Bio2 Initial Release 13june PDF

The Commission on Higher Education
in collaboration with the Philippine Normal University
INITIAL RELEASE: 13 JUNE 2016

Teaching Guide for Senior High School
GENERAL
BIOLOGY 2
SPECIALIZED SUBJECT | ACADEMIC-STEM
This Teaching Guide was collaboratively developed and reviewed by

educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at [email protected]. We value your feedback and
recommendations.
Development Team
Team Leader: Ivan Marcelo A. Duka
Writers: Neil Andrew B. Bascos, Ph.D., Ma.
Genaleen Q. Diaz, Ph.D., Ian Kendrich C. Fontanilla, This Teaching Guide by the
Ph.D., Ma. Carmina C. Manuel, Ph.D., Sharon Rose Commission on Higher Education is
M. Tabugo, Ph.D., Eugenio P. Quijano Jr. licensed under a Creative
Commons Attribution-
Technical Editors: Annalee S. Hadsall, Ph.D. NonCommercial-ShareAlike 4.0
Copy Reader: Caroline H. Pajaron International License. This means
Published by the Commission on Higher Education, 2016 you are free to:
Illustrator: Ma. Daniella Louise F. Borrero
Chairperson: Patricia B. Licuanan, Ph.D. Share copy and redistribute the
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz material in any medium or format
Commission on Higher Education
Adapt remix, transform, and
K to 12 Transition Program Management Unit
build upon the material.
Office Address: 4th Floor, Commission on Higher Education, Senior High School Support Team The licensor, CHED, cannot revoke
C.P. Garcia Ave., Diliman, Quezon City CHED K to 12 Transition Program Management Unit these freedoms as long as you
Telefax: (02) 441-0927 / E-mail Address: [email protected] follow the license terms. However,
Program Director: Karol Mark R. Yee
under the following terms:
Lead for Senior High School Support: Attribution You must give
Gerson M. Abesamis appropriate credit, provide a link to
Consultants the license, and indicate if changes
Lead for Policy Advocacy and Communications:
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY. were made. You may do so in any
Averill M. Pizarro reasonable manner, but not in any
University President: Ester B. Ogena, Ph.D.
Course Development Officers: way that suggests the licensor
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
endorses you or your use.
VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D. John Carlo P. Fernando, Danie Son D. Gonzalvo
NonCommercial You may not use
Ma. Cynthia Rose B. Bautista, Ph.D., CHED Teacher Training Officers: the material for commercial
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University Ma. Theresa C. Carlos, Mylene E. Dones purposes.
ShareAlike If you remix,
Carmela C. Oracion, Ph.D., Ateneo de Manila University Monitoring and Evaluation Officer: transform, or build upon the
Minella C. Alarcon, Ph.D., CHED Robert Adrian N. Daulat material, you must distribute your
Gareth Price, Sheffield Hallam University contributions under the same license
Administrative Officers:
Stuart Bevins, Ph.D., Sheffield Hallam University as the original.
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City, [email protected]
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ii Chapter 3: Systematics Based on Evolutionary Relationships
DepEd General Biology 2 Curriculum Guide . . . . . . . . . . . . . vi Lesson 14: Systematics Based on Evolutionary Relationships:
Chapter 1: Genetics Tree of Life and Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Lesson 1: Pedigree Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Lesson 15: Systematics Based on Evolutionary Relationships:

Lesson 2: Sex Linkage and Recombination . . . . . . . . . . . . . . . .
8 Taxonomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
Lesson 3: Modifications to Mendels Classic Ratios . . . . . . . . . 13 Lesson 16: Systematics Based on Evolutionary Relationships:
Lesson 4: Molecular Structure of DNA, RNA, and Proteins . . .
19 Cladistics and Phylogeny . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 129
Lesson 5: DNA Replication and Protein Synthesis . . . . . . . . . . 24 Chapter 4: Compare and Contrast Processes in Plants and Animals
Lesson 6: Genetic Engineering . . . . . . . . . . . . . . . . . . . . . . . . . 30 Lesson 17: Reproduction and Development . . . . . . . . . . . . . . . . . 136
Lesson 7: Discuss the Applications of Recombinant DNA . . . . 36 Lesson 18: Nutrition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158
Chapter 2: Evolution and Origin of Biodiversity Lesson 19: Gas Exchange . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179
Lesson 8: History of Life on Earth . . . . . . . . . . . . . . . . . . . . . . . 49 Lesson 20: Transport and Circulation . . . . . . . . . . . . . . . . . . . . . . 190
Lesson 9: Mechanisms that Produce Change in Populations . . 70 Lesson 21: Regulation of Body Fluids . . . . . . . . . . . . . . . . . . . . . . 194
Lesson 10: Evolution and Origin of Biodiversity: Patterns of Lesson 22: Immune Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204
Descent with Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Lesson 23: Chemical and Nervous Control . . . . . . . . . . . . . . . . . 214
Lesson 11: Development of Evolutionary Thought . . . . . . . . . 87 Lesson 24: Sensory and Motor Mechanisms . . . . . . . . . . . . . . . . . 226
Lesson 12: Evidences of Evolution . . . . . . . . . . . . . . . . . . . . . . 92 Lesson 25: Feedback Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . 235
Lesson 13: Infer Evolutionary Relationships of Organisms . . . . 102 Colored Images . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257
i
Introduction
As the Commission supports DepEds implementation of Senior High School (SHS), it upholds the vision
and mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
Education Act of 2013, that every graduate of basic education be an empowered individual, through a
program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with
appropriate methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards deeper
content areas and competencies. Thus, the introduction of the SHS for SHS Framework.
The SHS for SHS Framework, which stands for Saysay-Husay-Sarili for Senior High School, is at the
SHS for SHS core of this book. The lessons, which combine high-quality content with flexible elements to
Framework accommodate diversity of teachers and environments, promote these three fundamental concepts:
SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP

Why is this important? How will I deeply understand this? What can I do with this?
Through this Teaching Guide, Given that developing mastery When teachers empower
teachers will be able to facilitate goes beyond memorization, learners to take ownership of
an understanding of the value teachers should also aim for their learning, they develop
of the lessons, for each learner deep understanding of the independence and self-
to fully engage in the content subject matter where they lead direction, learning about both
on both the cognitive and learners to analyze and the subject matter and
affective levels. synthesize knowledge. themselves.
This Teaching Guide is intended for Science, Technology, Engineering, and Mathematics (STEM) Strand
teachers who are teaching learners under the Academic Track. The prerequisite course for this subject is
General Biology 1, that primarily focuses on life processes at the cellular and molecular levels. The said
prerequisite course also covers the transformation of energy in organisms.
As we go broader on a macro-level perspective, General Biology 2 is designed to enhance the

understanding of the principles and concepts in the study of Biology, particularly heredity and variation,
and the diversity of living organisms, their structure, function, and evolution. It is with passionate desire
that the teachers who will tackle the concepts in General Biology 2 lead Grade 12 students to pursue
Science-related courses in college. Studies conducted across the globe have identified innovation and
education in the fields of Science, Technology, Education and Mathematics (STEM) as critical
determinants economic prosperity. Indeed, STEM educated and trained individuals have been shown to
be major determinants of innovation and, thus, contributors to significant economic productivity.
Through this Teaching Guide, teachers are also empowered to be Designers, Facilitators, and
Learners of their own lessons:
1. When teachers are Designers, they should be able to:
- Contextualize available resources, content, and tools to fit their learners and environments
- Collaborate with fellow teachers in preparing materials and lessons
About this - Create and utilize assessments (rubrics, exams, projects)
- Leverage Pedagogical-Content Knowledge in developing lessons
Teaching Guide - Design lessons that encourage creativity and leadership
2. When teachers are Facilitators, they should be able to:
- Ask questions, facilitate discussions, and encourage student reflection
- Use learner-centered teaching strategies
- Provide useful feedback for learners
- Mentor learners for careers and further education
- Be sensitive to teenage development (gender, identity, character, grit)
3. When teachers are Learners, they should be able to:
- Gather data and student feedback
- Reflect on student feedback and classroom insights to improve teaching
- Use teacher/peer observations
- Critically use research and information
- Connect prior knowledge and debunk common misconceptions in education
iii
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
Parts of the usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
Teaching Guide innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
Highlight key concepts and identify the essential questions
Show the big picture
Connect and/or review prerequisite knowledge
Clearly communicate learning competencies and objectives
Motivate through applications and connections to real-life
2. Motivation
Give local examples and applications
Engage in a game or movement activity
Provide a hands-on/laboratory activity
Connect to a real-life problem
3. Instruction/Delivery
Give a demonstration/lecture/simulation/hands-on activity
Show step-by-step solutions to sample problems
Give applications of the theory
Connect to a real-life problem if applicable
4. Practice
Discuss worked-out examples
Provide easy-medium-hard questions
Give time for hands-on unguided classroom work and discovery
Use formative assessment to give feedback
5. Enrichment
Provide additional examples and applications
Introduce extensions or generalisations of concepts
Engage in reflection questions
Encourage analysis through higher order thinking prompts
6. Evaluation
Supply a diverse question bank for written work and exercises
Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of On the other hand, the Commission declared the College
the Senior High School program, it is of paramount importance to Readiness Standards that consist of the combination of knowledge,
align Functional Skills set by DepEd with the College Readiness skills, and reflective thinking necessary to participate and succeed -
Standards stated by CHED. without remediation - in entry-level undergraduate courses in
The DepEd articulated a set of 21st century skills that should be college.
embedded in the SHS curriculum across various subjects and tracks. The alignment of both standards, shown below, is also presented in
These skills are desired outcomes that K to 12 graduates should this Teaching Guide - prepares Senior High School graduates to the
possess in order to proceed to either higher education, revised college curriculum which will initially be implemented by AY
employment, entrepreneurship, or middle-level skills development. 2018-2019.
College Readiness Standards Foundational Skills DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation; Visual and information literacies, media literacy, critical thinking
3. Application of critical and creative thinking and doing processes; and problem solving skills, creativity, initiative and self-direction
4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and
5. Clear appreciation of ones responsibility as a citizen of a multicultural Philippines and a
diverse world;
Global awareness, scientific and economic literacy, curiosity,

Systematically apply knowledge, understanding, theory, and skills for the development of
critical thinking and problem solving skills, risk taking, flexibility
the self, local, and global communities using prior learning, inquiry, and experimentation and adaptability, initiative and self-direction
Global awareness, media literacy, technological literacy,

Work comfortably with relevant technologies and develop adaptations and innovations for
creativity, flexibility and adaptability, productivity and
significant use in local and global communities accountability
Global awareness, multicultural literacy, collaboration and

Communicate with local and global communities with proficiency, orally, in writing, and
interpersonal skills, social and cross-cultural skills, leadership
through new technologies of communication and responsibility
Media literacy, multicultural literacy, global awareness,

Interact meaningfully in a social setting and contribute to the fulfilment of individual and
collaboration and interpersonal skills, social and cross-cultural
shared goals, respecting the fundamental humanity of all persons and the diversity of skills, leadership and responsibility, ethical, moral, and spiritual
groups and communities values
v
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12 Quarters: 3rd to 4th Quarter
Subject Title: Biology 2 I No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly heredity and variation, and
the diversity of living organisms, their structure, function, and evolution.
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
The learners demonstrate The learners:
an understanding of:
1. compare and contrast the following processes in plants
1. Plant and Animal The learners shall be able to: and animals: reproduction, development, nutrition, gas STEM_BIO11/12-
exchange, transport/circulation, regulation of body IVa-h-1
Organ Systems and
develop a presentation (e.g. fluids, chemical and nervous control, immune systems,
their Functions
Organismal role-playing, dramatization and and sensory and motor mechanisms
other forms of multimedia) to
Biology 2. explain how some organisms maintain steady internal STEM_BIO11/12-
show how an organism
conditions that possess various structures and processes IVi-j-2
maintains homeostasis through
the interaction of the various 3. describe examples of homeostasis (e.g., temperature
2. Feedback Mechanisms organ systems in the body regulation, osmotic balance and glucose levels) and the STEM_BIO11/12-
major features of feedback loops that produce such IVi-j-3
homeostasis
1. predict genotypes and phenotypes of parents and STEM_BIO11/12-

1. make a pedigree analysis in offspring using the laws of inheritance IIIa-b-1
the learners family using a
simple genetic trait 2. explain sex linkage and recombination STEM_BIO11/12-
IIIa-b-2
2. make a research paper/case
3. describe modifications to Mendels classic ratios (gene STEM_BIO11/12-
study/poster on genetic
1. Mendels Laws of interaction) IIIa-b-3
diseases
Inheritance
2. Sex Linkage 4. illustrate the molecular structure of DNA, RNA, and STEM_BIO11/12-
Genetics 3. make a diagram (e.g., proteins
3. Central Dogma of IIIa-b-4
pictogram, poster) showing
Molecular Biology
the evolution of a 5. diagram the steps in DNA replication and protein STEM_BIO11/12-
4. Recombinant DNA
domesticated crop synthesis IIIa-b-5
4. differentiate the 3-Domain 6. outline the processes involved in genetic engineering STEM_BIO11/12-
Scheme from the 5-Kingdom IIIa-b-6
Scheme of classification of
living things STEM_BIO11/12-
7. discuss the applications of recombinant DNA
IIIa-b-7
K to 12 Senior High School STEM Specialized Subject General Biology 2 December 2013 Page 1 of 3
CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE
1. describe general features of the history of life on Earth,

including generally accepted dates and sequence of the STEM_BIO11/12-
geologic time scale and characteristics of major groups IIIc-g-8
of organisms present during these time periods
2. explain the mechanisms that produce change in
populations from generation to generation (e.g., STEM_BIO11/12-
artificial selection, natural selection, genetic drift, IIIc-g-9
mutation, recombination)
Evolution and Relevance, Mechanisms, 3. show patterns of descent with modification from
Origin of Evidence/Bases, and common ancestors to produce the organismal diversity STEM_BIO11/12-
Biodiversity Theories of Evolution observed today IIIc-g-10
4. trace the development of evolutionary thought STEM_BIO11/12-

IIIc-g-11
5. explain evidences of evolution (e.g., biogeography,
fossil record, DNA/protein sequences, homology, and STEM_BIO11/12-
embryology) IIIc-g-12
6. infer evolutionary relationships among organisms using STEM_BIO11/12-

the evidence of evolution IIIc-g-13
1. explain how the structural and developmental
characteristics and relatedness of DNA sequences are STEM_BIO11/12IIIh-
used in classifying living things j-14
Basic Taxonomic Concepts
Systematics
and Principles, Description, 2. identify the unique/distinctive characteristics of a
Based on STEM_BIO11/12IIIh-
Nomenclature, specific taxon relative to other taxa
Evolutionary j-15
Identification, and
Relationships 3. describe species diversity and cladistics, including the
Classification
types of evidence and procedures that can be used to STEM_BIO11/12IIIh-
establish evolutionary relationships j-16
Code Book Legend
Sample: STEM_BIO11/12IIIh-j-16
LEGEND SAMPLE
Learning Area and Strand/ Subject or Science, Technology, Engineering and

Specialization Mathematics
First Entry
STEM_BIO11/12
Grade Level Grade 11 or 12
Domain/Content/
Uppercase Letter/s General Biology
Component/ Topic
Roman Numeral
Quarter Third Quarter III
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate Week Weeks eight to ten h-j
more than a specific week
-
describe species diversity and cladistics,
including the types of evidence and
Arabic Number Competency 16
procedures that can be used to establish
evolutionary relationships
SUGGESTED ACADEMIC TRACK SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) STRAND SCHEDULING OF SUBJECTS*
Grade 11 Grade 12
STEM
1st Semester 2nd Semester 1st Semester 2nd Semester
st
21 Century Literature from the
Oral Communication in Context Reading and Writing Skills Physical Education and Health
Philippines and the World
Komunikasyon at Pananaliksik sa Pagbasa at Pagsusuri ng Ibat-Ibang Contemporary Philippine Arts from
Wika at Kulturang Pilipino Teksto Tungo sa Pananaliksik the Regions
CORE SUBJECTS
General Mathematics Statistics and Probability Media and Information Literacy

Disaster Readiness and Risk Understanding Culture, Society and
Earth Science
Reduction Politics
Introduction to the Philosophy of
Personal Development / Pansariling
the Human Person / Pambungad sa Physical Education and Health
Kaunlaran
Pilosopiya ng Tao
Physical Education and Health Physical Education and Health
Empowerment Technologies (E- English for Academic and
Research in Daily Life 1 Research in Daily Life 2
CONTEXTUALIZED
Tech): ICT for Professional Tracks Professional Purposes

