PCR Methods R
PCR Methods R
PCR
Methods and Protocols
Methods in Molecular Biology
Series Editor
JohnM. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB,UK
Edited by
Luclia Domingues
CEBCentre of Biological Engineering, University of Minho, Braga, Portugal
Editor
Luclia Domingues
CEBCentre of Biological Engineering
University of Minho
Braga, Portugal
Discovered by Kary Mullis in 1983, the polymerase chain reaction (PCR) is a breakthrough
technology that has allowed the advancement of different scientific fields, being a funda-
mental tool in current scientific research. As such, significant literature exists on the basics
of the PCR technique, but the specificities of its application to different areas of the bio-
technology and bioengineering field is mostly dispersed. Despite being a well-established
technique, novel applications are constantly emerging given the power and flexibility of
PCR, with continuous updates being published in this very exciting and moving field.
Thus, along with cutting-edge methodologies, this volume focuses on many core PCR
applications in the biotechnology and bioengineering field.
In the initial chapters, software for in silico PCR and primer design as well as some
particular PCR protocols, such as long fragment or degenerate PCR, are given. Subsequently,
particular focus is given to PCR applied to molecular and synthetic biotechnology, includ-
ing the presentation of a novel platform for high-throughput gene synthesis by PCR.Also,
a protocol is presented for nucleic acid extraction and molecular enrichment by whole
genome amplification (CRENAME) before PCR, which enables the multiparametric assess-
ment of potable/drinking water, but that can be easily applied to other type of samples. In
the following chapters, several examples of PCR applications in food science and technol-
ogy, environmental microbiology and molecular ecology, and healthcare are presented.
Within these, novel applications in currently hot research topics, such as synthetic biology,
food authentication and metagenomics are addressed. The book is not intended to cover all
existing PCR protocols, but rather to give an overview of the power and flexibility of this
technique with concrete examples in the biotechnology and bioengineering field. While
initially aimed to cover only end-point PCR, two chapters dealing with the detection of
allergens and soy in food matrices include real-time PCR protocols, as in these cases quan-
tification is mandatory.
In the fast-changing world of today, its hard to imagine how a simple technique not
only managed to stay popular for over 30 years, as its use is still expanding. One of the ways
PCR has managed to maintain ubiquitous has been through diverse technological advances.
This book aims to contribute to a current update of PCR-dependent methods and thus, to
be a valuable and useful resource for wet lab researchers, particularly within the biotechnol-
ogy and bioengineering field.
v
Contents
Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
vii
viii Contents
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281
Contributors
ix
x Contributors
Abstract
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important
practical molecular technique for the research laboratory. The principle of this technique has been further
used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In
parallel to laboratory wet bench experiments for nucleic acid amplification technologies, in silico or
virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico
NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or
probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis,
DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes
requires a search to determine whether they match a database with an optimal number of mismatches,
similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification
technologies, the prospects for the development of new NAAT or similar approaches should be taken into
account, including forward-looking and comprehensive analysis that is not limited to only one PCR tech-
nique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of
linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced
search. These tools are suitable for processing of batch files that are essential for automation when working
with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/
fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html.
Key words Polymerase chain reaction, Isothermal amplification of nucleic acids, DNA primers nucleic
acid hybridization, Primer binding site, PCR primer and probe analysis, Degenerate PCR, Probe,
Genetic engineering tools, DNA fingerprints
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_1, Springer Science+Business Media LLC 2017
1
2 Ruslan Kalendar et al.
Table 1
Summary of the FastPCR software features for in silico PCR facilities
2 Software
2.2 Downloading The FastPCR software for Windows is available for download at
andInstalling http://primerdigital.com/fastpcr.html. To install the program,
save the FastPCR.msi file in your computer. Run the FastPCR.
msi file that starts the installation wizard. Follow all steps
suggested by the wizard. This is a local software installation and
requires administrator rights to install.
The program manual, licence agreement, and files for installa-
tion are available on the internet at http://primerdigital.com/
fastpcr/ and the YouTube tutorial videos at http://www.youtube.
com/user/primerdigital.
The online FastPCR (jPCR) software requires the Java Runtime
Environment (http://www.oracle.com/technetwork/java/javase/
downloads/). Oracle strongly recommends that all Java users
upgrade to the latest Java 8 release.
Before using the online FastPCR software the user needs to
add the URL (http://primerdigital.com/) of this application to
Exception Site List (https://www.java.com/en/download/faq/
exception_sitelist.xml), which is located under the Security tab of
the Java Control Panel (http://www.java.com/en/download/
help/appsecuritydialogs.xml). The addition of this application
URL to this list will allow it to run after presenting some security
warnings. By adding the application URL to the Exception list the
users can run Rich Internet Applications (RIAs) that would nor-
mally be blocked by security checks. The exception site list is man-
aged in the Security tab of the Java Control Panel. The list is shown
in the tab. To add, edit, or remove an URL from the list, click Edit
Site List:
Click on the Edit Site List button.
Click the Add in the Exception Site List window.
Click in the empty field under Location field to enter the
URL: http://primerdigital.com/.
Click OK to save the URL that you entered. If you click
Cancel, the URLs are not saved.
Click Continue on the Security Warning dialog.
In order to enhance security, the certificate revocation check-
ing feature has been enabled by default starting in Java 7. Before
Java will attempt to launch a signed application, the associated cer-
tificate will be validated to ensure that it has not been revoked by
the issuing authority. This feature has been implemented using
both Certificate Revocation Lists (CRLs) and Online Certificate
Status Protocol (OCSP) mechanisms.
8 Ruslan Kalendar et al.
3 Methods
3.1 In Silico PCR For predicting the sensitivity and specificity of a primer pair it is
Searching Algorithm necessary an algorithm that searches for pairs of sites matching the
primers with certain differences, where the sites are separated by a
certain distance that represents the range of possible amplicon
lengths.
An implicit assumption is that stable hybridization of a primer
with the template is a prerequisite for priming by DNA polymerase.
Binding occurs if a primer is complementary to the nucleotide
sequence of the target. The stable binding of the primer to the
target is very important for PCR efficiency, being especially impor-
tant the stability and complementarity in the 3-termini of primer
from where the polymerase will extend. Mismatches at the 3 end
of the primers affect target amplification much more than mis-
matches at the 5 end. A two base mismatch at the 3 end of the
primer prevents amplification, while several mismatches at the 5
end of the primer allow amplification, although with reduced
amplification efficiency.
Therefore, the FastPCR software pays particular attention to
the 3 end portion of the primer and calculates the similarity of the
3 end of the primer to the target (the length is chosen by the user)
to determine the stability of the 3-terminus. A few mismatches
may be tolerated, typically at the expense of reduced amplification
efficiency. The parameters adopted are based on our experimental
In Silico PCR Tools for a Fast Primer and Probe Searching 9
data for efficient PCR and are translated into algorithms in order
to design combinations of primer pairs for optimal amplification.
Modeling the hybridization of primers to targeted annealing
sites is the only way to predict PCR products. The last 1012 bases
at the 3 end of primers are important for binding stability, as single
mismatches can reduce PCR efficiency, the effect increasing with
the proximity to the 3 end.
The FastPCR is a quick heuristic search algorithm, designed
for PCR primers and probes. FastPCR is computationally efficient,
achieving effective complexity that can approach linear time in the
database size and constant time in (i.e., independent of) the num-
ber of queries. This in silico tool is useful for quickly analyzing
primers or probes against target sequences, for determining primer
location, orientation, and efficiency of binding, and for calculating
their melting and annealing temperature. Moreover, there may be
other situations where the PCR product formation can occur with
a single primer that is complementary to inverted repeats placed
near to each other. Besides, the PCR primers may additionally uti-
lize one or more oligonucleotides (known as probe) for detection
of the formed PCR product.
Initially, the FastPCR software creates a hash-table for all
K-mers (words of fixed length K) to the primer set. The K-mers
length can be equal to 7, 9, or 12 nt, depending on the sensitivity
of the search, type of task and length of the primer. For each
K-mers, up to one mismatch inside is stipulated. Therefore, the use
of long K-mers (= 12 nt) does not result in loss of sensitivity and
does not lead to false negatives. In addition, the software allows
the use of a primer sequence shorter (down to 4 nt) than the mini-
mum K-mers (= 7 nt). The FastPCR algorithm searches for a
match to a forward primer by enumerating all K-mers in a database
sequence. The software offers flexible specificity stringency options.
The user can specify the number of mismatches that primers may
have to unintended targets at the 3 end region and where these
mismatches may be present. The default specificity settings are that
at least one mismatch exists in the last seven bases of the 3 end of
the primer. The parameters adopted are based on our experimental
data for efficient PCR and are translated into algorithms in order
to design combinations of primer pairs for optimal amplification.
The nucleotide sequence of the 3 end region of the probe may not
necessarily be completely complementary to the target. For
instance, both termini of the probe molecular beacon have not
complementary regions to the target.
The parameters for quick alignment can be set to allow differ-
ent degrees of mismatches at the 3 end of the primers: 05 mis-
matches, being the default number of mismatches 2. Furthermore,
the program can handle degenerate primer or probe sequences,
including those with 5 or 3 tail. The program includes the detec-
tion of the alternative hydrogen bonding to WatsonCrick base
10 Ruslan Kalendar et al.
3.3 Calculation The optimal annealing temperature (Ta) is the range of tempera-
ofOptimal Annealing tures where the efficiency of the PCR amplification is maximal
Temperature without nonspecific products. The most important values for esti-
mating the Ta is the primer quality, the Tm of the primers and the
length of the PCR fragment. Primers with high Tms (>60 C) can
be used in PCRs with a wide Ta range compared to primers with
low Tms (<50 C). The optimal annealing temperature for PCR is
calculated directly as the value for the primer with the lowest Tm
(Tmmin):
Ta (C ) = Tmmin + ln L ,
4 The Interface
4.1 The Program The software has a user-friendly interface, containing the menu,
Interface toolbars, ribbon, and three text editor tabs. Getting started with a
basic project in FastPCR software is as easy as opening a new or
existing file, copy-paste, or starting to type. The ribbon is designed
to help the user to quickly find the commands that are needed to
complete a task. Commands are organized in logical groups, which
are collected together under tabs. Each ribbon relates to a type of
activity, such as PCR Primer Design, In silico PCR, or Primer
Test.
There are three independent text editors at different tabs:
Sequences, Additional sequence(s) or Pre-designed primers
(probes) list, and Result report. The two first text editors are
necessary for loading sequences for analysis: the text editor
12 Ruslan Kalendar et al.
4.2 Input Data The sequence data file should be prepared using a text editor
(Notepad, WordPad, Word), and stored in the ASCII format as
text/plain or Rich Text Format (.rtf). The software accepts a num-
ber of different types of input formats and automatically deter-
mines the format of the input. To allow this feature there are
certain conventions required with regard to the input of identifiers.
The formats accepted as input data can be a single or multiple sepa-
rate DNA sequences in FASTA format, bare sequence, sequence
identifiers, tabulated format (two columns from Excel sheet or
Word table), EMBL, MEGA, GenBank and MSF, DIALIGN or
simple alignment formats, and Blast Queue web alignments result
format. The template length is not limited. NCBI Genbank acces-
sion records can be retrieved by querying with an accession num-
ber or NCBI sequence identifier through the File menu (Fig.1).
The software allows opening files in several ways:
The original file can be opened as read-only for editing with
text editors.
The larger files can be opened directly to memory without
using text editors.
Multiple files can be selected within a folder and opened to
memory during task execution.
Furthermore, users can type or import from file(s) into
Sequences or Additional sequence(s) or pre-designed primers
(probes) list editors. The entire target sequences to be used for in
silico PCR search should be pasted in the Sequences tab text
area and the primers list sequences should be pasted in the
Additional sequence(s) or pre-designed primers (probes) list tab
text area.
Once a sequence file is open, the software displays the informa-
tion about opened sequences and sequences format. The informa-
tion status bar shows the amount of sequences, total sequences
length (in nucleotides), nucleotide compositions, purine, pyrimi-
dine, and CG% contents.
In Silico PCR Tools for a Fast Primer and Probe Searching 13
Fig. 1 Input of FastPCR online Java version, primer sequences editor, and user interface
4.3 Program Output The software automatically generates results to the Result report
text editor in a tabulated format, ready for transferring to a
Microsoft Excel sheet with copy-paste. Alternatively, output results
can be easyly saved as .XLS or .RTF Text files compatible with
Excel or Open Office.
The separated output of the primer design comprises a list of
primers, a set of primer pair sequences with their theoretical PCR
products, and for multiplex PCR, the result of the calculation of
multiple PCR primers for given target sequences. The output
shows optimal annealing temperature for each primer pair, the size
of the PCR product and complete information for each designed
primer and for multiplex PCR product set.
14 Ruslan Kalendar et al.
4.4 In Silico PCR The in silico PCR program can be initiated by clicking on the
Application Settings ribbon in silico PCR. The required input items can be grouped
into three parts. (1) The entire target sequences should be pasted
in the Sequences tab text area. Target sequences can be either
multiple separate DNA sequences or opening files from the entered
folder. For in silico PCR against whole genome(s) or a list of chro-
mosome, user must specify a directory for input. The program will
be consistent, and file-by-file will look for the DNA sequence posi-
tion of the primers. (2) Single or primer list sequences to be tested
can be typed in or pasted as pre-existing primers list into the sec-
ond tab of the Additional sequence(s) or pre-designed primers
(probes) list text editor. The amount of preexisting primers is not
limited to one primer pair, it can be as much as the user needs. (3)
The searching parameters into the tab of Parameters for PCR
Product Analysis contain:
The box of Maximal PCR Product length (bp), which has
the default value of 5000 bpallows the user to define the
maximal size of the expected PCR product; any amplicons
larger than a defined value will be filtered out.
PCR product prediction, which has the default value of
checkedto search for primer binding sites without further
analysis of potential PCR fragments this option should be
disabled.
Circular sequencein the analysis of circular molecules
(plasmid, mitochondrial or plastid DNA, etc.) the primers can
produce one or two amplicons.
C >> T bisulphite conversiondesign of specific PCR
primers for in silico bisulphite conversion for both strands of
bisulphite modified genome sequences; only cytosines not
followed by guanidine (CpG methylation) will be replaced by
thymines.
Restrict analysis for F/R primer pairsthis option is used
for analysis of primer lists, where each primer pairs are united
by the common name. Similar analysis can be carried out for
primers with the same names or with names that differ in the
last letterF/R.The program will recognize paired primers
(Forward as F and Reverse as R). For this type of analysis,
primers from the same pair(s) must have identical names and
finish with R or F (e.g., seq1R and seq1F form a pair).
The name length and structure (including F and R inside
names) are not important. Moreover, the program is not lim-
ited in one unique pair per primer: for one Forward primer,
there can be several reverse, and the same for the Reverse
primer. The searching of potential amplicons will be carried
out only for these primer pairs, while other primers from list
will be ignored.
In Silico PCR Tools for a Fast Primer and Probe Searching 15
4.5 Additional The additional configuration settings allow optimizing the primer or
Options Relating probe binding site search and increasing the representativeness of the
toRepresentation results. This is mainly determined by the following parameters:
ofResults Show all matching for primers alignment, checked by
defaultthe software shows all matches of stable binding
primer to the target. Not in all cases the combinations of prim-
ers are able to produce the PCR products in the current assay
conditions, but the user can examine the stability of primer
binding sites, orientation and coordinates in the target.
Show alignment only for matching primers for PCR prod-
uctin the previous option all primer binding sites were rep-
resented, while in this case the analysis of primer and target
alignment will be shown only for matching primers.
Show only amplicons lengthschecking this option allows the
user to collect only amplicons lengths without analysis of primer
and target alignment. This option is recommended for in silico
PCR of whole genomes, including analysis of all chromosomes
with highly abandoned repeated sequences (in silico PCR for
techniques based on repeats: iPBS, IRAP, ISSR, or RAPD).
The main search criteria for primer binding sites that the users
can select into the Pre-designed Searching Options tab are:
Default criteria searchingK-mers = 9 nt with up to a single
mismatch at the 3 termini (single mismatch within K-mers)
and at least 15 bases complementarity for primers longer than
14 nucleotides. The Default criteria searching is recom-
mended for searching of primer binding sites, because this pro-
vides the most effective and fastest searching and minimizes
false positives. This criterion is also recommended when using
degenerated target DNA or/and primers.
Strong criteria searchingK-mers = 12 nt with a single mis-
match at the 3 termini and at least 15 bases complementarity for
primers longer 14 nucleotides. The Strong criteria searching is
recommended when it is necessary the fast searching of primer
binding sites with minimum mismatches at the 3 termini.
Seldom, when primer sequences or target DNA are degenerate
and when using the Strong criteria of searching no primer
binding sites are revealed. In this case, it is necessary to use the
Sensitive criteria searching and Degenerated sequence.
Sensitive criteria searchingK-mers = 7 nt with a maximum
of two mismatches at the 3 termini (single mismatch within
K-mers) and at least 15 bases complementarity for primers lon-
ger than 14 nucleotides.
Degenerated sequenceK-mers = 7 nt with a maximum of
three mismatches at the 3 termini and at least 15 bases com-
plementarity for primers longer than 14 nucleotides.
16 Ruslan Kalendar et al.
In some cases, the user can use the option of Probe search
or Advanced (Linked) search.
The Probe search helps the user to execute searching of
binding sites not only for primers but also for probes (TaqMan,
molecular beacon, microarrays, etc.). By default, the K-mers value
is set equal to 9 with up to a single mismatch within K-mers.
However, if the probe length is less than 9 and more than 3, the
length of the K-mers will be set equal to the probes length. This
option is recommended when primer binding sites were not found
or for searching of binding sites of probes for which the comple-
mentarity is expected only for part of the sequence (e.g., in molec-
ular beacon, where both termini do not have complementary
regions to the target).
The Linked (Associated) search is a programmable search-
ing that can be used when binding sites for primers or probes are
searched within a determined distance. This criterion is described
in detail below.
4.6 In Silico PCR Running in silico PCR analysis with the FastPCR is a stepwise pro-
Analysis Steps cess. The user has the ability to set all possible parameters required
to run in silico PCR analysis interactively:
1. Select a task type at the ribbonin silico PCR.
2. Input user data.
(a) The entire target sequences to be used for in silico PCR
search should be pasted in the Sequences tab text area.
(b) The entire primers list sequences should be pasted in the
Additional sequence(s) or pre-designed primers (probes)
list tab text area.
3. Choose an algorithm.
(a)
By defaultstandard algorithm for matching of stable
binding primer to the target searching.
(b) Probe search.
(c) Linked search.
4. Set parameters.
5. Run.
6. Visualize results.
5.1 Example To validate the software, the NCBI Eucariota database of genome
forSoftware sequences (https://www.ncbi.nlm.nih.gov/genome/browse/) was
Validation used as a target set to measure search performance and accuracy
(false negatives and false positives). Primer and probe sequences
from the retrotransposons sequence were obtained as query sets.
In Silico PCR Tools for a Fast Primer and Probe Searching 17
5.2 In Silico PCR For in silico PCR analysis, the Java Web-based application or
Application: Windows FastPCR software is suitable, allowing the analysis of a
Example 1 set of sequences. Several simple in silico PCR examples may be
found from the menu File: in silico PCR example 1 & 2 and in
silico PCR, complex search.
1. Launch the jPCR server through http://primerdigital.com/
tools/pcr.html or from the desktop using the Java Web Start
(JavaWS) command:
javawshttp://primerdigital.com/j/pcr.jnlp.
Table 2
Search times and total numbers of hits for degenerate primer pair corresponding to highly conserved
peptide sequence of plant copia-type reverse transcriptase (RT) for several eukaryotic genomes from
EMBL-EBI database
ITS1 TCCGTAGGTGAACCTGCGG
ITS2 GCTGCGTTCTTCATCGATGC
ITS3 GCATCGATGAAGAACGCAGC
ITS4 TCCTCCGCTTATTGATATGC
ITS5 GGAAGTAAAAGTCGTAACAAGG
KAN2-FP ACCTACAACAAAGCTCTCATCAACC
KAN2-RP GCAATGTAACATCAGAGATTTTGAG
L_SP6 TCAAGCTATGCATCCAACGCG
L_T7 TAGGGCGAATTGGGCCCGACG
3. Upload the FASTA file from the selected location, copy and
paste, type or import from file(s). The entire target sequences
to be used for in silico PCR search should be entered in the
Sequences tab text area and the primers list sequences should
be pasted or loaded from a file in the Additional sequence(s)
or pre-designed primers (probes) list tab text area. If the tar-
get sequences or primers list are recognized by the program,
the software will rapidly indicate features for these sequences,
such as format, length, G% content and Tm.
4. Select the in silico PCR ribbon. Optionally, users can specify
searching options: stringency and PCR product detection
options. At the stringency options, users can specify the number
of mismatches that primers are allowed at the 3 end. The default
specificity settings are for a maximum of two mismatches within
the 3 end of the primer. These mismatches within the 3 end of
the primer should not be located close to each other.
5. To execute the searching task click F5 or Run in the drop-
down menu.
5.3 Results Once the in silico PCR analysis is complete, the result will appear
Interpretation in the third Result text editor tab, In silicoPCR Result, when any
targets have been found from the designated genome or sequences.
The results in the In silico PCR Result text editor reports the
specificity of the primers (locations, including target position, simi-
larity, and Tm), summary of primer pairs in relation to the PCR
template, as well as detailed information on each primer pair, their
length and Ta (Fig.2).
The description line of a primer begins with In silico Primer(s)
search for: followed by the target name and the FASTA descrip-
tion of the target genome sequence. The description line of a
template begins with a > sign followed by its identification. A
query primer begins without a > sign followed by its identifica-
tion, including their original sequence. It will show target-specific
primers if found, and the actual targets will be listed along with
detailed alignments between primers and targets.
Features of the individual reports of the query primers include
representation of their alignments with the target sequence. The
actual target fragments will be listed along with detailed align-
ments and linked query sequences, as well as with detailed infor-
mation on each query sequence, including locations on target
position and its similarity (Fig.2).
The alignment of query primers to their target template will be
shown along with their starting and ending coordinates. Nucleotides
on the template which perfectly match with the aligned query are
embodied by a vertical bar and those mismatched nucleotides are
given as a colon (at least similarity 60%) or by a space.
The products are grouped by the target template where they are
found in. One or multiple products can be found with product size
20 Ruslan Kalendar et al.
Fig. 2 In silico PCR detailed result for example 1 is shown. The primer-template binding is shown with the
presence of mismatches, coordinates on target DNA and its similarity and Tm. It will show target-specific prim-
ers if found, the actual targets will be listed along with detailed alignments between primers and targets. If the
potential amplicons for primer pairs in relation to the PCR template were found, the detailed information on
each primer pair, its length and Ta would be shown
5-gcttgtcctcaagcgaaaassa->
||||||||||||||||:::::|
tcgcttgtcctcaagcgarrrnnaagtg
5-gcttgtcctcaagcgaaaassa->
||||||||||||||||::::::
tcgcttgtcctcaagcgawrwnnratcc
2 5'-cgcagcgttctcataaggtcr
<-rctggaatactcttgcgacgc-5
::|||||||||||||||||||
cgssaccttatgagaacgctgcgacgc
>1 251->272
5'-gcttgtcctcaagcgaaaassa
>2 1074<-1094
5'-cgcagcgttctcataaggtcr
PCR product size: 844bp Ta=66C
>1 285->306
5'-gcttgtcctcaagcgaaaassa
>2 1074<-1094
5'-cgcagcgttctcataaggtcr
PCR product size: 810bp Ta=66C
5.4 In Silico PCR To obtain genome sequence data, the entire genome sequence
Application: content of the EMBL-EBI database or any other genome data-
Example 2 bases source has to be downloaded in a FASTA format into local
folders on your computer.
1. Access the EMBL-EBI database through http://www.ebi.
ac.uk/genomes/eukaryota.html or collect a plant genome
sequence from publicly available databases, such as NCBI
(https://www.ncbi.nlm.nih.gov/genome/browse/).
2. Select the download format and, optionally, customize the
FASTA header.
22 Ruslan Kalendar et al.
3. Click on any file from the folder in the File Menu or select
Working with all files from folder (Ctrl-J) to enter the entire
target genome sequences in the Sequences tab without
opening to Editor.
4. The degenerate primer pair corresponding to highly conserved
peptide sequence of plant copia-type reverse transcriptase (RT):
>RT+(QMDVK)
5-CARATGGAYGTNAARAC
>RT-(YVDDML)
5-CATRTCRTCNACRTA
should be pasted into the Additional sequence(s) or pre-
designed primers (probes) list tab text area.
5. Select the in silico PCR ribbon. The default specificity settings
are set to a maximum of two mismatches within the 3 end of
the primer. These mismatches should not be located close to
each other. Set the Maximal PCR product length (bp) equal
to 1000 and select the Show only amplicons lengths.
6. To execute the searching task click F5 or Run in the drop-
down menu.
Results from the analysis of the human and of some plant
genomes are represented in Table2. For the human genome, these
primers cannot be used due to strong differences in the sequence
of the Reverse Transcriptase gene from animals and plants, which
explains the absence of amplicons for the human genome.
The analysis summary information, including amplicons, their
length and Ta, will be presented for each file separately (nuclear
DNA, plastid and mitochondrial DNA) (Fig.3). For the present
example, the length of the amplicons ranged from 270 to 281 bp,
which corresponds to the expected value.
Similar to this example, the in silico PCR can be carried out for
whole genome analysis as well as for any other tasks, such as in
silico RAPD or other methods, based on using repeat DNA
sequences. Also, it is likely to be suitable for genotyping or DNA
fingerprinting, by using random primers for retroelements from
published genomes.
Furthermore, a similar analysis can be carried out for detecting
sequences inserted into plasmid vectors after DNA sequencing.
based on the ends of the inserted sequence. For this, instead of
using primers, one may use small sequences flanking the insertion
or within the insertion. In this case, the Probe search option
should be applied.
5.5 Programmed The in silico PCR is one example of sequence similarity searching,
(Linked, Associated) in which primer sequences are placed at a certain distance and ori-
Searching ented to each other.
In Silico PCR Tools for a Fast Primer and Probe Searching 23
5.6 Example In the in silico PCR example 2, two degenerate Copia-type reverse
ofanAlternative Way transcriptase RT primers were used for in silico PCR search with
ofInSilico PCR expected amplicons from 200 to 300 bp:
byLinkedSearch >RT+(QMDVK)
5-CARATGGAYGTNAARAC
>RT-(YVDDML)
5-CATRTCRTCNACRTA
This task can also be solved by Linked search. For this, the
sequences of both primers should be rewritten in a single line with
indication of the expected distance between them:
>RT+(QMDVK)_RT-(YVDDML)
CARATGGAYGTNAARAC [200300] TAYGTNGAYGAYATG
In this example, the Forward primer (5-CARATG
GAYGTNAARAC) is written on the left, followed by the expected
distance between primer-template binding sites ([200300]) and
then the Reverse primer (5-CATRTCRTCNACRTA) represented
in the complementary sequence (TAYGTNGAYGAYATG).
