Reverse Transcription - Polymerase Chain Reaction: Protocol
Reverse Transcription - Polymerase Chain Reaction: Protocol
Reverse transcription coupled to the polymerase chain reaction (RTPCR) is commonly used to detect
the presence of mRNAs, pre-mRNAs, or other types of RNA such as noncoding RNAs. The method
involves using a primer annealed to the RNA of interest. For mRNA, the primer is usually a synthetic
oligo(dT)1518, a random hexamer mixture (dN)6, or a synthetic DNA oligonucleotide that is com-
plementary to a specic transcript (a gene-specic primer). This DNA:RNA hybrid serves as a template
during reverse transcription, in which the enzyme reverse transcriptase (RT) generates a single-strand-
ed cDNA copy of a portion of the target RNA molecule. Using random hexamer priming, it is possible
to obtain representative cDNA copies of sequences from the entire length of the mRNAs and pre-
mRNAs in a population. This cDNA can then be used as a template for PCR. On addition of gene-
specic primers, a specic DNA fragment corresponding to a portion of the RNA of interest is
generated.
MATERIALS
It is essential that you consult the appropriate Material Safety Data Sheets and your institutions Environmental
Health and Safety Ofce for proper handling of equipment and hazardous materials used in this protocol.
RECIPE: Please see the end of this protocol for recipes indicated by <R>. Additional recipes can be found online at
http://cshprotocols.cshlp.org/site/recipes.
Reagents
[-32P]dCTP (3000 mCi/mmol, 20 Ci/mL) (for PCR using random hexamer-primed cDNA or oligo
[dT]-primed cDNA only; see Step 17)
AmpliTaq DNA polymerase (5 units/L) and 10 buffer (Applied Biosystems)
Dithiothreitol (DTT) (0.1 M)
dNTPs (each 10 mM)
First-strand buffer for RTPCR (5) <R>
Gel (1.8% agarose or 5%7.5% polyacrylamide [0.8:30 bis-acrylamide: acrylamide]) and electro-
phoresis buffer (e.g., 1 TBE)
H2O (RNase-free)
Methanol (10%)/acetic acid (10%) (optional; see Step 20)
Mineral oil (for gene-specic priming method only; see Steps 12 and 23)
Primers
For reverse transcription, use random hexamers ([dN]6) (5 mg/mL), oligo(dT)15 or oligo(dT)18 (100 pmol/L), or
one gene-specific primer (the 3 primer is used). For PCR, use two gene-specific primers (one 5 and one 3 ).
Adapted from RNA: A Laboratory Manual by Donald C. Rio, Manuel Ares Jr, Gregory J. Hannon, and Timothy W. Nilsen. CSHL Press,
Cold Spring Harbor, NY, USA, 2011.
2014 Cold Spring Harbor Laboratory Press
Cite this protocol as Cold Spring Harb Protoc; doi:10.1101/pdb.prot080887
1207
D.C. Rio
Equipment
Bucket with ice
Gel electrophoresis system (for polyacrylamide and agarose gels) and power supply, vacuum gel drier,
and detection equipment, as required (see Steps 19, 20, and 25)
PCR tubes (200 L)
Thermal cycler
METHOD
RTPCR proceeds in two stages. First, oligo(dT)15, (dN)6, or a gene-specific primer is annealed to the target mRNA
population, and reverse transcriptase and dNTPs are added to allow first-strand cDNA synthesis (reverse transcription,
or RT). Second, new primers, fresh dNTPs, and Taq polymerase are added to generate a PCR to amplify the cDNA of
interest. These products are then run on either on an agarose gel or on a native polyacrylamide gel and analyzed.
5. Return the tube to the thermal cycler and allow the thermal cycler program to proceed through
completion.
Proceed immediately to Step 16. Otherwise, store the cDNA; it will keep indefinitely at 20C.
Total RNA 5 g
(dN)6 (5 mg/mL) 1 L
dNTPs (each 10 mM) 1 L
H2O (RNase-free) to 12 L
8. Run the heat/snap-cool protocol on the thermal cycler. Remove the tube and place in an ice
bucket.
9. Add the following components to the tube on ice:
10. Return the tubes to the thermal cycler and run the reverse transcription program on the
thermal cycler.
Proceed immediately to Step 16. Otherwise, store the cDNA; it will keep indefinitely at 20C.
i. The following program will anneal the primer to the template DNA:
Total RNA 12 g
First-strand buffer (5) 2 L
Gene-specic primer (3 only) 25 pmol
RNasin (40 units/L) 0.3 L
H2O (RNase-free) to 10 L
Adjust the amount of total RNA according to the relative abundance of the transcript. Overlay the reaction
with 30 L of mineral oil if using a thermal cycler without a heated lid.