SUBJECTS
Entrepreneurship
Pagsulat sa Filipino sa Piling

Research Project
Larangan (Akademik)
Pre-Calculus Basic Calculus General Physics 1 General Physics 2

SPECIALIZATION
SUBJECTS
General Chemistry 1 General Biology 1 General Biology 2
General Chemistry 2
Research/Capstone Project
HOURS
PER DAY 5.8 6.6 6.6 5.8
Please note that some subjects have prerequisites. These are indicated in the Curriculum Guides and are listed below for easy referral.
SUBJECT PREREQUISITE/S
Research in Daily Life 2 Statistics and Probability
Basic Calculus Pre-Calculus
General Biology 2 General Biology 1
General Chemistry 2 General Chemistry 1
General Physics 1 Pre-Calculus, Calculus
General Physics 2 General Physics 1
K to 12 Senior High School Science, Engineering, Technology and Mathematics Strand Scheduling * 80 hours per subject
General Biology 2 60 MINS
Lesson 1: Pedigree Analysis

Content Standard
The learners understand Mendels Laws of Inheritance. LESSON OUTLINE
Performance Standard Introduction Communicating Learning Objectives and 5
The learners shall be able to: Relevant Vocabulary
make a Pedigree Analysis in the learners family using a simple genetic trait. Motivation Narrative 5
Learning Competency
The learners shall be able to construct pedigrees and predict genotypes based Instruction Recall in Mendelian Ratios, Discussion 40
on pedigree analysis (STEM_BIO11/12-IIIa-b-1) on Co-Dominance and Multiple Alleles
Specific Learning Outcomes: Practice Group Work: Non-Mendelian Traits in 40

At the end of the lesson, the learners will be able to: Humans, Plants, and Animals
identify the mode of inheritance of a particular trait given the pedigree; Materials
predict the genotypes of parents; and Pen, paper, and ruler
compute the probability of occurrence of an affected offspring in a given Resources

cross. (1) Klug WS, Cummings MR, Spencer CA, Palladino MA.
2012. Essentials of genetics. 8th ed. Benjamin Cummings;
2012. 624 p.
(2) Reece JB, Urry LA, Cain ML, Wasserman SA, Minorsky PV,
Jackson RB. 2012. Campbell biology, 9th ed. The
Benjamin Cummings Publishing Co., Inc: 2012. 1464 p.
(3) Bennett RL, Steinhaus KA, Uhrich SB, OSullivan CK, Resta
RG, Lochner-Doyle D, Markel DS, Vincent V, Hamanishi J.
Recommendations for standardized human pedigree
nomenclature. Am J Human Genet. 1995; 56:745-752.
INTRODUCTION (5 MINS)
1. Cite the learning objectives, which are as follows:
I. identify the mode of inheritance of a particular trait given the pedigree
II. predict the genotypes of parents
III. predict the probability of having an affected offspring
2. Relevant vocabulary
I. Pedigree. Making use of diagrams showing the ancestral relationships and transmission of
genetic traits over several generations in a family
II. Proband. The individual in the pedigree that led to the construction of the pedigree. For
example, a couple consults a medical geneticist because they have an offspring who is
afflicted with a disease and they want to find out the mode of transmission of this disease.
When the medical geneticist constructs the pedigree, the offspring will be labeled as the
proband. Through the pedigree, the probability of having other affected children may be
determined.
III. Law of Segregation (1st Mendelian Law). For every trait governed by a pair of alleles,
these alleles segregate or separate during gamete formation in meiosis
IV. Law of Independent Assortment (2nd Mendelian Law). A pair of alleles for one trait will
segregate or separate independently of another pair of alleles for another trait during
meiosis
V. Autosomal trait. A trait whose alleles that control it are found in the autosomes (body
chromosomes/ non-sex chromosomes)
Teacher Tip:
VI. Genotype. The gene pair an individual carries for a particular trait symbolized with a pair Tell the learners that they have to use a letter in
of letters. By convention, uppercase letter (eg. A) for a dominant allele and lowercase which the uppercase and lowercase versions are
letter (eg. a) for the recessive allele. Any letter in the alphabet may be used easy to distinguish using cursive to avoid
confusion.
A. For a diploid organism with two alleles in a given gene pair, genotypes may be
written as:
i. Homozygous dominant, i.e. with two dominant alleles (DD)
Ask learners to recall their lessons in classical
ii. Heterozygous, i.e. with a dominant and recessive allele (Dd). The individual will genetics in their previous grade levels.
show the dominant phenotype.
iii. Homozygous recessive, i.e. with two recessive alleles (dd)
2
VII. Phenotype Teacher Tip:
A. The observable trait of an individual based on its genotype. Examples: red flower, curly Note that the phenotype is determined by the
genotype. In complete dominance, RR- red flower;
hair, blood types ( i.e. the blood type is the phenotype)
rr- white flower; but Rr will express the red flower
B. For a typical Mendelian trait, phenotypes may either be: condition because one dominant allele is enough
for the dominant trait to be expressed in the
i. Dominant. A trait that requires at least one dominant allele for the trait to be
organism.
expressed, e.g. Dd
ii. Recessive. A trait that requires two recessive alleles for the trait to be expressed
VIII.Phenocopy. A trait that is expressed due to specific environmental conditions (i.e. having
hair that is dyed of a different color) and is not due to the genotype.
IX. Identical twins. Also known as monozygotic twins, which are derived from a single
fertilization event. After the first cleavage or cell division of the zygote, the cells or
blastomeres separate and become independent blastocysts implanted in the mothers
uterus.
X. Fraternal twins. Twins that are derived from separate fertilization events (two eggs
fertilized by two sperms) within the fallopian tube, resulting in two separate zygotes; also
known as dizygotic twins
REVIEW (15 MINS) Teacher Tip:

The learners should be able to predict correctly
1. Ask the learners to recall Mendelian Laws of Inheritance
the Mendelian ratios without having to use a
I. Law of Segregation (1st Mendelian Law) Punnett square. They should be able to solve for
probabilities of occurrence of a trait by analyzing a
II. Law of Independent Assortment (2nd Mendelian Law)
pedigree.
2. Ask the learners to define genotypes and phenotypes, dominant and recessive traits,
homozygous and heterozygous dominants as well as homozygous recessive
3. Ask the learners to review the classic monohybrid Mendelian F2 genotypic and phenotypic
ratios by filling out a table (see table 1 at the end of this document)
4. In a monohybrid cross and assuming complete dominance, the ratio of the F2 progenies may
be predicted as 3:1, i.e. 3 with the dominant trait and 1 with the recessive trait.
5. In a dihybrid cross and assuming complete dominance, the ratio of the F2 progenies may be
predicted as 9:3:3:1.
INSTRUCTION (15 MINS)
1. Define pedigree analysis. 4. What to expect in a human pedigree
2. Enumerate uses of pedigree analysis: I. For autosomal dominant trait: Two affected individuals can
have a normal offspring
I. Describe the mode of inheritance of a trait
II. For autosomal recessive trait: Two affected individuals can
II. Calculate the probability of occurrence an affected offspring
NEVER have a normal offspring
in a given cross
5. Give an example of a pedigree and solve some questions
3. Establish symbols for creating pedigrees
I. Male (square) vs female (circle)
II. Affected (shaded) vs unaffected (unshaded) individual PRACTICE (25 MINUTES)
III. Marriage/mating line (line connecting mates) vs. sibship line 1. Divide learners into groups of four.
(line connecting siblings) 2. Provide copies of four sample pedigrees. (See samples in Figure
IV. Fraternal twins (one birthline branching out into the 2 at the end of this document.)
individual twin) vs. identical twins (same as fraternal twins but 3. For each pedigree, provide questions for the group to answer
with a horizontal bar connecting the branches) I. Identify the mode of inheritance
V. Generation (Roman numerals) vs. individuals in the same II. Write down the genotypes of specific individuals
generation, counting left to right (designated by Hindu- III. Compute for the probability of having an affected offspring
Arabic numerals)
VI. Proband (arrow)
Sample pedigree with symbol guides

4
A. Look at the family of IV-9 and IV-10. If the trait is dominant, is
it possible for them to have an affected offspring?
(Answer: NO. If the trait is dominant, then unaffected
individuals are homozygous recessive. Two recessive
individuals CANNOT produce a dominant offspring.) A. Is this trait dominant or recessive?
B. If the trait is recessive, is it also possible for IV-9 and IV-10 to (Answer: RECESSIVE. If the trait were dominant, then
have an unaffected offspring? individuals I-3 and I-4 are both homozygous recessive, which
(Answer: YES. This can happen if both parents are means they CANNOT have a dominant offspring.)
heterozygous for the trait, which means they can each B. What are the most probable genotypes of I-3 and I-4?
give a recessive allele to produce a homozygous (Answer: Dd and Dd in order for each parent to be able to
recessive offspring.)
contribute a recessive allele to give rise to a recessive
C. Based on your answers for a) and b), is the trait dominant or
offspring.)
recessive?
(Answer: RECESSIVE) C. What are the most probable genotypes of II-4 and II-5?
D. Give the genotypes of the following: (Answer: Dd and Dd. Same reason as b.)
i. IV-9 (Answer: Dd) D. What is the probability that II-4 and II-5 will have another normal
ii. IV-10 (Answer: Dd) offspring?
iii. V-1 (Answer: DD or Dd) (Answer: 75%. A hybrid cross will produce 75% dominant
iv. I-1 (Answer: dd) offspring and 25% recessive offspring.)
v. I-2 (Answer: Dd)
E. If IV-9 and IV-10 were to have another child, what is the
probability that they will have an affected offspring?
(Answer: 1/4 or 25% following the Mendelian ratio from a
hybrid cross)
A. Is the trait dominant or recessive? A. Is the trait dominant or recessive?
(Answer: DOMINANT. If the trait were recessive, then (Answer: DOMINANT. If the trait were recessive, then
individuals I-1 and I-2 are homozygous recessive, and individuals I-3 and I-4 must be homozygous recessive, and
they CANNOT produce a dominant affected offspring.) they CANNOT produce a dominant offspring.)
B. What are the genotypes of I-1 and I-2?
B. What are the most probable genotypes of I-2 and I-3?
(Answer: dd and dd. Since the trait is dominant, it follows that
(Answer: Dd and Dd. Each parent must be heterozygous unaffected individuals are homozygous recessive.)
in order to give a recessive allele to produce a recessive C. What is the probability that I-1 and I-2 will have an affected
unaffected offspring.) offspring?
C. What is the probability that II-2 is Dd? (Answer: 0. Homozygous recessive individuals CANNOT
(Answer: 1 or 100%. II-2, together with the homozygous produce an offspring with a dominant trait.)
recessive II-1, was able to produce homozygous D. What are the genotypes of I-3 and I-4?
recessive unaffected offspring. This can only happen if (Answer: Dd and Dd. Each parent must have a recessive allele
II-2 also possesses a recessive allele, which means s/he is in order to produce a homozygous recessive offspring.)
a heterozygote.) E. What is the probability that II-6 is Dd?
D. What is the probability that II-1 and II-2 will have another (Answer: 2/3. II-6s parents are both heterozygotes. Following
normal offspring? the Mendelian cross of Dd x Dd, the probabilities of
occurrence of phenotypes in this cross are 25% (1/4) DD, 50%
(Answer: 1/2 or 50%. Following the Mendelian cross of
(2/4) Dd, and 25% (1/4) dd, giving a ratio of 1:2:1. Since II-6 is
dd x Dd, there is a 50% probability of producing a
already affected, then his phenotype is dominant. Therefore,
homozygous recessive unaffected offspring.)
the probability of II-6 being affected is 0. So instead of a ratio
of 1:2:1, the ratio to be considered should now be just 1:2
(DD:Dd). The probability of II-6 being Dd should now be 2/3.)
6
ENRICHMENT
1. As a homework, assign each learner to construct a pedigree of an authentic family using any of the following traits:
I. With (dominant) or without finger hair (recessive)
II. Normal (dominant) or hitchhikers thumb (recessive)
III. Widows peak (dominant) or straight hairline (recessive)
IV. Free (dominant) or attached earlobe (recessive)
V. Curly (dominant), wavy (heterozygous) or straight (recessive) hair
2. B. Where possible, determine the genotypes of every individual in the family
CROSS EXPECTED GENOTYPE(S) EXPECTED PHENOTYPE(S)

1. DD x DD 100% DD 100% dominant
2. DD x Dd 50% DD: 50% Dd 100% dominant
3. DD x dd 100% Dd 100% dominant
4. Dd x Dd 25% DD: 50% Dd: 25% dd 75% dominant: 25% recessive
5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive

Lesson 2: Sex Linkage and

Recombination
Content Standard
LESSON OUTLINE
The learners understand inheritance of Sex Linked characters
Introduction Communicating Learning Objectives and 5
Performance Standard
The learners shall be able to Relevant Vocabulary
make a a research paper/case study/poster on transmission of a sex-linked Motivation Case Study 10

genetic disease
Instruction Discussion of Sex-Linked Traits 25
Learning Competency
The learners shall be able to explain sex related inheritance and Practice Group Work 20
recombination; illustrate the transmission of sex-linked characters; and
Enrichment Narrative
distinguish sex-linked traits from other sex-related traits (STEM_BIO11/12-IIIa-
b-2) Materials
Specific Learning Outcomes Pen, paper, and ruler
At the end of the lesson, the learners will be able to: Resources
illustrate the transmission of an X-linked and a Y-linked character; (1) Klug, W. S., M. R. Cummings, C. A. Spencer and M.A.
compute the probability of the occurrence of a sex-linked trait; and Palladino. 2012. Essentials of Genetics. 8th ed. Benjamin
Cummings.
give examples of other sex-related traits.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A.,
Minorsky, P.V., and Jackson, R.B. 2012. Campbell Biology,
(9th ed). The Benjamin Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructors guide for Biology, 5th ed.
By Campbell, Reece, Mitchell. Addison Wesley Longman,
Inc.
8
INTRODUCTION (5 MINS) Teacher tip:
Ask the learners to review the topic on
Communicating Learning Objectives recombination in Meiosis that they took up in BIO 1.
1. Cite the learning objectives, which are as follows: Recombination or shuffling of genes/ alleles in
Meiosis results to variation in the genome of
I. illustrate the transmission of an X-linked and a Y-linked character gametes, the sperm cells and egg cells.
II. compute the probability of the occurrence of a sex-linked trait
In any cell of the body (somatic), there are
III. give examples of other sex-related traits chromosome pairs. In humans, pair numbers 1-22 are
the autosomes or body chromosomes while the last
Relevant Vocabulary
(23rd) pair is the sex chromosome.
2. State the relevant vocabulary:
I. Sex linked trait. The gene (pair) that determines a character (e.g. hemophilia) is located Normal human females have two X chromosomes
and normal human males have one X chromosome
on the sex chromosomes
and a Y chromosome; that is:
II. X-linked trait. A sex-linked trait is where the gene or allele for the trait is found on the X XX- female
chromosome XY- male
III. Color blindness. An X-linked recessive trait where a affected individual could not
distinguish red from green color (red green color blindness)
IV. Hemophilia. An X-linked recessive trait where an affected individual suffers from delayed
blood clotting during injuries because of the absence of certain blood clotting factors
V. Y-linked trait. A sex-linked trait where the gene or allele for the trait is found on the Y
chromosome
VI. Hypertrichosis pinnae auris. A Y-linked trait where affected males have hair growing from
their external ears
VII. Other sex-related traits.
A. Sex-influenced trait- Any trait in a diploid organism whose expression is affected by
an individuals biological sex; a trait that occurs at a higher frequency in one sex over
the other
B. Sex-limited trait- Any trait in a diploid organism whose expression is limited to just
one biological sex
C.
MOTIVATION (10 MINS)
Case Study
Present these three cases using pictures:
A picture of a color blindness test chart A picture of a family with male members A picture or description of a woman
Ask the learners if they could see a figure in who are bald breastfeeding a baby
the picture and ask the class to recite aloud Ask the learners if baldness occurs more in Ask the learners who among the men and
the figure/ number. men or women. women are able to lactate or breastfeed their
young.
Use a high resolution figure (photograph or image projected on a Be careful in conducting this test to discourage teasing of actual
computer or LCD) to ensure the accuracy of the color blindness test. colorblind learners. Emphasize that colorblind individuals are
Those that could see the figure are normal; those that cannot are normal except that they could not distinguish between red and
colorblind. In most cases, the colorblind males outnumber the green colors.
colorblind females, which are rare. If there are no colorblind
individuals in the class, the teacher will just have to mention as a
Misconception: Common misconception is that baldness occurs
matter of fact that colorblind females are rare.
only in males. Emphasize that baldness does happen in women,
although the frequency is much lower and is therefore rare.
10
Sex-linked traits
Give the definition of an X-linked trait Hypertrichosis pinnae auris as an example of a Y-linked trait
Explain why X-linked traits may occur more frequently in one If a male has the allele responsible for the trait, then his Y
sex over the other chromosome will possess that allele. Since he will pass on his
In humans, males and females are represented by different Y chromosome to his sons, then all his sons will inherit the
sex chromosomes trait, and they, in turn, can pass on the allele to their sons.
Females have two X chromosomes in the nucleus of their
cells. 3. Describe other sex-related traits
Males have one X chromosome and one Y chromosome in Sex-influenced trait
the nucleus of their cells. Give the definition
Depending on whether the trait is dominant or recessive, the Explain why traits may be expressed differently between
expression pattern of the trait differs in males and females sexes
Colorblindness in humans as an example of sex-linked trait Hormonal or physiological differences between the sexes
The alleles responsible for colorblindness is found on the X cause differences of expression of certain genes
chromosome only Baldness in humans as an example of a sex-influenced
The dominant allele is the normal allele; the recessive allele trait. See Table 1 how baldness is hypothesized to be
causes colorblindness expressed by a single pair of alleles, with B as the
Females need two copies of the recessive allele, one from dominant allele for baldness and b as the recessive
each of the two X chromosomes, for the trait to be normal allele.
manifested. If they only have one copy of the recessive Sex-limited traits
allele, they have normal color vision. However, they are Give the definition
carriers for the trait in that they may pass it on to their Explain why traits may be limited to one sex only
offspring. Hormonal or physiological differences between sexes
Males only need one recessive allele in their sole X may limit the expression of some genes to one biological
chromosome for the trait to be expressed. sex only
Explain what happens to the expression patterns if the trait Functional mammary glands as an example of a sex-
is X-linked and dominant. limited trait. Only females can express functional
Use Table 2 as guide. mammary glands that produce milk immediately after
Give the definition of a Y-linked trait giving birth.
Explain why there is difference in expression between males Note that baldness behaves like a dominant trait in
and females for Y-linked traits. (Since the allele is found only males in that only one dominant allele is needed for
in the Y chromosome, and since only males have Y- baldness to be expressed. On the other hand, the trait
chromosomes, then only males will express the trait. behaves like a recessive trait in women in that they need
Females CANNOT express Y-linked traits.) both dominant alleles to be present for baldness to be
expressed.
PRACTICE (20 MINS)
1. Divide learners into groups of four.
2. Ask each group to answer a set of questions related to sex-related traits in humans. See
sample questions.
ENRICHMENT
As a homework, provide this narrative to the class:
The last Emperor of Russia, Nicolas II, was married to Empress Alexandra, and they had five Teacher tip:
Hemophilia is an X-linked recessive trait. Empress
children, Olga, Tatiana, Maria, Anastasia, and Alexis. Alexis was the only one who was afflicted Alexandra was most likely a carrier of the trait (XCX).
with hemophilia or the royal bleeding disease; all other members were normal. She was a descendant of Queen Victoria of the
Research on this medical condition and determine the mode of inheritance. United Kingdom, who herself was a probable carrier.
The Emperor was completely unaffected and
If only Prince Alexis was afflicted with the disease, determine his genotype. therefore had an XY genotype. Based on the
What could be the genotypes of the Emperor and Empress? genotypes of the parents, Alexis had an XCY
genotype, with the defective X chromosome carrying
Is it possible that each daughter could have been a carrier? the allele for hemophilia coming from his mother.
Each daughter, in turn, had a 50% probability of
being a carrier, but they could NEVER have been
affected.
12
Lesson 3: Modification to Mendels Classic