After the Linked search is performed, the local alignment of
query sequences (primers) and target DNA sequence between
primer-template binding sites is presented (Fig.4):
atcaaatggatgtcaagtcggccttct/../tgatcgcat-
gcttatatgtagatgacttgat
In silico Primer(s) search for:
C:\Users\Genomes\Arabidopsis\AE005172.
fasta//arabidopsis thaliana chromosome 1 top
arm, complete sequence:
>RT+(QMDVK)_RT-(YVDDML)
CARATGGAYGTNAARAC[200-300]TAYGTNGAYGAYATG
Fig. 4 In silico PCR Linked search detailed result for the search of two degenerate Copia-type reverse tran-
scriptase (RT) primers in Arabidopsis genome is shown
5.7 Linked Search The in silico searching and extraction from the plant genomes of
Example: Cassandra the LTR-retrotransposon Cassandra sequences is as an example of
LTR Retrotransposon Linked search utilization. The Cassandra retroelement LTR-
Searching retrotransposon, universally carries conserved 5S rRNA sequences
and associated RNA polymerase III promoters in their long termi-
nal repeats (LTR), and are found in all vascular plants investigated.
The use of conservative sequences for all LTR-retrotransposon
Cassandra allowed us to find new copies of this retrotransposon in
plant genomes, and revealed the presence of the Cassandra LTR-
retrotransposon in plant species not previously identified.
5S rRNA sequences from the Cassandra LTR-retrotransposon
contains two conservative regionsboxA (RGTTAAGYRHGY)
and boxC (RRRATRGGTRACY), separated by 18 nt. Furthermore,
in the center of the Cassandra LTR-retrotransposon, it is located a
conserved segment, the PBS sequence (TGGTATCAGAGC).
Within PBS (primer binding site), located near to the 3 end of the
5 LTR, there is a 1218 bp sequence, complementary to the 3 tail
of some tRNA.
The PBS of the Cassandra LTR-retrotransposon is located in
the LTR at 8 bp from the sequence encoding the 5S rRNA for
ferns and 173 bp or longer for Brassica species. For this reason, the
In Silico PCR Tools for a Fast Primer and Probe Searching 27
Fig. 5 In silico PCR Linked search detailed result for the example Cassandra LTR retrotransposon searching
is shown
atagttaagcgtgcttgggctagagtagtttcacgataggt-
gaccttccggga/../gggcgttacaagtggtatcagagccaaa
In silicoPrimer(s) search for: AE005173.
fasta//ENA|AE005173|AE005173.1Arabidopsis
thalianachromosome 1 bottom arm, complete
sequence.
1 5'-RGTTAAGYRHGY[1525]RRRATRGGTRACY[5-200]
TGGTATCAGAGC
Acknowledgments
Java Web tools are publicly available. They may not be reproduced
or distributed for commercial use. This work was supported by the
companies Primer Digital Ltd.
30 Ruslan Kalendar et al.
References
1. Walker-Daniels J(2012) Current PCR meth- chain reaction. JPharm Bioallied Sci 5(4):245
ods. Mat Methods 2:119. doi:10.13070/ 252. doi:10.4103/0975-7406.120066
mm.en.2.119 15. Liu W etal (2015) Polymerase spiral reaction
2. Tisi LC etal. (2010) Nucleic acid amplifica- (PSR): a novel isothermal nucleic acid amplifi-
tion. Canada Patent CA2417798 cation method. Sci Rep 5:12723. doi:10.1038/
3. Notomi T etal (2000) Loop-mediated isother- srep12723
mal amplification of DNA.Nucleic Acids Res 16. Smykal P etal (2009) Evolutionary conserved
28(12):e63. doi:10.1093/nar/28.12.e63 lineage of Angela-family retrotransposons as a
4. Walker GT etal (1992) Strand displacement genome-wide microsatellite repeat dispersal
amplificationan isothermal, invitro DNA agent. Heredity (Edinb) 103(2):157167.
amplification technique. Nucleic Acids Res doi:10.1038/hdy.2009.45
20(7):16911696. doi:10.1093/ 17. Kalendar R, Schulman AH (2014) Transposon-
nar/20.7.1691 based tagging: IRAP, REMAP, and
5. Banr Jetal (1998) Signal amplification of iPBS.Methods Mol Biol 1115:233255.
padlock probes by rolling circle replication. doi:10.1007/978-1-62703-767-9_12
Nucleic Acids Res 26(22):50735078. 18. Kalendar R etal (2011) Analysis of plant diver-
doi:10.1093/nar/26.22.5073 sity with retrotransposon-based molecular
6. Tatsumi K etal (2008) Rapid screening assay markers. Heredity 106(4):520530.
for KRAS mutations by the modified smart doi:10.1038/hdy.2010.93
amplification process. JMol Diagn 10(6):520 19. Hosid E etal (2012) Diversity of long terminal
526. doi:10.2353/jmoldx.2008.080024 repeat retrotransposon genome distribution in
7. Kwoh DY etal (1989) Transcription-based natural populations of the wild diploid wheat
amplification system and detection of amplified Aegilops speltoides. Genetics 190(1):263274.
human immunodeficiency virus type 1 with a doi:10.1534/genetics.111.134643
bead-based sandwich hybridization format. 20. Belyayev A etal (2010) Transposable ele-
Proc Natl Acad Sci U S A 86(4):11731177 ments in a marginal plant population: tempo-
8. Fahy E etal (1991) Self-sustained sequence ral fluctuations provide new insights into
replication (3SR): an isothermal transcription- genome evolution of wild diploid wheat.
based amplification system alternative to Mobile DNA 1(6):116. doi:10.1186/
PCR.PCR Methods Appl 1(1):2533. 1759-8753-1-6
doi:10.1101/gr.1.1.25 21. Kalendar R etal (2014) FastPCR software for
9. Vincent M etal (2004) Helicase-dependent PCR, in silico PCR, and oligonucleotide
isothermal DNA amplification. EMBO Rep assembly and analysis. In: Valla S, Lale R (eds)
5(8):795800. doi:10.1038/sj. DNA cloning and assembly methods, Methods
embor.7400200 in molecular biology, vol 1116. Humana,
10. Kurn N etal (2005) Novel isothermal, linear NewYork, NY, pp271302.
nucleic acid amplification systems for highly doi:10.1007/978-1-62703-764-8_18
multiplexed applications. Clin Chem 22. Kalendar R etal (2011) Java web tools for
51(10):19731981. doi:10.1373/ PCR, in silico PCR, and oligonucleotide
clinchem.2005.053694 assembly and analysis. Genomics 98(2):137
11. Fang R etal (2009) Cross-priming amplifica- 144. doi:10.1016/j.ygeno.2011.04.009
tion for rapid detection of Mycobacterium 23. Lexa M etal (2001) Virtual PCR.Bioinformatics
tuberculosis in sputum specimens. JClin 17(2):192193. doi:10.1093/
Microbiol 47(3):845847. doi:10.1128/ bioinformatics/17.2.192
JCM.01528-08 24. Yu B, Zhang C (2011) In silico PCR analysis.
12. Zhao Y etal (2015) Isothermal amplification of Methods Mol Biol 760:91107.
nucleic acids. Chem Rev 115(22):12491 doi:10.1007/978-1-61779-176-5_6
12545. doi:10.1021/acs.chemrev.5b00428 25. Salinas NR, Little DP (2012) Electric LAMP:
13. Katja Niemann VT (2015) Isothermal amplifi- virtual loop-mediated isothermal
cation and quantification of nucleic acids and AMPlification. ISRN Bioinform 2012:696758.
its use in microsystems. JNanosci Nanotechnol doi:10.5402/2012/696758
06(03). doi:10.4172/2157-7439.1000282 26. Johnson M etal (2008) NCBI BLAST: a better
14. Fakruddin M etal (2013) Nucleic acid amplifi- web interface. Nucleic Acids Res 36(Web
cation: alternative methods of polymerase Server issue):59. doi:10.1093/nar/gkn201
In Silico PCR Tools for a Fast Primer and Probe Searching 31
27. Boutros PC, Okey AB (2004) PUNS: tran- chain reaction. BMC Bioinformatics 13:134.
scriptomic- and genomic-in silico PCR for doi:10.1186/1471-2105-13-134
enhanced primer design. Bioinformatics 32. Peyret N etal (1999) Nearest-neighbor ther-
20(15):23992400. doi:10.1093/bioinfor- modynamics and NMR of DNA sequences
matics/bth257 with internal A.A, C.C, G.G, and T.T mis-
28. Bikandi Jetal (2004) In silico analysis of com- matches. Biochemistry 38(12):34683477.
plete bacterial genomes: PCR, AFLPPCR and doi:10.1021/bi9825091
endonuclease restriction. Bioinformatics 33. SantaLucia JJr etal (1996) Improved nearest-
20(5):798799. doi:10.1093/bioinformatics/ neighbor parameters for predicting DNA
btg491 duplex stability. Biochemistry 35(11):3555
29. Rotmistrovsky K etal (2004) A web server for 3562. doi:10.1021/bi951907q
performing electronic PCR.Nucleic Acids Res 34. Lane AN etal (2008) Stability and kinetics of
32(Suppl 2):W108W112. doi:10.1093/nar/ G-quadruplex structures. Nucleic Acids Res
gkh450 36(17):54825515. doi:10.1093/nar/gkn517
30. Gardner SN, Slezak T (2014) Simulate_PCR 35. Shing Ho P (1994) The non-B-DNA structure
for amplicon prediction and annotation from of d(CA/TG)n does not differ from that of
multiplex, degenerate primers and probes. Z-DNA.Proc Natl Acad Sci U S A
BMC Bioinformatics 15(1):16. 91(20):95499553
doi:10.1186/1471-2105-15-237 36. Nomenclature for incompletely specified bases
31. Ye Jetal (2012) Primer-BLAST: a tool to in nucleic acid sequences (1984) http://www.
design target-specific primers for polymerase chem.qmul.ac.uk/iubmb/misc/naseq.html.
Chapter 2
Abstract
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and
probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR
efficiency. The software provides comprehensive facilities for designing primers for most PCR applications
and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse,
real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and
loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucle-
otide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile
across a region(s) of interest. The software calculates the melting temperature for the standard and degen-
erate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analy-
ses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex
detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program
consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA%
content, and the purinepyrimidine skew. It also analyzes the linguistic sequence complexity and performs
generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to
find or create restriction enzyme recognition sites for coding sequences and supports the clustering of
sequences. It performs efficient and complete detection of various repeat types with visual display. The
FastPCR software allows the sequence file batch processing that is essential for automation. The program
is available for download at http://primerdigital.com/fastpcr.html, and its online version is located at
http://primerdigital.com/tools/pcr.html.
Key words PCR primer design, Isothermal amplification of nucleic acids, Software probe design,
DNA primers, DNA primers nucleic acid hybridization, Degenerate PCR, Tiling arrays, Primer lin-
guistic complexity, Ligase chain reaction
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_2, Springer Science+Business Media LLC 2017
33
34 Ruslan Kalendar et al.
Table 1
Summary of the FastPCR software for PCR, in silico PCR, and oligonucleotide assembly and analysis
Features
CR tool provides comprehensive facilities for designing primers for most PCR applications and their
P
combinations:
Standard, multiplex, long distance, inverse, real-time PCR (LUX and self-reporting), group-specific
(universal primers for genetically related DNA sequences) or unique (specific primers for each from
genetically related DNA sequences), overlap extension PCR (OE-PCR)multi-fragments assembling
cloning and loop-mediated isothermal amplification (LAMP); single primer PCR (design of PCR
primers from close located inverted repeat), automatically detecting simple sequence repeat (SSR)
loci and direct PCR primer design, amino acid sequence degenerate PCR, polymerase chain assembly
(PCA), design amplicons that tile across a region(s) of interest
A long oligonucleotide can be designed for microarray analyses and dual-labeled oligonucleotides for
probes such as molecular beacons
PCA or oligonucleotides assemblycreated to automate the design oligonucleotide sets for long
sequence assembly by PCR
In silico (virtual) PCR or multiple primer or probe searches, or in silico PCR against whole
genome(s) or a list of chromosome prediction of probable PCR products, and search for potential
mismatching locations of the specified primers or probes
Testing of individual primers, melting temperature calculation for standard and degenerate
oligonucleotides including LNA and other modifications
PCR efficiency, linguistic complexity, dimer and G/C-quadruplex detection, dilution and
resuspension calculator
Analysis of features of multiple primers simultaneously, including Tm, GC content, linguistic
complexity, dimer formation; optimal Ta
Tool for identifying SSR loci by analyzing the low complexity regions of input sequences
Tool for restriction IIIIII types enzymes and homing endonucleases analysis, find or create
restriction enzyme recognition sites for coding sequences
Tool for searching for similar sequences (or primers)
Translates nucleotide (DNA/RNA) sequences to the corresponding peptide sequence in all six
frames for standard and degenerate DNA and modifications (inosine, uridine)
The program includes various bioinformatics tools for patterns analysis of sequences with GC:(G
C)/(G + C), AT:(A T)/(A + T), SW:(S W)/(S + W), MK:(M K)/(M + K), purine
pyrimidine (R Y)/(R + Y) skews, CG%, GA% content and purinepyrimidine skew, the melting
temperature, considers linguistic sequence complexity profiles
2 Software
2.2 Downloading The online version of the FastPCR software requires the Java
andInstalling Runtime Environment (http://www.oracle.com/technetwork/
java/javase/downloads/). The Oracle company strongly recom-
mends that all Java users upgrade to the latest Java 8 release.
The online version FastPCR software users need to add the
URL (http://primerdigital.com/) of this application to the
Exception Site List (https://www.java.com/en/download/faq/
exception_sitelist.xml), which is located under the Security tab of
the Java Control Panel (http://www.java.com/en/download/
help/appsecuritydialogs.xml). Adding this application URL to the
list will allow it to run after presenting some security warnings.
Existence of the application URL in the Exception list allows users
to run Rich Internet Applications (RIAs) that would normally be
blocked by security checks. The exception site list is managed in the
Security tab of the Java Control Panel. The list is shown in the tab.
To add, edit or remove a URL from the list, use the following:
Click on the Edit Site List button.
Click the Add in the Exception Site List window.
Click in the empty field under Location field to enter the URL:
http://primerdigital.com/.
Click OK to save the URL that you entered. If you click
Cancel, the URLs will not be saved.
Click Continue in the Security Warning dialog.
In order to enhance security, the certificate revocation check-
ing feature has been enabled by default (starting from Java 7).
Before Java attempts to launch a signed application, the associated
certificate will be validated to ensure that it has not been revoked
by the issuing authority. This feature has been implemented using
both Certificate Revocation Lists (CRLs) and Online Certificate
Status Protocol (OCSP) mechanisms.
Optionally, users can download self-signed certificates file
(http://primerdigital.com/j/primerdigital.cer) and import it to
Signer CA (Certificate Authority) from the Java Control Panel.
Finally, users need to set Security Level to High under the
Security tab of the Java Control Panel (as it is shown on the
38 Ruslan Kalendar et al.
picture: http://primerdigital.com/image/primerdigital_certificate_
big.png).
Running and downloading online jPCR software from a desktop
computer using the Java Web Start (JavaWS) command:
javaws http://primerdigital.com/j/pcr.jnlp
or
javaws http://primerdigital.com/j/pcr2.jnlp
Alternatively, users can run the software directly from the WEB
site: http://primerdigital.com/tools/pcr.html.
3 The Interface
3.1 Inputs The software contains the menus, the toolbars, the ribbon, and
toFastPCR three text editors. The ribbon is designed to help the user to quickly
find the commands that are needed to complete a task. Commands
are organized in the logical groups, which are displayed together
under tabs (Fig.1). Each tab relates to a type of activity, such as
PCR Primer Design, in silico PCR, or Oligo Test.
Getting started with a basic project in the FastPCR software is
as easy as opening a new or existing file as well as a copy-paste or
starting to type.
There are three independent text editors at different tabs:
General Sequence(s), Additional sequence(s) or pre-designed
primers (probes) list, and Result report.
The two first text editors are necessary for loading sequences
for analysis, the General Sequence(s) text editor is designed for
working with the project sequences; the Additional sequence(s)
or pre-designed primers (probes) list text editor is applied for spe-
cial and additional sequences, for example, for predesigned prim-
ers, multiple query sequences or for the numbers for input.
3.2 Program Output The FastPCR software automatically generates results in the third
text editor named as Result report. It is performed in a tabulated
format for transferring the results to Microsoft Excel sheet from a
clipboard with a copy-paste method or to save them as .XLS or
.RTF text file, compatible with both MS Excel and Open Office.
Moreover, the program also produces results containing the list of
primers, a set of primer pair sequences with their theoretical PCR
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 39
products and for multiplex PCR. It also provides a user with the
results of the calculation of multiple PCR primers for a given target
sequences. In addition, the output shows the optimal annealing
temperature for each primer pair as well as the size of PCR product
and complete information for each primer designed and for the
multiplex PCR product set.
3.3 Sequence Entry Prepare your sequence data file using a text editor (Notepad,
WordPad, Word), and save in a ASCII text/plain format or a Rich
Text Format (.rtf). The program takes either a single sequence or
accepts multiple separate DNA sequences in the FASTA, tabulated
(two columns from either MS Excel sheet or Word table), EMBL,
MEGA, GenBank and MSF, DIALIGN format or in the simple
alignment and Blast Queue web alignments result formats. The
template length is not limited.
The FastPCR software clipboard allows user to copy/paste
operations with text or table from Microsoft Office documents or
Excel worksheets (or other programs) and use them in another MS
Office document. Importantly, the full target sequences must be
40 Ruslan Kalendar et al.
prepared in the same format. User can type or import data from
file(s) into the General Sequence(s), Additional sequence(s) or
pre-designed primers (probes) list editors. In the FastPCR soft-
ware users have several options on how to open a file while starting
the program. The user can open the original file as read-only in
order to work with text editors, or open file to memory without
opening to text editors, which is the better choice for large file(s).
An alternative way to open files is by showing to the program the
entered folder; the program will open each file while executing task
without opening it to text editor. Additionally, users can open all
files from a selected folder and program will combine all the files in
a text editor. For example, this feature can be applied for convert-
ing all files from the selected folder into a single file presenting the
list of FASTA sequences. As opposed to this feature, the program
allows splitting of FASTA sequences into individual files in a
selected folder. At the time, users can download file(s) from the
NCBI Genebank server by accession number(s). The identifier
may be a Genebank accession, accession.version or gis (e.g.,
p01013, AAA68881.1, 129295) and a bar-separated NCBI
sequence identifier (e.g., gi|129295). Spaces (or comma) between
identifiers in the input will lead to downloading all sequences
simultaneously to text-editor (spaces before or after the identifier
are allowed).
When a sequence file is open, the FastPCR software displays
the information about the opened sequences and the sequences
format. The information status bar shows the amount of sequences,
total sequences length (in nucleotides), nucleotide compositions,
purine, pyrimidine, and CG% contents.
When users save a file from the current text editor, they must
choose the file format to save the file, e.g., Rich Text Format (.rtf),
MS Excel worksheet (.xls), or text/plain format (.txt).
3.4 FASTA Format The FastPCR software normally is expected to read files with
Description sequences in FASTA format (http://blast.ncbi.nlm.nih.gov/
blastcgihelp.shtml). The FASTA format have a highest priority
and is simple as the raw sequence proceeded by definition line.
The definition line begins with a > sign that can be optionally
followed by a sequence name of any length and amount of words
with no space in between. There can be many sequences listed in
the same file. The format requires that a new sequence always
starts with a new > symbol. It is important to press Enter key
at the end of each definition line to help the FastPCR software
recognize the end and beginning of sequence and the sequence
name. Make sure the first line starts with a > and, optionally, a
header description.
Degenerate DNA sequences are accepted as IUPAC code that
is an extended vocabulary of 11 letters that allows the description
of ambiguous DNA code [14]. Each letter represents a
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 41
3.5 Alignment There are many different programs, which produce many different
Format Description types of alignment formats. The use of a standard set of formats
enables creation of programs that can read the results originating
from many different sources. In all alignment formats, gaps that
have been introduced into the sequences to make them align are
indicated by the - character. The exception to this rule is GCG/
MSF format, which uses . as the gap character inside the
sequences. The alignment file may begin with as many lines of
comment or description as required. The first mandatory line that
is recognized as part of the MSF file contains the text MSF, or
contains the text Alignment as simple alignment format, or con-
tains the texts DIALIGN or MEGA recognized as alignments from
these programs. There then follows lines with each sequence line
starting with the sequence name which is separated from the
aligned sequence residues by white space.
4.1 PCR Primer Primer design is one of the key steps for successful PCR.For PCR
Design Generalities applications, primers are usually 1835 bases in length and should
be designed such that they have complete sequence identity to the
desired target fragment to be amplified. The primer design param-
eters, controllable either by the user or automatically, include the
primer length (12500 nt), melting temperature for short primers
calculated by nearest neighbor thermodynamic parameters, the
theoretical primer PCR efficiency (quality at %) value, primer CG
content, 3 end terminal enforcement, preferable 3 terminal
nucleotide sequence composition in degenerated formulae, and
added sequence tags at 5 termini. The other main parameters used
for primer selection represented by the general nucleotide structure
of the primer such as linguistic complexity (nucleotide arrange-
ment and composition), primer specificity, the melting tempera-
ture of the whole primer and the melting temperature at the 3 and
5 termini as well as the self-complementarity and secondary (non-
specific) binding.
The software can dynamically optimize the best primer length
for entered parameters. All PCR primer (probe) design parameters
are flexible and changeable according to the features of the
42 Ruslan Kalendar et al.
Table 2
Default primer design selection criteria
analyzed sequence and research task. Primer pairs are analyzed for
cross-hybridization, specificity of both primers and, optionally, are
selected with similar melting temperatures. Primers with balanced
melting temperatures (within 16 C of each other) are desirable
but not mandatory. The default primer design selection criteria are
shown in Table2. It is possible to use predesigned primers or
probes or, alternatively, predesigned primers can act as references
for the design of new primers. The program accepts a list of prede-
signed oligonucleotide sequences and checks the compatibility of
each primer with a newly designed primer or probe.
4.2 Melting The Tm is defined as the temperature at which half the DNA strands
Temperature (Tm) are in the double-helical state and half are in the random-coil
Calculation state. The Tm for short oligonucleotides with normal or degenerate
(mixed) nucleotide combinations are calculated in the default set-
ting using nearest neighbor thermodynamic parameters [15, 16].
The Tm is calculated using a formula based on nearest neighbor
thermodynamic theory with unified dS, dH and dG parameters:
dH
Tm ( C ) = - 273.15,
c
(
dS + R ln + 0.368 ( L - 1) ln K +
f
)
where dH is enthalpy for helix formation, dS is entropy for helix
formation, R is molar gas constant (1.987 cal/K mol), c is the
nucleic acid molar concentration (250 pM), [K+] is salt molar con-
centration (default value is 50 mM). The f = 4 when the two
strands are different and f = 1 when self-hybridization takes place.
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 43
Tm ( C ) = 2 ( L + G + C )
Alternative and more advanced nonthermodynamic formulae:
41 ([G + C ] - 16.4 )
Tm ( C ) = 64.9 + .
L
or formulae [21]:
41[G + C ] - 528
Tm ( C ) = 77.1 + 11.7 log10 K + +
L
where L is the length of primer and [G + C] is the number of
Gs and Cs, [K+] is salt molar concentration (default value is
50 mM).
The two equations above assume that the stabilizing effects of
cations are the same on all base pairs. Alternatively, the melting
temperature of the PCR product may be calculated using the for-
mulae [18]:
41[G + C ] - 675
Tm ( C ) = 81.5 + 16.6 log10 K + + .
L
4.3 Linguistic The sequence analysis complexity calculation method can be used
Complexity to search for conserved regions between compared sequences for
ofSequence the detection of low-complexity regions including simple sequence
andNucleotide-Skew repeats, imperfect direct or inverted repeats, polypurine and
Analysis polypyrimidine triple-stranded DNA structures, and four-stranded
structures (such as G/C-quadruplexes).
44 Ruslan Kalendar et al.
4.4 Primer Quality Our experimental data showed that the primer nucleotide compo-
(Virtual PCR sition and melting temperature of the 12 bases at the 3 end of the
Efficiency) primers are important factors for PCR efficiency. The melting tem-
Determination perature of the 12 base 3 terminus is calculated preferably by
nearest-neighbor thermodynamic parameters [16]. The composi-
tion of the sequence at the 3 terminus is important; primers with
two terminal C/G bases are recommended for increased PCR effi-
ciency [24]. Nucleotide residues C and G form a strong pairing
structure in the duplex DNA strands. Stability at the 3 end in
primer template complexes will improve the polymerization
efficiency.
We specify an abstract parameter called Primer Quality (PQ)
that can help to estimate the efficiency of primers for PCR.PQ is
calculated by the consecutive summation of the points according
to the following parameters: total sequence and purinepyrimi-
dine sequence complexity, the melting temperature of the whole
primer and of the terminal 3 and 5 12 bases. Self-complementarity,
which gives rise to possible dimer and hairpin structures, reduces
the final value. PQ tries to describe the likelihood of PCR success
of each primer; this value varies from 100 for the best to 0 for the
worst primers.
To meet multiplexing demands, it is possible in the program to
select the best primer with an optimal temperature range, allowing
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 45
4.5 Hairpin (Loop) Primer-dimers involving one or two sequences may occur in a PCR
andDimer Formation reaction. The FastPCR tool eliminates intra- and inter-
oligonucleotide reactions before generating a primer list and
primer pair candidates. It is very important for PCR efficiency that
the production of stable and inhibitory dimers are avoided, espe-
cially avoiding complementarity in the 3-ends of primers from
where the polymerase will extend. Stable primer dimer formation
is very effective at inhibiting PCR since the dimers formed are
amplified efficiently and compete with the intended target.
Primer dimer prediction is based on analysis of non-gap local
alignment and the stability of both the 3 end and the central part
of the primers. Primers will be rejected when they have the poten-
tial to form stable dimers depending on nucleotides composition
and with at least five bases at the 3 end or seven bases at the central
part. Tools calculate Tm for primer dimers with mismatches for
pure, mixed, or modified (inosine, uridine, or locked nucleic acid)
bases using averaged nearest neighbor thermodynamic parameters
provided for DNADNA duplexes [1517, 25, 26].
Besides WatsonCrick base pairing, there is a variety of other
hydrogen bonding possible configurations [2730] such as
G /C-q uadruplexes or wobble base pairs that the FastPCR
software detects.
