starting DNA:\n\n";
print "$DNA\n\n";

# Transcribe the DNA to RNA by substituting all T's with U's.

$RNA = $DNA;
$RNA =~ s/T/U/g;
# Print the RNA onto the screen
print "Here is the result of transcribing the DNA to
RNA:\n\n";
print "$RNA\n";

# Exit the program.


exit;

Reverse Complement

#!/usr/bin/perl -w
# Calculating the reverse complement of a strand of DNA

# The DNA
$DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';

# Print the DNA onto the screen


print "Here is the starting DNA:\n\n";
print "$DNA\n\n";

# Calculate the reverse complement

# First, copy the DNA into new variable $revcom


# (short for REVerse COMplement)
#
# It doesn't matter if we first reverse the string and then
# do the complementation; or if we first do the
complementation
# and then reverse the string. Same result each time.
# So when we make the copy we'll do the reverse in the same
statement.

$revcom = reverse $DNA;

-----
The DNA is now reversed.. we neeed to complement the bases
in revcom - substitute all bases by their complements.
# A->T, T->A, G->C, C->G
####Attempt 1:

$revcom =~ s/A/T/g;
$revcom =~ s/T/A/g;
$revcom =~ s/G/C/g;
$revcom =~ s/C/G/g;
# Print the reverse complement DNA onto the screen
print "Here is the reverse complement DNA:\n\n";
print "$revcom\n";

#################

Does this work?? Why?





# See the text for a discussion of tr///
$revcom =~ tr/ACGTacgt/TGCAtgca/;

# Print the reverse complement DNA onto the screen


print "Here is the reverse complement DNA:\n\n";
print "$revcom\n";
print "\nThis time it worked!\n\n";
exit;




Reading Proteins in files

#!/usr/bin/perl -w
# Reading protein sequence data from a file
# The filename of the file containing the protein sequence
data

$proteinfilename = 'Name_Of_your_sequence_file.txt';

# First we have to "open" the file, and associate


# a "filehandle" with it. We choose the filehandle
# PROTEINFILE for readability.
open(PROTEINFILE, $proteinfilename) || Die ("cannot open
file");

# Now we do the actual reading of the protein sequence data


from the file, by using the angle brackets < and > to get
the input from the filehandle. We store the data into our
variable $protein.

@protein = <PROTEINFILE>;

# Now that we've got our data, we can close the file.

close PROTEINFILE;

# Print the protein onto the screen


print "Here is the protein:\n\n";
print @protein;
exit;

Pattern matching: Motifs and Loops

Proceed ONLY if condition is true...

code layout..
if (condition)

do something

Finding Motifs
#!/usr/bin/perl -w
# if-elsif-else

$word = 'MNIDDKL';

# if-elsif-else conditionals

if($word eq 'QSTVSGE') {
print "QSTVSGE\n";
} elsif($word eq 'MRQQDMISHDEL') {
print "MRQQDMISHDEL\n";
}

GC CONTENT

In PCR experiments, the GC-content of primers are used to predict their annealing temperature
to the template DNA. A higher GC-content level indicates a higher melting temperature.

GC % = G + C x100

A+G+C+T

Logical:

for each base in the DNA

if base is A
count_of_A = count_of_A + 1

if base is C
count_of_C = count_of_C + 1
if base is G
count_of_G = count_of_G + 1

if base is T
count_of_T = count_of_T + 1

done

print count_of_A, count_of_C, count_of_G, count_of_T


the script

#!/usr/bin/perl -w
# Determining frequency of nucleotides
# Get the name of the file with the DNA sequence data

$dna_filename = File_name.txt;

# Remove the newline from the DNA filename


chomp $dna_filename;

# open the file, or exit

open(DNAFILE, $dna_filename) || die ("Cannot open file


\"$dna_filename\");
exit;
}

# Read the DNA sequence data from the file, and store it
# into the array variable @DNA
@DNA = <DNAFILE>;
# Close the file
close DNAFILE;

# From the lines of the DNA file,


# put the DNA sequence data into a single string.
$DNA = join( '', @DNA);
# Remove whitespace
$DNA =~ s/\s//g;

# Now explode the DNA into an array where each letter of


# the original string is now an element in the array.
# This will make it easy to look at each position.
# Notice that we're reusing the variable @DNA for this
purpose.
@DNA = split( '', $DNA );

# Initialize the counts.


# Notice that we can use scalar variables to hold numbers.
$count_of_A = 0;
$count_of_C = 0;
$count_of_G = 0;
$count_of_T = 0;
$errors = 0;

# In a loop, look at each base in turn, determine which of


# the four types of nucleotides it is, and increment the
# appropriate count.

foreach $base (@DNA)


{
if ( $base eq 'A' ) {
++$count_of_A;
}
elsif ( $base eq 'C' ) {
++$count_of_C;
}
elsif ( $base eq 'G' ) {
++$count_of_G;
}
elsif ( $base eq 'T' ) {
++$count_of_T;
}
else {
print "!!!!!!!! Error - I don\'t recognize this
base: $base\n";
++$errors;
}
}

# print the results


print "A = $count_of_A\n";
print "C = $count_of_C\n";
print "G = $count_of_G\n";
print "T = $count_of_T\n";
print "errors = $errors\n";
# exit the program
exit;

---using regex ---

while($DNA =~ /a/ig){$a++}
while($DNA =~ /c/ig){$c++}
while($DNA =~ /g/ig){$g++}
while($DNA =~ /t/ig){$t++}
while($DNA =~ /[^acgt]/ig){$e++}
print "A=$a C=$c G=$g T=$t errors=$e\n";

----

Next is a new kind of loop, the foreach loop. This loop works over the elements
of an
array. The line:
foreach $base (@DNA)

Wrtiting to files

# Also write the results to a file called "countbase"


$outputfile = "countbase";
(
unless
open(COUNTBASE, ">$outputfile") || die ("Cannot open file
\"$outputfile\" to write to!!\n\n");

print COUNTBASE "A=$a C=$c G=$g T=$t errors=$e\n";


close(COUNTBASE);

You might also like