13. Place the reaction in the thermal cycler and run the annealing program from Step 11.i. After the
program is complete, remove the reaction from the thermal cycler and immediately place it
on ice.
14. Add the following components to the tube on ice:
15. Place the reaction in the thermal cycler and run the cDNA synthesis program from Step 11.ii.
After the program is complete, remove the reaction from the PCR machine.
Mineral oil can be removed by extracting with chloroform using standard procedures.
To use the cDNA for PCR, proceed immediately to Step 21. Otherwise, store the cDNA; it will keep
indefinitely at 20C.
A
hsp70 NLS LacZ
IVS3
CUGCAGUUUAAGUAUAGGUUAAGAAAAUAUAUAAUAG/GUAUGA
F1 F2 5ss
84
4
48
B
p4
rp
+ hr
/h
+/ 8 4/
84
p4
p4
+
hr
+/
hr
RT + +
18. Place the reaction in the thermal cycler and run the program from Step 16.
19. Load 5 L of each reaction on a 5%7.5% native polyacrylamide gel (0.8:30 bis-acrylamide:
acrylamide) in 1 TBE.
20. Fix the gel in 10% methanol/10% acetic acid and dry on a vacuum gel drier. Subject the gel to
quantitation by phosphorimaging.
If the gel is thin (<0.75 mm), gel fixation is optional.
See Troubleshooting.
Typically, it is not necessary to add more dNTPs to the PCR because there were sufficient dNTPs in the
RT reaction.
23. Place the reaction tube in the thermal cycler with the cap open.
24. Begin the program. Once the thermal cycler has reached 80C, add 5 L of the following mix:
AmpliTaq buffer (10) 0.5 L
AmpliTaq DNA polymerase (5 units/L) 0.25 L
H2O 4.25 L
This step is called a manual hot start and helps to reduce nonspecific annealing of the primers. Make sure
that the mix has been added to all samples before the annealing/extension cycles begin. See Discussion.
25. Load 510 L of each amplication reaction on a 1.8% agarose gel and detect using standard
procedures.
See Troubleshooting.
TROUBLESHOOTING
Problem (Steps 20 and 25): The reactions are not visible by acrylamide or agarose gel electrophoresis.
Solution: Consider the following.
When this procedure does not work, it is often because of poor primer design. It is critical that the
two PCR primers be Tm-matched (Sambrook et al. 1989). Also check primers for structure or
potential homodimer formation. It is worth spending some effort on primer design before using
this protocol (see Discussion).
To determine whether any product is present, try blotting the gel to a membrane and hybridizing
with a specic 32P-labeled probe. Also, try radiolabeling the PCR product(s) during the PCR. If
using the labeling method, analyze the results by native polyacrylamide gel electrophoresis as
described in Steps 19 and 20.
reduces nonspecic PCR amplication products. The use of a hot start (as in Step 24) may also
reduce nonspecic amplication (see Discussion).
DISCUSSION
Tm = 2 C (A + T) + 4 C (G + C).
4. If at all possible, make an effort to design primer pairs with similar or identical Tm values.
5. Optimal annealing temperatures are empirical, i.e., the optimal annealing temperature for a given
primer pair may be either above or below the calculated Tm. As an initial starting point, try an
annealing temperature at 5C below the Tm.
6. Make every attempt to avoid complementarity of the 3 terminal two or three bases on the
primer pairs so as to reduce the formation of primer dimers. Use available software programs
for this.
7. Make sure to avoid base sequence mismatches between the very 3 end of the primer and the
template cDNA target sequence.
8. Make sure to avoid putting extended runs of three or more Gs or Cs at the 3 end of the primer.
9. If possible, avoid a T at the extreme 3 end of the primer because it has been observed that primers
with a T at the 3 end have a potential for mispriming caused by mismatch tolerance.
10. Avoid any extended complementary sequences within a single primer and between the two
primers of a primer pair.
11. For single-stranded DNA oligonucleotide primers, the spectrophotometric conversion for
primers is as follows: 1 A260 unit = 33 g/mL or 20 A260 units = 660 g/mL.