The program includes the detection of the alternative hydro-
gen bonding to WatsonCrick base pairing at the primer-dimers
and in silico PCR primer binding site detection. The mismatches
stability follows the trend in order of decreasing stability: G-C >
A-T > GG > GT GA > TT AA > TC AC CC.Guanine
is the most universal base, since it forms the strongest base pair and
the strongest mismatches. On the other hand, C is the most
discriminating base, since it forms the strongest pair and the three
weakest mismatches [25, 31].
Therefore, the tools are also looking at stable guanine mis-
matches: GG, GT, and GA.
G-rich (and C-rich) nucleic acid sequences can fold into four-
stranded DNA structures that contain stacks of G-quartets [30].
These quadruplexes can be formed by the intermolecular association
of two or four DNA molecules, dimerization of sequences that con-
tain two G-bases, or by the intermolecular folding of a single strand
containing four blocks of guanines; these are easy to eliminate from
primer design because of their low linguistic complexity, LC = 32%
46 Ruslan Kalendar et al.
4.6 Calculation The optimal annealing temperature (Ta) is the range of tempera-
ofOptimal Annealing tures where efficiency of PCR amplification is maximal without
Temperature nonspecific products. The most important values for estimating
the Ta is the primer quality, the Tm of the primers and the length of
PCR fragment. Primers with high Tms (>60 C) can be used in
PCRs with a wide Ta range compared to primers with low Tms
(<50 C). The optimal annealing temperature for PCR is calcu-
lated directly as the value for the primer with the lowest Tm (Tmmin).
However, PCR can work in temperatures up to 10 C higher than
the Tm of the primer to favor primer target duplex formation:
Ta ( C ) = Tmmin + ln L ,
4.7 The Secondary The specificity of the oligonucleotides is one of the most important
Nonspecific Binding factors for good PCR; optimal primers should hybridize only to
Test; Alternative the target sequence, particularly when complex genomic DNA is
Amplification used as the template. Amplification problems can arise due to
primers annealing to repetitious sequences (retrotransposons,
DNA transposons, or tandem repeats). Alternative product ampli-
fication can also occur when primers are complementary to inverted
repeats and produce multiple bands. This is unlikely when primers
have been designed using specific DNA sequences (unique PCR).
However, the generation of inverted repeat sequences is exploited
in two common generic DNA fingerprinting methodsRandom
amplified polymorphic DNA (RAPD) and Arbitrarily Primed (AP)-
PCR [32, 33]. Because only one primer is used in these PCR reac-
tions, the ends of the products must be reverse complements and
thus can form stem-loops.
The techniques of inter-retrotransposon amplification poly-
morphism (IRAP), retrotransposon-microsatellite amplification
polymorphisms (REMAP), inter-MITE amplification [34, 35],
and Alu-repeat polymorphism [36, 37] have exploited these highly
abundant dispersed repeats as markers. However, primers comple-
mentary to repetitious DNA may produce many nonspecific bands
in single-primer amplification and compromise the performance of
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 47
5 Methods
5.1 Execution User selects the ribbon with the task needed. The program will
oftheSelectedTask only perform the selected task. Depending on thetask selected, the
program will show on the status bar the name of the executive task
(Fig.3) by Press F5. To execute the current task, user can either
press the F5 key or click the arrow on the toolbar with the mouse.
Once the executive task is complete, the result is shown in the
Result report text editor. Figure4 shows a sample result visualiza-
tion window.
5.2 PCR Primer The PCR Primer Design Tab contains various execution
Design Options options to easily select the type of PCR and most important PCR
parameters. Figure2 shows PCR Primers or Probe Design
Options panel. Once user selects any attribute, the option attri-
bute value field shows the default attributes value, which can then
be modified. PCR Primers or Probe Design Options affects
to all sequences. For individual PCR primer design options for
each sequence, user can type special commands at the header of
sequence (http://primerdigital.com/soft/pcr_help.html).
Typically, the user does not need to use commands to manage
PCR primer design, all these commands use optionally and only
for advanced tasks. User can type at text editor this help command:
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 49
Fig. 3 The ribbon with the tasks. The program will only perform selected task
5.3 Examples Users can specify, individually for each sequence, multiple loca-
forPrimer Selection tions for both forward and reverse primer design with the com-
Regions mands: -FpdN1-N2 for forward primers and -RpdN1-N2 for
reverse primers, where from N1 to N2 are bases from the selected
regions or with the command -pdN1-N2 (see more at: http://
primerdigital.com/soft/pcr_help.html). Alternatively, users can
specify the multiple locations for both forward and reverse prim-
ers design using [ and ] inside each sequence: the software allows
multiple and independent locations of both forward and reverse
primer design inside each of the sequences, whilst PCR design
will be performed independently for different targets. Multiplex
PCRs can be performed simultaneously within a single sequence
with multiple amplicons as well as for different sequences, or
combinations of both, i.e., all possible combinations of [ and ]
inside the sequence(s). By default, software is designing primers
within the entire sequence length.
Optionally, users can specify, individually for each sequence,
multiple locations for both forward and reverse primer design with
the commands:
1. The same location for both Forward and Reverse primers will
be designed in the central [nnnnnnnnn] part ([ ] is Used
only once):
.......[nnnnnnnnnn].......
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 51
5.4 User-Defined The user can specify the PCR product size in a similar way, with the
PCR Product Size command: (N1-N2); these values can be specified in the form of
minimum and maximum value for the product size. For example,
the (400500) line defining the PCR product size ranges from 400
to 500 bases. In case a user wants to specify a fixed product size,
the command should be a single number, for example (500). As
default, the program allows PCR product sizes ranging between
30 and 10,000 bases.
5.6 Bisulfite The >>T bisulphite conversion option allows the design of
Modified DNA specific PCR primers for in silico bisulfite conversion for both
54 Ruslan Kalendar et al.
5.7 PCR The PCR primer design algorithm generates a set of primers with
PrimerDesign a high likelihood of success in any amplification protocol. All PCR
primers designed by FastPCR can be used for PCR, sequencing
experiments or isothermal amplification.
The program is able to generate either long oligonucleotides
or PCR primers for the amplification of gene-specific DNA frag-
ments of user-defined length. FastPCR provides a flexible approach
to designing primers for many applications and for linear and cir-
cular sequences. It will check if either primers or probes have sec-
ondary binding sites in the input sequences that may give rise to an
additional PCR product. The selection of the optimal target region
for the design of long oligonucleotides is performed in the same
way as for PCR primers. The basic parameters in primer design are
also used as a measure of the oligonucleotide quality and the ther-
modynamic stability of the 3 and 5 terminal bases are evaluated.
The proposal of primer pairs and the selection of the best pairs
are both possible. The user can vary the product size or design
primer pairs for the whole sequence without specifying parameters
by using default or predesigned parameters. The predesigned
parameters are specified for different situations: for example, for
sequences with low CG content or long distance PCR, or degener-
ate sequences, or for manual input. A list of best primer candidates
and all compatible primer pairs that are optimal for PCR is gener-
ated. Users can specify, individually for each sequence, multiple
locations for both forward and reverse primer design inside each
sequence, whilst PCR design will be performed independently for
different targets. Multiplex PCRs can be performed simultaneously
within a single sequence with multiple amplicons as well as for dif-
ferent sequences, or combinations of both (Fig.1).
The program generates primer pairs (and probes) from the
input sequences and shows the optimal annealing temperature for
each primer pair and the sizes of PCR products, together with
information for each designed primer. Results are generated by the
program showing the suggested primers and primer pairs in tabu-
lated format for Excel or Open Office. The spreadsheets show the
following properties: automatically generated primer name, primer
sequence, sequence location, direction, length, melting tempera-
ture, CG content (%), molecular weight, molar extinction coeffi-
cient, linguistic complexity (%), and PQ.For compatible primer
pairs, the annealing temperature and PCR product size are also
provided.
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 55
5.8 Multiplex PCR Multiplex PCR is an approach commonly used to amplify several
Primer Design DNA target regions in a single reaction. The simultaneous
amplification of many targets reduces the number of reactions that
needs to be performed; multiplex PCR thus increases throughput
efficiency. The design of multiplex PCR assays can be difficult
because it involves extensive computational analyses of primer pairs
for cross interactions. The multiplex PCR algorithm is based on the
fast non-recursion method, with the software performing checks on
product size compatibility (if necessary), the melting and annealing
(Ta) temperatures, dG compatibility and cross-dimer interaction for
all primers. To achieve uniform amplification of the targets, the
primers must be designed to bind with equal efficiencies to their
targets. FastPCR can quickly design a set of multiplex PCR primers
for all the input sequences and/or multiplex targets within each
sequence. PCR conditions may need to be adjusted; for example,
the annealing temperature increased or lowered so that all products
are amplified with equal efficiency. To achieve this, most existing
multiplex primer design packages use primer melting temperature.
In practical terms, the design of nearly identical Tas and Tms is
important. The melting temperatures of the PCR products are also
important, since these are related to annealing temperature values.
The Tm of a PCR product directly depends on its GC content and
length; short products are more efficiently amplified at low PCR
annealing temperatures (100 bp, 5055 C) than long products
(>3000 bp, 6572 C). For most multiplex PCRs, there is usually a
small variation (up 5 C) between the optimal Tas of all primer pairs
and PCR products. The annealing temperature must be optimal in
order to maximize the likelihood of amplifying the target genomic
sequences while minimizing the risk of nonspecific amplification.
Further improvements can be achieved by selecting the optimal set
of primers that maximize the range of common Tms. Once
prompted, FastPCR calculates multiplex PCR primer pairs for given
target sequences. The speed of calculation depends on the number
of target sequences and primer pairs involved.
An alternative way to design compatible multiplex PCR primer
pairs is to use predesigned primers as references for the design of
new primers. The user can also select input options for the PCR
products such as the minimum product size difference between the
amplicons. One can set primer design conditions either individu-
ally for each given sequence or use common values. The individual
setting has a higher priority for PCR primer or probe design than
do the general settings. The results include primers for individual
sequences, primers compatible together, the product sizes, and
annealing temperatures. Because clear differentiation of the prod-
ucts is dependent on using compatible primer pairs in the single
reactions, the program recovers all potential variants of primer
combinations for analyses of the chosen DNA regions and pro-
vides, in tabular form, their compatibility with information
56 Ruslan Kalendar et al.
5.10 Simple Simple sequence repeats (SSRs, or microsatellites) are short tan-
Sequence Repeat dem repeats of one or more bases. Microsatellites are ubiquitously
(SSR) Locus Search distributed throughout eukaryotic genomes, often highly
andPCR polymorphic in length, and thereby an important class of markers
PrimerDesign for population genetic studies. Our approach to SSR searching is
to analyse low complexity regions by using linguistic sequence
complexity. This method allows the detection of perfect and imper-
fect SSRs with a single, up to 10-base, repeat motif. Each entry
58 Ruslan Kalendar et al.
5.11 Polymerase The application to make long synthetic DNA molecules rely on the
Cycling Assembly invitro assembly of a set of short oligonucleotides, either by ligase
chain reaction (LCR) [39] or by assembly PCR [40]. These oligo-
nucleotides should be adjacent on the same strand and overlap the
complementary oligonucleotides from the second strand. There
are several major parameters to designing oligonucleotides for
gene synthesis by LCR or assembly PCR: first, the oligonucleotides
should share about similar Tm value; second, a given oligonucle-
otides sequence should be unique to avoid multiple nonspecific
binding that conduct to incorrect assembly. The software must
dynamically choose the length of the oligonucleotides to ensure
both the specificity and the uniform Tm. Our algorithm is able to
design oligonucleotides for long sequences containing repeats and
to minimize their potential nonspecific hybridization during 3 end
extension in PCR.For long sequence assembly, oligonucleotide
design starts from the 5 end of a given sequence; the oligonucle-
otide length is dynamically changed until a unique 3 end has been
found and Tm of oligonucleotide has reached the Tm threshold. All
oligonucleotides are designed without gaps between them. The
other strand is used for design of the overlapping oligonucleotides
with the same algorithm as above but with the Tm of the overlap-
ping regions reaching the Tm 15 C threshold. The composition
of the sequence at the 3 terminus is important because stability at
the 3 terminus in the oligonucleotide complexes will improve the
specificity of extension by the polymerase. To reduce nonspecific
polymerase extension and ligation, the algorithm chooses only
unique sequences for the 3 terminus. Minimally, the last two
nucleotides at the 3 terminus must not be complementary to the
nonspecific target. Other complementary regions, apart from the
3 terminus, are not important for assembling multiple fragments
by PCR and ligation.
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 59
5.13 Primer Individual and sets of primers are evaluated using software. They
Analyses calculate primer Tms using default or other formulae for normal
and degenerate nucleotide combinations, CG content, extinction
coefficient, unit conversion (nmol per OD), mass (g per OD),
molecular weight, linguistic complexity, and consider primer PCR
efficiency. Users can select either DNA or RNA primers (online
Java: PrimerAnalyser) with normal or degenerate oligonucleotides
or modifications with different labels (for example inosine, uridine,
or fluorescent dyes). Tools allow the choice of other nearest-
neighbor thermodynamic parameters or nonthermodynamic Tm
calculation formulae.
For LNA modifications the four symbols: dA = E, dC = F, dG
= J, dT = L are used. Both programs perform analyses on-type,
which allow users to see the results immediately on screen. They
can also calculate the volume of solvent required to attain a specific
concentration from the known mass (mg), OD, or moles of dry
oligonucleotide.
All primers are analyzed for intra- and inter-primer interactions
to form dimers. Primer(s) can efficiently hybridize using the 5 end
or middle of the sequences. Even though such interactions are not
efficiently extended by DNA polymerase, their formation reduces
the effective primer concentration available for binding to the tar-
get and their presence can strongly inhibit PCR, since double-
stranded DNA at high concentrations is a strong inhibitor of DNA
polymerase (Fig.7).
Example for a primer complementarity test including mis-
matches: when it is necessary to determine the annealing stability
at the binding site and the Tm for primers with mismatches, the
user may use the in silico PCR task. Another way to solve this
problem is by analyzing the two primers in the task Primer Test,
where one primer is analyzed, and the second complementary
strand of it. To do so, it is necessary to convert the primer sequence
into complementary and inverse chain and exclude the mismatches.
The program will identify self-dimer and calculate the Tm including
mismatches:
62 Ruslan Kalendar et al.
Tm = 38.8 C
5-ttcagaacaggtcccagatga-3
Length=21 A=7.0 G=5.0 T=4.0 C=5.0 CG=47.6%
Linguistic complexity = 82%
Primers PCR efficiency = 77%
Tm = 55.1 C
5-tcatcttcgacctgttcggaa-3
Length=21 A=4.0 G=4.0 T=7.0 C=6.0 CG=47.6%
Linguistic complexity = 87%
Primers PCR efficiency = 87%
Tm = 55.4 C
<aaggcttgtccagcttctact-5
|||:||||||||| ||||||
PCR Primer and Probe Design, Oligonucleotide Assembly and Analysis 63
5-ttcagaacaggtcccagatga->
Tm=38.8 C
Acknowledgments
Abstract
Polymerase chain reaction (PCR) is an oft-used preparatory technique in amplifying specific DNA regions
for downstream analysis. The size of an amplicon was initially limited by errors in nucleotide polymeriza-
tion and template deterioration during thermal cycling. A variant of PCR, designated long-range PCR, was
devised to counter these drawbacks and enable the amplification of large fragments exceeding a few kb. In
this chapter we describe a protocol for long-range PCR, which we have adopted to obtain products of 6.6,
7.2, 13, and 20 kb from human genomic DNA samples.
Key words Long-range polymerase chain reaction (PCR), Agarose gel electrophoresis, Taq DNA
polymerase, Proofreading enzyme, Thermal cycling, Long amplicons
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_3, Springer Science+Business Media LLC 2017
65
66 Eng Wee Chua et al.
Fig. 1 Amplification of long PCR fragments from three important pharmacogenes: CYP2A6 (left panel), CYP2D6
(middle panel), and CYP2C19 (right panel). af represent different human genomic DNA samples
2 Materials
3 Methods
3.1 Primer Design The presence of pseudogenes or genes with similar consensus
sequence is a common problem when trying to identify specific
single-nucleotide polymorphisms (SNPs). One way to precisely
target SNPs in a particular gene is to ensure the primers will amplify
the target gene only. For instance, the CYP2A6 and CYP2A7
genes are 96.5% identical with respect to their coding nucleotide
sequences, and identifying SNPs specific to CYP2A6 using small
fragment PCR can often result in the amplification of regions of
the CYP2A7 gene [6]. The design of primers for the specific ampli-
fication of the CYP2A6 gene is described below as an example.
3.1.1 Obtaining 1. Locate the gene, CYP2A6 (Gene ID 1548), which in this
theReference Sequence instance has been reviewed and collated into the RefSeq data-
base: http://www.ncbi.nlm.nih.gov/gene/ [7].
2. Select the appropriate genome assembly, in this case we have
chosen the GRCh37.p13 primary assembly, and obtain the
FASTA sequence for CYP2A6. The gene length is approxi-
mately 6.9 kb.
3. Update the FASTA sequence shown to include 500 bp on both
3 and 5 ends. This can be done by manipulating the chromo-
some position numbers. The total length of the updated
CYP2A6 FASTA sequence is now approximately 7.9 kb.
3.1.2 Obtaining Specific 1. Copy or upload the updated FASTA sequence onto an online
Primer Sequences (See tool for primer design, Primer-BLAST; this tool can be accessed
Fig.2) at http://www.ncbi.nlm.nih.gov/tools/primer-blast/. The
operation of the primer design feature is driven by Primer 3 [8, 9].
2. Specify the desired primer positions relative to the inserted
FASTA sequence. As we have allowed for a 500-bp window on
either side of the gene, forward primers can start anywhere
from 0 to 300 and reverse primers can start anywhere between
7500 and 7800. Also, the primers are positioned in such a
manner that they are 150 bp away from the intronexon
boundaries and that the resultant product would cover the
entire CYP2A6 gene.
68 Eng Wee Chua et al.
Fig. 2 A simple guide to primer design using Primer-BLAST, a free Web-based tool. Circled numbers refer to
the steps described in the text
3.2 PCR 1. Prepare all reaction mixes inside a horizontal laminar flow
hood. Also, it is mandatory to have strictly separate areas for
pre- and post-PCR work to reduce the chances of
contamination.
2. Irradiate the equipment and PCR reagents used for reaction
setup with ultraviolet light for about 1520 min, in order to
minimize the risk of carryover contamination; this may include
the pipettes, pipette tips, microfuge tubes, and PCR strip tubes
[10, 11].
3. While waiting for the decontamination procedure to finish, set
up the PCR protocol in a thermal cycler (seeNotes 9 and 10).
4. Add, in a 0.7 mL microfuge tube (or larger if required), the
following reagents: reaction buffer, magnesium chloride,
dNTP mix, primers, betaine or DMSO (if necessary), and
enzyme mix (seeNote 11).
5. Briefly flick the tube to mix all reaction components and
spin down the mixture with a 5- to 10-s pulse in a
microcentrifuge.
6. Divide the master mix into equal-volume aliquots and transfer
these into individual PCR strip tubes (see Notes 12 and 13).Add
template DNAs (or PCR-grade water for no-template controls;
seeNote 11).Always keep the tubes at 4 C (on ice or in a cold
block) prior to thermal cycling, in order to minimize unspecific
amplification that may arise from residual Taq polymerase activity
at low temperatures.
7. Close the strip tubes with their lids. Make sure that a tight seal
is formed to prevent evaporation of the reaction mixes during
thermal cycling.
8. Transfer the tubes into the thermal cycler and initiate the
cycling protocol. Note the positions in which the tubes are
placed within the thermal block (seeNote 14).
9. At the end of the cycling protocol, remove the tubes from the
thermal cycler. Store the products at 4 C until further analysis
or other downstream applications such as DNA sequencing.
3.3 Agarose Gel 1. On an electronic scale, weigh out the required amount of aga-
Electrophoresis rose gel powder (seeNote 15).
2. Add the agarose powder into an adequate volume of 1 TAE
buffer in a glass bottle and swirl briefly to mix.
70 Eng Wee Chua et al.
4 Notes
Fig. 3 The effect of different amounts of input DNA on the CYP2D6 long-range
PCR, performed in 10-L aliquots, was ascertained. It is obvious that 4 ng/L of
DNA resulted in greater amplification than 2 ng/L.Increasing the concentration
to 8 ng/L did not enhance the yield further; doubling it to 16 ng/L was clearly
detrimental. The samples used in these experiments were human genomic DNAs
Long Fragment PCR 73
References
1. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, fication for direct detection of HIV-1in DNA
Higuchi R, Horn GT etal (1988) Primer- of peripheral blood mononuclear cells. Science
directed enzymatic amplification of DNA with 239(4837):295297
a thermostable DNA polymerase. Science 3. Barnes WM (1994) PCR amplification of up to
239(4839):487491 35-kb DNA with high fidelity and high yield
2. Ou CY, Kwok S, Mitchell SW, Mack DH, from lambda bacteriophage templates. Proc
Sninsky JJ, Krebs JW etal (1988) DNA ampli- Natl Acad Sci U S A 91(6):22162220
74 Eng Wee Chua et al.
Abstract
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to
detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly differ-
ent oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the
amplification of a sequence of interest by the introduction of mismatches with the target sequence and
balancing their position toward the primers 5- or 3-ends. In this work, we explain in detail examples of
rational design of primers in two different applications, including the use of specific determinants at the
3-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully
degeneration at a core box of conserved genetic information, with the reduction of degeneration at the
5-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5-end
degenerate primers.
Key words PCR, Degenerate primers, 5-End, 3-End, Specificity determinants, PCR efficiency,
MAMA-DEG PCR
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_4, Springer Science+Business Media LLC 2017
75
76 Maria Jorge Campos and Alberto Quesada
2 Materials
Table 1
Genetic code and compressed notation code according to IUPAC [5]
Compressed
Amino acid Codons notation codon Nucleotide Base
A Alanine GCT, GCC, GCA, GCG GCN A Adenine
R Arginine CGT, CGC, CGA, CGG, CGN, MGR C Cytosine
AGA, AGG
N Asparagine AAT, AAC AAY G Guanine
D Aspartic acid GAT, GAC GAY T Thymine
C Cysteine TGT, TGC TGY R A or G
Q Glutamine CAA, CAG CAR Y C or T
E Glutamic acid GAA, GAG GAR S G or C
G Glycine GGT, GGC, GGA, GGG GGN W A or T
H Histidine CAT, CAC CAY K G or T
I Isoleucine ATT, ATC, ATA ATH M A or C
L Leucine TTA, TTG, CTT, CTC, YTR, CTN B C or G or T
CTA, CTG
K Lysine AAA, AAG AAR D A or G or T
M Methionine ATG H A or C or T
F Phenylalanine TTT, TTC TTY V A or C or G
P Proline CCT, CCC, CCA, CCG CCN N Any base
S Serine TCT, TCC, TCA, TCG, TCN, AGY
AGT, AGC
T Threonine ACT, ACC, ACA, ACG ACN
W Tryptophan TGG
Y Tyrosine TAT, TAC TAY
V Valine GTT, GTC, GTA, GTG GTN
Start ATG
Stop TAA, TGA, TAG TAR, TRA
2.2 PCR, Gel 1. 200 l and 1.5ml DNase-free plastic microtubes tubes (see
Electrophoresis Note 1).
andImage Acquisition 2. Termocycler.
3. Gel electrophoresis system.
4. UV transiluminator or gel acquisition system.
78 Maria Jorge Campos and Alberto Quesada
2.3 Reagents 1. DreamTaq green DNA polymerase (Thermo Fisher) and buf-
fer (see Note 2).
2. dNPTs (see Note 3).
3. Degenerate primers.
4. Nuclease-free water or autoclaved to sterility ultrapure water
obtained by a water purification system.
5. DNA stains, e.g., GelRed (Biotium).
6. Gel-electophoresis agarose.
7. DNA molecular weight marker, e.g., GeneRuler 1 kb Plus
DNA ladder (Thermo Scientific).
8. Gel electrophoresis Buffer TAE (see Note 4).
3 Methods
3.1 Guidelines Fully conserved motifs of 46 consecutive amino acids, the core
forPrimer Design box, are required to design the oligonucleotide 3-end with, at
fromProtein Family least, 11 nucleotide positions. This is considering that the first
Alignment: Reduction position, in the reverse primer, or the last position, in the for-
of5-End Complexity ward primer, leading to ambiguity is omitted from the oligonu-
cleotide sequence to start reducing its complexity. In general
terms, a good principle for designing highly efficient degenerate
primers would be to establish a limit of degeneracy up to 64 (the
number of different sequences within the mixture primer),
meaning that the core box should not contain at all amino acid
residues encoded by six codons (L, R, or S) and very few encoded
by 3 (I) or four codons (A, G, P, V, or T). In contrast, amino
acids encoded by two (C, D, E, F, H, K, N, T, or Y) or only one
codon (M or W) are strongly recommended (Table1). The
remaining sequence of primers, typically 712 nucleotides
toward the 5-end, are less critical for DNA synthesis and, thus,
is the region where efforts to reduce degeneration should be
focused. An example of core box selection for primer design is
shown in Fig.1, where relationships between the two class A
-lactamases found in Bacteroides and related microorganisms,
encoded by cepA and cfxA genes, are shown. Two primers were
designed for cepA selective PCR from core boxes containing
3-end specificity determinants (Table2), allowing genotyping
of -lactam resistant strains of gram-negative anaerobes isolated
from human and animals [8, 9].
The strategies to reduce primer complexity at the 5-end
include consideration of the codon usage bias, which is particular
for every organism [10]. So when the core box is extended toward
the 5-end of the oligonucleotide, the information contained in
the protein sequence might be reverse translated by using the
genetic code and the particular codon usage bias of the target
Specificity of Degenerate Primers 79
CepA1 CepA2
Bfra 110PQGGIEMSIADLLKYTLQQSDNNA I92VTM HKTGTGDRNAKG55
Bun1 109PDQDFTITLRELMQYSISQSDNNA I92TVV HKTGSSDRNADG53
Bthe 105PQGGFNIDIADLLNYTLQQSDNNA I92VTI HKTGTGDRNAKG53
Bun2 127SGPVISLTVRDLLRYTLTQSDNNASNL94VVIAHKTGSGYVNENG57
Pden 127SGPVISLTVRDLLRYTLTQSDNNASNL94VVIAHKTGSGDVNENG57
Coch 127SGPVISLTVRDLLRYTLTQSDNNASNL94VVIAHKTGSGDVNENG57
. : : : :*:.*:: ******.:: ..:.****:. * .*
Fig. 1 Protein alignment and core box selection for primer design. Sequences shown are: Bfra, AAA22905.1;
Bun1, AAA66962; Bthe, NP_813418.1; Bun2, AAB17891; Pden, AAM48119.1; Coch, AAL79549.2. Multiple
alignement was performed by Clustal Omega. Bold characters represent strongly conserved positions. Grey
boxes indicate identical residues. Black boxes represent CepA characteristic residues used to design primers
with 3-end specific determinants for discriminatory PCR.The expected size of cepA fragments amplified by
PCR with cepA1/A2 primers is 329 bp [8]
Table 2
Primer design for detection of cepA orthologous from Bacteroides and related anaerobic gram-
negative bacteria
Forward primer
Amino acids S D N N A C D
Coding sequence TCN GAC AAC AAC GCN TGC GAC
AGC T T T T T
T
Abbreviated WSN GAY AAY AAY GCN TGY GAY
3.2 Guidelines In primer design for allelic discrimination, the number of mis-
forPrimer Design matches at the last positions from the 3-end of the primer is cru-
fromDNA Alignment: cial for annealing and specific elongation by the DNA polymerase,
Reduction which supports the mismatch amplification mutation assay or
ofSpecificity MAMA-PCR [7]. The discrimination power of this technique is
byDegeneration based in the complementarity of each particular allele of a poly-
of5-End morphic position to the 3-end of their corresponding primers,
whose annealing is weakened by an additional mismatch with their
target sequences, in a way that allows amplification with one but
not two mismatches. The technique is so sensitive that additional
mispairing of primers produced by genetic variability of sequences
would give rise to false negatives. To solve that, in a particular case
that requires the use of DNA from closely related species as target
Specificity of Degenerate Primers 81
Fig. 2 gyrA sequence variability in human thermophilic Campylobacter: primer design for discrimination the
C-257-T polymorphism. Primers are shown above their target sequence, the gyrA gene from C. jejuni. Residues
in grey boxes represent primers degenerate positions (IUPAC code), according to the polymorphism of gyrA
that exists among described sequences from C. jejuni and C. coli that is shown below the target sequence.