Ratios
LESSON OUTLINE
Content Standard Introduction Communicating Learning Objectives and 5
The learners understand Non-Mendelian Modes of Inheritance Relevant Vocabulary
Performance Standard Motivation Narrative 5
The learners shall be able to
make a research paper/case study/poster on a non-Mendelian genetic trait Instruction Recall in Mendelian Ratios, Discussion 40
on Co-Dominance and Multiple Alleles
Learning Competency
The learners shall be able to describe some modifications to Mendels classic Practice Group Work: Non-Mendelian Traits in 40
ratios (gene interactions) (STEM_BIO11/12-IIIa-b-3) Humans, Plants, and Animals
Specific Learning Outcomes Materials

At the end of the lesson, the learners will be able to: Pen and Paper
distinguish Mendelian from non-Mendelian modes of inheritance; and Resources

(1) Klug, W.S., Cummings, M.R., Spencer, C.A. and Palladino, M.A.. 2012.
describe some cases of non-Mendelian genetic traits Essentials of Genetics. 8th ed. Benjamin Cummings.
(2) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin
Cummings Publishing Co., Inc.
(3) Sheridan, M. 1999. Instructors guide for Biology, 5th ed. By Campbell,
Reece, Mitchell. Addison Wesley Longman, Inc.
INTRODUCTION (5 MINS) MOTIVATION (5 MINS)
Communicating Learning Objectives Narrative
1. Cite the major learning objectives, which are as follows: 1. Provide this narrative to the class:
I. distinguish Mendelian from non-Mendelian modes of 2. A local hospital has sent word to a family of a possible mix up of
inheritance some of the children with other families when they were born.
II. describe some cases of non-Mendelian genetic traits To rule out any possible mix up, the hospital obtained the blood
types of every individual in the family, including the surviving
maternal grandfather and paternal grandmother. The results
Relevant Vocabulary were as follows:
2. Present the following relevant vocabulary:
Father: Type O
I. Co-dominance - When two contrasting alleles are present in Mother: Type A
the same locus or trait (heterozygote genotype), then the 1st child: Type O
phenotype expressed is a blend of the two extreme 2nd child: Type A
phenotypes. The two genes interact and the offspring shows 3rd child: Type B
the effects of both alleles. Maternal grandfather: Type AB
Paternal grandmother: Type B
II. Incomplete dominance - When two contrasting alleles are
present in the same locus or trait (heterozygote genotype), 3. Based on the results, is there a possibility that any one of the
then both alleles are expressed in the same phenotype children is not a biological offspring of the couple? To answer
this question, we must first understand how blood types, a non-
Mendelian trait is inherited.
III. Multiple alleles - When there are more than two types of
alleles for a given locus or trait, this will result in more than
two kinds of phenotypes that may be expressed for that
trait.
14
INSTRUCTION (40 MINS) Teacher Tip:
Review the Mendelian ratios and ensure that the
Recall in Mendelian Ratios, Discussion on Co-Dominance and Multiple Alleles learners are familiar with them before they could
1. Let the learners recall the Mendelian Ratios in STEM_BIO11/12-IIIa-b-1 proceed with the lesson.
2. Discuss incomplete dominance. Define the trait. The heterozygote genotype is expressed as a
distinct phenotype (a blend of the two extreme phenotypes). In this case, the phenotypic
ratio is the same as the genotypic ratio
I. Use snapdragon plants (Antirrhinum majus) as example (see figure 1).
A. RR red flowers
B. Rr pink flowers
C. rr white flowers
Emphasize that incomplete dominance and co-
3. Discuss co-dominance. Define the trait. The heterozygote genotype is expressed as a distinct
dominance are similar in that their phenotypic
phenotype (both extreme phenotypes are expressed at the same time). Similar to incomplete ratios follow their genotypic ratios. However, they
dominance, the phenotypic ratio is the same as the genotypic ratio. differ in the expression of the heterozygote
condition: in co-dominance, the heterozygote
I. Use human MN blood typing as an example
expresses both extreme phenotypes; in
A. MM type M incomplete dominance, the heterozygote is
expressed as a blend of the two extreme
B. MN type MN
phenotypes.
C. NN type N
4. Discuss multiple alleles. Define the trait. There are more than two types of alleles, and the
relationship of each allele with respect to others will determine the number of phenotypes
that may be expressed.
I. Use coat color in rabbits as example (see figure 2)
A. There are four different types of alleles in rabbits: C (Agouti), Cch (Chinchilla), Ch
(Himalayan), and c (Albino), with the following dominance hierarchy: C> Cch>Ch> c.
B. The following genotypes will have the corresponding phenotypes in coat color:
i. CC Agouti
ii. CCch Agouti
iii. CCh Agouti
iv. Cc Agouti
v. CchCch Chinchilla
vi. CchCh Chinchilla Teacher Tip:
vii. Cchc Chinchilla Note that in the ABO system, the O allele is
recessive to both A and B alleles while the A and B
viii. ChCh Himalayan alleles are co-dominants of one another.
ix. Chc Himalayan
x. Cc Albino
C. Use ABO blood typing in humans as example

i. There are three different types of alleles A (or IA), B (or IB) and O (or i)
ii. The following genotypes will have the following blood types (phenotypes):
iii. AA (or IAIA) Type A
iv. AO (or IAi) Type A
v. BB (or IBIB) Type B
vi. BO (or IBi) Type B
vii. AB (IAIB) Type AB
viii. OO (ii) Type O
5. Go back to the Motivation narrative

Blood types O and AB can only have OO and AB
I. The class will now answer the question/narrative provided during the Motivation part. The genotypes, respectively.
teacher will ask first the most probable genotypes of all the members of the family as The mother must be AO in order to have an
follows: offspring that is either A or O.
The paternal grandmother must be BO in order to
i. Father: Type O - OO have an offspring (father) who is blood type O.
ii. Mother: Type A - AO The 3rd child could have been the result of a mix
up because the B allele is not present in either
iii. 1st child: Type O - OO parent.
iv. 2nd child: Type A - AO
v. 3rd child: Type B B? Misconception
Emphasize that blood typing could only be used to
vi. Maternal grandfather: Type AB - AB
exclude/disprove biological parentage, not to
vii. Paternal grandmother: Type B BO prove it.
viii. Possible mix-up? Yes, 3rd child.
16
PRACTICE (40 MINS)
1. Divide learners into groups of four. C. Two wavy plants will produce what possible kinds of
2. Ask each group to answer a set of questions related to non- offspring? Give their ratios? (ANSWER: 25% serrated:
Mendelian modes of inheritance. See sample questions. 50% wavy: 25% smooth; this is a hybrid cross, which will
give a 1:2:1 ratio)
1. In cattle, coat color is inherited in a co-dominant fashion.

3. In guinea pigs, coat color is governed by four alleles that
Homozygous B1B1 produces black coat, homozygous B2B2
constitute a multiple allelic series, C (black), cS (sepia), cC
produces white coat, and the heterozygous B1B2 produces
(cream), and c (albino) with the following dominance
roan coat. Give the phenotypic ratio of the offspring of the
hierarchy: C>cS>cC>c. Determine the phenotypic ratios of
following crosses:
the progeny from the following crosses:
A. B1B1 x B1B1 (ANSWER: all black)
A. Cc x CcS (ANSWER: 75% black: 25% sepia; the
B. B1B1 x B2B2 (ANSWER: all roan) genotypes and their probabilities of occurrence are: 25%
C. B1B2 x B1B2 (ANSWER: 25% Black: 50% Roan: 25% CC, 25% CcS, 25% Cc, and 25% cSc, giving a phenotypic
White) ratio of 75% black and 25% sepia)
D. B1B1 x B1B2 (ANSWER: 50% Black: 50% Roan) B. CcS x cCc (ANSWER: 50% black: 50% sepia; the
E. B1B2 x B2B2 (ANSWER: 50% Roan: 50% White) genotypes and their probabilities of occurrence are 25%
CcC, 25% Cc, 25% cScC, 25% cSc, giving a phenotypic
ratio of 50% black and 50% sepia)
2. In a hypothetical plant, a serrated leaf margined plant, when
crossed with a smooth leaf margined plant, produces
offsprings with wavy leaf margin. 4. A man who is blood type B is married to a woman who is
blood type A. None of the mans parents is blood type O.
A. Identify the mode of inheritance. (ANSWER: Incomplete
This couple has 4 children with the following blood types: B,
dominance)
AB, AB and O. Give the genotypes of the parents.
B. Two serrated plants, when crossed, will give what type of (ANSWER: Man: BO; Woman: AO; Both parents must have
offspring? (ANSWER: Serrated plants; the trait is an O allele in order to produce and offspring with blood
homozygous, therefore producing offspring with the type O with genotype OO)
same phenotype as the parents)
Incomplete dominance in snapdragons, Antirrhinum majus. The
cross involving homozygote red flowers (RR) and homozygote white
flowers (rr) will yield a heterozygote (Rr) that expresses a different
phenotype, which is pink flowers. The cross between pink-flowered
Coat color in rabbits. The trait is controlled b multiple alleles with
individuals will produce offsprings where the genotypic ratio also
the following dominance hierarchy: C (Agouti) > Cch (Chinchilla) >
becomes the phenotypic ratio (25% red: 50% pink: 25% white).
Ch (Himalayan) > c (Albino).
(Wikipedia)
18
Lesson 4: Molecular Structure of DNA,

RNA, and Proteins
Content Standard LESSON OUTLINE
The learners understand Structures and Functions of DNA, RNA and proteins
Introduction Communicating Learning Objectives 5
The learners shall be able to Motivation Group Work 5
build models of DNA, RNA and proteins
Instruction Discussion on the Molecular Structures 30
Learning Competency of DNA, RNA, and Proteins
The learners shall explain how the structures of DNA, RNA and proteins are
related to their functions (STEM_BIO11/12- IIIa-b-4) Practice Building Models of DNA 5
Enrichment Conversion to mRNA Transcripts 5

Specific Learning Outcomes
Evaluation Identification of Biomolecule 10
At the end of the lesson, the learners will be able to:
Represented by Given Chain Structures
describe the building blocks of DNA, RNA and proteins;
identify the structural and functional differences between DNA and RNA Materials
Recyclable materials for model construction; freely
and
downloadable molecular modeling software.
explain the different levels of protein structure
Resources
Biochemistry textbooks; SwissPDB Viewer software (free
download); Protein Data Bank (www.pdb.org)
INTRODUCTION (5 MINS) Teacher Tip:
One dimensional and two dimensional models of
Communicating Learning Objectives
DNA should be presented to the class.
1. The learning outcomes will be presented as follows:
I. describe building blocks of DNA, RNA and Proteins.
II. identify the structural and functional differences between DNA and RNA.
III. discuss the different levels of protein structure (primary, secondary, tertiary and quaternary)
IV. 4.explain how protein structural features may influence their functions
2. Ask learners if they have heard of the term genes. Ask them what genes have they
inherited from their parents.
Sample answers: genes for dimples, straight hair, etc.
MOTIVATION (5 MINS) Teacher Tip:

Expected Answers:
1. Divide the class into groups of learners. Allow each group to enumerate the most important
DNA: repository of genetic information
functions of DNA and proteins that they can recall from their previous grade levels. RNA: transcripts; link between the gene and the
2. Consolidate these answers on the board. gene product (protein)
Protein: functional products; executors of cellular
functions

1. The building blocks of any nucleic acid are the nucleotides.
2. A nucleotide is composed of a phosphate group (with negative charges), a sugar portion and
an N-base.
3. The sugar in DNA is deoxyribose while the sugar in RNA is ribose. Explain the difference
through a visual aid.
4. DNA and RNA are polynucleotides. N-bases are either purines or pyrimidines. Purine bases
are Adenine (A) and Guanine (G). Pyrimidines are Cytosine (C), Thymine (T, in DNA only) and
Uracil (U, found only in RNA)
5. Specific base pairings occur in DNA. A pairs with T; G pairs with C
6. DNA is double stranded while RNA is single stranded with Uracil instead of Thymine.
20
7. Main Functions: Teacher Tip:
I. DNA: repository of genetic information; sequence of bases encodes the blueprint for life If computers and internet facilities are available,
processes structures for these biomolecules are available as
molecular structure files (*.pdb) from the Protein
II. RNA: information in the form of base sequence is transformed (transcribed) into mRNA, Data Bank (www.pdb.org).Focus on the important
tRNA and rRNA. DNA is the template copied into RNA by base pairing. G with C; A with parts of the structure that provide the necessary
U. physical properties of DNA, RNA and proteins.
III. Protein: functional products of genes; executes cellular functions
Discuss the importance of these physical features
8. The four structural levels of proteins are: 1.Primary- sequence of amino acids in the for the functions of DNA, RNA and proteins.
polypeptide chain; 2. Secondary- when the polypeptide chains form a helix or a pleated sheet
structure; 3. Tertiary- coiling of the polypeptide, combining helices and sheet forms; 4.
Quaternary- the association of two or more polypeptides in space
Summary of Important Physical Properties
BIOMOLECULE Physical Property Functional Relevance Emphasize that the DNA has negative charges on
the outside due to the phosphate groups. Other
DNA Complementary Base Pairs Allows each strand to serve as a template stabilizing factors in the DNA should be
for replication and transcription mentioned.
Phosphodiester bonds Essential for polynucleotide chain

elongation
RNA Single stranded but some bases For stability

can be complementary; hence,
some portions may be double
stranded
Uracil Nitrogenous base found only in RNA.