Hot-Start PCR
The complexity of cellular cDNA is high and can lead to spurious priming of DNA before or during the
denaturation step in the PCR procedure. The formation of primer dimers can also occur during the
initial phases of a PCR in which the temperature is raised from ambient to 95C. It is therefore often
useful in RTPCRs to perform a manual hot-start reaction in which the Taq (or other thermostable)
DNA polymerase is added after the reactions reach at least 80C. Alternatively, it is possible to use a
commercial polymerase, available from many companies and provided in an inactive state. These
polymerases are a modied form of the recombinant 94-kDa Taq DNA polymerase, have no poly-
merase activity at ambient temperatures, and remain inactive until an extended (215 min) incubation
at 95C. HotStarTaq DNA Polymerase, for example, allows for a quick PCR setup and prevents the
formation of misprimed products and primer dimers because all reaction components can be com-
bined at room temperature. HotStarTaq DNA polymerase is activated by a 15-min, 95C incubation
step that can easily be incorporated into existing thermal cycling programs. A hot-start protocol
usually provides high PCR specicity and often increases the yield of the specic PCR product.
Semiquantitative PCR
Once the RTPCR conditions for an RNA of interest have been established, it is often desirable
to determine the relative abundance of that RNA in one or more samples (e.g., in samples prepared
from different tissues, cell lines, or cell fractions). A convenient method for accomplishing
this is called semiquantitative PCR. In this approach, it is necessary to determine the number
of amplication cycles that are needed both to visualize a product (which is almost always radioac-
tive) and to determine a point (cycle number) where the amount of product is proportional to the
amount of input cDNAthe exponential or so-called linear portion of the product accumulation
curve (Fig. 2). The exponential phase of amplication occurs during PCR when the PCR products
100,000
cpm
Exponential range
Cycle number
10 12 14 16 18 20 22 24 26 28
are accumulating at a constant rate and when the reaction components are still in excess over the
product(s).
To empirically determine the exponential range, typically a PCR master mix is prepared that
includes 510 L/Ci of [-32P]dCTP (10 mCi/mL; 400800 Ci/mmol) in addition to the normal
PCR components and cDNA template. The master mix is then split into 10 different aliquots that
are then separately subjected to PCR. Samples are removed from the thermal cycler at the indicated
cycle numbers and resolved by electrophoresis on a native 5% polyacrylamide gel in TBE buffer (see
Fig. 3). The gel is then dried and the radiolabeled cDNA products are quantitated by phosphorimag-
ing. The cycle number (x-axis) is plotted versus the log of the 32P signal ( y-axis) and a straight line is
obtained for samples in the exponential (linear) phase of the amplication curve (see Fig. 2).
When comparing RNA samples, it is always necessary to normalize them based on the level of an
RNA that is known to be constant (e.g., an abundant housekeeping mRNA such as glyceraldehyde
phosphate dehydrogenase [GAPDH], rp49, actin, or tubulin). Once the linear range for this control
transcript is established in each sample, the most concentrated sample should be diluted to match the
concentration of the least concentrated. It is often desirable to prenormalize the RNA concentra-
tions of the samples using spectrophotometry, if possible, so that each sample gives the same signal at
the same cycle number. Once these conditions have been met, one can proceed to quantitate the
transcript of interest, keeping in mind that the number of cycles required to reach the linear range for a
less abundant transcript is going to be signicantly greater (e.g., by 515 cycles) than the number
needed for the abundant housekeeping gene.
In summary, semiquantitative PCR is an accepted and powerful method for quantifying the
relative abundance of specic RNAs in different preparations. It is important to realize and remember,
however, that this approach is not useful for absolute quantitation. For quantitative PCR, see Basic
Quantitative PCR Using Real-Time Fluorescence Measurements (Ares 2014).
RECIPE
REFERENCES
Ares M. 2014. Basic quantitative PCR using real-time uorescence measure- Castle J, Garrett-Engele P, Armour CD, Duenwald SJ, Loerch PM, Meyer
ments. Cold Spring Harb Protoc doi:10.1101/pdb.prot080903. MR, Schadt EE, Stoughton R, Parrish ML, Shoemaker DD, et al. 2003.
Optimization of oligonucleotide arrays and RNA amplication proto- Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users and
cols for analysis of transcript structure and alternative splicing. Genome for biologist programmers. Methods Mol Biol 132: 365386.
Biol 4: R66. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: A laboratory
Hammond L, Rudner DZ, Kanaar R, Rio DC. 1997. Mutations in the hrp48 manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring
gene, which encodes a Drosophila heterogeneous nuclear ribonucleo- Harbor, NY.
protein particle protein, cause lethality, developmental defects and
affect P-element third-intron splicing in vivo. Mol Cell Biol 17: 7260
7267.