Residues in black boxes are critical for MAMA-PCR.In the target sequence they represent the allele-specific
polymorphism whereas in primer sequence indicate the mismatch that weakens the annealing and enable
discriminatory PCR.The expected product sizes, for multiple PCR with the four primers, are 157 plus 329 bp,
for T-257 gyrA linked to quinolone resistant isolates, or 215 plus 329 bp, for C-257 gyrA of quinolone sensitive
Campylobacter [12]
3.3 Protocol 1. Gather all the DNA or protein sequences of interest from
forProtein or DNA online databases as the National Center for Biotechnology
Sequence Analysis Information (NCBI, http://www.ncbi.nlm.nih.gov/nuccore
for nucleotides or http://www.ncbi.nlm.nih.gov/protein/
for proteins) in FASTA format (see Note 5).
2. Paste the sequences in a text processor document.
3. Copy all the sequences and use the algorithm Clustal on online
platforms to align the multiple DNA or protein sequences.
Clustal can be found in the EBI multi Sequence Alignment
(http://www.ebi.ac.uk/Tools/msa/), the Swiss Institute of
Bioinformatics (www.ch.embnet.org/software/ClustalW.html),
82 Maria Jorge Campos and Alberto Quesada
3.4 PCR Reaction A successful PCR reaction relies on a number of factors, some of
which related to the quality of the primer design. Primer length
should be between 16 and 28 nucleotides, which depending on the
GC content should produce primers melting temperatures (Tm)
between 50 and 62 C.It is not judicious to have a Tm difference
between the two primers greater than 5 C [13], and the annealing
temperature can be empirically determined as being 5 C lower than
the primer with the lowest Tm. Since for degenerate primers the
working sequence(s) of primers is(are) unknown, a good approach is
to set annealing temperature between 50 and 55 C, although spe-
cific primers corresponding to one known homologue could be used
to estimate more accurately the PCR conditions.
Other important aspect in the success of the PCR reaction is
the quality of the genomic DNA that includes the target sequence.
Due to contamination problems, isolated areas in the laboratory
should be dedicated to the DNA extraction process and PCR
examination area, where gels are run, whilst PCR master mixes and
all PCR reagents should be handle in a laminar flow cabinet.
1. Bacterial DNA suitable for PCR can be obtained by the boiling
method (see Note 7) or by using any commercial DNA extrac-
tion kit.
Specificity of Degenerate Primers 83
3.5 Thermocycling Incubate the 200 l PCR microtubes containing the DNA and the
master mix in a thermocycler with the following program: initial
denaturation 95 C for 2 min, 35 cycles of denaturation at 95 C
for 30 s, primer annealing between 50 C and 55 C for 1 min,
extension at 72 C for 1 min, a final extension at 72 C for 10min.
The PCR can be maintained at room temperature indefinitely.
3.6 Gel Analysis 1. Prepare a 0.75 to 1.0% agarose gel (see Note 9).
2. Load 10 l of each PCR product in each gel well.
3. Connect the power supply to 80 V and wait approximately 1 h
or until the fastest moving band in the PCR buffer is close to
the gel hedge.
4. Observe the gel in the UV transiluminator or gel acquisition
system and look for the presence of the expected size band.
4 Notes
Acknowledgments
References
1. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn 8. Garca N, Gutirrez G, Lorenzo M, Garca JE,
GT, Erlich HA, Arnheim N (1985) Enzymatic Priz S, Quesada A (2008) Genetic determi-
amplification of beta-globin genomic sequences nants for cfxA expression in Bacteroides strains
and restriction site analysis for diagnosis of isolated from human infections. JAntimicrob
sickle cell anemia. Science 4732:13501354 Chemother 5:942947
2. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, 9. Lorenzo M, Garca N, Ayala JA, Vadillo S,
Higuchi R, Horn GT, Mullis KB, Erlich HA Priz S, Quesada A (2012) Antimicrobial
(1988) Primer-directed enzymatic amplifica- resistance determinants among anaerobic bac-
tion of DNA with a thermostable DNA poly- teria isolated from footrot. Vet Microbiol
merase. Science 4839:487491 157(12):112118
3. Chothia C, Lesk AM (1986) The relation 10. Ikemura T (1985) Codon usage and tRNA
between the divergence of sequence and struc- content in unicellular and multicellular organ-
ture in proteins. EMBO J4:823826 isms. Mol Biol Evol 1:1334
4. Iserte JA, Stephan BI, Goi SE, Borio CS, 11. Ben-Dov E, Shapiro OH, Siboni N, Kushmaro
Ghiringhelli PD, Lozano ME (2013) Family- A (2006) Advantage of using inosine at the 3
specific degenerate primer design: a tool to termini of 16S rRNA gene universal primers for
design consensus degenerated oligonucle- the study of microbial diversity. Appl Environ
otides. Biotechnol Res Int 2013:383646 Microbiol 11:69026906
5. Nomenclature Committee of the International 12. Hormeo L, Palomo G, Ugarte-Ruiz M,
Union of Biochemistry (NC-IUB) (1985) Porrero MC, Borge C, Vadillo S, Priz S,
Nomenclature for incompletely specified bases Domnguez L, Campos MJ, Quesada A
in nucleic acid sequences. Recommendations. (2016) Identification of the main quinolone
Biochem J229(2):281286 resistance determinant in Campylobacter
6. Haras D, Amoros JP (1994) Polymerase chain jejuni and Campylobacter coli by MAMA-
reaction, cold probes and clinical diagnosis. DEG PCR.Diagn Microbiol Infect Dis
Sante 4(1):4352 3:236239
7. Cha RS, Zarbl H, Keohavong P, Thilly WG 13. Chuang LY, Cheng YH, Yang CH (2013)
(1992) Mismatch amplification mutation assay Specific primer design for the polymerase chain
(MAMA): application to the c-H-ras gene. reaction. Biotechnol Lett 10:15411549
PCR Methods Appl 2(1):1420
Chapter 5
Abstract
Inverse PCR is a powerful tool for the rapid introduction of desired mutations at desired positions in a circu-
lar double-stranded DNA sequence. Here, custom-designed mutant primers oriented in the inverse direction
are used to amplify the entire circular template with incorporation of the required mutation(s). By careful
primer design it can be used to perform such diverse modifications as the introduction of point mutations
and multiple mutations, the insertion of new sequences, and even sequence deletions. Three primer formats
are commonly used; nonoverlapping, partially overlapping and fully overlapping primers, and here we
describe the use of nonoverlapping primers for introduction of a point mutation. Use of such a primer setup
in the PCR reaction, with one of the primers containing the desired mismatch mutation, results in the ampli-
fication of a linear, double-stranded, mutated product. Methylated template DNA is removed from the
nonmethylated PCR product by DpnI digestion and the PCR product is then phosphorylated by polynucleo-
tide kinase treatment before being recircularized by ligation, and transformed to E. coli. This relatively simple
site-directed mutagenesis procedure is of major importance in biology and biotechnology today where it is
commonly employed for the study and engineering of DNA, RNA, and proteins.
Key words Site-directed mutagenesis, Inverse PCR, Nonoverlapping primers, Protein engineering
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_5, Springer Science+Business Media LLC 2017
87
88 Diogo Silva et al.
Fig. 1 Illustration of primer design formats for inverse PCR with nonoverlapping (a), partially overlapping (b)
and fully overlapping (c) primers. The hatched sections show the overlapping regions of the primers
iPCR for Site-Directed-Mutagenesis 89
2 Materials
2.5 Transformation 1. 200 L aliquots of chemically competent E. coli XL1 Blue cells
(see Note 13). Store at 70 C.
2. pUC18 control plasmid (1 pg/L). Store at 20 C.
3. Luria Bertani Broth (LB): 10 g/L bacto tryptone, 5 g/L yeast
extract, 10 g/L NaCl. Adjust pH to 7 with a 200 g/L (5M)
NaOH solution. Autoclave to sterilize.
4. Ampicillin (see Note 14): 100 mg/mL stock solution in water.
Filter-sterilize through a 0.4 m membrane and store at 4 C
for no more than 1 month.
5. LB agar plates containing antibiotic (100 g/mL ampicillin).
Prepare LB as described above with addition of 18 g/L agar.
Autoclave to sterilize, cool to 5055 C, add 1 mL/L of 100
mg/mL ampicillin stock, mix and aseptically pour to petri
dishes.
3 Methods
3.1 iPCR Mutant 1. Primer Design. Inversed primers should anneal to opposite
Amplification strands of the plasmid, be nonoverlapping and aligned back-
to-back with apposing 5 ends. Ideally, the targeted mismatch
mutation should be located in the middle of the primer with
1015 perfectly matched nucleotides on either side. Mutations
can be incorporated closer to the 5 end but at least ten com-
plementary nucleotides are required at the 3 end
(see Note 15). Normal considerations for PCR primer design
should be adhered to (see Note 16). Phosphorylation of prim-
ers is not required (see Note 2). For best results, at least HPLC
grade purification of primers is required, for primers greater
iPCR for Site-Directed-Mutagenesis 93
4 Notes
References
1. Bommarius AS, Paye MF (2013) Stabilizing 12. Stuckey S, Storici F (2013) Gene knockouts,
biocatalysts. Chem Soc Rev 42:65346565. invivo site-directed mutagenesis and other
doi:10.1039/c3cs60137d modifications using the delitto perfetto sys-
2. Collins T, De Vos D, Hoyoux A, Savvides SN, tem in Saccharomyces cerevisiae. Methods
Gerday C, Van Beeumen J, Feller G (2005) Enzymol 533:103131. doi:10.1016/
Study of the active site residues of a glycoside B978-0-12-420067-8.00008-8
hydrolase family 8 xylanase. JMol Biol 13. Kren BT, Bandyopadhyay P, Steer CJ (1998)
354(2):425435 In vivo site-directed mutagenesis of the factor
3. Davids T, Schmidt M, Bottcher D, Bornscheuer IX gene by chimeric RNA/DNA oligonucle-
UT (2013) Strategies for the discovery and otides. Nat Med 4(3):285290
engineering of enzymes for biocatalysis. Curr 14. Higuchi R, Krummel B, Saiki RK (1988) A
Opin Chem Biol 17(2):215220. general method of invitro preparation and spe-
doi:10.1016/j.cbpa.2013.02.022 cific mutagenesis of DNA fragments: study of
4. Sanjuan R (2010) Mutational fitness effects in protein and DNA interactions. Nucleic Acids
RNA and single-stranded DNA viruses: com- Res 16(15):73517367
mon patterns revealed by site-directed muta- 15. Triglia T, Peterson MG, Kemp DJ (1988)
genesis studies. Philos Trans R Soc Lond B A procedure for invitro amplification of
Biol Sci 365(1548):19751982. doi:10.1098/ DNA segments that lie outside the boundar-
rstb.2010.0063 ies of known sequences. Nucleic Acids Res
5. Steiner K, Malke H (1997) Primary structure 16(16):8186
requirements for invivo activity and bidirec- 16. Ochman H, Gerber AS, Hartl DL (1988)
tional function of the transcription terminator Genetic applications of an inverse polymerase
shared by the oppositely oriented skc/rel-orf1 chain reaction. Genetics 120(3):621623
genes of Streptococcus equisimilis H46A.Mol 17. Hemsley A, Arnheim N, Toney MD,
Gen Genet 255(6):611618 Cortopassi G, Galas DJ (1989) A simple
6. Traboni C, Ciliberto G, Cortese R (1982) A method for site-directed mutagenesis using the
novel method for site-directed mutagenesis: its polymerase chain reaction. Nucleic Acids Res
application to an eukaryotic tRNAPro gene 17(16):65456551
promoter. EMBO J1(4):415420 18. Qi D, Scholthof KB (2008) A one-step
7. Hutchison CA, Phillips S, Edgell MH, Gillam PCR- based method for rapid and effi-
S, Jahnke P, Smith M (1978) Mutagenesis at a cient site-directed fragment deletion, inser-
specific position in a DNA sequence. JBiol tion, and substitution mutagenesis. JVirol
Chem 253(18):65516560 Methods 149(1):8590. doi:10.1016/j.
8. Hutchison CA 3rd, Edgell MH (1971) jviromet.2008.01.002
Genetic assay for small fragments of bacterio- 19. Zheng L, Baumann U, Reymond JL (2004)
phage phi X174 deoxyribonucleic acid. JVirol An efficient one-step site-directed and site-
8(2):181189 saturation mutagenesis protocol. Nucleic
9. Edgell MH, Hutchison CA 3rd, Sclair M Acids Res 32(14):e115. doi:10.1093/nar/
(1972) Specific endonuclease R fragments of gnh110
bacteriophage phiX174 deoxyribonucleic acid.
20. Liu H, Naismith JH (2008) An efficient
JVirol 9(4):574582 one- step site-directed deletion, insertion,
10. Reeves AR (ed) (2016) In vitro mutagen- single and multiple-site plasmid muta-
esis. Methods and protocols, series vol genesis protocol. BMC Biotechnol 8:91.
1498, 1 edn. Humana, NewYork, NY. doi:10.1186/1472-6750-8-91
doi:10.1007/978-1-4939-6472-7
21. Xia Y, Chu W, Qi Q, Xun L (2015) New
11. Ho SN, Hunt HD, Horton RM, Pullen JK, insights into the QuikChange process guide
Pease LR (1989) Site-directed mutagenesis by the use of Phusion DNA polymerase for site-
overlap extension using the polymerase chain directed mutagenesis. Nucleic Acids Res
reaction. Gene 77(1):5159 43(2):e12. doi:10.1093/nar/gku1189
Chapter 6
Abstract
The polymerase chain reaction (PCR) is the technique of choice used to obtain DNA for cloning, because
it rapidly provides high amounts of desired DNA fragments and allows the easy introduction of extremities
adequate for enzyme restriction or homologous recombination, and of artificial, native, or modified
sequence elements for specific applications. In this context, the use of megaprimer-based PCR strategies
allows the versatile and fast assembly and amplification of tailor-made DNA sequences readily available for
cloning.
In this chapter, we describe the design and use of a megaprimer-based PCR protocol to construct
customized fusion genes ready for cloning into commercial expression plasmids by restriction digestion
and ligation.
Key words Megaprimers, Two-step PCR, Fusion genes, Molecular cloning, Restriction enzymes,
Expression plasmids
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_6, Springer Science+Business Media LLC 2017
101
102 TatianaQ.Aguiar et al.
Fig. 1 Illustration of the megaprimer-based PCR strategy used to assemble the fusion genes EmGFP-TrCBM1Cel7A
(a) and EmGFP-NL-TrCBM1Cel7A (b), with indication of the location of primers and of all the extra sequence ele-
ments added after each PCR.Legends for the represented primer sequences: black lower case, recognition
sites for selected restriction enzymes (EcoRI: gaattc and KpnI: ggtacc); green lower case, sequences comple-
mentary to the EmGFP-coding region; golden, underlined upper case, complementary region of primer P4 with
PCR1/PCR3 products; blue lower case, histidine codons; red upper case italics, stop codon (TGA)
2 Materials
3 Methods
3.1 Primer Design Rational primer design is a critical step for the success of this
protocol, which requires the prior knowledge of the DNA
sequences of the genes and elements that we desire to fuse, as
well as the maps of the expression vectors where we intend to
clone the constructed fusions.
1. Assemble the final base pair sequence of the desired fusion
genes and optimize their codons according to the preferential
codon usage of the host where they are going to be expressed
in (Fig.2). In this protocol, the EmGFP-coding gene from
pPCG [10] was chosen as template for the initial PCR and the
codons of the sequences that were fused to this gene were
optimized for expression in P. pastoris using the online soft-
ware GENEius (Eurofins Genomics) (see Note 1).
2. Select appropriate enzymes for cloning. Analyse the multiple
cloning site of the selected expression vector and the restric-
tion map of each fusion gene (e.g., with the online NEBcutter
tool, New England Biolabs). Select two enzymes that do not
106 TatianaQ.Aguiar et al.
Fig. 2 DNA sequences of the customized fusion genes EmGFP-TrCBM1Cel7A (a) and EmGFP-NL-TrCBM1Cel7A (b)
with the codons optimized for expression in P. pastoris. The EmGFP- and CBM1-coding regions are highlighted
in green and gold, respectively. The CBM1 NL-coding region is highlighted in grey. The sequences encoding a
TEV recognition site and a six histidines tag are highlighted in pink and blue, respectively. Highlighted in red is
the stop codon. The underlined regions indicate the priming sites for the designed primers
3.2 Double-Step A two-step PCR was performed to synthesize the fusion genes
Primer ExtensionPCR EmGFP-TrCBM1Cel7A and EmGFP-NL-TrCBM1Cel7A, in which the
PCR products from the first PCR round served as template for the
second PCR (Table2).
1. To obtain the PCR1 and PCR3 products (Table2, Fig.1), mix
the following components in PCR tubes:
Template DNA100300ng (in 1 L).
Primer P1 (25 M)1 L.
Primer P2 for PCR1 and P3 for PCR3 (25 M)1 L.
dNTPs (10 mM each)1.5 L.
108 TatianaQ.Aguiar et al.
Table 2
Primers, template DNA, and annealing temperature (Ta) used for the
assembly and amplification of the fusion genes EmGFP-TrCBM1Cel7A and
EmGFP-NL-TrCBM1Cel7A
Number
of cycles PCR step Temperature (C) Time
1 Initial denaturation 95 2min
30 Denaturation 95 2min
Annealing (see Table2) 45 s
Extension 72 1 min/kb
1 Final extension 72 10min
Fig. 3 Final PCR products from the amplification of the fusion genes EmGFP-
TrCBM1Cel7 (A, PCR2 product) and EmGFP-NL-TrCBM1Cel7A (B, PCR4 product). MW
molecular weight standards
3.3 Vector Cloning The final PCR products can be digested with the cloning enzymes
andConfirmation and cloned directly into the expression vector or can alternatively
oftheFusion Genes be cloned into an intermediate cloning vector, propagated, excised
Sequence by restriction digestion, and finally cloned into the expression vec-
tor. Many convenient commercial systems for cloning of PCR
products are available, either for blunt-ended (e.g., pMOS, GE
healthcare) or A-ended products (e.g., pGEM-T, Promega).
Thermostable DNA polymerases with proofreading activity, such
as Vent, generate blunt-ended fragments, but these can be modi-
fied using an A-tailing procedure (see Note 9), and thus cloned in
any type of PCR cloning vectors. However, direct cloning is a more
rapid and less expensive approach.
1. Digest overnight at 37 C the purified PCR2 and PCR4 prod-
ucts with the cloning enzymes EcoRI-HF and KpnI-HF, using
the following reaction mixture:
Purified PCR product25 L
EcoRI-HF1 L
KpnI-HF1 L
10 CutSmart buffer3 L
2. Purify the digested products with the QIAquick PCR
Purification Kit (see Note 6).
110 TatianaQ.Aguiar et al.
4 Notes
Acknowledgments
References
1. Oliveira C, Aguiar TQ, Domingues L (2017) partners for soluble protein expression in
4 Principles of genetic engineering. In: Escherichia coli: a comparison with the tradi-
Pandey A, Teixeira JA (eds) Current develop- tional gene fusion technology. Appl Microbiol
ments in biotechnology and bioengineering: Biotechnol 97:67796791
Foundations of biotechnology and bioengi- 6. Ramos R, Domingues L, Gama M (2010)
neering, 1st edn. Elsevier, Oxford, pp81127 Escherichia coli Expression and purification of
2. Oliveira C, Seplveda G, Aguiar TQ, Gama LL37 fused to a family III carbohydrate-
FM, Domingues L (2015) Modification of binding module from Clostridium thermocel-
paper properties using carbohydrate-binding lum. Protein Expr Purif 7:17
module 3 from the Clostridium thermocellum 7. Aguiar TQ, Dinis C, Domingues L (2014)
CipA scaffolding protein produced in Pichia Cre-loxP-based system for removal and reuse
pastoris: elucidation of the glycosylation effect. of selection markers in Ashbya gossypii tar-
Cellulose 22:27552765 geted engineering. Fungal Genet Biol
3. Guerreiro CI, Fontes CM, Gama M, 68:18
Domingues L (2008) Escherichia coli 8. Sambrook J, Russell DW (2001) Molecular
Expression and purification of four antimicro- cloning: a laboratory manual. Cold Spring
bial peptides fused to a family 3 carbohydrate- Harbor Laboratory Press, Cold Spring
binding module (CBM) from Clostridium Harbor, NY
thermocellum. Protein Expr Purif 59:161168 9. Ling MM, Robinson BH (1997) Approaches
4. Oliveira C, Felix W, Moreira RA, Teixeira JA, to DNA mutagenesis: an overview. Anal
Domingues L (2008) Expression of frutalin, an Biochem 254:157178
-D-galactose-binding jacalin-related lectin, in 10. Wan W, Wang DM, Gao XL, Hong J(2011)
the yeast Pichia pastoris. Protein Expr Purif Expression of family 3 cellulose-binding mod-
60:188193 ule (CBM3) as an affinity tag for recombinant
5. Costa SJ, Almeida A, Castro A, Domingues L, proteins in yeast. Appl Microbiol Biotechnol
Besir H (2013) The novel Fh8 and H fusion 91:789798
Chapter 7
Abstract
Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including
recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and
mutagenesis procedures and allows generating nucleic acids for which no template is available. Here, we
describe a high-throughput platform to design and produce multiple synthetic genes (<500 bp) for recom-
binant expression in Escherichia coli. This pipeline includes an innovative codon optimization algorithm
that designs DNA sequences to maximize heterologous protein production in different hosts. The plat-
form is based on a simple gene synthesis method that uses a PCR-based protocol to assemble synthetic
DNA from pools of overlapping oligonucleotides. This technology incorporates an accurate, automated
and cost-effective ligase-independent cloning step to directly integrate the synthetic genes into an effective
E. coli expression vector. High-throughput production of synthetic genes is of increasing relevance to
allow exploring the biological function of the extensive genomic and meta-genomic information currently
available from various sources.
Key words Gene design, Gene synthesis, High-throughput (HTP), Codon optimization, PCR
assembly, Ligase-independent cloning (LIC)
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_7, Springer Science+Business Media LLC 2017
113
114 Ana Filipa Sequeira et al.
demands for synthetic genes, which far exceed existing gene syn-
thesis capabilities. Thus, it is crucial to develop simple gene synthe-
sis technologies that will allow synthesizing multiple artificial DNA
constructs of any size or sequence using rapid, accurate, cost-
effective and high-throughput (HTP) protocols.
Methods for de novo chemical synthesis of DNA have been
refined over the last years. A variety of these methodologies are
based on the assembling of oligonucleotides into complete genes
using PCR assembly [1, 2] or template-directed ligation [3].
Recently, improved methods have been described, which incorpo-
rate significant simplifications over earliest strategies [47]. In gen-
eral, the entire gene synthesis process involves seven major steps:
(1) gene design and sequence optimization; (2) oligonucleotides
design and synthesis; (3) gene assembly using PCR-based strate-
gies; (4) insertion of the generated nucleic acid into a cloning vec-
tor; (5) plasmid purification; (6) sequence verification and error
removal; and (7) synthetic gene product preparation for down-
stream applications. One important drawback of current protocols
is the low-throughput and high-cost associated with present tech-
nologies [8]. The establishment of HTP gene synthesis approaches
should allow obtaining 96, or more, synthetic genes simultane-
ously and requires high-fidelity oligonucleotides and DNA poly-
merases [7] used in optimized protocols. HTP gene synthesis
pipelines are powerful tools to increase the throughput of artificial
gene synthesis while decreasing production costs, thus contribut-
ing to create, in a simple manner, new biological products that can
potentially transform biomedical research.
This chapter reports an innovative HTP strategy for gene syn-
thesis that was used to produce thousands of genes encoding
venom peptides for efficient expression in Escherichia coli. This
platform was designed to produce small synthetic genes (up to 500
bp) following simple and accurate HTP protocols (multiples of 96
genes). The pipeline is totally automated (using a Tecan liquid
handling robot) but may be implemented manually. The developed
strategy avoids additional steps for the removal of errors from
synthetic genes, such as site-directed mutagenesis or enzyme treat-
ments using proteins involved in the recognition of mismatches
within DNA sequences [911]. Briefly, the HTP gene synthesis
protocol described here commences by designing the genes
(see Fig.1) by back-translating the peptide sequence and optimizing
Fig. 1 (continued) 24-DW plates containing LB medium supplemented with kanamycin (AD). On day 4,
synthetic genes cloned into pHTP4 vector are isolated by DNA plasmid purification and sequenced. Finally, DNA
sequences are checked for the presence of errors using NZYMulti Alignment tool, which allows analysing all
data simultaneously. highlights bioinformatics tools used for HTP gene and oligonucleotide design and
sequencing analysis (NZYTech, Ltd.) indicates steps that can be performed in an automated format using a
liquid handling robot containing a vacuum system. # represents checkpoints for control the efficiency of: #1
PCR assembly; #2PCR clean-up; #3Plasmid purification
DAY 0
Protein Gene Design with
Primers design
Sequences Codon Optimization
Primers synthesis
DAY 1
F1
PCR
master mix + + PCR setup
Inner primer R1
mix
Outer primers
PCR clean-up , #2
DNA quantification
DAY 2
Cloning
Transformation
4x 24-well LB
agar plates
A B C D
DAY 3
4x 24-DW 5 mL cultures
plates
A B C D
DAY 4
Plasmid purification , #3
DAY 5
Sequencing analysis
Fig. 1 Schematic representation of the HTP gene synthesis platform used for the production of multiples of 96
synthetic genes. This pipeline starts with gene design and codon optimization: multiple peptide sequences are
back-translated and optimized for expression in E. coli, using the ATGenium codon optimization algorithm.