Note:
PROTEIN Amino (N)Terminus Start of the polypeptide chain
For each classification of amino acid,give the
names of each amino acid. Give the one letter
Amino (N)Terminus End of the polypeptide chain symbol for each amino acid. The three letter code
for each amino acid may also be provided.
Peptide Bond Links amino acids together
One letter symbol for each Classes:

amino acid a. non-polar- aliphatic or aromatic
b. polar, uncharged
c. polar, charged- acidic and basic
PRACTICE (5 MINS)
Given the following coding sequence for DNA, provide the sequence of the complementary
Teacher Tip:
(template) sequence. Be sure to note the antiparallel orientation of the
Coding sequence : 5 ATGCATAGATTAGGATATCCCAGATAG 3 coding and non-coding strands of DNA. Explain
the relative positions of the 5 and 3 ends.
(Answer)
Complementary sequence 3 TACGTATCTAATCCTATAGGGTCTATC 5
Ask the learners to build models of DNA by using recyclable materials such as popsicle sticks or
pieces of colored papers to represent the complementary bases: G with C; A with T. The DNA
backbone (phosphate, sugar) should be included.
ENRICHMENT (5 MINS)
1. Convert the given coding sequence into an mRNA transcript: Teacher Tip:
The mRNA transcript has almost the same
Complementary Non-coding/ Template sequence 3 TACGTATCTAATCCTATAGGGTCTATC 5 sequence as the coding sequence (DNA), but the
(Answer) thymines are replaced to Uracil.
Coding sequence ~ mRNA transcript 5 AUGCAUAGAUUAGGAUAUCCCAGAUAG 3 Show the learners how to read the codon Table
Teach the learners the single letter codes for the

2. Translate the given mRNA transcript into a polypeptide sequence: amino acids (e.g. ryptophan ! Trp ! W).
Ask the learners to spell their names using the

Coding sequence ~ mRNA transcript 5 AUGCAUAGAUUAGGAUAUCCCAGAUAG 3 amino acid codes (e.g. N-E-I-L ! Asn Glu Ile
(Answer) Lue).
Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
22
EVALUATION (10 MINS) Teacher Tip:
Ask learners to identify the type of biomolecule represented by a given chain structure: To help learners practice the generation of
complementary sequences, worksheets with
1. DNA- partially completed sequences may be used.
2. RNA-
3. Protein-
Example
Template sequence
3 TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5
5 _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3
Learners may be asked to identify the important structural features in these chain structures
(features are listed in the instruction/ delivery table). A similar exercise of generating non-coding
sequences (DNA), transcripts (RNA) and translated polypeptides may be done to test the learners
understanding of the topic.
Lesson 5: DNA Replication and Protein

Synthesis
LESSON OUTLINE
Content Standard Introduction Communicating Learning Objectives and 5
The learners understand Central Dogma of Molecular Biology.
Review
Motivation Inquiry 5
identify requirements, enzymes and products in DNA Replication, Instruction Discussion on DNA Replication or DNA 20
transcription, and protein synthesis. Synthesis
Learning Competency Practice Matching Type Game 10
The learners should be able to diagram the steps in DNA replication,
transcription, and protein synthesis (STEM_BIO11/12- IIIa-b-5) Evaluation Take-home Activity 5
Materials
Specific Learning Outcomes Paper, coloured pens
At the end of the lesson, the learners will be able to: Resources
describe the requirements, proteins and enzymes in DNA replication; (1) Reece, J.B., Urry, L.A., Cain, M.L., Wasserman, S.A., Minorsky, P.V., and
Jackson, R.B. 2012. Campbell Biology, (9th ed). The Benjamin
transcription and translation; and Cummings Publishing Co., Inc.
diagram the steps in replication, transcription and translation.
24
1. The learning objectives will be communicated as follows: To help learners practice the generation of
A. Describe the requirements, proteins and enzymes in DNA replication, transcription and partially completed sequences may be used.
translation
B. Diagram the steps in replication, transcription and translation.
C. Explain what happens to a gene sequence that undergoes transcription and eventual
translation into protein
2. Ask the learners to recall the significance of Mitosis.

Mitosis is an equational cell division that produces daughter cells which are identical or clones
of the original, mother cell. This ensures that every cell of the body has the same genetic
content, i.e. chromosome number. To make this possible, cells have to duplicate their genetic
material which is primarily DNA.
MOTIVATION (5 MINS)
1. Ask learners to imagine how many cells a typical mature human contains. Tell them that they
all came from just one fertilized egg cell. A zygote goes through millions of generations of cell
divisions to become just the one person that a learner is. Even until now, cells in an individual
are still dividing. Ask learners what examples of tissues in their body are undergoing cell
division. (sample answers: skin; blood cells)
2. Also, ask learners to recall that in the previous topics on genetics, the phenotype is the
outside, visible characteristic of an organism. Any phenotype (eg. red flower) is directly
determined by proteins or enzymes functioning in a metabolic pathway. Proteins are made by
turning on specific portions of DNA that are called genes. Particular sequences of DNA are
transcribed to become RNAs. These are then used to produce proteins in a process called
translation.
1. DNA replication or DNA synthesis. DNA strands separate and serve as templates for the To help learners practice the generation of
production of new DNA molecules.
partially completed sequences may be used.
A. The following are features of replication:
i. Semiconservative- the resulting DNA consists of one old and one new strand
ii. Base pairing is maintained; Adenine pairs with Thymine, Guanine pairs with Cytosine
iii. New DNA molecules are produced in the 5 to 3 direction
iv. Semidiscontinuous. The leading strand is synthesized in a continuous manner (5 to 3)
while the lagging strand is produced discontinuously in short stretches called Okazaki
fragments.
B. In lagging strand synthesis, there is a need for a primer terminus which is provided by an
RNA molecule. RNA is synthesized by a primase or RNA polymerase. The 3OH of the
RNA is where new DNA nucleotides are added thus new DNA is built in the 5 to 3
direction.
C. Enzymes in replication are as follows: 1. helicase; 2. gyrase; 3. SSB (single strand binding
proteins); 4. primase or RNA polymerase; 4. DNA polymerase and 5. DNA ligase.
26
2. Transcription or RNA synthesis. DNA is unwound and one strand is used as template for the Teacher Tip:
production of an RNA molecule. An RNA polymerase makes RNA in the 5 to 3 direction. To help learners practice the generation of
Specific regions in the DNA called promoters allow the binding of transcription factors which complementary sequences, worksheets with
partially completed sequences may be used.
make possible the binding of RNA polymerase. Three major types of RNA are: messenger
RNA (mRNA); transfer RNA (tRNA) and ribosomal RNA (rRNA).
3. Translation or protein synthesis. This occurs in the ribosome. Basic ingredients are the
various types of RNAs produced in transcription and some proteins or enzymes. The mRNA
contains triplets of bases called codons that specify an amino acid, eg. UUU-phe. Various
tRNAs carry amino acids from the cytoplasm to the actual site of translation in the ribosome. A
tRNA has an anticodon that pair with a codon in the mRNA. Different rRNAs combine with
ribosomal proteins to make up the subunits of a ribosome. A functional ribosome has a small
and a large subunit.
In bacteria, transcription and translation may be simultaneous. In eukaryotic cells, mRNA,

tRNA and rRNA travel from the nucleus to the cytoplasm through the nuclear pores. RNAs
may undergo processing. Some unnecessary parts like introns are removed. In eukaryotic
mRNA, a 5 cap and a 3 poly A tail are added. Coding regions of mRNA are called exons.
They specify functional protein products.
In the elongation
process of translation,
amino acids are linked
by peptide bond
formation due to the
action of peptidyl
transferase known to
be a part of the
ribosome subunit. The
process is summarized
in the diagram above.
To initiate translation, the small and the big subunits of the ribosome have
to be separated. Initiation factors (IF) make this possible. They also prevent
the premature reassociation of these subunits. The small subunit of the
ribosome binds the mRNA and allows the entrance of a tRNA to the P site
bearing the first amino acid. The big subunit then binds and together they
form an assembly ready for the next amino acid in the A site of the
ribosome.
A stop codon signals the

end of translation. No
amino acid corresponds
to a stop codon. Release
factors halt the process
and the polypeptide is
released.
The genetic code is the correspondence of the mRNA codons to

amino acids. An amino acid is specified by a codon with three
code letters. The genetic code is shown as above.
28
The genetic code is the correspondence of the mRNA codons to amino acids. An amino acid is Teacher Tip:
specified by a codon with three code letters. The genetic code is shown as follows: Use flash cards. Organize learners into groups and
ask them to compete.
Point out the effect of the loss of the

following:
PRACTICE (5 MINS)
1. Matching Type Game: For each protein or enzyme or structure mentioned above, identify ENZYME EFFECT OF LOSS
whether such is involved in replication, transcription or translation. DNA Polymerase No replication
2. Explain why both DNA replication and RNA transcription are disrupted by the loss of RNA
Helicases Decreased DNA replication
polymerase. efficiency
Peptidyl No peptide bond formation

EVALUATION (5 MINS) transferase
1. As an assignment, ask the learners to make their own diagram of the steps involved in DNA
RNA Polymerase No replication
replication, transcription and translation or protein synthesis. (Note: The learners may choose a
No transcription
variety of medium for presenting the steps of the processes.)
Ribosomes No translation
Lesson 6: Genetic Engineering

Content Standard
The learners outline the steps in Recombinant DNA. LESSON OUTLINE
Performance Standard Introduction Communicating Learning Objectives and 5
The learners shall be able to Review
explain how genes may be modified and/or inserted in host cells/
Motivation Desirable Traits 5
organisms.
Learning Competency Instruction Genetic Engineering 35

The learners should be able to outline the steps involved in genetic Practice Recitation 5
engineering (STEM_BIO11/12-III a-b-6)
Enrichment Poster Making 5
Specific Learning Outcomes Evaluation Assignment 5

compare classical breeding with modern genetic engineering techniques; Materials
Recyclable materials for paper models of plasmids; scissors; tape; pens of
enumerate the steps in molecular cloning; various colors
describe some methods to introduce DNA into cells; and Resources
explain the selection and screening of transformants / genetically modified Biochemistry textbooks; online videos on genetic engineering
organisms (GMOs) and GMOs
30
INTRODUCTION (5 MINS)
Communicating Learning Objectives and Review Teacher Tip:
1. The learning outcomes will be presented and the overall idea on how organisms may be Make a quick review of the previous lesson on
DNA replication and protein synthesis.
modified will be discussed.
2. In order to survive, man has successfully domesticated selected plants and animals. He has
taken an active part in choosing desired traits of plants and animals. Traits that were
considered valuable (i.e. high fruit yield; high milk production, etc.) were sought out and
propagated. The processes involved may include classical breeding practices such as
controlled pollination of plants, and the mating of animals with desired traits. In todays
modern science, molecular biology techniques are being employed in the insertion and
expression of proteins in different organisms for various purposes.
MOTIVATION (5 MINS)
Desirable Traits Teacher Tip:
Group the learners into 3s or 4s and allow each
1. Ask for volunteers to enumerate plants and animals that have desirable or enhanced traits.
group to discuss examples of enhanced animals/
2. Ask learners to explain how each of the traits was introduced or developed (i.e. classical plants.
breeding or recombinant DNA technology).
ENHANCED TRAIT MODIFYING TECHNIQUE
Kobe / Wagyu Beef (Beef with good fat Classical breeding

distribution)
Guapple (Large sized guava) Classical breeding
Human Insulin-producing bacteria Recombinant DNA Technology
Flavr-Savr (Delayed-ripening tomatoes) Recombinant DNA Technology
Macapuno trait in coconuts Classical breeding

Pictures of common domesticated plants and
Genetic Engineering
animals may be shown in class.
1. Classical breeding practices focus on the mating of organisms with desirable qualities.
2. Genetic engineering involves the use of molecular techniques to modify the traits of a target High cost of medicine and other agricultural
products may be mentioned.
organism. The modification of traits may involve:
I. introduction of new traits into an organism
II. enhancement of a present trait by increasing the expression of the desired gene
III. enhancement of a present trait by disrupting the inhibition of the desired genes
expression.
3. A general outline of recombinant DNA may be given as follows:
I. cutting or cleavage of DNA by restriction enzymes (REs)
II. selection of an appropriate vector or vehicle which would propagate the recombinant
DNA ( eg. circular plasmid in bacteria with a foreign gene of interest)
III. ligation (join together) of the gene of interest (eg. from animal) with the vector ( cut
bacterial plasmid)
IV. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
V. selection process to screen which cells actually contain the gene of interest
VI. sequencing of the gene to find out the primary structure of the protein
4. After outlining the key steps in recombinant DNA, the teacher can proceed to describe the
ways in which these plasmids may be introduced into host organisms.
Biolistics. In this technique, a gene gun is used to fire DNA-coated pellets on plant tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid coated
pellets and acquire the ability to express the designed protein.

Plasmid insertion by Heat Shock Treatment. Heat Shock Treatment is a process used to
transfer plasmid DNA into bacteria. The target cells are pre-treated before the procedure to
increase the pore sizes of their plasma membranes. This pretreatment (usually with CaCl2) is
said to make the cells competent for accepting the plasmid DNA. After the cells are made
32
competent, they are incubated with the desired plasmid at about 4C for about 30min. The
plasmids concentrate near the cells during this time. Afterwards, a Heat Shock is done on
the plasmid-cell solution by incubating it at 42C for 1 minute then back to 4C for 2 minutes.
The rapid rise and drop of temperature is believed to increase and decrease the pore sizes in
the membrane. The plasmid DNA near the membrane surface are taken into the cells by this
process. The cells that took up the plasmids acquire new traits and are said to be
transformed.
Electroporation. This technique follows a similar methodology as Heat Shock Treatment, but,
the expansion of the membrane pores is done through an electric shock. This method is
commonly used for insertion of genes into mammalian cells.
5. Some methods to screen recombinant cells are as follows:

Selection of plasmid DNA containing cells
A selection marker within the inserted plasmid DNA sequence allows the selection of
transformants. Usually, an antibiotic resistance gene (e.g. AMP ampicillin resistance gene) is
included in the plasmid DNA. This allows only transformed cells to survive in the presence
of the antibiotic (e.g. ampicillin). Plating the plasmid-cell solution on antibiotic-containing
media will select for these transformants and only allow plasmid-containing cells to grow
and propagate into colonies.
Selection of transformed cells with the desired gene

Teacher Tip:
Certain inserted genes within the plasmids provide visible proof of their presence. These Agarose gel electrophoresis (AGE) allows the
include the antibiotic resistance genes that allow for the selection of the transformed cells identification of PCR products and estimation of
their sizes. This is done by running a molecular
within the solution. Some inserted genes also produce colored (e.g. chromogenic proteins) or
weight (MW) ladder alongside the samples. The
fluorescent products (e.g. GFP) that label the colonies/cells with the inserted gene. MW ladder is made up of DNA fragments of
known size (e.g. 100bp, 200bp, 300bp, 500bp,
etc). The size of the PCR product may be
In some cases, the location of the cloning site within the plasmid is in the middle of a gene approximated by the DNA fragment in the MW
(i.e. -galactosidase, lacZ) that generates a (blue) colored product in the presence of a ladder that runs a similar distance.
substrate (i.e. isopropyl -D-1 thiogalactopyranoside, or IPTG). Cells transformed with these
empty plasmids will turn blue in the presence of IPTG. Insertion of a gene in the cloning site
disrupts the sequence of the -galactosidase gene and prevents the generation of the colored
product in the presence of the substrate. Cells transformed with the disrupted -galactosidase
gene will remain white in the presence of IPTG. This blue-white screening protocol is thus
able to screen for cells that were transformed with the desired gene in the cloning site.
PCR detection of plasmid DNA

Alternatively, the presence of the desired gene in the inserted plasmids may be confirmed
using PCR amplification. PCR reactions specific for the desired gene may be done using DNA
from cells. Amplification of the expected product would confirm the presence of the gene
within the samples. PCR reactions specific for plasmid sequences will also confirm/identify the
type of plasmid used for the transformation.
Genetically Modified Organisms (GMOs)