Subsequently, oligonucleotides are designed using the NZYOligo designer. Day 1 starts with inner primer mix
preparation, followed by PCR assembly and PCR cleanup. On day 2, synthetic genes are directly cloned into the
E. coli pHTP4 expression vector using the NZYEasy Cloning & Expression kit (NZYTech, Ltd.). Cloning products
are transformed into E. coli DH5 cells and distributed into four 24-well LB agar plates supplemented with
kanamycin (AD). On day 3, an isolated colony from each well is inoculated into the correspondent well of four
116 Ana Filipa Sequeira et al.
2 Materials
F1 F2 F3 F4
Primer design 5' 3'
x96
3' 5'
R4 R3 R2 R1
Gap=20 bp Overlap=20 bp
F1 F2 F3 F4
No dilution
required
Fig. 2 Schematic diagram representing primer design, arrangement of plates for primer synthesis, and dilution
to be used for HTP gene synthesis production. After gene design, the 96 genes to synthesize are organized in
a 96-well format according to gene length. For each gene, a well position is defined and it is kept until the last
step of the HTP gene synthesis pipeline. This diagram presents the different steps involved in primer design,
primer synthesis and inner primer mix preparation for Gene 1 (340 bp), which is located in well position A01.
Each oligonucleotide is represented as an arrow; black arrows correspond to internal (inner) oligonucleotides,
while external (outer) oligonucleotides are denoted as grey arrows. Each strand of the desired gene is
dissected into 60 bp overlapping oligonucleotides spaced by 20 bp (named gap), with 20 bp overlap regions
between forward and reverse oligonucleotides (highlighted in light grey). Two outer oligonucleotides incorpo-
rate a 16 bp vector-complementary region at the 5-end (highlighted in dark grey rectangles) to ensure an
efficient LIC reaction. Following primer design, all oligonucleotides are organized by primer name in different
96-well plates. The total number of primer plates required is equal to the number of primers needed to syn-
thesize the desired gene (i.e., the synthesis of Gene 1 requires a total of eight primers that are distributed along
eight different primer plates). The inner primer mix will pool together in same well all inner primers at an equal
concentration of 125 nM.To do this and for Gene 1, a mixture of 5 L of each inner primer (F2, F3, F4, R2, R3,
and R4 primers) and 170 L of nuclease-free water is prepared in well position A01 of a new 96-well ELISA
plate, named inner primer mix plate. highlights bioinformatics tool used for HTP oligonucleotide design
(NZYOligo designer). indicates steps that can be performed in an automated format using a liquid handling
robot containing a vacuum system
118 Ana Filipa Sequeira et al.
2.2 Cloning 1. Cloning system: All cloning reactions are performed using the
andTransformation NZYEasy Cloning & Expression kit (NZYTech, Ltd). This sys-
tem allows direct cloning of synthetic genes into expression
vectors, avoiding additional steps of transferring genes from
cloning to expression vectors. In the current strategy, genes are
directly inserted into pHTP4 E. coli expression vector. This
vector is designed for direct cloning and high-level expression
of peptide sequences fused with a disulfide isomerase (DsbC)
protein. The vector carries the resistance gene for kanamycin
and includes an N-terminal 6-histidine tag which allows recom-
binant protein purification through IMAC (ion metal affinity
chromatography).
High-Throughput Gene Synthesis 119
3 Methods
3.2 Oligonucleotide The primer pool required to synthesize 96 artificial genes was
Design Using NZYOligo designed using the NZYOligo designer program, which allows
Designer Program working simultaneously with multiple DNA sequences. The algo-
rithm used for oligonucleotide design allows defining primer lengths,
gap regions, overlapping regions by defining start and end positions,
and introducing engineered 5- and 3-end sequences. The DNA
sequence of each gene is used as template to design the assembly
oligonucleotides by dividing the entire sequence into overlapping
primers with defined lengths. The external oligonucleotides, termed
outer primers, correspond to the external forward and reverse prim-
ers and internal oligonucleotides (termed inner primers) are usually
present in higher number than outer primers. Primers used for PCR
amplification had typically a length of 60 bp, an overlap region of 20
bp between forward and reverse primers, as well as a gap of 20 bp
(see Fig.2 and Note 4). Outer primer sequences included a 16-bp
overhangs on the 5-terminus of both forward and reverse primers
(see Table1) to allow ligase-independent cloning into the pHTP4
E. coli expression vector (see Notes 5 and 6).
In large projects, the arrangement of genes in a 96-well format
should be done according with gene size to facilitate the prepara-
tion of inner oligonucleotide mixtures. This enables keeping
together the genes that are assembled from a similar number of
oligonucleotides. Plate organization should be defined after gene
design. At this stage, a well position is defined and fixed for each
gene to synthesize by PCR assembly. For each gene, the same well
position is kept for respective primers and for subsequent steps.
Table 1
Overhang sequences included in the outer primers that allow cloning into
the pHTP4 vector
3.3 Gene Assembly 1. For each gene to be synthesized, prepare an inner primer mix
at 125 nM containing all inner oligonucleotides. For this, add
x L of nuclease-free water (x = 200 L n 5 L, nnum-
ber of inner primers that depends on the length of the target
gene) and add 5 L of each inner primer at 5 M to the cor-
responding well of the inner primer mix plate (see Fig.2 and
Note 9). Seal the plate with an adhesive PCR seal and centri-
fuge to spin down.
2. A single PCR reaction is performed in a final volume of 50
L.On ice, prepare a PCR master mix sufficient for 96 PCR
reactions (we recommend preparing a PCR master mix in
excess, for example for 104 reactions) by combining the
reagents specified in Table2 (see Note 10). Mix well the solu-
tion and centrifuge to spin down.
3. Using a multichannel pipette, distribute 26 L of PCR master
mix into each well of a 96-well PCR plate.
4. Using a multichannel pipette, add 8 L of inner primer mix at
125 nM, followed by 8 L of each outer primers at 5 M (F1
and R1 primers) into the corresponding well of the 96-well
PCR plate containing the PCR master mix. Seal the plate using
an adhesive PCR seal and centrifuge to spin down. The two
outer primers are used at a final concentration of 800 nM while
the inner primers are pooled together in an equimolar mixture
to achieve the final concentration of 20 nM in PCR reaction.
Table 2
PCR components used to perform 96 PCR assembly reactions
3.4 PCR Clean-Up 1. Proceed with silica-column purification of the PCR product
using NZYDNA Clean-up 96 well plate kit. This procedure
will remove dNTPs, unused primers and other impurities.
Purify the PCR products following the manufacturers instruc-
tions using the vacuum automated format (see Note 12).
2. Following PCR clean-up, quantify PCR products using a
UV/Vis microplate spectrophotometer, by measuring absor-
bance at 260nm. Determine an average concentration for 16
PCR products (in ng/L) and use this value to calculate the
amount of PCR product to use per cloning reaction, as
explained below.
3. Checkpoint #2: confirm the efficiency of the PCR clean-up
step by analysing a sample of eight out of the 96 reactions (one
column of the 96-well PCR plate, for example), through aga-
rose gel (1.5% w/v) electrophoresis (prepare and run samples
as explained above). Agarose gel electrophoresis should reveal
eight clear bands with the correct gene size (see Note 11).
3.5 Cloning Cloning of purified PCR products into the pHTP4 expression vec-
andTransformation tor should be performed using the NZYEasy Cloning & Expression
System that follows a LIC technology (see Notes 13 and 14). To
achieve high cloning efficiencies, we recommend using the follow-
ing equation which allows calculating the amount of PCR product
to be used per cloning reaction.
*
average concentration and PCR product length previously
calculated for 16 genes
1. A single cloning reaction is performed in a final volume of 10
L.On ice, prepare a cloning master mix sufficient for 96 reac-
tions (we recommend to prepare a cloning master mix in
124 Ana Filipa Sequeira et al.
Table 3
Cloning reaction components used to perform 96 cloning reactions
3.6 Plasmid 1. Using a centrifuge with a rotor for 24-DW plates, harvest cells
Purification at 1500 g for 15min at 4 C.Discard the supernatant into a
waste container with sodium hypochlorite for decontamina-
tion before disposal. Tap the plates upside down onto absor-
bent paper to remove any remaining liquid medium.
2. Purify plasmid DNA from the bacterial pellets using the
NZYMiniprep 96 well plate kit following the manufacturers
instructions for vacuum automated format (see Note 19).
3. Checkpoint #3: quantify DNA concentration using a UV/Vis
microplate spectrophotometer, by measuring absorbance at
260nm. Additionally, analyse a sample of eight out of the 96
DNA preparations (one column of the 96-well ELISA plate,
for example), through agarose gel (0.8% w/v) electrophoresis,
to confirm the concentration of plasmid DNAs. Agarose gel
electrophoresis should reveal a clear band with the correct
plasmid size (see Note 11).
4. Store plasmid DNA at 20 C.
126 Ana Filipa Sequeira et al.
3.7 Quality Control 1. Confirm the integrity of the gene sequences by Sanger
Sequencing. The artificial genes should be sequenced in both
directions. Quality control should ensure consistency of each
synthetic gene with the defined sequence (see Note 20).
2. Sequencing results are analysed using the NZYMulti Alignment
software or by performing a sequence alignment between tem-
plate DNA sequences and sequencing results of the 96 plas-
mids (see Notes 21 and 22).
4 Notes
References
1. Hoover DM, Lubkowski J(2002) DNAWorks: JMicrobiol Methods 81:147152.
an automated method for designing oligonu- doi:10.1016/j.mimet.2010.02.013
cleotides for PCR-based gene synthesis. 7. Wu G, Wolf JB, Ibrahim AF etal (2006) Simplified
Nucleic Acids Res 30:e43 gene synthesis: a one-step approach to PCR-based
2. Stemmer WP, Crameri A, Ha KD etal (1995) gene construction. JBiotechnol 124:496503.
Single-step assembly of a gene and entire plas- doi:10.1016/j.jbiotec.2006.01.015
mid from large numbers of oligodeoxyribonu- 8. Tian J, Ma K, Saaem I (2009) Advancing high-
cleotides. Gene 164:4953 throughput gene synthesis technology. Mol
3. Strizhov N, Keller M, Mathur Jetal (1996) A BioSyst 5:714. doi:10.1039/b822268c
synthetic cryIC gene, encoding a bacillus 9. Ma S, Saaem I, Tian J(2012) Error correction
thuringiensis delta-endotoxin, confers in gene synthesis technology. Trends
Spodoptera resistance in alfalfa and tobacco. Biotechnol 30:147154. doi:10.1016/j.
Proc Natl Acad Sci U S A 93:1501215017 tibtech.2011.10.002
4. Xiong A-S, Yao Q-H, Peng R-H etal (2004) A 10. Saaem I, Ma S, Quan J, Tian J(2012) Error
simple, rapid, high-fidelity and cost-effective correction of microchip synthesized genes
PCR-based two-step DNA synthesis method using surveyor nuclease. Nucleic Acids Res
for long gene sequences. Nucleic Acids Res 40:18. doi:10.1093/nar/gkr887
32:e98e98. doi:10.1093/nar/gnh094 11. Sequeira AF, Guerreiro CIPD, Vincentelli R,
5. Xiong A-S, Yao Q-H, Peng R-H etal (2006) Fontes CMGA (2016) T7 endonuclease I
PCR-based accurate synthesis of long DNA mediates error correction in artificial Gene
sequences. Nat Protoc 1:791797. synthesis. Mol Biotechnol. doi:10.1007/
doi:10.1038/nprot.2006.103 s12033-016-9957-7
6. Gordeeva TL, Borschevskaya LN, Sineoky SP 12. Welch M, Govindarajan S, Ness JE etal (2009)
(2010) Improved PCR-based gene synthesis Design parameters to control synthetic Gene
method and its application to the Citrobacter expression in Escherichia coli. PLoS One
freundii phytase gene codon modification. 4:e7002. doi:10.1371/journal.pone.0007002
Chapter 8
Colony PCR
FlvioAzevedo, HumbertoPereira, andBjrnJohansson
Abstract
Escherichia coli and Saccharomyces cerevisiae are currently the two most important organisms in synthetic
biology. E.coli is almost always used for fundamental DNA manipulation while yeast is the simplest host
system for studying eukaryotic gene expression and performing large scale DNA assembly. Yeast expression
studies may also require altering of the chromosomal DNA by homologous recombination. All these stud-
ies require the verification of the expected DNA sequence and the fastest method of screening is colony
PCR, which is direct PCR of DNA in cells without prior DNA purification. Colony PCR is hampered by
the difficulty of releasing DNA into the PCR mix and the presence of PCR inhibitors. We hereby present
one protocol for E. coli and two protocols for S. cerevisiae differing in efficiency and complexity as well as
an overview of past and possible future developments of efficient S. cerevisiae colony PCR protocols.
Key words PCR, Colony, Yeast, Saccharomyces cerevisiae, Escherichia coli, Direct lysis
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_8, Springer Science+Business Media LLC 2017
129
130 Flvio Azevedo et al.
2 Materials
Table 1
Recipe for 1 mL twice concentrated PCR mastermix containing 2% DMSO
suitable for colony PCR
Table 2
Recipe for 5 PCR compatible loading buffer
Component Volume
25% ficoll 10 mL
Tartrazine food coloring 1 mL
Xylene Cyanol 125 mg/mL 10 L
3 Methods
3.1 E. coli Colony This protocol can be used to amplify new constructs in E. coli
PCR transformants. We have found it efficient to use a three primer
strategy, using two vector-specific primers flanking the insertion
location of the insert and one gene-specific primer, which is usually
one of the primers used to amplify the insert (see Note 1). The two
vector-specific primers should differ in distance to the insertion site
by 200400 bp. Using this strategy, an empty clone will produce a
short PCR product corresponding to the distance between the
vector-specific primers while one of two longer bands will arise
depending on the orientation of the cloned insert.
1. Prepare a 1 PCR master mix containing all PCR components
except template DNA.We use a homemade 2 PCR master
mix containing DNA polymerase, buffer, Mg2+, dNTPs, and
DMSO (see Subheading 2) to which are added PCR primers to
a final concentration of 1 M and water. We prepare 110% of
the theoretical required volume, which is calculated as the total
volume of each PCR reaction times the number of clones,
including two negative (no cells and empty cells) and a positive
control if available. The cells are assumed to take up no volume
in the calculation.
2. Prepare the appropriate number of tubes containing 1 PCR
mastermix. We keep the tubes open before adding the E. coli
cells as we have found that the proximity to a bunsen burner
provide a sufficiently clean environment to avoid
contamination.
3. Add a part of the E. coli colony to the inside of the tube, by
swirling the toothpick against the wall of the tube (see Notes
24).
134 Flvio Azevedo et al.
3.2 S. cerevisiae This protocol usually represents the best compromise between
Colony PCR Using cost, work and success rate, and should probably be the first proto-
aMicrowaveOven col tested for a laboratory wishing to implement S. cerevisiae col-
ony PCR.We have found it to be efficient for PCR products up to
2 kb, with occasional success for products up to 3 kb in size.
1. Prepare 1 PCR master mix according to the same principles
as for the E. coli protocol (Subheading 3.1).
2. Pick a small, well-isolated colony with a sterile toothpick or a
sterile 200 L pipette tip (see Notes 3 and 5).
3. Transfer part of the colony to the side of a PCR tube. The most
common mistake is to transfer too much cell material to the
tube. We usually swirl the toothpick on the inside of the tube.
4. Transfer the remaining cells on the toothpick to fresh medium.
5. Incubate the tubes for 12min at full power (8001000 W)
using a stock microwave oven.
6. Cool the tubes by placing them on ice or by a 35-min incuba-
tion at 20 C in a freezer.
7. Add the PCR mastermix. We use a scale of 20 L to save on
reagents. A larger scale such as 50 L will be less sensitive to
excess biomass in the PCR reaction, which might be useful for
optimization.
8. Run the PCR program (see Note 6) and analyze 510 L of
the PCR product by gel electrophoresis.
3.3 PCR Using This protocol may not qualify as colony PCR, as DNA is effectively
S. cerevisiae LiAc purified from the cells. However, this protocol is considerably less
PermeabilizedCells laborious than methods relying on any combination of glass beads,
phenol, and chloroform. In our hands, this protocol has succeeded
where the microwave oven protocol (Subheading 3.2) failed. This
protocol has given us more stable results, especially in the hands of
less experienced workers. This protocol was first described by
Loke etal. [11].
Colony PCR 135
4 Future Development
5 Notes
Acknowledgment
References
1. Gssow D, Clackson T (1989) Direct clone nostic assays and DNA-extraction solutions.
characterization from plaques and colonies by Int JFood Microbiol 17:3745
the polymerase chain reaction. Nucleic Acids 13. Gietz RD, Schiestl RH (2007) High-efficiency
Res 17:4000 yeast transformation using the LiAc/SS carrier
2. Gibson DG, Benders GA, Axelrod KC, Zaveri DNA/PEG method. Nat Protoc 2:3134
J, Algire MA, Moodie M, Montague MG, 14. Pham TA, Kawai S, Murata K (2011)
Venter JC, Smith HO, Hutchison CA (2008) Visualization of the synergistic effect of lithium
One-step assembly in yeast of 25 overlapping acetate and single-stranded carrier DNA on
DNA fragments to form a complete synthetic Saccharomyces cerevisiae transformation. Curr
mycoplasma genitalium genome. Proc Natl Genet 57:233239
Acad Sci U S A 105:2040420409 15. Harju S, Fedosyuk H, Peterson KR (2004)
3. Pereira F, Azevedo F, Parachin NS, Hahn- Rapid isolation of yeast genomic DNA: bust n
Hgerdal B, Gorwa-Grauslund MF, Johansson grab. BMC Biotechnol 4:8
B (2016) Yeast pathway kit: a method for met- 16. Blount BA, Driessen MRM, Ellis T (2016) GC
abolic pathway assembly with automatically Preps: fast and easy extraction of stable yeast
simulated executable documentation. ACS genomic DNA.Sci Rep 6:26863
Synth Biol 5:386394
17. Walsh PS, Metzger DA, Higuchi R (1991)
4. Flvio Azevedo Humberto Pereira (2016) Chelex 100 as a medium for simple extraction
Online yeast colony PCR protocols. In: Public of DNA for PCR-based typing from forensic
Github Gist. https://gist.github.com/BjornF material. BioTechniques 10:506513
Johansson/490ca933976d286cbaef37a07df4
86b8. Accessed 1 Jul 2016 18. Kermekchiev MB, Kirilova LI, Vail EE, Barnes
WM (2009) Mutants of Taq DNA polymerase
5. Sathe GM, OBrien S, McLaughlin MM, resistant to PCR inhibitors allow DNA amplifi-
Watson F, Livi GP (1991) Use of polymerase cation from whole blood and crude soil sam-
chain reaction for rapid detection of gene ples. Nucleic Acids Res 37:e40
insertions in whole yeast cells. Nucleic Acids
Res 19:4775 19. Wang Y, Prosen DE, Mei L, Sullivan JC, Finney
M, Vander Horn PB (2004) A novel strategy to
6. Ling M, Merante F, Robinson BH (1995) A engineer DNA polymerases for enhanced pro-
rapid and reliable DNA preparation method cessivity and improved performance invitro.
for screening a large number of yeast clones by Nucleic Acids Res 32:11971207
polymerase chain reaction. Nucleic Acids Res
23:49244925 20. Ghadessy FJ, Ong JL, Holliger P (2001)
Directed evolution of polymerase function by
7. Wang H, Kohalmi SE, Cutler AJ (1996) An compartmentalized self-replication. Proc Natl
improved method for polymerase chain reac- Acad Sci U S A 98:45524557
tion using whole yeast cells. Anal Biochem
237:145146 21. Baar C, dAbbadie M, Vaisman A, Arana ME,
Hofreiter M, Woodgate R, Kunkel TA, Holliger
8. Bourke MT, Scherczinger CA, Ladd C, Lee P (2011) Molecular breeding of polymerases
HC (1999) NaOH treatment to neutralize for resistance to environmental inhibitors.
inhibitors of Taq polymerase. JForensic Sci Nucleic Acids Res 39:e51
44:10461050
22. Winship PR (1989) An improved method for
9. Akada R, Murakane T, Nishizawa Y (2000) directly sequencing PCR amplified material
DNA extraction method for screening yeast using dimethyl sulphoxide. Nucleic Acids Res
clones by PCR.BioTechniques 28:668670. 17:1266
672, 674
23. Varadaraj K, Skinner DM (1994) Denaturants
10. Linke B, Schrder K, Arter J, Gasperazzo T, or cosolvents improve the specificity of PCR
Woehlecke H, Ehwald R (2010) Extraction of amplification of a G + C-rich DNA using
nucleic acids from yeast cells and plant tissues genetically engineered DNA polymerases.
using ethanol as medium for sample preservation Gene 140:15
and cell disruption. BioTechniques 49:655657
24. Henke W, Herdel K, Jung K, Schnorr D,
11. Loke M, Kristjuhan K, Kristjuhan A (2011) Loening SA (1997) Betaine improves the PCR
Extraction of genomic DNA from yeasts for amplification of GC-rich DNA sequences.
PCR-based applications. BioTechniques Nucleic Acids Res 25:39573958
50:325328
25. Hengen PN (1997) Optimizing multiplex and
12. Rossen L, Nrskov P, Holmstrm K, LA-PCR with betaine. Trends Biochem Sci
Rasmussen OF (1992) Inhibition of PCR by 22:225226
components of food samples, microbial diag-
Colony PCR 139
26. Mytelka DS, Chamberlin MJ (1996) Analysis nanogold-assisted PCR with enhanced specific-
and suppression of DNA polymerase pauses ity. Angew Chem Int Ed 44:51005103
associated with a trinucleotide consensus. 36. Yang W, Li X, Sun J, Shao Z (2013) Enhanced
Nucleic Acids Res 24:27742781 PCR amplification of GC-rich DNA templates
27. Frackman S, Kobs G, Simpson D, Storts D etal by gold nanoparticles. ACS Appl Mater
(1998) Betaine and DMSO: enhancing agents Interfaces 5:1152011524
for PCR.Promega Notes 65:2729 37. Khaliq RA, Sonawane PJ, Sasi BK, Sahu BS,
28. Kang J, Lee MS, Gorenstein DG (2005) The Pradeep T, Das SK, Mahapatra NR (2010)
enhancement of PCR amplification of a ran- Enhancement in the efficiency of polymerase
dom sequence DNA library by DMSO and chain reaction by TiO 2 nanoparticles: crucial
betaine: application to invitro combinatorial role of enhanced thermal conductivity.
selection of aptamers. JBiochem Biophys Nanotechnology 21:255704
Methods 64:147151 38. Jia J, Sun L, Hu N, Huang G, Weng J(2012)
29. Hardjasa A, Ling M, Ma K, Yu H (2010) Graphene enhances the specificity of the poly-
Investigating the effects of DMSO on PCR merase chain reaction. Small 8:20112015
fidelity using a restriction digest-based 39. Musso M, Bocciardi R, Parodi S, Ravazzolo R,
method. JExp Microbiol Immunol Ceccherini I (2006) Betaine, dimethyl sulfox-
14:161164 ide, and 7-deaza-dGTP, a powerful mixture for
30. Rees WA, Yager TD, Korte J, von Hippel PH amplification of GC-rich DNA sequences.
(1993) Betaine can eliminate the base pair JMol Diagn 8:544550
composition dependence of DNA melting. 40. Ralser M, Querfurth R, Warnatz H-J, Lehrach
Biochemistry 32:137144 H, Yaspo M-L, Krobitsch S (2006) An efficient
31. Spiess A-N, Mueller N, Ivell R (2004) and economic enhancer mix for PCR.Biochem
Trehalose is a potent PCR enhancer: lowering Biophys Res Commun 347:747751
of DNA melting temperature and thermal sta- 41. Zhang Z, Kermekchiev MB, Barnes WM
bilization of taq polymerase by the disaccharide (2010) Direct DNA amplification from crude
trehalose. Clin Chem 50:12561259 clinical samples using a PCR enhancer cocktail
32. Desai UJ, Pfaffle PK (1995) Single-step purifi- and novel mutants of Taq. JMol Diagn
cation of a thermostable DNA polymerase 12:152161
expressed in Escherichia coli. BioTechniques 42. Dallas-Yang Q, Jiang G, Sladek FM (1998)
19(780782):784 Avoiding false positives in colony
33. Bachmann B, Lke W, Hunsmann G (1990) PCR.BioTechniques 24:580582
Improvement of PCR amplified DNA sequenc- 43. Lee AB, Cooper TA (1995) Improved direct
ing with the aid of detergents. Nucleic Acids PCR screen for bacterial colonies: wooden
Res 18:1309 toothpicks inhibit PCR amplification.
34. Wilson IG (1997) Inhibition and facilitation of BioTechniques 18:225226
nucleic acid amplification. Appl Environ 44. Colony Immunoblotting Assay for Detection
Microbiol 63:37413751 of Bacterial Cell-surface or Extracellular
35. Li H, Huang J, Lv J, An H, Zhang X, Zhang Proteins BIO-PROTOCOL. http://www.
Z, Fan C, Hu J(2005) Nanoparticle PCR: bio-protocol.org/e888. Accessed 26 Jul 2016
Chapter 9
Abstract
The microbial assessment of potable/drinking water is done to ensure that the resource is free of fecal
contamination indicators or waterborne pathogens. Culture-based methods for verifying the microbial
safety are limited in the sense that a standard volume of water is generally tested for only one indicator
(family) or pathogen.
In this work, we describe a membrane filtration-based molecular microbiology method, CRENAME
(Concentration Recovery Extraction of Nucleic Acids and Molecular Enrichment), exploiting molecular
enrichment by whole genome amplification (WGA) to yield, in less than 4 h, a nucleic acid preparation
which can be repetitively tested by real-time PCR for example, to provide multiparametric presence/
absence tests (1 colony forming unit or microbial particle per standard volume of 100-1000 mL) for bacte-
rial or protozoan parasite cells or particles susceptible to contaminate potable/drinking water.
Key words Drinking water analysis, Molecular microbiology, Multiparametric detection, Microbial
assessment, Fecal contamination indicators, Waterborne pathogens, CRENAME, Membrane filtra-
tion, Whole genome amplification
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_9, Springer Science+Business Media LLC 2017
141
142 Luc Bissonnette et al.
2 Materials
2.1 Water Sample 1. Potable/drinking water sample. Volume from 100 to 1000
Membrane Filtration mL (see Note 1).
2. Internal process control. B. atrophaeus subsp. globigii CCRI-
9827 (equivalent to strain NRS1221 A; also named B. globigii)
[28] (see Note 2).
3. Tri-headed standard filtration manifold, UV sterilization appa-
ratus, and vacuum pump.
4. Sterile (sterilizable) tweezers or forceps.
5. Sterile non-gridded GN-6 Metricel membrane filters (47mm
diameter, 0.45 m pore size; PALL Corporation) (see Notes 3
and 4).
6. Reverse osmosis-purified water (RO water; resistivity of 18
M-cm min at 25 C).
7. Sterile RO water is autoclaved for 30min (121 C, 15 lbs./in2).
8. Sterile 15-mL polypropylene tube.
3 Methods
3.1 Water Sample 1. Prior to filtration, B. globigii spores used as internal process
Membrane Filtration control are added to water samples at approximately 60 per
100 mL.
2. For filtration of the potable/drinking water sample (1001000
mL) spiked with B. globigii spores, a GN-6 membrane is asep-
tically deposited on the filtration platform of a tri-headed man-
ifold before assembly of the UV-sterilized funnel with filtration
head. The water sample is dispensed in the funnel and vacuum
is applied to force the sample through the filtration membrane.
The funnel is rinsed with approximately 2530 mL of sterile
RO water and the filtration is completed.
3. After filtration, the funnel is removed and the filtration mem-
brane is aseptically and quickly transferred to a clean 15-mL
polypropylene tube (see Note 7) (Fig.1).
Fig. 1 Transfer of the filtration membrane into a 15-mL polypropylene tube. While
still wet, the filtration membrane is rolled over sterile tweezers or forceps to
facilitate insertion in the polypropylene tube. The top portion of the filter (where
most particles must be immobilized) facing inward the tube to minimize physical
or physicochemical interactions of particles with the plastic surface
4 Notes
Acknowledgments
References
1. OECD (Organisation for Economic 12. Scheusner DL, Busta FF, Speck ML (1971)
Co-operation and Development) (1999) Inhibition of injured Escherichia coli by several
Health Policy brief molecular technologies selective agents. Appl Microbiol 21:4649
for safe drinking water: results from the inter- 13. Feng PC, Hartman PA (1982) Fluorogenic
laken workshop, Switzerland. http://www. assays for immediate confirmation of Escherichia
oecd.org/health/biotech/2097510.pdf. coli. Appl Environ Microbiol 43:13201329
Accessed 16 Jun 2016 14. Frahm E, Obst U (2003) Application of the
2. Maheux AF, Bissonnette L, Hupp V etal fluorogenic probe technique (TaqMan PCR)
(2016) The requirements and challenges of a to the detection of Enterococcus spp. and
mobile laboratory for onsite water microbiol- Escherichia coli in water samples. JMicrobiol
ogy assessment. Water Pract Technol 11:198 Meth 52:123131
209. doi:10.2166/wpt.2016.024 15. Dwivedi HP, Jaykus L-E (2011) Detection of
3. Costn-Longares A, Montemayor M, Payn A pathogens in foods: the current state-of-the art
etal (2008) Microbial indicators and patho- and future directions. Crit Rev Microbiol
gens: removal, relationships and predictive 37:4063
capabilities in water reclamation facilities. 16. Sontakke S, Cadenas MB, Maggi RG etal
Water Res 42:44394448 (2009) Use of broad range 16S rDNA PCR in
4. USEPA (United States Environmental clinical microbiology. JMicrobiol Meth
Protection Agency) (2008) Literature review 76:217225
of molecular methods for simultaneous detec- 17. Aldom JE, Chagla AH (1995) Recovery of
tion of pathogens in water. Cryptosporidium oocysts from water by mem-
EPA/600/R-07/128, Environmental brane filter dissolution method. Lett Appl
Technology Council, United States Microbiol 20:186187
Environmental Protection Agency, Cincinnati,
OH, p139. http://nepis.epa.gov/Adobe/ 18. Fukatsu T (1999) Acetone preservation: a
PDF/P1008BJ3.pdf. Accessed 16 Jun 2016 practical technique for molecular analysis. Mol
Ecol 8:19351945
5. Payment P, Locas A (2011) Pathogens in
water: value and limits of correlation with 19. Mangels JI, Cox ME, Lindberg LH (1984)
microbial indicators. Ground Water 49:411 Methanol fixation. An alternative to heat fixa-
tion of smears before staining. Diagn Microbiol
6. Wu J, Long SC, Das D etal (2011) Are micro- Infect Dis 2:129137
bial indicators and pathogens correlated? A sta-
tistical analysis of 40 years of research. JWater 20. Ganesh A, Lin J(2013) Waterborne human
Health 9:265278 pathogenic viruses of public health concern.
Int JEnviron Health Res 23:544564
7. Maheux AF, Bissonnette L, Boissinot M etal
(2011) Rapid concentration and molecular 21. Gibson KE (2013) Viral pathogens in water:
enrichment approach for sensitive detection of occurrence, public health impact, and available
Escherichia coli/Shigella in potable water sam- control strategies. Curr Opin Virol 4:5057
ples. Appl Environ Microbiol 77:61996207 22. Ikner LA, Gerba CP, Bright KR (2012)
8. Li L, Mendis N, Trigui H, Oliver JD etal Concentration and recovery of viruses from
(2014) The importance of the viable but non- water: a comprehensive review. Food Environ
culturable state in human bacterial pathogens. Virol 4:4167
Front Microbiol 5:258 23. Maheux AF, Bissonnette L, Boissinot M etal
9. Lasken RS, Egholm M (2003) Whole genome (2011) Method for rapid and sensitive detec-
amplification: abundant supplies of DNA from tion of Enterococcus sp. and Enterococcus
precious samples or clinical specimens. Trends faecalis/faecium cells in potable water samples.
Biotechnol 21:531535 Water Res 45:23422354
10. Lovmar L, Syvnen A-C (2006) Multiple dis- 24. Maheux AF, Brub , Boudreau DK etal
placement amplification to create a long-lasting (2013) Abilities of the mCP agar method and
source of DNA for genetic studies. Hum Mutat CRENAME alpha toxin-specific real-time PCR
27:603614 assay to detect Clostridium perfringens spores
in drinking water. Appl Environ Microbiol
11. Binga EK, Lasken RS, Neufeld JD (2008) 79:76547661
Something from (almost) nothing: the impact
of multiple displacement amplification on 25. Maheux AF, Hupp V, Bissonnette L etal
microbial ecology. ISME J2:233241 (2012) Comparative analysis of classical and
molecular microbiology methods for the detec-
CRENAME for Multiparametric Assessment of Potable/Drinking Water 151
tion of Escherichia coli and Enterococcus spp. in water regulations: long term 2 enhanced sur-
well water. JEnviron Monitor 14:29832989 face water treatment rule; final rule. Fed
26. Maheux AF, Boudreau DK, Bisson M-A etal Register 71:654786
(2014) Molecular method for detection of
28. Picard FJ, Gagnon M, Bernier MR etal
total coliforms in drinking water samples. Appl (2009) Internal control for nucleic acid test-
Environ Microbiol 80:40744084 ing based on the use of purified Bacillus atro-
27. USEPA (U.S.Environmental Protection phaeus subsp. globigii spores. JClin Microbiol
Agency) (2006) National primary drinking 47:751575
Chapter 10
Abstract
Detection of food-borne pathogens is traditionally carried out by plating out techniques in selective or
differential media using Petri agar dishes or other culture-dependent methods, usually designed for each
pathogen to be detected. These classical methods are time and personnel consuming and also may last for
up to 5 days in the case of final confirmation of some specific pathogens.
Here we describe a method for fast multiplex detection of nine food-borne pathogens (all species usu-
ally required under most countrylegislations) by means of a single multiplex PCR reaction coupled to a
capillary electrophoresis detection, in just 22.5h and with a minimum cost of around 2 per sample and
nine pathogens. This method saves consumables and personnel time and allows a faster detection of any
possible contaminated food batches at industrial level, therefore helping to prevent future food-borne
outbreaks at clinical level.
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_10, Springer Science+Business Media LLC 2017
153
154 Germn Villamizar-Rodrguez and Felipe Lomb
method has been useful for many years, but it involves a high level
of laboratory work and time needed to obtain confirmation of
pathogens presence. In some cases, up to 96h may be necessary in
order to obtain confirmation, delaying the implementation of the
right actions to stop or contain an outbreak.
Molecular methods, such as PCR, allow fast detection of food-
borne pathogens, avoiding extended time frames and intense
human laboratory work. Also, these molecular methods produce
results in less time than conventional culture ones. PCR detection
of pathogens, allows an important reduction in time analysis, gen-
erating results in just 2124h, including an initial pre-enrichment
step. This allows a faster response in case of an outbreak, but it also
reduces storage costs for the food industry.
PCR detection methods can be improved, by using more than
one pair of primers in the same PCR reaction, allowing the detec-
tion of more than one DNA target simultaneously in multiplex
mode. Multiplex PCR has been used previously for food-borne
pathogens detection [1]. This technique is able to detect up to
nine different targets at the same time [2], showing a high poten-
tial as the routine method in different food safety analyses.
Also, a non-selective pre-enrichment is a necessary step in
pathogen detection. This step is used to promote growth of puta-
tive pathogens which are present in low numbers or which may
have been affected by manufacturing, transport or storage condi-
tions, causing a drop in the numbers of viable cells, which could
not be detected in a given assay. In order to simplify our detection
method and to save time and reagents, a universal pre-enrichment
medium, named GVUM [2] has been developed in this work. This
GVUM has been designed to allow growth of most important
food-borne pathogens, such as the nine pathogens described
above.
The multiplex PCR method described here coupled to capil-
lary electrophoresis, represents an advantage in food-borne
pathogen detection, because of the possibility of performing
amplification of nine different targets in the same reaction, with a
high level of accuracy and resolution, reducing time and sample
processing.
2 Materials
2.4 Genomic DNA 1. Qiagen DNeasy Blood & Tissue Kit (Qiagen), for gDNA
Extraction extracted from pure cultures (standard gDNA).
2. PrepMan Ultra Reagent (Thermo Fisher Scientific) for gDNA
extracted from food samples.
3. 1.5mL Eppendorf Safe-Lock Microcentrifuge tubes.
4. Hot water bath or thermal block.
5. Microcentrifuge.
6. 0.510, 10100 and 1001000L Micropipettes with tips.
3 Methods
3.1 Primer Design 1. For primer design, it is necessary to choose DNA targets which
must be specific for each pathogen. For this purpose, genomes
of each pathogen must be acquired from DNA databases such
as GenBank. In the selection process, it is necessary to avoid
genes with high level of variation or those related with viru-
lence/resistance features which may be present only in some
strains of a given species. The selected target gene must show
a well preserved sequence or must be common for all strains of
the pathogen of interest.
2. Once the gene sequence target has been established, different
software available on-line or in desktop versions can be used
for designing the PCR primers. Primer3 [4] and Fast PCR [5]
are useful tools which allow to fix final size of amplicons. This
is a necessary step in order to obtain amplicons with different
sizes which will be visualized later. These softwares also allow
the addition of GC-clamps at the end of the selected sequences.
Fast PCR allows primer evaluation too, in order to avoid
primer-dimer and cross amplification.
3. At the moment of ordering the synthesis of the designed oligo-
nucleotides, you may order them as lyophilized product, or
already dissolved in some buffers. We usually prefer the first
option, doing the stock solution in TE 1 in our laboratory, on
a final concentration of 100M for each primer.
3.2 Multiplex Primer 1. Test individual performance of each primer pair with the cor-
Optimization responding gDNA target, using a concentration of 1M for
each primer and fixing the Tm following the data obtained
from the software during the primer design process.
2. Adjust the concentration of each primer at a given Tm range,
testing this Tm range starting 2C under the theoretical Tm
and increasing 2C in each trial.
Multiplex Detection ofFood-Borne Pathogens 157
3.3 Food Matrices 1. Food sampling procedures are well regulated by the food safety
Sampling agencies. A model for sampling can be consulted online in the
laboratory manuals of FDA [6]. For example, for the genus
Salmonella, FDA establishes three categories of food which
have to be considered during the sampling. For each category,
I, II and III, the number of analytical units (25g each) are 60,
30 and 15, correspondingly.
2. Samples can be processed immediately or can be kept at 4C
until use.
3.4 Pre-Enrichment 1. Mix all ingredients of the GVUM medium in a beaker; add
enough distilled water to guarantee good mixing. Transfer the
mix to a graduate cylinder or to another volumetric device.
Complete the desired volume with distilled water. Then steril-
ize it autoclaving at 121C during 15min.
2. In a sterile cabinet, weigh 25g of the corresponding food sam-
ple in the homogenizer bag, using a sterile fork or spatula to
transfer the food matrix. Assure that the food portion reaches
the bottom of the bag avoiding the introduction of the fork or
spatula. If the sample has been retained in the middle, use the
bag walls to displace it to the right place.
3. Add to the bag the GVUM medium previously prepared, directly
from the sterile bottle until reaching 100g of total weigh, con-
sidering the sample and the pre-enrichment medium.
4. Seal the bag, folding from the opened size and using a clip.
5. Insert the bag in the homogenizer (Stomacher or similar).
Homogenize for 1min for soft samples or 2min for difficult
food samples.
6. Remove the bag from the homogenizer and place it in the incu-
bator for 24h at the corresponding temperature (3742C).
158 Germn Villamizar-Rodrguez and Felipe Lomb
3.5 Genomic DNA 1. Remove the bag from the incubator and open it carefully, in
Extraction order to avoid splashing.
2. Using a sterile serological pipette, collect aliquots of 1mL
from each bag and place them in 1.5mL centrifuge tube.
Remember to use one pipette to each bag. Discard the pipette
and the bag properly.
3. Centrifuge the tubes at 13,523g, for 1min.
4. Discard supernatant and add 180L of PrepMan Ultra
Reagent.
5. Mix well by vortex or pipetting.
6. Place the tubes in a thermal block or water bath at 100C for
10min. Sometimes caps could open during the process, be
careful with hot splash.
7. Once this incubation time is finished, remove the tubes and let
cool to room temperature.
8. Centrifuge at 12,000rpm for 2min.
9. Collect 100L of the supernatant and place it in a new sterile
1.5mL tube.
10. Keep at 4C until use (see Note 3).
3.6 PCR Run 1. Prepare the Master Mix, following the instructions of the man-
ufacturer and considering optimized concentration for each
primer pair. Remember to consider at least one or two reac-
tions more than the number of samples to test, in order to
balance possible pipetting errors during preparation.
2. Place 12L of DNA samples from Subheading 3.5 in the
PCR tubes, strips or plates.
3. Add the corresponding volume of master mix.
4. Place the tubes/strips/plates in the thermal cycle and run the
PCR amplification program (see Note 4).
5. Remove the samples and keep at 4C, waiting for the next step.
Fig. 1 Agarose gel electrophoresis showing the nine individual PCR amplicons generated on total DNA obtained
from spiked food matrix (red minced meat) with the different pathogens of this study. The right bar shows the
molecular weight of the corresponding PCR amplicons. BC: Bacillus cereus, CJ: Campylobacter jejuni, CP:
Clostridium perfringens, CS: Cronobacter sakazakii, EB: Enterobacteriaceae, EC: E. coli, LM: Listeria monocy-
togenes, SA: Staphylococcus aureus, SE: Salmonella spp.
8. Once the gel is solid, remove the comb, taking care to not
break the gel.
9. Add the corresponding volume of loading buffer in each sam-
ple tube (containing PCR product) mixing well by pipetting
(see Note 6).
10. Place each sample in the well, remembering to include a DNA
Ladder lane (see Note 7).
11. Close the electrophoresis chamber, programming the power
unit for the right voltage and time (see Note 8).
12. Start electrophoresis run.
13. Once the run has been finished, remove the gel and place it in
a UV lamp (see Note 9). A typical result is shown in Fig.1.
LM
[FU]
5
16
450
400 EB
CP SE
350 86 5 BC CS
12 18
1
9
EC 142 19
300
70
250 CJ
SA 0
200 25
1
11
150
100
50
0
25 50 100 150 200 [bp]
Fig. 2 Capillary electropherogram showing the amplification of the nine pathogen gene targets after the multiplex
PCR. BC: Bacillus cereus, CJ: Campylobacter jejuni, CP: Clostridium perfringens, CS: Cronobacter sakazakii, EB:
Enterobacteriaceae, EC: E. coli, LM: Listeria monocytogenes, SA: Staphylococcus aureus, SE: Salmonella spp.
4. Close the priming station and press the plunger until hearing a
click.
5. Wait 60s and then release the plunger.
6. Before 5s, pull back gently the plunger up to 1mL position
and open the priming station (see Note 10).
7. Pipette now 9L in each one of the another two wells marked
with a squared G.
8. Load 5L of Gel-Dye Mix in the 12 sample wells, taking care
to not leave any well empty or introduce bubbles in the well.
9. Put the chip in the vortex adapter and mix for 1min at 28.97g,
avoiding splashes (see Note 11).
10. Place the chip on the 2100 Bioanalyzer, close the lid and check
that the chip has been recognized by the software.
11. Start the run.
12. Results can be viewed, analyzed and edited in the data window
of the 2100 Expert software (Fig.2).
4 Notes
Acknowledgments
References
1. Asakura M, Samosornsuk W, Hinenoya A, 4. Rozen S (1998) Primer3. http://bioinfo.
Misawa N, Nishimura K, Matsuhisa A etal ut.ee/primer3-0.4.0/primer3/
(2008) Development of a cytolethal distending 5. Kalendar R, Lee D, Schulman AH (2011) Java
toxin (cdt) gene-based species-specific multiplex web tools for in silico PCR and oligonucle-
PCR assay for the detection and identification of otide assembly and analysis. Genomics 98:
Campylobacter jejuni, Campylobacter coli and 137144
Campylobacter fetus. FEMS Immunol Med 6. Food and Drug Administration-FDA (2016)
Microbiol 52:260266 Bacteriological analytical manual (BAM).
2. Villamizar-Rodrguez G, Fernndez J, Marn L, https://www.fda.gov/Food/FoodScience
Muiz J, Gonzlez I, Lomb F (2015) Multiplex Research/LaboratoryMethods/ucm2006949.
detection of nine food-borne pathogens by mPCR htm
and capillary electrophoresis after using a universal 7. Yoon JY, Kim B (2012) Lab-on-a-Chip patho-
pre-enrichment medium. Front Microbiol 6:1194 gen sensors for food safety. Sensors (Basel)
3. Altschul SF, Gish W, Miller W, Myers EW, 12(8):1071310741
Lipman DJ (1997) Basic local alignment search
tool. JMol Biol 215:403410
Chapter 11
Abstract
Crustaceans are one of the most common allergens causing severe food reaction. Hypersensitivity reactions
associated with seafood intake are one of the most common food allergies in adults. Crustaceans including
shrimps, prawns, crabs, lobster, and crayfish are a common cause of anaphylaxis or hypersensitivity, with
shrimps and crabs being the most common causes of allergy. Symptoms occur most often when food or
cooking water are ingested.
These food allergens are a health problem, and they have become very important; as evidenced by the
existence of several regulations that establish that labeling must be present regarding these allergens to
warn consumers.
The methodology herein exposed allows the detection of crustaceans in any type of product, includ-
ing those where very aggressive treatments of temperature and pressure are used during the manufacturing
process.
The main features of this method are its high sensitivity and specificity, and reduced analysis time of
real-time PCR (40min). This assay is a potential tool in issues related to the labeling of products and food
security to protect the allergic consumer.
Key words Crustacean, Detection, Allergen, Fast real-time PCR, LNA probe
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_11, Springer Science+Business Media LLC 2017
163
164 Francisco J. Santaclara and Montserrat Espieira
9. Spectrophotometer (NanoDrop).
10. Vortex mixer.
11. Tissue homogenizer.
12. Autoclave.
13. Balances.
14. Freezer.
15. Centrifuge for PCR plates.
16. Maxwell 16 MDx Research Instrument.
17. ViiA 7 Real-time PCR System (Applied Biosystems).
2.3 Reagents 1. Maxwell 16 FFS Nucleic Acid Extraction Kit X9431 (Promega).
2. CTAB (cetyl trimethyl ammonium bromide). For 1L of
Maxwell CTAB buffer: 20g of CTAB, 81.9g of NaCl, 100mL
of 1M Tris hydrochloride solution, 40mL of 0.5M EDTA
pH8.0. Dissolve and bring to 1L (to facilitate the dissolution
of the components, preheat on a hot plate with stirring at
65C). Autoclave for sterilizing the solution.
3. NaCl.
4. 1M Tris.
5. 0.5M EDTA pH8.
6. TaqMan Universal PCR Master Mix (Applied Biosystems).
7. Oligonucleotide primers (Table1).
8. FAM-LNA labeled oligonucleotide probe (Table1).
3 Methods
3.1 DNA Extraction 1. Prepare CTAB buffer as described in the Subheading 2.3.2,
use within 3months, store capped in the refrigerator at
4C.Preheat the CTAB solution at 65C before use to
dissolve the precipitate particles.
Table 1
Primers and probe used in this protocol for the detection of crustaceans in food with the protocol
herein described
3
1
2
Table 2
Composition of PCR reactions
3.2 Real-Time PCR While the PCR reactions are being set up, precautions should be
taken at all stages to avoid contamination of samples and reagents
(see Note 2).
1. Mix well all reagents by inverting the tubes a number of times
or for small volumes by flicking the tube and spin briefly (~5s)
in a centrifuge.
2. Prepare a PCR master mix in 1.5mL microcentrifuge tubes,
following the proportions indicated in the Table2 to maximize
uniformity and minimize labor when working with multiple
tubes or plates. The final volume of each master mix depends
on the number of reactions required for each real-time
PCR.Master mixes can be made in excess of what is actually
needed to account for pipetting variations, i.e., prepare 10%
excess of master mix. The probe must be handled with extreme
caution (see Note 3).
168 Francisco J. Santaclara and Montserrat Espieira
Table 3
PCR amplification profile of the real-time PCR system herein described
3.3 Program 1. Operate the Applied Biosystems ViiA 7 System and SDS
andRun Applied (Sequence Detection System) software according to the
Biosystems ViiA 7 manufacturers recommendations. Set reaction volume to
System 20L, and the amplification program as described in Table3
(unless other parameters are established in the internal meth-
odological validation). Use FAM/LNA as detector/quencher.
2. Briefly, launch the SDS software and open a new plate template
window to denote well locations on the 96-well plate for the
controls, and testing samples. Save the template window with
the recorded data as a SDS run file.
3. Select the Connect button, and then load the 96-well plate
into the instrument. Select the Start button to begin the
actual run.
4. Run the PCR reaction to determine Ct (cycle threshold) values
for each sample.
3.4 Data Collection After the run is completed, select baseline, and place the threshold
andAnalysis line at the exponential phase of amplification. Remove the plate
from the instrument and save the results of the run. When the analy-
sis button is selected in the SDS software, the results will be analyzed
automatically if the standards and testing sample information were
recorded as noted in the previous section. The Ct values obtained
should be thoroughly reviewed (see Note 5) and interpretation of
Fast Real-Time PCR fortheDetection ofCrustacean Allergens inFoods 169
4 Notes
References
1. Brzezinski JL (2005) Detection of crustacean 2. Herrero B, Vieites JM, Espieira M (2012) Fast
DNA and species identification using a PCR real-time PCR for the detection of crustacean
restriction fragment length polymorphism allergen in foods. JAgric Food Chem
method. JFood Prot 68(9):18661873 60(8):18931897
Chapter 12
Abstract
Soy is used as an additive in the manufacturing of diverse products, because of their ability of emulsifica-
tion, water and fat absorption, contributing to the consistency of food products. Moreover, soy is recog-
nized as a potential allergen, so its presence should be indicated in all the food products.
These issues highlight the need for techniques that allow the detection of soy in foods. This work
describes a real-time PCR method for the detection of soy in a wide range of foodstuffs. The main features
of this technique are its reliability and sensitivity, allowing the detection of trace amounts of soybean in
processed products. TaqMan real-time PCR is one of the simplest and fastest molecular biology tech-
niques, with a high potential for automation. Therefore, it is one of the techniques most used for screening
a variety of substances.
The methodology herein described is of great value in issues regarding the presence of soy protein in
processed products, especially in verifying labeling and security regulations to protect consumers rights.
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_12, Springer Science+Business Media LLC 2017
173
174 Montserrat Espieira and Francisco J. Santaclara
Table 1
Primers and probe used in this protocol for the soy detection with the protocol herein described
Molecular Amplicon
Oligonucleotide designation Sequence (5-3) marker size (bp) References
Forward LEC IF CTT CTT TCT CGC ACC Lectin gene 100 [5]
primer AAT
Reverse LEC IR CTC AAC AGC GAC GAC
primer TTG
Probe LE-Probe 6-FAM-CAC ATG CAG GTT [1]
ATC TTG GTC-TAMRA
176 Montserrat Espieira and Francisco J. Santaclara
3 Methods
3.1 DNA Extraction 1. Prepare CTAB solution as described in the materials section
(Subheading 2.3, item 5), use within 3months, store capped
in the refrigerator at 4C.Prior to use, add to 100mL of
CTAB, 4g polyvinylpyrrolidone MW 40,000 (PVP-40) and
500L -mercaptoethanol and stir to dissolve before starting
extractions. Preheat the CTAB solution at 65C before use to
dissolve the precipitate particles.
2. Weigh out 10g of triturated and homogenized sample that
will be analyzed.
3. Add 10mL of preheated CTAB buffer and 100L proteinase
K (10mg/mL).
4. Transfer the solution to a 50-mL tube. Optional: Add 10L of
RNAse A (2mg/mL) and mix by inverting.
5. Incubate samples in a thermomixer (or similar equipment) at
55C for 1h. Then centrifuge for 5min at maximum speed
and transfer 1mL of aqueous phase to a 2mL microtube (in
duplicate).
6. Add 500L of 24:1 chloroformisoamyl alcohol and mix well
the tubes with hands (by inversion), until a homogeneous
emulsion is formed.
7. Centrifuge for 810min at maximum speed (12,000
13,000rpm or 960011300 relative centrifugal force).
Following centrifugation, you should have three layers. Top:
aqueous phase; middle: debris and proteins; and bottom: chlo-
roform with cellular debris. Proceed to the next step quickly,
so the phases do not remix.
8. Pipette off the aqueous phase (top) taking care not to suck up
any of the middle or chloroform phases.
9. Place the aqueous phase into a new labeled 1.5mL tube.
10. Add 30L of cold 7.5M ammonium acetate.
11. Add 200 L of cold isopropanol (20C, to the combined
volume of aqueous phase and added ammonium acetate).
12. Mix well by inversion.
13. Let sit in freezer for 45min to an hour.
14. Centrifuge for 3min at maximum speed. Orient tubes in an
equal fashion to facilitate subsequent removal of supernatant
without disturbing resultant DNA pellet.
15. Pipette off the liquid, being careful not to lose the pellet with
your DNA.The DNA pellet at this stage is very loose and
difficult to see.