Teacher Tip:
With the ability to insert gene sequences, comes the possibility of providing new traits for Note that antisense RNA strands bind to mRNAs.
these target organisms. This has allowed the development of GMOs. Some of these genetic This prevents their expression into proteins.
modifications promise higher product yield for their targets. These include the Flavr-Savr
Tomato and Bt-Corn.
The Flavr-Savr (Flavor Savor) tomato was the first genetically modified organism that was Note:
licensed for human consumption. The trait modified in this tomato is its ripening process. A Which of the techniques discussed can be used to
gene for an enzyme that causes the degradation of pectin in the cell walls (i.e. detect if GMOs were used in a certain food
product?
polygalacturonase) normally softens the fruit as it ripens. In Flavr Savr tomatoes, an inhibitor
(i.e. antisense RNA) disrupts the expression of this gene, thereby delaying the softening of the Answer: Assuming that the DNA is still intact in the
fruit and extending the time it may be kept in storage and transported to markets. sample, testing for specific marker genes in
expression plasmids can be used to detect the
presence of these engineered plasmids.
Bt-Corn was developed to incorporate the production of a toxin (i.e. Bt-endotoxin) from
Bacillus thuringensis in corn plants. This toxin results in the death of pests that feed on these
plants like the corn borer larvae. The toxin has been shown to be selective for Lepidoptera
larvae and is non-toxic to humans, mammals, fish and birds. The selective toxicity of the toxin
allows its use in foodcrops. The introduction of the toxin is believed to increase crop
production due to decreased losses from pest infestation. The same technology has been
applied in the Philippines for the development of Bt-Eggplant.
34
Despite the proposed benefits of GMOs, some people have raised their concerns regarding
the consumption of these modified foods. While most of the products are tested for safety,
concerns are raised for the possibility of not being able to detect hazards that are present, but
are currently undetectable by todays current technology.
Because of these issues, manufacturers are urged to provide labels that notify consumers of
GMO presence in their products. While GMOs are believed to be safe when licensed by the
food regulatory agencies, it is believed that the consumers must be provided with enough
information to make their own choices regarding their use.
PRACTICE (5 MINS)
Teacher Tip:
Recitation Biolistics may be more suitable for plants due to
1. Ask the learners to differentiate the various technologies for delivering genes into cells. their thick cell walls.
2. Determine which technologies are most appropriate for which cell types.
(Answers: Biolistics for plants; Electroporation for mammalian cells; Heat shock for
bacterial cells)
ENRICHMENT (5 MINS)
Teacher Tip:
Poster Making
This may also be given as an assignment.
1. Learners may be asked to make a poster on the steps and other methods involved in
recombinant DNA.
EVALUATION (5 MINS)
Assignment
1. Give an assignment and allow learners to research on the pros and cons of genetic
engineering.
2. Ask them for their opinion on the matter, and ask them to support these opinions with facts
learned in class. Be sure that issues of biosafety are included in the discussion.
Lesson 7: Discuss the Applications of

Recombinant DNA
Content Standard
The learners demonstrate an understanding of recombinant DNA and LESSON OUTLINE
examples of products from Recombinant DNA Technology.
Performance Standards
The learners shall be able to: Motivation Thought Experiment 5
describe some techniques for the expression of desired traits in target
organisms; and
Instruction Presentation of Recombinant DNA 35
search online databases for specific traits and source organisms. Practice Steps in PCR and Gene Cloning 5
Learning Competency Enrichment User of PCR and GMOs 5

The learners should be able to discuss the applications of Recombinant DNA
Technology (STEM_BIO11/12-III a-b-7) Evaluation Sample Exercise 5
Specific Learning Outcomes: Materials

At the end of the lesson, the learners will be able to: Writing materials, recyclable materials for models of plasmids,
give examples of products from recombinant DNA technology; tape, pens
illustrate the use of databases to search genes for desired traits; Resources
describe steps in PCR to amplify and detect a gene of interest; (1) Genbank, www.ncbi.nlm.nih.gov
identify the parts of an expression vector; (2) Protein Data Bank, www.pdb.org
explain how genes may be cloned and expressed
36
Be sure to stress that for a gene to add a trait to
Communicating Learning Objectives an organism, the gene for the trait must be
1. The learning objectives will be presented and the processes in the Central Dogma of Molecular inserted within the target organism, and the
Biology will be reviewed: organism should have the necessary
equipment (i.e. enzymes, materials ) to
DNA (gene) ! RNA (transcript) ! Protein (trait)
produce the protein that results in the trait or
2. Different organisms have different traits based on their genes (DNA sequences). desired phenotype.
For example, frogs have antimicrobial peptides on their skin. Some jellyfish have proteins that
allow them to glow in the dark. Mutations in hemoglobin genes lead to anemia.
3. Based on the central dogma, if transcription and translation of genes lead to some traits, then
the insertion of certain genes in a given organism may provide it with new traits. This is the basis
for the development of genetically modified organisms (GMOs).
MOTIVATION (5 MINS)
Teacher Tip:
Thought Experiment Discuss the merits of the different proposed
1. The learner may be given a group activity/ thought experiment for constructing a genetically designer genes based on the following
criteria:
modified organism/trait in a fruit. Designer Genes group work
I. Arrange the learners into groups of 3 or 4. 1. Originality of the study (i.e. Has anyone
done studies of this type before?)
II. Have them identify a special trait (e.g. large fruit size)
2. Feasibility of the study (How possible is the
III. Have them identify a source organism (e.g. jackfruit / langka) proposed modification? Can the target
organism support the proposed trait? )
IV. Have them identify a target organism (e.g. aratilis)
3. Potential Applications of the new organism
V. Have them identify the modified / added trait (e.g. langka-sized aratilis). (What benefits would the recombinant
organism provide to society?)
VI. Have the learners present their work to the rest of the class, and let the class decide on the
best proposal. Some examples: Flood-resistant rice Delayed-
ripening fruits
Teacher Tip:
Presentation of Recombinant DNA
Ask the learners on the significance of finding
1. After the exercise, the learners should now be aware that there are many different traits that can many versus few entries on a given topic in the
be introduced to organisms to change their properties. The following table shows examples of database.
modified traits using cloned genes and their applications:
GENE RECIPIENT APPLICATION FEW entries MANY

MODIFIED TRAIT in the entries in the
MODIFICATION ORGANISM (FIELD)
database database
Insulin Production Insertion of Human Bacteria (Medicine)
Insulin Gene Topic has not Topic is much
Production of Human
been studied
Insulin in Bacteria
extensively
studied
Much
Pest Resistance Insertion of Bt-toxin Corn / Maize (Agriculture) PROS information is
gene Production of corn High chance available on
plants with increased to discover the topic
resistance to corn novel traits /
boxer applications
CONS Low number Difficult to

of research to discover new
Delayed Ripening Disruption of a gene Tomato plant Agriculture)
verify the information
for a ripening enzyme Production of plants
observations on the topic
(e.g. with fruits that have
polygalacturonase) delayed ripening
fruits. These fruits will
survive longer
transport time,
allowing their delivery
to further locations
(i.e. export deliveries)
38

Chymosin Production Insertion of a gene for Bacteria (Industry)
chymosin Enhance large scale

production of
chymosin. This enzyme
serves as a substitute
for rennet in the
coagulation of milk.
Rennet has to be
harvested from calves.
The large scale
production of this
enzyme in bacteria
provides an abundant
supply of this
important component
for the cheese
production industry.
Web based research:

Search for these different traits and how they may be made useful. This involves the collection of gene sequences in accessible locations, such
as databases (e.g. Genbank (www.ncbi.nlm.nih.gov) ; Protein Data Bank (www.pdb.org)). These databases serve like libraries that may be
consulted when trying to find specific traits that belong to different organisms.
For example, one would want to find out if any work has been done on spider silks. The databases (e.g. Genbank:Nucleotide database) may be
searched for entries that contain information on Spiders, and Silk (Result: 93615 entries). The results may be screened for more specific
studies (e.g. Malaysia, Spiders, and Silk- Result two entries).
PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or expression in a
given organism.
1. Detection Teacher Tip:

Some researchers may be interested in determining if a given gene/trait is available in a particular Mention that unlike DNA replication in
organism. If no previous research provides this information, researchers may test the DNA of vivo, PCR reactions do not use too many
helper enzymes such as helicases and
different organisms for the presence of these specific genes. A technique that allows the detection gyrases to help denature and stabilize the
of specific genes in target organisms is called PCR. template DNA strands.
The cyclic heating of the samples is meant
to provide the physical separation of the
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It utilizes a template DNA strands through heat
thermostable (heat-resistant) DNA polymerase that builds single stranded DNA strands unto denaturation of the inter-strand H-bonds.
unwound DNA templates. PCR uses repeated cycles of incubation at different temperatures to
promote the unwinding of the DNA template (~95C); the annealing of a primer (a ~20bp
oligonucleotide sequence (recall RNA primers in DNA replication) onto the ssDNA template strand
(~54 - 60C); and the extension of the generated ssDNA strand through the binding of
complementary bases to the template strand (~72 C). The thermostability of the polymerase allows
it to survive the repeated cycles of denaturation, annealing and extension with little loss of enzyme
function. Each cycle of PCR doubles the amount of the target sequence. A typical PCR experiment
uses about 35 cycles of amplification. This increases the original amount of the target sequence by
235 (i.e. ~34 billion) times.
Gene detection by PCR involves the design of primers that would only bind to sequences that are
specific to a target. For example, researchers would want to find out if gene X (e.g. the gene for
insulin) is available in a target organism (e.g. a mouse, Mus musculus). Primers may be designed by
looking at the available sequences for gene X in the databases (e.g. all the genes for insulin in
different organisms; humans, pigs, cows, etc.). The different gene X sequences must be aligned/
compared to match areas of sequence similarity (conserved sequences) and areas of sequence
dissimilarity (non-conserved sequences). Primers designed to have the same sequence as the
conserved areas will be specific for binding gene X sequences in all the target organisms. Primers
designed to have the same sequence as the non-conserved areas will only be specific for the
organisms which match its sequence.
40
Primers may be classified as forward or reverse primers. Forward primers are complementary and Teacher Tip:
bind to the reverse complementary (non-coding) sequence of the gene. Reverse primers are Let the learners recall the antiparallel orientation
of the bound primers to the template DNA. If the
complementary and bind to the coding sequence of the gene.
template is represented from left to right in the
5 ! 3 orientation; then the primers should bind
near the 3 end and the primers would be
STEPS in PCR Amplification represented 3 ! 5 going left to right.
Step 0: Undenatured Template ; Temp ~ 54 "C;
Template: double stranded (ds) DNA strand. Complementary sequences are held together by H-bonds
5 A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3 (Coding strand)
3 T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5 (Non-coding strand)
Step 1: Template denaturation ; Temp ~ 95 "C;

Template: single stranded (ss) DNA strands; DNA strands are separated; H-bonds between
complementary sequences are broken
Step 2: Primer Annealing ; Temp ~ 54 "C (dependent on primer melting temperature);

Template: ssDNA strands. H-bonds are formed between complementary sequences on the primers
and the target sequences.
Direction of elongation CCATAGATC (Reverse Primer)
5 GCGATGAGG 3 Direction of elongation (Forward Primer)

Teacher Tip:
Step 3: New DNA strand elongation ; Temp ~ 72 "C; Illustrate how by the 2nd round of PCR the two
The two new dsDNA strands are formed by the elongation of the generated ssDNA and the H-bonds newly synthesized DNA strands can now be used
as templates. For the given example, new strand
between the complementary sequences on these new strands and their templates. Each of the new
synthesis will again generate a 37 base pair long
dsDNA strands is made up of one old strand from the original template, and one new strand that was product. Repeated cycles of PCR will make this
generated as a reverse complement of the template. This is called semiconservative replication of the product the predominant type of double stranded
sequence. DNA in the solution.
New Strand 1:
5 A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3 (Coding strand) (old)
3 CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5 (Reverse Primer) (new)
New Strand 2:
5 GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3 (Forward Primer) (new)
3 T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5 (Non-coding strand) (old)
Step 4: Repeat step 1 to 3 for N number of cycles (N is usually 35)
PCR Results
The expected product of PCR amplification will depend on the sequences / position at which the
primer sequences bind. If the forward primer starts binding at nucleotide 3 (coming from the 5 end) of
a 43bp long gene, and the reverse primer binds at a position complementary to nucleotide 39 of the
coding strand, then a 37bp product is expected per cycle of PCR.
New Strand 1:
Nucleotide # 3 Nucleotide # 39 Note: Other types of organisms (e.g. Yeast,
Mammalian Cells, etc.) may also be transformed
37 bp product to exhibit new traits. The type of DNA constructs
used for insertion of genes into these organisms
5 A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3 (Coding strand) (old) will vary (e.g. Bacmids, Cosmids, etc.)
3- CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC 5 (Reverse Primer) (new)

42
New Strand 2:
Nucleotide # 3 Nucleotide # 39
37 bp product
5 GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG -3 (Forward Primer) (new)
3 T A C GCTACTCCTATACTGGGCTATCTATCTCCATAGATC TCTA 5 (Non-coding strand) (old)
PCR Applications Teacher Tip:

PCR may be used to detect the presence of a desired gene in an organism. Depending on the primer The multiple cloning site (MCS) may contain
sequences that may be cut by different restriction
design, the expected product may represent only a specific region of the gene or the entire gene itself. enzymes. Stress how the use of two restriction
The first case is useful for detection of the gene, or the detection of organisms with that specific gene enzymes may control the orientation of the
within a sample. The second case is useful for the amplification of the entire gene for eventual inserted gene in the plasmid.
Note: Forward and Reverse primers should not be
expression in other organisms. The direct amplification/copying of a full gene is part of the process for complementary.
cloning that gene.
2. Cloning and Expression

Some genes provide economically, and industrially important products (e.g. insulin-coding genes;
genes for collagen degradation). In some cases, scientists would want to put these genes into
organisms for the expression of their products. One example would be the insertion of an insulin-
coding gene from the human genome into bacteria. This allows the transformed bacteria to now
produce human insulin as a product.
Certain types of bacteria are capable of this process since they are able to take genes within their cell
membranes for eventual expression. The genes are normally in the form of small, circular DNA
structures called plasmids.
The genes found in the inserted plasmid DNA sequence will be expressed as proteins that provide
specific traits to the transformed bacteria. The basic components of an expression plasmid are listed in
the following table. The purpose of each of these is also provided.
COMPONENT PURPOSE
Promoter Allows the controlled expression of the desired gene in the presence
of an inducing agent (e.g. beta- galactosidase; heat treatment (~65"C)
Multiple Cloning Site DNA sequence or portion for the insertion of the desired gene. This
section may contain sequences that will be cut by specific restriction
endonucleases ( cuts within the molecule) If both the amplified gene
and the plasmid are cut with the same restriction enzyme, then
complementary sequences will be generated for each, allowing them
to bind together or anneal. The desired gene is inserted into the
multiple cloning site through this process.
Restriction enzymes cut at specific sequences.
EcoR1 Target Sequence:

5 GAATTC 3
3 CTTAAG 5
Digestion Reaction
Undigested: Digested dsDNA:

5 GAATTC 3 5 G AATTC3
3 CTTAAG 5 3 CTTAA G5
If the desired cut sites are not found in the gene that needs to be
inserted; the sequences can be added by including the target
sequences in the primers used for PCR amplification.
44
COMPONENT PURPOSE
Multiple Cloning Site PCR Primers:

5 GCGATGAGG 3 (Forward Primer)
3 CCATAGATC 5 (Reverse Primer)
Forward Primer + EcoRI target sequence:

5 GAATTCGCGATGAGG 3
Reverse Primer + EcoRI target sequence:
3 CCATAGATCCTTAAG 5
Inserted Gene Sequence Successful insertion of a gene allows the expression of its protein
product. This usually provides a specific trait to the transformed
bacteria. For example, if the gene for Green Fluorescent Protein is
placed within the expression plasmid, bacteria transformed with this
plasmid will produce protein (GFP) that will allow the bacterial cells /
colonies to glow green in the dark.
Antibiotic Resistance Provides a way to screen a population of bacteria for those that took
Gene up the plasmid. For example, if an ampicillin resistance gene is
encoded in the plasmid, then only bacteria which took up the plasmid
will be able to grow on media with ampicillin.
However, if the ampicillin resistance gene is cut and the gene is
inserted here for cloning, then the cell will no longer be resistant to
ampicillin. This is a way to select which among the colony of cells
actually contain the inserted gene sequence. Bacterial cells whose
ampicillin resistance gene have been cut will die in the presence (agar
plate) of ampicillin.
PRACTICE (5 MINS) Teacher Tip:
At this point, learners imagination could be
Steps in PCR and Gene Cloning stretched, but caution the learners that certain
1. Let learners give other hypothetically modified or genetically engineered plants and animals which ethical principles should be followed and adhered
can be used for health, industry, agriculture and for the protection of the environment. to in the production of genetically modified
organisms. Animal welfare should be taken cared
2. Ask learner to draw the parts of an expression vector. of and human cloning must never be conducted.
3. Using pieces of paper, allow the learners to illustrate the steps in restriction digestion and PCR
ENRICHMENT (5 MINS)
Uses of PCR and GMOs
1. Discuss how PCR may be used for the detection of disease causing pathogens in a population. For
example, it may be used to check if a patient has a dengue virus infection. This is done by using
primers that are specific for complementary DNA (cDNA) sequences that correspond to the
dengue viruses. If PCR amplification occurs using cDNA from a patients blood sample then the
patient likely has dengue viruses in his/her blood.
2. Discuss how the cloning and expression of certain genes allows for massive production of the
desired product. For example, the cloning and expression of insulin in bacteria allows for the mass
production of this necessary protein for use by diabetic patients. Prior to insulin production in
bacteria, insulin was harvested from other animals such as pigs.
Teacher Tip:
Try using other classic restriction enzymes:
Ex. Xho1; HindIII
46
EVALUATION (5 MINS)
Sample Exercise
1. Give learners a set of known Restriction Enzyme (RE) cut sites:
EcoRI BamH1
5 GAATTC 3 5 GGATTC 3
3 CTTAGG 5 3 CTTAGG 5
DNA Sequence (69 bp long) 28 49
5 ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATCCTATGCCCGAATGTC 3
3 TACGTACCATGCATCTCAAGGTACTTAAGCGGGGATATCCCATCGGCTCCTAGGATACGGGCTTACAG 5
Expected Fragment sizes:

With EcoR1 digestion : 28 bp, 41 bp
With BamH1 digestion : 20 bp, 49 bp
With both EcoR1 and BamH1: 20bp, 28bp, and 21 bp
3. Ask the learners to scan a double stranded DNA sequence to determine the presence of these cut sites. Allow them to provide the
fragment sizes expected for using different combinations of the RE on the given sequence. You may choose to give the sequence as linear
or circular DNA. Discuss how the fragment sizes will vary if the target sequence is in circular or linear DNA.
4. A similar exercise may be done to locate areas where primer sequences can bind. The expected fragment sizes for PCR amplification using
different primers can be tested
Example:
Forward Primer:
5 CATGGTACGTAG 3
Reverse Primer:
3 GCTCTATACGGG 5
Target Sequence:
4 Product Size: 62 - 4 = 48bp 62
5 ATGCATGGTACGTAGAGTTCCATGATAGAGCCCCTATAGGGTAGCCGAGCGAGATATGCCCGAATGTC 3 3
TACGTACCATGCATCTCAAGGTACTATCTCGGGGATATCCCATCGGCTCGCTCTATACGGGCTTACAG 5
48
Lesson 8.1: History of Life on Earth

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY ONE
life on Earth.
The learners shall be able to Motivation Discussion: How Old is the Earth? 15
create a personal timeline and compare it with the geologic time scale Instruction Picture Timeline and Short Film 20
design a poster tracing evolutionary changes in a crop plant (e.g., rice or
Enrichment GTS Introductory Worksheet 10
corn) that occurred through domestication
Learning Competency Evaluation My Life History: A Short Narrative 10

The learners describe general features of the history of life on Earth, including
Materials
generally accepted dates and sequence of the geologic time scale and Visual aids on the geologic time scale; 20 printed pictures of events/
characteristics (STEM_BIO11/12-IIIc-g-8) structures/ organisms; computers and internet connection
Specific Learning Outcomes All Resources listed at the End of this Lesson
identify the dates and sequence of the periods in the geologic time scale;
identify the major events in each major period;
describe the characteristics of the major groups of organisms present
during a time period;
identify types of fossils; and
describe causes of mass extinctions.
INTRODUCTION (5 MINS) Introduction
When we study the Earths age, we are also
Communicate Learning Objectives studying the fossil record and ultimately, the
Introduce the following objectives by asking volunteers to read them aloud: theory of evolution. The Earth is approximately 4.6
billion years old a very big number ordinary
1. I can identify the dates and sequence of the geologic time scale
humans cant easily relate with, especially, the
2. I can describe the characteristic features of major groups of organisms in each time period. specific time frame when we appeared. Comparing
the Earths age to one calendar year, events such
as the extinction of dinosaurs and the re-discovery
of the New World by Columbus would appear
MOTIVATION (10 MINS) relatively much easier. Understanding the
geologic time scale reminds us of our time and
Discussion: How Old is the Earth? place in the universe.
1. What is the age of the Earth?
The learners may give various answers from thousands to millions of years. Some will give Big Ideas: (May be written on the board or manila
answers near to 4.6 billion years. Write all the answers on the board and let them think of what paper and posted on the board.
the age of the Earth is.) The Earth is 4.6 billion years old.
Life on Earth arose around 3.5 billion years
ago.
2. What was the Earth like million of years ago? Over Earths vast history, both gradual and
catastrophic processes have produced
Ask learners: Have you seen the movies Ice Age and The Land Before Time? How was the enormous changes.
Earth presented in movies such as these? Based from what you may have read, describe the
Earth million of years ago. The following answers may be given by learners: (1) covered with
Misconceptions:
thick blanket of ice, (2) lots of volcanoes and high mountains, (3) large organisms roamed the Humans and dinosaurs existed on the Earth at
land, (4) the atmosphere did not have high oxygen content, (4) asteroids/ meteors frequently the same time.
hit the surface, (5) the lands moved a lot or the continents were a little closer to each other, (6) Plants and animals on Earth have always
volcanic eruptions, (7) a little bit warmer, (8) plants were bigger, (9) humans were not yet existed.
The Earth is too big to change.
around. Accept all answers and ask them what are the possible conditions on the early Earth.
The teacher may show a clip from any of the movies depicting ancient earth conditions.)
Teachers must correct the misconceptions learners
have about the history of life on Earth.
3. When did man first appear on Earth?
Learners may give answers such as millions to thousands years ago. Ask learners to choose
the more probable dates and provide evidence for its accuracy. They may enumerate the
different hominid species but ask them the approximate time when our species (modern
humans) first appeared. Tell them that humans did not co-exist with dinosaurs as what movies
50
usually depict. Man could have first appeared about 100 150 thousand years ago as shown Teacher Tip:
by artefactual evidences in various sites. The human timeline is rather flexible and debatable- Its hard for learners to understand geologic events
every time we know a specific date, a new discovery is announced and everything gets re- and the time frame where each event took place. It
will be easier if everything is connected in a 1- year
dated to fit the best estimates.) time frame (calendar year). It is more relevant to
see how everything unfolds in a short time span.
However, tell them that a lot of things can happen
4. Distribute the 15 20 pictures to some volunteers. Ask each volunteer to post them along the in the span of a year.
length of the board based on what each thinks occurred first.
The teacher will print 15 - 20 events (preferably
5. Let the other learners check what have been posted. They can suggest a possible re- with pictures, if necessary) to be used for this
lesson. Refer to the Sample Events List.
arrangement of the pictures.
6. When everybody is satisfied with the lineup, tell them that they are going to watch a short The pictures should be posted on the front board
that will serve as a 1-year timeline. Tell them that
video. they will view the Earths history in this time frame.
To make it more interesting, attach the 12 months
of the year. Ask interesting questions, such
as,Who would like to have a birthday party with
INSTRUCTION (20 MINS) dinosaurs?
1. Watch a short clip Unlocking of Terms:
I. Geologic Time Scale (https://www.youtube.com/watch?v=nofyRleo3Vc ) EON- largest division of the geologic time
scale; spans hundreds to thousands of million
II. Four Ways to Understand the Earths Age. (https://www.youtube.com/watch?v=tkxWmh- of years ago (mya)
ERA- division in an Era that span time periods
tFGs&spfreload=10
of tens to hundreds of millions of years
2. Tell everyone to listen and watch attentively. PERIOD- a division of geologic history that
spans no more than one hundred million years
3. Use the following questions to guide the learners as they watch the video. EPOCH- the smallest division of the geologic
time scale characterized by distinctive
I. What are the four ways mentioned in the film?
organisms
II. Why is it hard to create a timeline of events chronicling Earths history?
Tip:
III. What are the divisions of the geologic time scale? The teacher may also ask the learners to plot their
birthdates side-by-side with the geologic events.
4. Share in class what you have learned from the video.
5. Ask the learners to take a closer look at the timeline constructed on the board. Ask:
In which timeframe were you born? What specific
6. Let them re-arrange (if necessary) based on what they learned from the video. events happened the day you were born, using the
geologic time scale.
Alternate Video:
Geologic Time Scale: Major Eons, Eras, Periods
and Epochs- https://www.youtube.com/watch?
v=nofyRleo3Vc
ENRICHMENT (10 MINS) Teacher Tip:
1. Answer the following in your journal. Journaling is a good technique to help some
passive learners to jot down their thoughts first
I. The Earth has an incredibly long history. How does understanding of geologic time and then share whatever they have written with a
the significant geologic events of the past impact your understanding of humans unique partner.
responsibility and place on earth? Volunteers may be tapped in advance.
II. How does understanding the past help us understand the present? The best output will be posted in the room.
III. Calculate how many generations of humans it would take for us to exist now (assume an
average life span of 80 years) (What must we humans do to ensure we are able to exist this
long for many generations?
2. Form a dyad and discuss your answers.
Alternate Activity:
EVALUATION (5 MINS) Time Machine:
1. Answer the Worksheet on Geologic Time Scale. Submit next meeting. 1. Look around your community. Make a narrative
2. My Life History: Create a timeline of events that happened to you since you were born up to on how the place looked like several years ago
and how it will be several years (maybe after 50
the present time. Choose only 20 events that you think are the most important. Be ready to years) from now.
present your timeline next meeting.
ASSIGNMENT: (5 MINS) Going Further:

If time and space permits, the following activity
1. Make a table in your notebook of the geologic time scale (GTS) and include the following
can be done.
details; Understanding Geologic Time
I. Major divisions of the GTS (From: http://www.jsg.utexas.edu/glow/files/
II. Major events and characteristic organisms Understanding-Geologic-Time-6-8.pdf)
52

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY TWO
life on Earth.
Motivation Discussion: How Old is the Earth? 5
create a personal timeline and compare it with the geologic time scale Instruction Lecture of the Geologic Time Scale 20
design a poster tracing evolutionary changes in a crop plant (e.g., rice or Enrichment The Anthropocene 20
Evaluation Quiz 10
Learning Competency
The learners describe general features of the history of life on Earth, including Materials
generally accepted dates and sequence of the geologic time scale and Visual aids on the geologic time scale; 20 printed pictures of events/
characteristics (STEM_BIO11/12-IIIc-g-8) structures/ organisms; computers and internet connection
Specific Learning Outcomes All Resources listed at the End of this Lesson
identify the dates and sequence of the periods in the geologic time scale;
describe causes of mass extinctions
This lesson will present formally the lesson on GTS.
Communicating Learning Objectives The learners will understand better the highlights
The lesson for today will cover the following topics: of each time frame in the GTS.
1. Major events in the Geologic Time Scale (GTS)
2. Cambrian Explosion
MOTIVATION (5 MINS)
Discussion: How Old is the Earth?
Discussion: How Old is the Earth?
Ask the following questions:
1. How old is the Earth?
2. What is the biggest time frame in the GTS?
3. What is the smallest time frame in the GTS?

Teacher Tip:
Lecture of the Geologic Time Scale The Geologic Time Record is a tabular
1. Present a lecture discussion on the Geologic Time Scale representation of the major divisions of the Earths
2. The following outline can guide the teacher in the discussion: history. The time intervals are divided and
described from the longest to the shortest as
I. The Geological Time Scale (GTS) EONS, ERAS, PERIODS and EPOCHS.
A. Four eras - Precambrian; Paleozoic; Mesozoic; Cenozoic
Each period has an approximated time frame and
B. Periods under the Paleozoic era - Cambrian, Ordovician, Silurian, Devonian, characterized by distinctive features (events and
Carboniferous, Permian organisms).
C. Periods under the Mesozoic era - Triassic, Jurassic, Cretaceous

D. Periods under the Cenozoic era - Tertiary and Quaternary
II. Age in millions of years of each time period
III. Major events in the history of life
54
The Geologic time is divided into four large segments called Eons:
Hadean, Archean, Proterozoic and Phanerozoic. The Phanerozoic is
divided into Eras: Paleozoic, Mesozoic, and Cenozoic. Extinction
events and appearance of new life forms characterized the
divisions among Eras. Smaller divisions, called Periods,
characterized by a single type of rock system, make up each Era.
Some Periods are further divided into smaller time frame called
Epochs. (From: http://goo.gl/ITmoty)
There is a mnemonics (memory device) to remember the Periods in

exact order (from the earliest to the recent); jumps between periods
and epochs.
Pregnant Plentiful
Camels Early
Often Oiling
Sit Might
Down Prevent
Carefully. Partial
Perhaps Rheumatism!
Their
Joints
Creak?
The teacher can also discuss CAMBRIAN EXPLOSION.

CAMBRIAN EXPLOSION is the belief that there was a sudden,
apparent explosion of diversity in life forms about 545 million years
ago. The explosion created the complexity of multi-celled organisms
in a relatively short time frame of 5 to 10 million years. This explosion
also created most of the major extant animal groups today.
SOURCE: http://d32ogoqmya1dw8.cloudfront.net/images/NAGTWorkshops/time/
visualizations_teachtips/variable_time_geologic_time.jpg
The start of the Cambrian was characterized by the breaking up of ** The following PowerPoint presentations might help in organizing your
supercontinent Gondwana into smaller land masses opening up new discussion on this lesson.
http://goo.gl/Xfu2dz
environmental niches where organisms can colonize and specialize. http://goo.gl/YMUvFL
http://goo.gl/yRa5c7
http://goo.gl/45c27A
http://goo.gl/CoumSB
Teacher Tip:
ENRICHMENT (20 MINS) Ask the learners to research if there are evidences to support that the explosion
is as sudden and spontaneous as it is used to describe the fossil record.
The Anthropocene
1. Present to the learners a new proposed Epoch, the Anthropocene. This is also a good time to discuss how new findings can affect an existing body of
I. What are the evidences that suggest that we are entering/ have knowledge.
entered a new epoch?
Let the learners read the following articles about a proposed new epoch, the
II. How do scientists decide if a new finding should be validated? Anthropocene.
Human impact has pushed Earth into the Anthropocene - http://goo.gl/
2. This can be discussed in a small group of 5 learners.
fxggQf (04/13/16)
What Is Anthropocene and Are We in It? - http://goo.gl/mq7I9V (04/13/16)
Welcome to the Anthropocene - http://www.anthropocene.info (04/13/16)
EVALUATION (10 MINS)

1. Geologically speaking with reference to the entire history of the 3. The Earth is ________ years old.
earth, the dinosaurs went extinct A. 6,000
A. Shortly after the formation of Earth B. 46,000,000
B. In the first billion years of Earths history C. 4,600,000,000
C. In the most recent 2% of the history of Earth D. There is no way to know
D. Before the first fish formed
2. Relative to the percent of time dominating the surface of Earth 4. 100,000 years in the geologic history of Earth would be
which organisms have the longest reign? considered
A. Dinosaurs A. Immensely long
B. Plants B. A drop in the bucket
C. Prokaryotes C. Half of Earth's history
D. Eukaryotes D. An extremely significant amount of time
E. Humans
56
5. Understanding geologic time is significant because it helps us 6. Which organism first dominated Earth?
A. Understand humans impact on our environment A. Dinosaurs
B. Understand the evolution of organisms over time B. Insects
C. Understand the possibility for life on other planets C. Plants
D. Understand the process of evolution D. Fish
E. All of the above E. Bacteria
ASSIGNMENT Answer Key:

Answer with discussion must be given by the teacher.
1. What are fossils? How are they formed?
1. C
2. List down the types of fossils and given examples. 2. C
3. C
3. How do we measure the age of fossils?
4. B
4. What are mass extinctions? How many mass extinctions events 5. B
happened in the GTS? 6. E
Teacher Tip:
See to it that everyone has a clear understanding of the geologic time scale.
There is no need to remember all the events in each period.