Fast Real-Time PCR Method forDetection ofSoy inFoods 177
3.2 Real-Time PCR While PCR reactions are being set up, precautions should be taken
at all stages to avoid contamination of samples and reagents. It is
advisable to work in laboratories with unidirectional workflow, and
at least the following rooms: DNA extraction room; master mix
preparation room (in this room only reagents are handled, and no
DNA enters, in order to avoid contamination of reagents); PCR
room (in this room, the DNA is dispensed, and the master mix
previously prepared is added); PCR room, where the thermocycler
and PCR reactions are performed (see Note 2).
1. Mix well all reagents by inverting the tubes a number of times
or for small volumes by flicking the tube and spin briefly (~5s)
in a centrifuge. The probe must be prepared as described in the
Note 3.
2. Prepare the PCR master mix in 1.5mL microcentrifuge tubes,
as shown in Table2 to maximize uniformity and minimize
labor when working with multiple tubes. The final volume of
each master mix depends on the number of reactions required
for each real-time PCR.Master mixes can be made in excess of
what is actually needed to account for pipetting variations, i.e.,
prepare 10% excess of master mix.
3. Mix the master mix thoroughly and dispense equal aliquots
into each thin-walled PCR tube. Set up the real-time PCR in a
178 Montserrat Espieira and Francisco J. Santaclara
Table 2
Composition of PCR reactions
Table 3
PCR amplification profile of the real-time PCR system herein described
3.3 Program 1. Operate the Applied Biosystems ViiA 7 System and SDS
andRun Applied (Sequence Detection System) software according to the manu-
Biosystems ViiA 7 facturers recommendations. Set reaction volume to 25L,
system and the amplification program as described in Table3 (unless
other parameters are established in the methodological valida-
tion). Use FAM/TAMRA as detector/quencher.
2. Briefly, launch the SDS software and open a new plate template
window to denote well locations on the 96-well plate for the
controls, and testing samples. Save the template window with
the recorded data as an SDS run file.
Fast Real-Time PCR Method forDetection ofSoy inFoods 179
3. Select the Connect button, and then load the 96-well plate
into the instrument. Select the Start button to begin the
actual run.
4. Run the PCR reaction to determine Ct (cycle threshold) values
for each sample.
3.4 Data Collection After the run is completed, select baseline and place the threshold
andAnalysis line at the exponential phase of amplification. Remove the plate
from the instrument and save the results of the run. When the
analysis button is selected in the SDS software, the results will be
analyzed automatically if the standards and testing sample informa-
tion has been recorded as noted above. The Ct values obtained
should be reviewed (see Notes 7 and 8) and interpretation of the
results must be made in relation to data obtained in the internal
validation performed in each laboratory for a given detection limit
(see Notes 911), allowing to determine whether a sample con-
tains or does not contain soy.
4 Notes
References
1. Belloque J, Garca MC, Torre M, Marina ML 4. Espieira M, Herrero B, Vieites JM, Santaclara
(2002) Analysis of soyabean proteins in meat FJ (2010) Validation of end-point and real-time
products: a review. Crit Rev Food Sci Nutr PCR methods for the rapid detection of soy
42(5):507532 allergen in processed products. Food Addit
2. Hoogenkamp HW (2005) Soy protein and for- Contam Part A 27(4):426432
mulated meat products. CABI Pub, Cambridge 5. Zhang M, Gao X, Yu Y, Ao J, Qin J, Yao Y, Li Q
3. Codex Alimentarius (2016.) http://www.fao. (2007) Detection of roundup ready soy in
org/fao-who-codexalimentarius/codex-home/ highly processed products by triplex nested
es/. Accessed Jun 2016. PCR.Food Control 18(10):12771281
Chapter 13
Abstract
Food safety and quality are nowadays a major consumers concern. In the dairy industry the fraudulent
addition of cheaper/lower-quality milks from nonlegitimate species/breeds compromises the quality and
value of the final product. Despite the already existing approaches for identification of the species origin of
milk, there is little information regarding differentiation at an intra-species level. In this protocol we
describe a low-cost, sensitive, fast, and reliable analytical techniqueRandom Amplified Polymorphic
DNA/Sequence Characterized Amplified Region (RAPD/SCAR)capable of an efficient detection of
adulterant breeds in milk mixtures used for fraudulent manufacturing of dairy products and suitable for the
detection of milk adulteration in processed dairy foods.
Key words DNA extraction, RAPD, SCAR, Breed identification, Milk adulteration, Dairy authenti-
cation, Food quality control
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_13, Springer Science+Business Media LLC 2017
183
184 JoanaT. Cunha andLucliaDomingues
Fig. 1 Schematic illustration of the basic steps in the RAPD/SCAR approach for breed identification from milk
samples
RAPD/SCAR for Breed Identification in Dairy 185
2 Materials
3 Methods
3.1 DNA Extraction 1. Harvest somatic cells by mixing 0.5 mL of Clearing Solution
fromMilk Samples with 1 mL of milk sample and centrifuging at 16,100 g for 5min.
Remove the resulting cream pad and supernatant (see Note 1).
2. Lyse the somatic cells by ressuspending the pellet in 860 L of
Extraction Buffer, 100 L of 5M guanidine hydrochloride and
20 L of 20 mg/mL Proteinase K.Incubate for 3 h or o/n at
55 C, 80rpm.
3. Let the cell lysate cool at room temperature. In a fume hood
add 500 L of phenolchloroformisoamyl alcohol (25:24:1)
and centrifuge at 16,100 g for 15min. Collect the clear aque-
ous upper phase containing DNA (see Note 2).
4. Precipitate DNA by adding 800 L of ice-cold absolute ethanol
and centrifuge at 4 C and 16,100rpm for 30min. Discard the
supernatant and let the pellet to dry in a fume hood (see Note 3).
5. Elute the DNA in 30 L of sterile ultrapure water. Determine
spectrophotometrically the DNA concentration and purity (see
Note 4).
RAPD/SCAR for Breed Identification in Dairy 187
3.2 RAPD Analysis 1. Select appropriate RAPD primers from the literature (see Note 5).
2. Select DNA from one individual of each breed to perform a
preliminary analysis with all the RAPD primers (see Note 6).
3. For the RAPD PCR, prepare the following reaction mixture
(see Note 7).
Template DNA: 200ng.
50 mM MgCl2: 4 L.
10 mM dNTPS: 2.5 L.
20 M RAPD primer: 2.5 L.
100% DMSO: 2.5 L.
5 U/L Taq polymerase: 0.5 L.
10x Reaction buffer: 5 L.
Ultrapure H2O: up to 50 L (depending on template
DNA concentration).
4. Perform the amplification in a thermal cycler programmed as
follows (see Note 7):
Number Time
of cycles PCR step Temperature (C) (min)
1 Initial denaturation 95 2
45 Denaturation 95 1
Annealing 34 1
Extension 72 2
1 Final extension 72 5
Fig. 3 RAPD amplification patterns obtained, with two combined primers GLA-19 (5 CAAACGTCCGG 3) and
OPB-12 (5 CCTTGACGCA 3), from several individuals of each breed: seven of A, two from B, four from C, and
two from D.MM, molecular marker
RAPD/SCAR for Breed Identification in Dairy 189
Number
of cycles PCR step Temperature (C) Time
1 Initial denaturation 95 2min
45 Denaturation 95 1min
Annealing 63 1min
Extension 72 20 s
1 Final extension 72 5min
4 Notes
Acknowledgments
References
1. Lipkin E, Shalom A, Khatib H etal (1993) identification of cows, goats and sheeps milk
Milk as a source of deoxyribonucleic acid and as in dairy products. Int Dairy J13:277282
a substrate for the polymerase chain reaction. 4. Gonalves J, Pereira F, Amorim A etal (2012)
JDairy Sci 76:20252032 New method for the simultaneous identifica-
2. Agrimonti C, Pirondini A, Marmiroli M etal tion of cow, sheep, goat, and water buffalo in
(2015) A quadruplex PCR (qxPCR) assay for dairy products by analysis of short species-
adulteration in dairy products. Food Chem specific mitochondrial DNA targets. JAgric
187:5864 Food Chem 60:1048010485
3. Bottero MT, Civera T, Nucera D etal (2003) A 5. Abdel-Rahman SM, Ahmed MMM (2007)
multiplex polymerase chain reaction for the Rapid and sensitive identification of buffalos,
RAPD/SCAR for Breed Identification in Dairy 193
cattles and sheeps milk using species-specific goat breed dairy products. Food Res Int 74:
PCR and PCR-RFLP techniques. Food Control 115122
18:12461249 10. Cunha JT, Ribeiro TIB, Rocha JB etal (2016)
6. Ganopoulos I, Sakaridis I, Argiriou A etal RAPD and SCAR markers as potential tools for
(2013) A novel closed-tube method based on detection of milk origin in dairy products: adul-
high resolution melting (HRM) analysis for terant sheep breeds in Serra da Estrela cheese
authenticity testing and quantitative detection production. Food Chem 211:631636
in Greek PDO feta cheese. Food Chem 141: 11. Blixt Y, Knutsson R, Borch E etal (2003)
835840 Interlaboratory random amplified polymorphic
7. Lpez-Calleja I, Gonzlez I, Fajardo V etal DNA typing of Yersinia enterocolitica and Y.
(2007) Quantitative detection of goats milk in enterocolitica-like bacteria. Int JFood Microbiol
sheeps milk by realtime PCR.Food Control 83:1526
18:14661473 12. Gl F, Aldem OS, Gler L (2004) Differential
8. Fontanesi L, Beretti F, DallOlio S etal (2011) identification of cattle Sarcocystis spp. by ran-
A melanocortin 1 receptor (MC1R) gene poly- dom amplified polymorphic DNA polymerase
morphism is useful for authentication of chain reaction (RAPD-PCR). Rev Med Vet
Massese sheep dairy products. JDairy Res 155:440444
78:122128 13. Perry AL, Worthington T, Hilton AC (2003)
9. Sardina MT, Tortorici L, Mastrangelo S etal Analysis of clinical isolates of Propionibacterium
(2015) Application of microsatellite markers as acnes by optimised RAPD.FEMS Microbiol
potential tools for traceability of Girgentana Lett 228:5155
Chapter 14
Abstract
Inter simple sequence repeat (ISSR) markers help in identifying and determining the extent of genetic
diversity in cultivars. Here, we describe their application in determining the genetic diversity of bael (Aegle
marmelos Corr.). Universal ISSR primers are selected and their marker characteristics such as polymor-
phism information content, effective multiplex ratio and marker index have been evaluated. ISSR-PCR is
then performed using universal ISSR primers to generate polymorphic bands. This information is used to
determine the degree of genetic similarity among the bael varieties/accessions by cluster analysis using
unweighted pair-group method with arithmetic averages (UPGMA). This technology is valuable for bio-
diversity conservation and for making an efficient choice of parents in breeding programs.
Key words Bael (Aegle marmelos), DNA fingerprinting, Genetic diversity, ISSR, UPGMA
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_14, Springer Science+Business Media LLC 2017
195
196 Farina Mujeeb et al.
2 Materials
2.2 Agarose Gel 1. Midi subsystem of submarine gel electrophoresis unit with
Electrophoresis, power pack.
Quantification, and 2. 50 TrisAcetateEDTA Buffer (TAE), pH 8.0. 50 electro-
VisualizationofDNA phoresis and gel buffer. For preparing 100 mL of 50 TAE
buffer, add 24.2 g Tris free base (M.W. 121.14), 10 mL of
0.5M stock solution of Na2EDTA (pH 8.0), 5.71 mL glacial
acetic acid (M.W 60) and remaining volume of sterile distilled
water. For preparing 1 working solution (1 TAE), dilute 20
mL of 50 TAE to 1000 mL with distilled water. The 1 TAE
solution is 40 mM Tris, 20 mM Acetate and 1 mM Na2EDTA
(see Note 5).
3. DNA intercalating dye: 10 mg/mL ethidium bromide (EtBr).
Dissolve 10mg EtBr in 1 mL of sterile distilled water (see Note 6).
Store at 4 C.
4. Agarose gel: 0.8% (w/v) and 1.5% (w/v) agarose gel for visu-
alization of genomic DNA and amplified products, respec-
tively. Prepare agarose gels by melting 0.4 and 0.75 g,
respectively, in 50 mL of 1 TAE buffer (pH 8.0) by heating
(>90 C) in a microwave oven until completely melted. Cool
molten agarose (tolerable to hand) and add the stock of EtBr
at the concentration of 0.5 g/mL before casting the gel (see
Notes 6 and 7). Pour the solution on casting tray in the elec-
trophoresis unit with comb placed in order and allow it to
solidify at room temperature [26].
After solidification, immerse the gel under 1 TAE buffer in
the electrophoresis tank and gently remove the comb, leaving
wells where DNA samples are loaded.
5. 6 Tracking or sample loading dye: 0.25% bromophenol blue
(BPB), 30% glycerol. Prepare 100 mL of tracking dye by add-
ing 0.25 g BPB and 30 mL glycerol in rest volume of sterile
distilled water. Store at 4 C.
6. DNA size marker: DNA EcoR I + Hind III double digest.
7. DNA ladder: 100 bp.
8. Gel documentation system for visualization of EtBr-stained gel.
9. NanoDrop spectrophotometer (ND2000).
3 Methods
3.2 Quantification 1. Quantify and determine the purity of DNA by measuring opti-
and Visualization cal density (O.D.) at A260 and A280 with a NanoDrop
ofDNA Spectrophotometer (see Notes 12 and 13).
2. Dilute DNA to a concentration of 50 ng/L and store at 20 C
for further use.
3. Prepare DNA samples by mixing 6X tracking dye to get a final
concentration of 1 (see Note 14).
200 Farina Mujeeb et al.
3.3 Optimization 1. Select and purchase universal ISSR primers for PCR amplifica-
ofthePCR tion of genomic DNA from several varieties/accessions of
Amplification Reaction Aegle marmelos (Table1) (see Note 16).
2. Perform PCR amplifications by using the following PCR reac-
tion mixture: 25 L reaction mixture containing 2.0 L of
50ng template DNA, 2.5 L of 10 PCR buffer, 1.0 L of 50
mM MgCl2, 2.0 L of 10 mM dNTPs mix, 2.0 L of 10 pico-
mol primers, 0.5 L of 1 U Taq DNA polymerase, and 15.0 L
of sterile Milli-Q water (see Note 17).
3. Mix all the reagents by giving a short spin and amplify in a
DNA thermal cycler.
Table 1
ISSR primers used in the investigation of bael varieties/accessions
3.4 Analysis In order to assess the ability of the most informative primers to
ofMarker Properties differentiate between the bael varieties/accessions, calculate
various parameters for determining the marker efficiency and
genetic characteristics (see Note 19).
1. Calculate the polymorphism information content (PIC)
(Table2).
PIC =1 p2 q2 [27], where p is the band frequency and
q is no band frequency. Obtain the frequency of an allele by
dividing the number of isolates where the band is found by the
total number of isolates.
2. Calculate the effective multiplex ratio (EMR or E) (Table2).
E is the product of the total number of fragments per primer
(n) and the fraction of polymorphic fragments () [20, 28].
Thus,
E = n, where n = total number of bands and = total
number of polymorphic bands
3. Calculate the marker index (MI) (Table2).
MI is the product of PIC and EMR [29], given as: MI =
PIC EMR
a M1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M2
21,226
5,148/4,973
4,268 3,000
3,530
2,000
2,027
1,904 1,500
1,584
1,375
1,000
900
947 800
831
700
600
500
400
b M1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M2
21,226
5,148/4,973
4,268 3,000
3,530
2,000
2,027
1,904
1,584 1,500
1,375
1,000
947 900
831 800
700
600
500
400
c M1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M2
21,226
5,148/4,973
4,268 3,000
3,530
2,000
2,027
1,904
1,584
1,500
1,375
1,000
947
900
831
800
700
564
600
500
400
Fig. 1 Amplification products of ISSR primers (a) UBC-811, (b) UBC-825, and (c) UBC-842. Interpretation of
figure is given in Table2
Genetic Diversity of Bael: ISSR 203
Table 2
ISSR fingerprint data for the molecular characterization of Aegle marmelos. genotypes. The ISSR
bands for the highlighted primers are shown in Fig.1 (see Note 21)
ISSR Polymorphic
S.No. primers No. of bands bands % polymorphism PIC EMR MI
1. UBC 811 7 5 71.4% 0.20 35 7.0
2. UBC 815 2 2 100% 0.45 4 1.8
3. UBC 824 3 2 66.6% 0.22 6 1.2
4. UBC 825 11 10 90.9% 0.37 110 40.7
5. UBC 836 8 6 75.0% 0.20 48 9.6
6. UBC 840 5 5 100.0% 0.40 25 10
7. UBC 842 6 5 83.3% 0.36 30 10.8
8. UBC 859 3 2 66.6% 0.22 6 1.32
9. UBC 888 14 14 100.0% 0.36 196 70.56
10. UBC 889 14 14 100% 0.39 196 76.44
11. UBC 890 13 10 76.9% 0.27 130 35.1
Total 86 75
Mean/Avg. values 7.81 bands/primer 6.81 87.21% 0.31 71.45 24.04
4 Notes
AM-1
AM-2
AM-3
AM-4
AM-7
NB-16
NB-17
Pt.Ap
AM-6
NB-1
NB-4
NB-9
NB-7
Pt.St.
Pt.Sh
Kaghzi
NB-5
AM-8
0.44 0.47 0.51 0.55 0.59 0.63 0.67 0.71 0.75 0.78
Coefficient
Fig. 2 Dendrogram based on genetic distance computed from ISSR using UPGMA algorithm in different geno-
types of bael (see Note 22)
Acknowledgements
References
1. Benharrat H, Veronesi C, Theodet C, 6. Rubio-Moraga A, Candel-Perez D, Lucas-
Thalouam P (2002) Orobanche species and Borja ME, Tiscar PA, Viegla B, Linares JC,
population discrimination using inter simple Gmez-Gmez L, Ahrazem O (2012) Genetic
sequence repeat (ISSR). Weed Res 42: diversity of Pinus nigra Arn. Populations in
470474 southern Spain and northern Morocco revealed
2. Gonalves LSA, Rodrigues R, Amaral Jnior by inter-simple sequence repeat profiles. Int
AT, Karasawa M, Sudr CP (2008) Comparison JMol Sci 13:56455658
of multivariate statistical algorithms to cluster 7. Chowdhury MA, Vandenberg B, Warkentin T
tomato heirloom accessions. Genet Mol Res (2002) Cultivar identification and genetic rela-
7(4):12891297 tionship among selected breeding lines and cul-
3. Virk PS, Zhu J, Newburg HJ, Bryan GJ, tivars in chickpea (Cicer arietinum L.)
Jeckson MT, Ford-Lloyd BV (2001) Euphytica 127:317325
Effectiveness of different classes of molecular 8. Mattioni C, Casasoli M, Gonzalez M, Ipinza R,
markers for classifying and revealing variation Villani F (2002) Comparison of ISSR and
in rice germplasm. Euphytica 112:275284 RAPD markers to characterize three Chilean
4. Fernandez ME, Figueiras AM, Benito C (2002) Nothofagus species. Theor Appl Genet 104:
The use of ISSR and RAPD markers for detect- 10641070
ing DNA polymorphisms, genotype identifica- 9. Goulo L, Oliveira CM (2001) Molecular char-
tion and genetic diversity among barley cultivars acterization of cultivars of apple (Malus domes-
with known origin. Theor Appl Gen 104: tica Borkh.) using microsatellite (SSR and
845851 ISSR) markers. Euphytica 122:8189
5. Vicente MJ, Segura F, Aguado M, Migliaro D, 10. Tian HL, Xue JH, Wen J, Mitchell G, Zhou
Franco JA, Martnez-Snchez JJ (2011) S-L (2008) Genetic diversity and relationships
Genetic diversity of Astragalus nitidiflorus, a of lotus (Nelumbo) cultivars based on allozyme
critically endangered endemic of SE Spain, and and ISSR markers. Sci Hortic 116(4):421429
implications for its conservation. Biochem Syst 11. Reddy MP, Sarla N, Siddiq EA (2002) Inter
Ecol 39:175182 simple sequence repeat (ISSR) polymorphism
Genetic Diversity of Bael: ISSR 211
and its application in plant breeding. Euphytica ngerprinting of potato cultivars. Theor Appl
fi
128:917 Genet 1:107112
12. Triest L (2007) Molecular ecology and bioge- 21. Casasoli M, Mattioni C, Cherubini M, Villani F
ography of mangrove trees towards conceptual (2001) A genetic linkage map of European
insights on gene flow and barriers: a review. chestnut (Castanea sative mill.) based on
Aquat Bot 89:138154 RAPD, ISSR and isozyme markers. Theor Appl
13. Wolfe AD, Liston A (1998) Contributions of Genet 102:11901199
PCR-based methods to plant systematics and 22. Arnau G, Lallemand J, Bourgoin M (2002)
evolutionary biology. In: Soltis DE, Soltis PS, Fast and reliable strawberry cultivar identifica-
Oyle JJ (eds) Plant Mol sys II.Kluwer, Boston tion using inter simple sequence repeat (ISSR)
14. Saki S, Bagheri H, Deljou A, Zeinalabedini M amplification. Euphytica 129:6979
(2016) Evaluation of genetic diversity amongst 23. Archak S, Gaikwad AB, Gautam D, Rao EVVB,
Descurainia sophia L. genotypes by inter-simple Swamy KRM, Karihaloo JL (2003) DNA fin-
sequence repeat (ISSR) marker. Physiol Mol gerprinting of Indian cashew (Anacardium
Biol Plants 22(1):97105 occidentale L.) varieties using RAPD and ISSR
15. Liu LW, Zhao LP, Gong YQ, Wang MX, Chen techniques. Euphytica 130:397404
LM, Yang JL, Wang Y, Yu FM, Wang LZ 24. Vijayan K, Chatterjee SN (2003) ISSR profil-
(2008) DNA fingerprinting and genetic diver- ing of Indian cultivars of mulberry (Morus
sity analysis of late-bolting radish cultivars with spp.) and its relevance to breeding programs.
RAPD, ISSR and SRAP markers. Sci Hortic Euphytica 131:5363
116:240247 25. Gardner N, Hokanson SC (2005) Intersimple
16. Wan YT, Xin-Xiang A, Fan CZ, Xu FR, Yu TQ, sequence repeat fingerprinting and genetic
Tang CF, Dai LY (2008) ISSR analysis on variation of clematis cultivars and commercial
genetic diversity of the 34 populations of Oryza germplasm. HortSci 40:19821987
meyeriana distributing in Yunnan province, 26. Sambrook J, Russell DW (2001) Molecular
China. Rice Sci 15(1):1320 cloning: a laboratory manual. CSHL Press,
17. Huang Y, Ji KS, Jiang ZH (2008) Genetic NewYork
structure of Buxus sinica Var. Parvifolia, a rare 27. Ghislain M, Zhang D, Fajardo D, Huaman Z,
and endangered plant. Sci Hortic 116: Hijmans RJ (1999) Marker-assisted sampling
324329 of the cultivated Andean potato Solanum
18. Thangjam R (2014) Inter-simple sequence phureja collection using RAPD markers. Genet
repeat (ISSR) marker analysis in Parkia timo- Resour Crop Evol 46:547555
riana (DC.) Merr. Populations from 28. Tiwari S, Tiwari R, Srivastava R, Kumari P,
Northeast India. Appl Biochem Biotechnol Singh SK (2013) Molecular genetic analysis of
172:17271734 Eucalyptus tereticornis by using RAPD markers.
19. Mishra P, Kumar LD, Kumar A, Gokul S, Eur JExp Biol 3(6):103110
Ravikumar K, Shukla AK, Sundaresan V (2015) 29. Varshney RKG, Sorrells ME (2005) Genomics-
Population dynamics and conservation implica- assisted breeding for crop improvement.
tions of Decalepis arayalpathra (J.Joseph and Trends Plant Sci 10:621630
V.Chandras.) Venter, a steno endemic species 30. Rohlf FJ (1998) NTSYS-PC: Numerical
of Western Ghats, India. Appl Biochem Taxonomy and Multivariate Analysis System,
Biotechnol 176:14131430 Version 2.0. Exeter Software, NewYork, USA.
20. Prevost A, Wilkinson MJ (1999) A new system 31. Sneath PHA, Sokal RR (1973) Numerical tax-
of comparing PCR primers applied to ISSR onomy. Freeman, San Francisco, CA
Chapter 15
Abstract
Inborn errors of metabolism (IEMs) are individually rare but collectively common. As more and more
genes are cloned and specific disease-causing mutations are identified, the diagnosis of IEMs is becoming
increasingly confirmed by mutation analysis. Diagnosis is important not only for treatment and prognosis
but also for genetic counselling and prenatal diagnosis in subsequent pregnancies. A wide range of molecu-
lar methods is available for the identification of mutations and other DNA variants, most of which are
based on the Polymerase Chain Reaction (PCR). In this chapter, we focus on PCR-based methods for the
detection of point mutations or small deletions/insertions as these are the most frequent causes of IEMs.
Key words PCR, IEM, Prenatal molecular diagnosis, Postnatal molecular diagnosis
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_15, Springer Science+Business Media LLC 2017
213
214 LauraVilarinho andCliaNogueira
2 Materials
2.1 DNA Extraction Various commercially available DNA extraction kits and systems
are becoming increasingly popular because of their ease of use,
limited labor, and ability to consistently produce high-quality
DNA.Because of proprietary considerations of the manufacturer,
the composition of some components in these kits is not revealed
to the user. These kits contain a stable proteinase K solution,
unidentified non-phenolchloroform buffers, a silica-gel mem-
brane spin-column or magnetic-particles to isolate and purify high-
quality DNA for PCR.
2.2 PCR Oligonucleotides are widely available and there are many compa-
Requirements nies (such as Thermo scientific, Invitrogen, MWG Biotech, Applied
Biosystems, Sigma Genosys, among others) that offer low-cost
2.2.1 Oligonucleotide
custom synthesis and purification of your primer sequences within
Primers
a few days of ordering. For most PCRs you will need two primers
of different sequence that anneal to complementary strands of the
template DNA.When you know the DNA sequence of your tem-
plate it is quite easy to design appropriate primers to amplify any
segment that you require [8]. There are several computer pro-
grams that can be used to assist primer design.
2.2.2 PCR Premixes Several commercial PCR premixes, such as ImmoMix Red
(Bioline), AmpliTaq Gold (Applied Biosystems), TaKaRa Taq
DNA Polymerase (TaKaRa-Clontech), among others are available.
These premixes contain buffer, dNTPs and Taq DNA polymerase
as a premixed reagent at a concentration that allows addition of
template DNA and primers to produce the final reaction volume.