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY THREE
life on Earth.
The learners shall be able to Motivation Questions on Dinosaurs 5
create a personal timeline and compare it with the geologic time scale; and
Instruction Types of Fossils 50
corn) that occurred through domestication Materials
Visual aids on the geologic time scale; 20 printed pictures of events/
Learning Competency structures/ organisms; computers and internet connection
The learners describe general features of the history of life on Earth, including Resources
generally accepted dates and sequence of the geologic time scale and (1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
characteristics (STEM_BIO11/12-IIIc-g-8) Benjamin Cummings. pp. 503-525.
(2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson.
Specific Learning Outcomes Campbell Biology. 9th ed. 2014. Illinois: Pearson Education Inc. pp.
At the end of the lesson, the learners will be able to: 480-499.
identify the dates and sequence of the periods in the geologic time scale; (3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
identify the major events in each major period; 419-439.
Additional Resources listed at the End of this Lesson
58
The lesson for today will cover the following topic: An alternative could be to show a clip from the
movie Jurassic Park or Jurassic World.
1. The types of fossils
2. Ways fossils are formed and how fossils ages are determined
The following sites provide information about
3. Mass extinctions- causes and frequency in the GTS Fossils:
http://teacher.scholastic.com/scholasticnews/
magazines/scienceworld/assets/SW-
MOTIVATION (5 MINS) POWERPOINT-FOSSILS.ppt - (Downloaded
1. Where did scientists discover the first dinosaurs? 04/15/16)
2. Who coined the term dinosaurs? http://www.enchantedlearning.com/subjects/
dinosaurs/dinofossils/Fossiltypes.html -
3. How did the discovery of dinosaurs make scientists become more interested in the geologic (Downloaded 04/15/16)
record? http://www.livescience.com/37781-how-do-
4. How can fossils be used as evidence for the evolution of living forms? fossils-form-rocks.html - (Downloaded
04/15/16)
http://www.bbc.co.uk/nature/fossils -
INSTRUCTION (50 MINS) (Downloaded 04/15/16)
1. The teacher will post on the board examples of fossils and let the learners identify the type. http://www.whatisafossil.net - (Downloaded
04/15/16)
FOSSILS are evidences of organisms that lived in the past. They can be actual remains like
bones, teeth, shells, leaves, seeds, spores or traces of past activities such as animal
burrows, nests and dinosaur footprints or even the ripples created on a prehistoric shore.
In exceptional preservation, fine details such as original color and individual muscle fibers
are retained, features often visible in electron microscopes. This is referred to as the
Medusa effect. (From: http://www.bbc.co.uk/nature/fossils/Lagersttte)
TYPES OF FOSSILS DESCRIPTION EXAMPLES
Molds Impression made in a substrate = negative image of an Shells

organism
Casts When a mold is filled in Bones and teeth
Petrified Organic material is converted into stone Petrified trees;

Coal balls (fossilized plants and their tissues, in round
ball shape)
Original Remains Preserved wholly (frozen in ice, trapped in tar pits, dried/ Woolly mammoth;
dessicated inside caves in arid regions or encased in amber/ Amber from the Baltic Sea region
fossilized resin)
Carbon Film Carbon impression in sedimentary rocks Leaf impression on the rock
Trace / Ichnofossils Record the movements and behaviors of the organism Trackways, toothmarks, gizzard rocks, coprolites
(fossilized dungs), burrows and nests
THE SIX WAYS OF FOSSILIZATION Teacher Tips:

1. Unaltered preservation - Small organism or part trapped in amber, hardened plant sap The teacher may also mention that more than 90
percent of all organisms that have ever lived on
2. Permineralization/ Petrification - The organic contents of bone and wood are replaced with Earth are extinct (http://goo.gl/K83SA). This is due
silica, calcite or pyrite, forming a rock-like fossil to mass extinctions events that wiped out
organisms in the past. The following sites offer
3. Replacement - hard parts are dissolved and replaced by other minerals, like calcite, silica, explanations on these mass extinction events.
pyrite, or iron
4. Carbonization or Coalification - The other elements are removed and only the carbon Big 5 Mass Extinction Events - http://
www.bbc.co.uk/nature/extinction_events -
remained (Downloaded 04/16/16)
5. Recrystalization - Hard parts are converted to more stable minerals or small crystals turn into The Great Dying - http://science.nasa.gov/
larger crystals science-news/science-at-nasa/
2002/28jan_extinction/ - (Downloaded
6. Authigenic preservation - Molds and casts are formed after most of the organism have been 04/16/16)
destroyed or dissolved Mass Extinctions - http://
science.nationalgeographic.com/science/
prehistoric-world/mass-extinction -
(Downloaded 04/16/16)
60
DATING FOSSILS
Knowing the age of a fossil can help a scientist establish its position in the geologic time scale
and find its relationship with the other fossils. There are two ways to measure the age of a fossil:
relative dating and absolute dating.
1. RELATIVE DATING
I. Based upon the study of layer of rocks
II. Does not tell the exact age: only compare fossils as older or younger, depends on their
position in rock layer
III. Fossils in the uppermost rock layer/ strata are younger while those in the lowermost
deposition are oldest
How Relative Age is Determined

I. Law of Superposition: if a layer of rock is undisturbed, the fossils found on upper layers are
younger than those found in lower layers of rocks
II. However, because the Earth is active, rocks move and may disturb the layer making this
process not highly accurate
Rules of Relative Dating

(From: http://staff.harrisonburg.k12.va.us/~esutliff/forms/Relative_Dating_1334236393.ppt)
A. LAW OF SUPERPOSITION: Sedimentary layers are deposited in a specific time- youngest

rocks on top, oldest rocks at the bottom
B. LAW OF ORIGINAL HORIZONTALITY: Deposition of rocks happen horizontally- tilting,

folding or breaking happened recently
C. LAW OF CROSS-CUTTING RELATIONSHIPS: If an igneous intrusion or a fault cuts
through existing rocks, the intrusion/fault is YOUNGER than the rock it cuts through
Try this exercise on radioactive dating:

Carbon-14 Dating: http://www.starhop.com/library/pdf/studyguide/high/
brsp-15carbondating.pdf
INDEX FOSSILS (guide fossils/ indicator fossils/ zone fossils): fossils from short-lived
organisms that lived in many places; used to define and identify geologic periods
2. ABSOLUTE DATING
Determines the actual age of the fossil
Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40
Considers the half-life or the time it takes for half of the atoms of the radioactive element
to decay
The decay products of radioactive isotopes are stable atoms.
Take a look at the table below. A living organism has carbon-14. For the amount of Carbon in the
organisms body to become half, it will take about 5,700 years; which is the half-life of carbon-14.
Fill up the remaining data in the table. What is the limit in using carbon-14 as a measure to
determine a fossils age?
62

Content Standard
The learners demonstrate understanding of the major events in the history of LESSON OUTLINE - DAY FOUR
life on Earth.
Practice Creation of Fossils 50
Wrap Up Clean Up 10
create a personal timeline and compare it with the geologic time scale Materials
Visual aids on the geologic time scale; 20 printed pictures of events/
design a poster tracing evolutionary changes in a crop plant (e.g., rice or structures/ organisms; computers and internet connection
Resources
Learning Competency (1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
The learners describe general features of the history of life on Earth, including Benjamin Cummings. pp. 503-525.
generally accepted dates and sequence of the geologic time scale and (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson.
Campbell Biology. 9th ed. 2014. Illinois: Pearson Education Inc. pp.
characteristics (STEM_BIO11/12-IIIc-g-8) 480-499.
Specific Learning Outcomes (3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
At the end of the lesson, the learners will be able to: Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
419-439.
identify the dates and sequence of the periods in the geologic time scale
Additional Resources listed at the End of this Lesson
identify the major events in each major period
during a time period
identify types of fossils and
describe causes of mass extinctions
PRACTICE (50 MINS) Teacher Tip:
1. The learners are going to make fossils from a natural and man-made object. Making fossil is a fun way to get involved in
science. There are a lot of online sites to guide you
2. There are two methods used to create fossils. on how to create cheap replicas of fossils.
A. Imprint
The activity can be a little messy, so instruct the
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, learners to use newspapers or this can be done in
animal bone) will do as long as it fits in the container. If you choose leaves, be sure it is an open area.
not dry.
The following materials are needed for this activity.
II. Coat the object with petroleum jelly. This will keep the object from sticking to the 1. A small natural object (shell, bone, leaf)
plaster when you try to remove it. Coat it thoroughly. 2. Any small toy
3. Clay
III. Mix plaster and water in a bowl. Follow the directions on the plaster of Paris
4. Petroleum jelly
packaging. Mix them together thoroughly and let the concoction sit for a few minutes 5. Plaster of Paris
without stirring. You should need about 2x more water than plaster, but you can adjust 6. Disposable dish
the ratio as you see fit.
IV. Press the object into the plaster of Paris. Be careful not to push too hard! Now your Teacher Tip:
part is done; all it has to do is dry. Set it aside and check it the next day; drying will Given that this can be messy, tell learners to work
take at least one day. on top of old newspapers. Tell them not to throw
plastic of Paris in the sink or drainage in order for
V. Remove the object. After you've waited 24 hours, pop your natural item out of the them not to get clogged with the dried up
plaster of Paris. It's just like a shell that was enveloped in soil for thousands of years. It materials. Provide a container for them to put all
was disintegrated and this image was left behind. waste materials.
B. 3-D Object (Cast) It will take 1 - 2 days to completely dry and harden
I. Choose the object you want to make a fossil of. Any natural object (shells, leaves, the fossil model.
animal bone) will do as long as it fits in the container. If you choose leaves, be sure it is
Give incentives/ small tokens to those who made
not dry. the best fossils.
II. Combine the plaster of Paris with water. Use 1 part plaster of Paris to 2 parts water and
mix well in a paper cup with a plastic spoon. Let it sit while you work with the clay.
III. Choose an object as the template of your fossil. Generally, leaves, shells, branches, or
bones work best. Just make sure you have enough clay and plaster to cover it.
IV. Knead the modeling clay until it is soft and pliable. This will be what your object rests
and forms an impression in. It needs to be kneaded until it can cover the area of your
object.
V. Coat the object with petroleum jelly. Firmly yet slowly press it into the modeling clay to
64
make an impression. The petroleum jelly prevents it from sticking to the clay, so be
generous. Remove the object carefully to create a mold in the shape of the item you
used.
VI. Fill the impression left by your object with plaster of Paris. Smooth the plaster to the
level of the clay to form a flat surface. Place your clay and plaster mold on a
newspaper, paper towel, or other disposable surface and allow it to harden. You'll
need to wait at least overnight, but 2 or 3 days is preferable and safer.
VII. Peel the clay off the hardened plaster to free the fossil. The shape of your object
should be recreated in the plaster, details intact.
WRAP UP (10 MINS)

1. Tell the learners to clean up and put all the output in one corner of the room for them to dry
up.
2. Tell them to label their works with masking tape.

Content Standard
The learners demonstrate understanding of the major events in the history of
LESSON OUTLINE - DAY FIVE
life on Earth.
Performance Standards Evaluation Summative Assessment 60

The learners shall be able to Materials
create a personal timeline and compare it with the geologic time scale; and Visual aids on the geologic time scale; 20 printed pictures of events/
structures/ organisms; computers and internet connection
corn) that occurred through domestication Resources
(1) Freeman, S. Biological Science. 3rd ed. 2008. California: Pearson
Learning Competency Benjamin Cummings. pp. 503-525.
The learners describe general features of the history of life on Earth, including (2) Reece, JB, LA Urry, ML Cain, S Wasserman, PV Minorsky, RB Jackson.
generally accepted dates and sequence of the geologic time scale and Campbell Biology. 9th ed. 2014. Illinois: Pearson Education Inc. pp.
480-499.
characteristics (STEM_BIO11/12-IIIc-g-8)
(3) Russell PJ, SL Wolfe, PE Hertz, C Starr, B Mc Millan. Biology: the
Specific Learning Outcomes Dynamic Science. 2008. California: Brooks/Cole CENGAGE Learning. pp.
At the end of the lesson, the learners will be able to: 419-439.
identify the dates and sequence of the periods in the geologic time scale; Additional Resources listed at the End of this Lesson
describe the characteristics of the major groups of organisms
present during a time period;
66
SUMMATIVE ASSESSMENT 3. The layers in sedimentary rocks are also called
1. Geologic Time Scale Practice A. eras
Go to this site and try the quiz. (There is no need to memorize B. epochs
the smaller divisions of the geologic time scale.) http:// C. strata
www.geosci.ipfw.edu/gildner/TimeScalePractice.html D. gaps
(Downloaded 04/16/16)
4. The movie Jurassic Park got its title from which era?
2. Geologic Time Scale Events A. Paleozoic
B. Mesozoic
Go to this site and try the quiz. http://www.glencoe.com/qe/
scienceOLC.php?qi=6024 (Downloaded 04/16/16) C. Cenozoic
D. Holozoic
3. Practice Quiz for the Nature of Fossils 5. During which era were the first land plants formed?
Go to this site and try the quiz. http://anthro.palomar.edu/time/ A. Cambrian
quizzes/timquiz1.htm (Downloaded 04/16/16)
B. Pre-Cambrian
C. Paleozoic
MULTIPLE CHOICE. Choose the letter of the correct answer. D. Mesozoic
1. The largest division of the geologic time scale is the
6. The era of middle life, a time of many changes on Earth
A. Eon
A. Paleozoic
B. Era
B. Mesozoic
C. Period
C. Cenozoic
D. Epoch
D. Holozoic
2. The Mesozoic Era was the Age of Reptiles while the current 7. What is the longest part of Earths history where trace fossils
Cenozoic Era is the Age of appeared.
A. Mammals A. Pre-Cambrian
B. Birds B. Paloezoic
C. Humans C. Mesozoic
D. Technology D. Cenozoic
8. The geologic time scale is subdivided into 4 groups. List them TRUE OR FALSE. Write True if the statement is correct and False if
from the largest to the smallest. it is not.
A. Eons, periods, epochs, eras 1. Fossils give clues about the past.
B. Eras, eons, periods, epochs 2. Animals that are extinct are still alive today.
C. Epochs, periods, eras, eons 3. Scientists do not know for sure what happened to the dinosaurs.
D. Eons, eras, periods, epochs 4. A mold is a cast filled in with sediments.
5. Soft body parts cannot be fossilized.
9. The end of this era was believed to be caused by a comet or 6. Paleontology is the study of fossils.
asteroid colliding with Earth, causing a huge cloud of dust and 7. A wooly mammoths footprint is a trace fossil.
smoke to rise into the atmosphere, blocking out the sun.
8. Distinctive fossils used to determine the ages of rocks are called
A. Paleozoic scale fossils.
B. Holozoic 9. Saber - toothed tiger is more likely preserved in amber.
C. Mesozoic 10. Fossils are most likely found in sedimentary rocks.
D. Cenozoic
10. Which geologic event occurred during the Mesozoic era?

A. Pangaea formed
B. Asteroids killed the dinosaurs
C. The Rocky Mountains formed
D. The Pleistocene Ice Age began
68
RESOURCES:
NOTES:
1. The Geologic Time Scale: http://www.uky.edu/KGS/education/geologictimescale.pdf (Retrieved 07/08/15)
2. What Is a Fossil: http://www.discoveringfossils.co.uk/whatisafossil.htm (Retrieved 04/16/16)
3. BBC- Fossils: http://www.bbc.co.uk/nature/fossils (Retrieved 04/16/16)
4. How Fossils Form: http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossilhow.html
(Retrieved 04/16/16)
VIDEOS:
1. Evolution (1971 animation)- https://www.youtube.com/watch?v=T1_vnsdgxII (viewed 07/08/15)
2. Geologic Time Scale
3. The Geologic Time Scale: https://www.youtube.com/watch?v=r10oh1NHKv4&spfreload=10 (viewed 07/08/15)
4. The Geologic Time Scale: https://www.youtube.com/watch?v=nofyRleo3Vc (viewed 07/24/15)
5. Four Ways to Understand the Earths Age: https://www.youtube.com/watch?v=tkxWmh-tFGs&spfreload=10 (viewed 07/08/15)
6. The History of Earth: https://www.youtube.com/watch?v=RQm6N60bneo (viewed 07/08/15)
FURTHER: Advance learners can explore these sites beyond class.

1. Deep Time: A History of the Earth Interactive Infographic: http://deeptime.info (viewed 07/09/15)
2. National Museum of Natural History Geologic Time: http://www.nmnh.si.edu/paleo/geotime/index.htm (viewed 07/09/15)
3. Abiogenesis: https://www.youtube.com/watch?v=W3ceg--uQKM (viewed 07/08/15)
4. http://mitep.mtu.edu/include/documents/2013/presentations/What_is_the_Geologic_Time_Scale_DWagner.pdf
5. http://ed.ted.com/lessons/the-earth-s-age-in-measurements-you-can-understand-joshua-m-sneideman#review
6. http://www.stratigraphy.org/index.php/ics-chart-timescale
7. http://deeptime.info
8. http://www.nmnh.si.edu/paleo/geotime/index.htm
9. http://www.enchantedlearning.com/subjects/dinosaurs/dinofossils/Fossiltypes.html
Other possible sources of quiz items on fossils: (Downloaded 04/16/16)

1. https://mrssmiths4thportfolio.wikispaces.com/file/view/fossil+quiz.pdf
2. http://www.marcom.com.au/SGuides/ZZVECS/6VCSQS06.pdf
3. https://www.nps.gov/blca/learn/education/upload/fossils-2.pdf
4. http://www.biorules.org/Biology/articles/hist_life/Chap12PracTest.pdf
5. http://scioly.org/wiki/images/4/44/2015CT_FOSS1_TESTKEY.pdf
General Biology 2
SUPPLEMENTARY HANDOUTS
HANDOUT A
BODY SYSTEM DEBATE
In this project you and your group mates will research on a human Your campaign must include the following:
body system. Organize a campaign for your body system, present 1. The name of your body system written clearly.
your campaign to the rest of the class, and debate whether or not
2. A colored, life-size representation of your body system.
your body system is most essential to the survival of the human
3. A brief description of the overall function(s) of your body
species. In doing this, you will become an expert on your body
system.
system as well as learn about the other body systems from our
classroom experts. Once all campaigning and debating is 4. All organs/parts of your body system drawn on your
complete, each student will vote for the system that they feel is representation where they are found in nature and clearly
most essential to humans. labeled.
5. A complete description of the function of each organ/part.
The body system you will be campaigning for is the (check one): 6. A complete description of the importance of your body system
to an individual and to the survival of humans referencing
Digestive
information given in points 1-5.
Respiratory
Reproductive
Circulatory Your Debate must include the following:
Excretory 1. A review of the importance of your system to the individual and
Lymphatic the species.
Integumentary
2. Rebuttals to points made by each of the other systems.
Nervous
3. Closing arguments.
Skeletal
Endocrine
Muscular
246
CAMPAIGN and DEBATE RUBRIC
CAMPAIGN CAMPAIGN DEBATE
NAME OF BODY SYSTEM POINTS DESCRIPTION OF ORGAN OR PART REVIEW POINTS

FUNCTION
Written clearly, spelled correctly, easy Clearly stated, easy to understand 2
3 Accurate, clearly stated, easy to
to see
6 Missing one criterion 1
understand
Missing one criterion 2
Missing one criterion 4 Absent 0
Missing two criteria 1
Missing two criteria 2 REBUTTAL
Absent 0
Not all organs and parts accounted for 1 Effectively refutes points made in all 15
LIFE SIZE REPRESENTATION other campaigns
Absent 0
Correct size, colored, neatly drawn 12 All other campaigns are refuted, but 10
CONCLUSION not all points
Clearly stated, easy to understand, All other campaigns are not refuted 5
Missing two criteria 4 9
evidence to back it up
Absent 0
Absent 0 Missing one criterion 6
CLOSING ARGUMENT
DESCRIPTION OF BODY SYSTEM FUNCTION Missing two criteria 3
Clearly stated, easy to understand, 3
Accurate, clearly stated, easy to Absent 0 evidence to back it up
6
understand
Absent 0
Absent 0
PLACEMENT AND LABELLING OF ORGANS

AND PARTS
All organs and parts are accurately

4
placed and labeled
Either not labeled or placed correctly 3
Not all organs and parts accounted for 2
Absent 0
BALLOT ESSAY RUBRIC
QUESTION: WHY IS THERE NOT ONE SYSTEM

WHICH BODY SYSTEM IS MOST ESSENTIAL TO THAT IS MOST ESSENTIAL TO SURVIVAL OF THE
THE SURVIVAL OF THE HUMAN SPECIES? HUMAN SPECIES?
Nervous System Substandard

Student shows only a surface level understanding of why there is no
Integumentary System one system that is most essential to the survival of the species, and
cannot cite examples of this in practice or effectively refute
Skeletal System arguments to the contrary.
Muscular System
Adequate
Circulatory System Student shows clear but not deep understanding of why there is no
one system that is most essential to the survival of the species, cites
Respiratory System examples of this in practice, but cannot effectively refute arguments
to the contrary.
Digestive System
Proficient
Excretory System
Student shows clear and deep understanding of why there is no one
Endocrine System system that is most essential to the survival of the species, cites
examples of this in practice, but cannot effectively refute arguments
Reproductive System to the contrary.
Lymphatic System Exemplary

Student shows clear and deep understanding of why there is no one
system that is most essential to the survival of the species, cites
examples of this in practice, and effectively refutes arguments to the
contrary.
248
General Biology 2 - Colored Images
Lesson 2: Sex Linkage Lesson 3: Modification to

Lesson 5: DNA Replication and Protein Synthesis
and Recombination Mendels Classic Ratios
Page 26, 27, and 28
Page 10 Page 18
Lesson 5: DNA Replication and Protein
Synthesis, Page 28
250
Lesson 17.1: Compare and Contrast Process in Plants and Animals: Reproduction and Development
Pages 141, 142, and 143
Lesson 17.1: Reproduction and
Lesson 17.2: Reproduction and Development / Pages 150, 151, 152, and 153
Development / Pages 143 and 145
252
Lesson 17.2: Reproduction and Development
Pages 153, 154, and 155
Lesson 19: Gas Exchange / Page 184 Lesson 23: Chemical and Nervous Control / Page 217
Lesson 23: Chemical and Nervous Control /

Page 218
254
Lesson 23: Chemical and Nervous Control / Page 216
Lesson 17: Introduction to Reproduction / Page 138
Lesson 25: Feedback Mechanisms / Pages 240 and 241
!
256
Biographical Notes
IVAN MARCELO A. DUKA NEIL ANDREW B. BASCOS, PH.D.
Team Leader Writer
Prof. Ivan Marcelo A. Duka is an Associate Professor 5 and the Dr. Bascos is an Associate Professor 7 at the National Institute of
College Secretary of the College of Arts and Sciences at the Molecular Biology and Biotechnology at the University of the
University of the Philippines Los Banos. He has been teaching at Philippines Diliman. He earned his doctorate degree in Molecular
the university various courses, such as Biology 1 and 2, Molecular and Cellular Biology from Tulane University, New Orleans; and his
Biology, Evolutionary Biology, Cell Biology and Genetics for 40 bachelors degree in Molecular Biology and Biotechnology from
years. the University of the Philippines Diliman. He is also a Principal
Investigator at the Protein Structure and Immunology Laboratory
at the National Institute of Molecular Biology and Biotechnology,
He finished his Master of Science in Genetics from the University
UP Diliman. He is a member of the Technical Panel on Biology
of the Philippines Los Banos, and his Bachelors Degree in
and Molecular Biology at the Commission on Higher Education,
Biology, major in Zoology, in the same university. He also earned
and also became the Deputy Director for Facilities and Services
a Cell Biology Apprentice Degree from the University of Wales
at the National Institute of Molecular Biology and Biotechnology,
College of Cardiff, United Kingdom. He received numerous
University of the Philippines Diliman.
grants and fellowships, such as the AIDAB Fellowship Award in
Sydney, Australia; and the British Council Fellowship to the
University of Wales. He also wrote various papers, articles, books, MA. GENALEEN Q. DIAZ, PH.D.
laboratory manuals, and other teaching materials focusing on Writer
Biotechnology, Molecular Biology, Immunology, Recombinant Dr. Genaleen Diaz is Professor IV at the University of the
DNA Techniques, Physiology, and Genetic Engineering. Philippines Los Banos where she has been teaching
undergraduate and graduate subjects for 27 years. She is
currently the Head of Genetics and Molecular Biology Division of
Prof. Duka is also a Board Member of the Philippine Society for
the Institute of Biological Sciences. Dr. Diaz earned her doctorate
Biochemistry and Molecular Biology, a Subject Matter Specialist
degree in Genetics at the UPLB. She also completed her masters
of the Learning Resource Centre for Biology Tutorials and
degree in Genetics and her bachelors degree in Biology at the
Biology Summer Bridge Course, and a member of the UPLB
same university. Dr. Diaz is a member of the National Research
University Council. He is also primarily responsible for assisting
Council of the Philippines and the Outstanding Young Scientists,
incoming university instructors by providing them necessary
Inc. Her scholarly works were included in publications such as the
mentorship in classroom management and curriculum
Philippine Journal of Philippine Science and Technology, Journal
development.
of Genetics, and UPLBs Genetics Laboratory Manual.
MA. CARMINA C MANUEL, PH.D. IAN KENDRICH C. FONTANILLA, PH.D.
Writer Writer
Dr. Carmina Manuel is Assistant Professor V at the University of Dr. Ian Fontanilla has been teaching at the University of the
the Philippines Los Banos where she teaches subjects spanning Philippines Diliman for 20 years, where he is currently Assistant
molecular genetics, human genetics, and evolutionary biology. Professor. His researches are found in scholarly publications,
Dr Manuel is recipient of the IBS Outstanding Teacher Award for including the Philippine Journal of Science, Asia Life Sciences,
3 consecutive years since 2013. She has also presented her and the Zoological Journal of the Linnean Society. Dr. Fontanilla
authored research papers in Science conferences around the has presented academic papers in international conferences in
country. Dr. Manuel finished her doctorate degree in Genetics at the Philippines, Portugal, Brazil, Belgium, London, and Australia.
the UPLB. She earned her masters degree in Genetics and her He is a member of professional societies such as Unitas
bachelors degree (cum laude) also in UPLB. Malacologia and the Philippine Environmental Mutagen Society
among others. Dr. Fontanilla completed his doctorate in Genetics
at the University of Nottingham, while he earned his masters and
bachelors degrees in Biology at UP Diliman.
SHARON ROSE M. TABUGO, PH.D.
Writer
Dr. Sharon Rose is Assistant Professor IV at the Mindanao State
University - Iligan Institute of Technology where she has been EUGENIO P. QUIJANO, JR.
teaching for 6 years. Her academic papers and researches were Writer
published in a number of ISI-indexed and international journals Mr. Eugenio Quijano, Jr. has been teaching science for 25 years
such as the International Research Journal of Biological Sciences, now. He is currently a Biology and General Science teacher at the
the European Journal of Zoological Research, the Australian Xavier School and also a student Trainer in science competitions.
Journal of Biological Sciences, and the Global Journal of Prior to teaching, he has worked as a Researcher for the DOST
Medicinal Plant Research. Dr. Tabugo earned her doctorate and DepEd. Mr Quijano is a member of the Biology Teachers
degree in Biology at the MSU-IIT. She received her masters Association of the Philippines and the Greenpeace Organization.
degree in Biology as a DOST scholar also in MSU-IIT and she He is currently finishing his masters degree in Biological Sciences
graduated cum laude with a bachelors degree in Biology at the at the University of Santo Tomas. He finished his Certification
same university. Program in Education at the University of the Philippines Diliman,
and earned his bachelors degree in Biology at the UST.
258
ANNALEE S. HADSALL CAROLINE PAJARON
Technical Editor Writer
Prof. Annalee S. Hadsall is an Assistant Professor 7 at the Institute Caroline Hernandez Pajaron is a communication specialist and
of Biological Sciences, College of Arts and Sciences, University of journalist. She has 13 years of experience in content
the Philippines Los Banos. She earned her bachelors degree in development, production, and management with different
Biology, Cum Laude, from the Philippine Normal College. She agencies such as Globe Telecommunications, and Asian
finished her Master of Science degree in Botany, Major in Plant Development Bank . She is currently Information and Advocacy
Systematics, and a Minor degree in Horticulture at the University Officer of the Civil Society Coalition on the Convention on the
of the Philippines Los Banos, under the UP-NSDB Graduate Rights of the Child. Ms. Pajaron received her masters degree in
Manpower Scholarship Program. Journalism from the Ateneo de Manila University through a
Konrad Adenauer Center for Journalism grant. She graduated
She is also the curator for orchids and epiphytes at the UPLB from the Ateneo as a Father Nicholas Kulny scholar with degrees
Museum of Natural History. Her research interests include in English Literature and Communication. She is finishing her
morpho-anatomical diversity of indigenous Philippine orchids, doctorate degree in Public Administration at the University of the
biodiversity studies of Mt. Isarog, and phytogeographical Philippines.
patterns of epiphytes. With her work in botany studies, she was
able to describe three new plant species, and has written
laboratory exercises in biodiversity and general botany. She also MA. DANIELA LOUISE F. BORRERO
a writer in Distance Education Modules for the Diploma in Illustrator
Science Teaching of UP Open University. Ms. Daniela Borrero is a visual artist, photographer, writer, and
teacher. She is the Founder and Chief Operating Officer of the
Besides being prolific in her academic publications, she was also D11B Graphic Design Studio. She has also worked as Human
tapped by the Department of Education to evaluate teaching Resource Officer in a Law Office. Ms. Borreros works were part in
materials and general references in elementary Science. She exhibits such as The Heist Conference and Analog Signals in
became a trainer for Grades 8, 9, and 10 Science. She is actively Nova Gallery, and Maximum Purity in Prose Gallery. She
involved in training teachers, especially in biodiversity and plant graduated her bachelors degree in Home Economics and
systematics. Elementary Education at the University of the Philippines Diliman.

Bio2 Initial Release 13june PDF

Uploaded by

Copyright:

Available Formats

Bio2 Initial Release 13june PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Bio2 Initial Release 13june PDF

Uploaded by

Copyright:

Available Formats

The Commission on Higher Education

in collaboration with the Philippine Normal University

INITIAL RELEASE: 13 JUNE 2016

This Teaching Guide was collaboratively developed and reviewed by

Chapter 1: Genetics Tree of Life and Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109

Lesson 1: Pedigree Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Lesson 15: Systematics Based on Evolutionary Relationships:

Lesson 6: Genetic Engineering . . . . . . . . . . . . . . . . . . . . . . . . . 30 Lesson 17: Reproduction and Development . . . . . . . . . . . . . . . . . 136

Lesson 12: Evidences of Evolution . . . . . . . . . . . . . . . . . . . . . . 92 Lesson 25: Feedback Mechanisms . . . . . . . . . . . . . . . . . . . . . . . . 235

Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257

SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP

As we go broader on a macro-level perspective, General Biology 2 is designed to enhance the

College Readiness Standards Foundational Skills DepEd Functional Skills

Global awareness, scientific and economic literacy, curiosity,

Global awareness, media literacy, technological literacy,

Global awareness, multicultural literacy, collaboration and

Media literacy, multicultural literacy, global awareness,

1. predict genotypes and phenotypes of parents and STEM_BIO11/12-

CONTENT CONTENT STANDARD PERFORMANCE STANDARD LEARNING COMPETENCIES CODE

1. describe general features of the history of life on Earth,

4. trace the development of evolutionary thought STEM_BIO11/12-

6. infer evolutionary relationships among organisms using STEM_BIO11/12-

Code Book Legend

Learning Area and Strand/ Subject or Science, Technology, Engineering and

General Mathematics Statistics and Probability Media and Information Literacy

Tech): ICT for Professional Tracks Professional Purposes

Pagsulat sa Filipino sa Piling

Pre-Calculus Basic Calculus General Physics 1 General Physics 2

General Chemistry 1 General Biology 1 General Biology 2

Lesson 1: Pedigree Analysis

Specific Learning Outcomes: Practice Group Work: Non-Mendelian Traits in 40

compute the probability of occurrence of an affected offspring in a given Resources

REVIEW (15 MINS) Teacher Tip:

Sample pedigree with symbol guides

CROSS EXPECTED GENOTYPE(S) EXPECTED PHENOTYPE(S)

2. DD x Dd 50% DD: 50% Dd 100% dominant

3. DD x dd 100% Dd 100% dominant

4. Dd x Dd 25% DD: 50% Dd: 25% dd 75% dominant: 25% recessive

5. Dd x dd 50% Dd: 50% dd 50% dominant: 50% recessive

Lesson 2: Sex Linkage and

make a a research paper/case study/poster on transmission of a sex-linked Motivation Case Study 10

Lesson 3: Modification to Mendels Classic

Specific Learning Outcomes Materials

distinguish Mendelian from non-Mendelian modes of inheritance; and Resources

C. Use ABO blood typing in humans as example

5. Go back to the Motivation narrative

1. In cattle, coat color is inherited in a co-dominant fashion.

Lesson 4: Molecular Structure of DNA,

Enrichment Conversion to mRNA Transcripts 5

MOTIVATION (5 MINS) Teacher Tip:

INSTRUCTION (30 MINS)

Summary of Important Physical Properties

Phosphodiester bonds Essential for polynucleotide chain

RNA Single stranded but some bases For stability

Uracil Nitrogenous base found only in RNA.

One letter symbol for each Classes:

Teach the learners the single letter codes for the

Ask the learners to spell their names using the

Polypeptide sequence N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C

5 _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3