In some cases the buffers contain no magnesium, allowing optimi-
zation experiments to be undertaken by addition of magnesium
stocks. Clearly, the use of premixes is highly advantageous for
PCR Analysis in Prenatal and Postnatal Diagnosis 215
2.2.3 PCR Cleanup 1. ExoSAP-IT reagent treats PCR products ranging in size from
andSequencing less than 100 bp to over 20 kb with absolutely no sample loss
by removing unused primers and nucleotides. ExoSAP-IT
PCR Product clean up is active in commonly used PCR buf-
fers, so no buffer exchange is required.
2. The BigDye Terminator v1.1 Cycle Sequencing Kit provides
premixed reagents for Sanger sequencing reactions [10]. The
kit includes BigDye Terminator v 1.1, [5] Sequencing
Buffer, which is specifically optimized for use with the BigDye
Ready Reaction mixes.
3. DyeEx Kits provide either spin columns or 96-well plates and
use gel-filtration technology to remove unincorporated dye
terminators from sequencing reactions. Sequencing reactions
are loaded onto the prehydrated gel-filtration material. After a
short centrifugation step, the reactions are ready to be loaded
onto a capillary sequencer. Unincorporated dye terminators
are retained in the gel matrix.
2.3 Agarose Gel 1. Agarose gels are prepared using a w/v percentage solution and
Electrophoresis should be diluted in running buffer. The concentration of aga-
rose in a gel will depend on the sizes of the DNA fragments to
be separated, with most gels ranging between 0.5 and 2%.
2. The most common gel running buffers are [1] TAE (40 mM
Trisacetate, 1 mM EDTA) and [1] TBE (45 mM Tris
borate, 1 mM EDTA).
3. [1] GelRed (Biotium).
3 Methods
3.1 DNA Extraction DNA from almost any source has been successfully used in PCR.
However, for prenatal diagnosis of IEMs we usually isolated
DNA directly from amniotic fluid or chorionic villi, and/or cul-
tured amniocytes or chorionic villi cells. For Postnatal diagnosis
of IEMs DNA is usually extracted from total blood, Guthrie cards,
and/or tissues (fibroblasts, muscle, or liver).
In general, PCR is almost certain to work best with the clean-
est, purest DNA sample you can prepare.
Most DNA preparation protocols outline the steps involved in
four major phases of DNA isolation:
1. The first phase contains preparatory procedures and the solu-
tions used during these steps.
216 LauraVilarinho andCliaNogueira
3.3 Primers Design Primers can be designed using several computer programs, such as:
Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/), in order to flank
the coding sequences and exonintron junctions of the genes, and
FastPCR program (http://www.biocenter.helsinki.fi/bi/
Programs/fastpcr.htm), to predict the formation of dimers and to
evaluate the quality of the designed primers [12].
However, in practice many technicians still design primers by
following some simple rules:
1. A primer should be 1630 nucleotides long, which provides
good specificity for a unique target sequence, even with a start-
ing template as complex as human genomic DNA.
2. Primers should contain approximately equal numbers of each
nucleotide.
3. Primers should not include stretches of polybase sequences
(e.g., poly (dG)) or repeating motifs, as these can hybridize
inappropriately to the template.
4. Primer pairs should have compatible melting temperatures
(within 5 C) and contain approximately 50% GC content.
High GC content results in the formation of stable imperfect
hybrids, while high AT content depresses the melting tempera-
ture of perfectly matched hybrids. If possible, the 3 end of the
primer should be rich in GC bases (GC clamp) to enhance
annealing of the end that will be extended, but should not
exceed 3 Gs or Cs.
5. Primers should not be able to form secondary structures due
to internal complementarity.
6. Primers should not contain sequences at the 3-ends that will
allow base pairing with itself or any other primer that it may be
coupled with in a PCR, otherwise this can lead to the forma-
tion of primer dimers (see Note 1).
7. The first three nucleotides at the 3-end should perfectly match
the template with complementarity extending to about 20 bp
with a few mismatched bases, because this is the end of the
primer that is extended by the DNA polymerase and is there-
fore most important for ensuring the specificity of annealing to
the correct target sequence.
218 LauraVilarinho andCliaNogueira
3.4 PCR Procedure 1. Remove the following reagents from 20 C freezer and keep
on ice throughout this procedure.
2. Mix gently by vortex and briefly centrifuge to collect all com-
ponents to the bottom of the tube.
3. Label microcentrifuge tubes and add components as indicated
as follows:
4. Amplification conditions:
1,200
1,000
900
800
700
600
500/517
400
300
200
100
3.5 Agarose Gel 1. Weigh out the appropriate amount of agarose into an
Electrophoresis Erlenmeyer flask (see Note 3).
2. Add Running buffer.
3. Melt the agarosebuffer mixture in a microwave. At 30-s inter-
vals, remove the flask and swirl the contents to mix well. Repeat
until the agarose is completely dissolved.
4. Add [1] GelRed.
5. Place the gel tray into the casting apparatus and put an appro-
priate comb into the gel mold to create the wells.
6. Allow the agarose to set at room temperature.
7. Remove the comb and place the gel in the gel box.
8. Add loading dye to the DNA samples to be separated, in the
case of uncolored PCR mixes. An appropriate DNA size marker
should always be loaded along with experimental samples.
9. Program the power supply to desired voltage (15 V/cm
between electrodes) and run for 1520min.
10. The PCR amplification product can be analyzed in 2% agarose
in [1] TAE buffer with GelRed and visualized in a Gel Doc
System.
11. Agarose gel analysis enables quick and easy quantification of
DNA, especially for small DNA fragments (such as PCR
products). The amount of sample DNA loaded can be estimated
by comparison of the band intensity with the standards used.
220 LauraVilarinho andCliaNogueira
3.6 PCR Clean Up 1. Remove ExoSAP-IT reagent from 20 C freezer and keep on
ice throughout this procedure (see Note 4).
2. Mix 2 L of a post-PCR reaction product with 1 L of
ExoSAP-IT reagent for a combined 3 L reaction volume (see
Note 5).
3. Incubate at 37 C for 15min in the thermocycler to degrade
remaining primers and nucleotides.
4. Incubate at 80 C for 15min in the thermocycler to inactivate
ExoSAP-IT reagent.
5. The treated PCR product is now ready for use in DNA sequenc-
ing, single nucleotide polymorphism (SNP) analyses, or other
primer-extension applications that require DNA to be free of
excess primers and nucleotides (see Note 3).
6. Treated PCR products may be stored at 20 C until required.
Quantity per
Component reaction (L)
BigDye Terminator 3.1 Ready 0.5
Reaction Mix
M13 forward or M13 reverse primer 0.5
or primer forward or primer reverse
(3.2 M)
[5] sequencing buffer 0.5
Template 3.0
Deionized water (RNase/DNase-free) 5.5
Total volume 10.0
3.8 Sequencing 1. Take the DyeEx 96 plate out of the bag, and remove the tape
Reaction Cleanup sheets first from the bottom and then from the top of the
DyeEx 96 plate. When handling the DyeEx 96 plate, ensure
that it remains horizontal.
2. Place the DyeEx 96 plate on the top of the collection plate
(provided; reusable) and centrifuge for 1min at the calculated
speed. Discard the flow-through. Always use the waste collec-
tion plates provided with the DyeEx 96 Kit.
3. Place the DyeEx 96 plate on top of the collection plate, add
300 L deionized water to each well, and centrifuge for 3min
at the calculated speed (see Note 6).
4. Carefully place the DyeEx 96 plate on an appropriate elution
plate with a suitable adapter.
5. Slowly apply the 10 L of sequencing samples to the gel bed of
each well (see Notes 7 and 8).
6. Centrifuge for 3min at the calculated speed. The eluate con-
tains the purified sequencing reaction (see Note 9).
3.9 Automated DNA 1. The sequencing runs were performed in Genetic Analyzers,
Sequencing which use capillary electrophoresis.
2. The products of the cycle sequencing reaction are injected
electrokinetically into capillaries filled with polymer.
3. High voltage is applied so that the negatively charged DNA
fragments move through the polymer in the capillaries toward
the positive electrode.
4. Capillary electrophoresis can resolve DNA molecules that dif-
fer in molecular weight by only one nucleotide.
5. Shortly before reaching the positive electrode, the fluores-
cently labeled DNA fragments, separated by size, move
through the path of a laser beam.
6. An optical detection device on genetic analyzers detects the
fluorescence signal.
7. The data is then displayed as an electropherogram (Fig.2).
222 LauraVilarinho andCliaNogueira
4 Notes
References
1. Mak CM, Lee HC, Chan AY etal (2013) amplification. Springer Science, Berlin/
Inborn errors of metabolism and expanded Heidelberg, Germany
newborn screening: review and update. Crit 9. McPherson MJ, Moller SG (eds) (2007) PCR
Rev Clin Lab Sci 50:142162 second edition. The BASICS.Garland Science,
2. Ezgu F (2016) Inborn errors of metabolism. NewYork
Adv Clin Chem 73:195250 10. Hernandez-Rodriguez P, Gomez A (2012)
3. Vernon HJ (2015) Inborn errors of metabo- Polymerase chain reaction: types, utilities and
lism: advances in diagnosis and therapy. JAMA limitations. In: Hernandez-Rodriguez P (ed)
Pediatr 169:778782 Polymerase chain reaction. InTech
4. Rinaldo P, Hahn S, Matern D (2004) Clinical 11. Desjardins PR, Conklin DS (2011)
biochemical genetics in the twenty-first cen- Microvolume quantitation of nucleic acids.
tury. Acta Paediatr Suppl 93:2226 Curr Protoc Mol Biol 3:3J
5. Kamboj M (2008) Clinical approach to the 12. Kalendar R, Lee D, Schulman AH (2014)
diagnoses of inborn errors of metabolism. FastPCR software for PCR, in silico PCR, and
Pediatr Clin N Am 55:11131127 oligonucleotide assembly and analysis. Methods
6. Sharma S, Kumar P, Agarwal R etal (2008) Mol Biol 1116:271302
Approach to inborn errors of metabolism pre- 13. Munshi A (ed) (2012) DNA sequencing
senting in the neonate. Indian JPediatr methods and applications. InTech, Rijeka
75:271276 14. Thompson JD, Higgins DG, Gibson TJ (1994)
7. Mahdieh N, Rabbani B (2013) An overview of CLUSTAL W: improving the sensitivity of pro-
mutation detection methods in genetic disor- gressive multiple sequence alignment through
ders. Iran JPediatr 23:375388 sequence weighting, position-specific gap pen-
8. Van Pelt-Verkuil E, van Belkum A, Hays J(eds) alties and weight matrix choice. Nucleic Acids
(2008) Principles and technical aspects of PCR Res 22:46734680
Chapter 16
Abstract
Polymerase chain reaction (PCR) is central to methods in molecular ecology. Here, we describe PCR-
dependent approaches useful for investigating microbial diversity and its function in various natural,
human-associated, and built environment ecosystems. Protocols routinely used for DNA extraction, puri-
fication, cloning, and sequencing are included along with various resources for the statistical analysis fol-
lowing gel electrophoresis-based methods (DGGE) and sequencing. We also provide insights into
eukaryotic microbiome analysis, sample preservation techniques, PCR troubleshooting, DNA quantifica-
tion methods, and commonly used ordination techniques.
Key words Polymerase chain reaction (PCR), Microbiome, Canonical correspondence analysis
(CCA), Restriction fragment length polymorphism (T-RFLP), Denaturing gradient gel electrophore-
sis (DGGE), Next generation sequencing (NGS)
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_16, Springer Science+Business Media LLC 2017
225
226 Sujal Phadke et al.
Microbial samples
Polymerase Chain
from different DNA Isolation
origins
Reaction (PCR)
DGGE (Denaturing
Gradient Gel Cloning & Sequencing
Electrophoresis)
2 Materials
3. Magnetic stirrer.
4. Peristaltic pump.
5. Glass plates: one large and one smaller.
6. Spacers (two).
7. Clamps (two).
8. Power supply.
9. Gelbond.
10. 96% ethanol.
11. 70% ethanol.
12. Plastic card (with the size of the gel).
13. Combs.
14. TEMED (Tetramethylethylenediamine).
15. 10% ammonium persulfate solution in water.
16. 80% denaturant solution, 8% polyacrylamide: 200 mL 40%
acryl/bisacrylamide 37.5:1, 320 mL formamide, 10 mL 50
TAE buffer, 20 mL glycerol (only when silver staining is per-
formed), 337.3 g urea. Carefully heat hand-warm, add stirrer
and dissolve. Adjust to final volume of 1L with dH2O.Store
in the dark and at room temperature.
17. 0% denaturant solution, 8% polyacrylamide: 200 mL 40%
acryl/bisacrylamide 37.5:1, 10 mL 50 TAE buffer, 20 mL
glycerol (only when silver staining is performed). Adjust to the
final volume of 1L with dH2O.Store in the dark at room
temperature.
18. Steel boxes (two).
19. 1 Cairns fixation solution. Prepare 8 fixation solution by
adding 200 mL 96% ethanol, 10 mL acetic acid, and 40 mL
dH2O.To prepare 1 Cairns fixation solution add 50 mL of
8 solution and 350 mL dH2O.
20. Silver staining solution. Add 0.4 g AgNO3 to 200 mL of 1
Cairns fixing solution.
21. Developer solution: a spatula tip of NaBH4 (approx. 10 mg),
250 mL 1.5% NaOH solution, and 750 L formaldehyde.
22. Cairns preservation solution: 250 mL 96% ethanol, 100 mL
glycerol, and 650 mL dH2O.
23. Cellophane sheets.
24. Oven (60 C).
5. 10 M reverse primer.
6. Ultrapure water.
7. 10 U/L Taq DNA polymerase.
8. Thermocycler.
9. Commercial kit for PCR products purification (e.g., Nucleo
Spin Extract II, Macherey-Nagel; QIAquick PCR Purification
Kit, QIAGEN Inc., Valencia, CA, or Exo-SAP protocol).
10. Restriction enzymes (Alu I, BstUI, DdeI, Sau96I, MspI, and
HhaI).
11. 10 Restriction buffer.
12. Thermoblock.
13. Loading buffer.
14. Dye-labeled size standard.
21. Incubator.
22. TE buffer: 1 mL of 1M TrisHCl, 200 L of 0.5M EDTA
(pH 8.0) in 100 mL of ultrapure water and sterilize by
autoclaving.
23. Glycerol.
24. Freezer at 80 C.
3 Methods
3.1 DNA Extraction The choice of the DNA extraction method is highly dependent on
Methods the type of biological sample such as soil, biofilms, plants, and
blood for which there are specific commercial kits available (e.g.,
MO BIO Laboratories, MP Biomedicals, Qiagen, among others).
DNA extraction, isolation, and purification is a critical step and the
same methodology should be maintained for meaningful compari-
sons between samples within a study because different extraction
methods yield differences in DNA quality, influencing downstream
processing including PCR (e.g., cells in the biofilm and filamen-
tous microbes are harder to lyse prior to DNA extraction, whereas
a significant amount of water must be filtered to obtain sufficient
cellular mass for an adequate DNA yield). Also, the samples, as well
as the extracted DNA, should be preserved using appropriate tech-
niques, as the preservation temperature, reagents and time can
influence the microbial community composition (seeNote 2). The
first step in DNA extraction methods is the cell disruption. Cell
lysis can be achieved mechanically (bead beating or equivalent),
chemically (using detergents), by freeze and thaw, among others,
as well as by combining two or more methods. After cell lysis, cell
debris need to be separated from nucleic acids, usually by
centrifugation. Together with nucleic acids, proteins will also
remain in the supernatant and subsequent steps aim to isolate the
nucleic acids. The classical method for nucleic acids isolation is
extraction with phenolchloroformisoamyl alcohol. Most of the
commercial kits do not use this method but it is still utilized in
several laboratories. The principal steps of the phenolchloroform
isoamyl alcohol method are the following:
1. To 500 L of lysate/supernatant, add 500 L of phenolchlo-
roformisoamyl alcohol (25:24:1) and mix well.
2. Centrifuge at maximum speed for 5min.
3. Carefully pipet the aqueous phase to a new tube, avoiding the
interphase and the organic phase (phenol phase), if the phases
are mixed, repeat the centrifugation step.
4. Add 500 L of chloroformisoamyl alcohol (24:1).
5. Vortex to homogenize.
234 Sujal Phadke et al.
Table 1
Reagents and respective volumes used in one polymerase chain reaction
3.3 DGGE PCR amplified fragments that have the same nucleotide length can
be separated in a denaturing gradient gel based on their nucleotide
sequences. One of the primers used for amplifying the gene of
interest should have a GC clamp attached in the 5 end (a scheme
of the DGGE technique is represented in Fig.2).
3.3.1 DGGE Procedure The procedure herein described is for 8% (v/v) polyacrylamide gel
running in a Dcode Universal Mutation Detection System.
236 Sujal Phadke et al.
PCR products
Assembling theDGGE 1. Clean one large and a smaller glass plate with soap, dry with
Plate Cassette paper and clean with 96% ethanol.
2. Cut the gelbond to the size of the largest glass plate.
3. Add some drops of water to the surface of the large glass plate.
4. Place the gelbond hydrophobic side down on this glass plate.
5. Fix the gelbond, without removing the paper sheet, using a
roller, then remove the paper sheet.
6. Dry the gelbond carefully using clean paper.
7. Clean a set of spacers with 96% ethanol, and place them over
the gelbond.
8. Place the smaller glass plate on top after ensuring that it is
cleaned (this arrangement is called a sandwich).
9. Add the clamps to the sides of the sandwich, and place in the
sandwich-holder. Verify the distance between the spacers by
putting the plastic card (with the size of the gel) between the
glass plates and the spacers.
10. Press the spacers down and fasten the screws on the clamps.
11. Place the sandwich on top of the rubber gasket and press down
the handles.
PCR-Based Methods for Microbiome Analysis 237
Table 2
Denaturing gradient gel electrophoresis mixing table
Casting theDenaturing 1. Prepare four gel solutions (HIGH, LOW, plug, and stacking
Gradient Gels gel) in 50 mL tubes, on ice, according to Table2 (the APS
solution is added just before pouring the gel). For bacteria and
archaeal amplicons analysis, usually a 3060% gradient and a
3050% gradient are used, respectively. However, according
to the result obtained gradients can be altered in order to get
the best separation of the amplicons. Plug and stacking gels are
prepared with 0% solution.
2. Prepare 1 mL of plug gel solution (1.5 mL 0% solution +4.5
L TEMED +15 L 10% APS) and pour it at the bottom of
the DGGE plate cassette (between glass plates) prior to m
aking
the main resolving gradient gels. It will prevent leakage from
the bottom of the plates.
3. For casting gradient gels, a gradient former, a magnetic stirrer
and a peristaltic pump is used.
4. Rinse the gradient maker and tubes with demi-water, switch
on the pump at running speed (20 mL/min) and drain the
system well.
5. Close the screw between the compartments of the gradient
maker.
6. Dry the compartments with a tissue.
7. Add 10% APS to the HIGH and LOW solutions and pour in
the right and left compartment, respectively.
8. Start the stirrer and open the screw and immediately start the
pump at 4 mL/min flow rate.
9. Place the needle between the glass plates and secure the tube.
10. Remove the needle when the gel is poured and switch off the
pump.
238 Sujal Phadke et al.
Running theGel 1. Add 50 TAE buffer to the buffer tank and fill up until reach-
ing the fill position.
2. Switch on the Dcode at least 90min before electrophoresis
starts, so that the buffer can heat up to 60 C.
3. Remove the comb from the gel carefully.
4. Remove nonpolymerized gel fragments by rinsing the slots
with demi-water and put the sandwich in the sandwich-holder
(there should always be a sandwich at the other side to get a
closed upper buffer compartment).
5. Switch off the Dcode, and take off the lid. Put the two sand-
wiches connected to sandwich holder inside the buffer tank.
6. Switch on the Dcode until the upper buffer compartment is
filled with buffer.
7. Switch off the Dcode and take off the lid. Load your samples.
About 1 L of loading dye should be mixed with about 5 L
PCR product before loading the samples.
8. Put the lid and switch on the Dcode.
9. Switch on the power supply for 10min at 200 V to guarantee
that the samples enter into the gel. Then, reduce the voltage to
85 V and run for 16 h at 60 C.
Staining theGel DGGE gels can be stained with SYBRSafe or with silver (accord-
ing to Sanguinetty etal. [13]), as following:
1. Place the gel in a stainless steel box.
2. Add 200 mL 1 Cairns fixation solution and rock the box for
3 min, remove the solution and store for later application.
3. Add 200 mL silver staining solution to the box and rock for
10min (use gloves).
4. Discard the solution (chemical waste).
PCR-Based Methods for Microbiome Analysis 239
3.3.2 Comparative Most common methods for the comparative analysis of DGGE
Analysis ofDGGE Profiles profiles include hierarchical cluster analysis, principal component
analysis (PCA), multidimensional scaling (MDS) and canonical
correspondence analysis (CCA). Gel Compar and Bionumerics
(Applied Maths, St. Martens-Latem, Belgium) are examples of
software available to perform the comparative analysis.
3.3.3 Interpretation Ordination techniques including MDS, CCA, PCA and clustering
ofOrdination Analyses algorithms aim at reducing the dimensionality of ecological data,
UsingCCA which typically contain multiple environmental variables that may
together determine microbial diversity. PCA is typically a biplot in
which the two axes represent variance in species abundance,
whereas CCA incorporates information from multiple regression
analysis and is typically shown as a triplot in which the three axes
represent variance in dispersion (or inertia). CCA) is the most
commonly used technique that can provide information about
how various environmental variables correlate with the species
presence. Species and samples are shown as points and the most
abundant species occupy the diagonal because of their largest con-
tribution to inertia. Arrows from the origin indicate various pre-
dictors (environmental variables) of the distribution. The arrows
at the right angle indicate independent effects; those at small angle
240 Sujal Phadke et al.
3rd stage:
Electrophoresis a
f
Separation and c
d
detection of the e
digested products via b
electrophoresis
3.4.1 T-RFLP Procedure 1. The choice of which gene to amplify is dependent on the
objective of the experiment.is Typical diversity analysis experi-
PCR Amplification
ments rely on 16S rRNA gene amplification. Table3 lists some
of the commonly used primers for DNA amplification prior to
T-RFLP analysis. Primers can be labeled at the 5 end with
fluorescent dyes such as FAM (blue) or PET (red), among
others.
PCR-Based Methods for Microbiome Analysis 241
Table 3
List of primers used for the analysis of microbial communities using T-RFLP
Table 4
Master mix composition for PCR amplification
3.4.2 PCR Product PCR products can be purified using commercially available kits
Purification following the manufacturers instructions.
3.4.3 Restriction Enzyme Most common restriction enzymes used to study microbial com-
Digestion munities are AluI, BstUI, DdeI, Sau96I, MspI, and HhaI.Digestion
can be checked in silico using the tools available at http://mica.
ibest.uidaho.edu/ or http://nc2.neb.com/NEBcutter2/
(seeNote 5).
1. Mix the following components in a microtube.
200400ng Purified PCR product
1,5L 10 restriction buffer
10U Restriction enzyme
15L Total volume (with H2O)
3.4.5 Data Analysis When forward and reverse primers are fluorescently labeled, two
profiles per sample will be generated and if two restriction enzymes
are used, each sample will have a total of four profiles. There is
software available to analyze the peak patterns generated in T-RFLP
assays (e.g., GeneMapper, Applied Biosystems). Additional data
analysis such as cluster analysis, PCA, MDS, CCA, or redundancy
analysis (RDA) can be performed to understand similarities
between samples and the correlations with environmental factors.
3.4.6 Microbial T-RFLP results can be combined with cloning and sequencing in
Community Identification order to identify the predominant microorganisms. Taxonomic
identity of microorganisms can also be retrieved from T-RFLP data
using informatics tools such as TAP-TRFLP, MiCA, T-RFLP
Phylogenetic Assignment Tool (PAT), TReFID, TRAMPR, ARB-
software integrated tool (TRF-CUT), TRiFLe, T-RFPred.
PCR Clean Up
E. coli
7th stage: Electrophoresis 6th stage: RFLP 5th stage: Lysis and PCR
Separate restriction Cut amplified inserts Lyse the cells and amplif y inserts
fragments by of each clone with from positive clones with primers
electrophoresis restriction enzymes flanking the inserts
3.5.1 PCR Amplification 1. 16S rRNA genes are amplified with specific primers (e.g., U27f
andCloning and U1492r) using the following PCR program: initial denatur-
ation at 95 C for 2 min; 30 cycles of amplification (95 C, 30
s; 52 C, 40 s; 72 C, 1.5 min), and a final extension at 72 C,
5 min, followed by a hold at 4 C until PCR products can be
visualized in a 1% agarose gel by mixing 5 L of PCR product
with 1 L of loading dye.
2. PCR products are purified prior to inserting in the cloning vec-
tor, using commercially available kits or alternatively, by fol-
lowing the traditional ethanol precipitation protocol.
3. Purified PCR products are cloned into the pGEM-T easy vec-
tor kit according to the manufacturers instructions.
3.6 Next Generation Metagenomic studies are commonly performed by analyzing the
Sequencing prokaryotic 16S ribosomal RNA gene (16S rRNA), which is
approximately 1500 bp long and contains nine variable regions
interspersed between conserved regions. Variable regions of 16S
rRNA are frequently used in phylogenetic classifications such as
genus or species in diverse microbial populations. Which 16S
rRNA region to sequence is an area of debate, and your region of
interest might vary depending on things such as experimental
objectives, design, and sample type. A protocol describing a
method for preparing samples for sequencing the variable V3 and
V4 regions of the 16S rRNA gene using the Illumina technology
can be obtained in the Illumina website [14]. The protocol can
also be applied to sequence alternative regions of the 16S rRNA
gene and for other targeted amplicon sequences of interest.
A detailed overview of amplicon sequencing using PacBio
technology is available at the PacBio website [15, 16].
4 Notes
References
1. VerBerkmoes NC, Denef VJ, Hettich RL, PCR to measure the distributions of planktonic
Banfield JF (2009) Systems biology: functional ciliates in coastal waters. Limnol Oceanogr
analysis of natural microbial consortia using Methods 5(6):163173
community proteomics. Nat Rev Microbiol 5. Martin KJ, Rygiewicz PT (2005) Fungal-
7(3):196205 specific PCR primers developed for analysis of
2. Hugerth LW, Muller EE, Hu YO, Lebrun LA, the ITS region of environmental DNA extracts.
Roume H, Lundin D, Wilmes P, Andersson AF BMC Microbiol 5:28
(2014) Systematic design of 18S rRNA gene 6. Borneman J, Hartin RJ (2000) PCR primers
primers for determining eukaryotic diversity in that amplify fungal rRNA genes from environ-
microbial consortia. PLoS One 9(4):e95567 mental samples. Appl Environ Microbiol
3. Stock M, Lampert KP, Moller D, Schlupp I, 66(10):43564360
Schartl M (2010) Monophyletic origin of mul- 7. Massana R, del Campo J, Sieracki ME, Audic S,
tiple clonal lineages in an asexual fish (Poecilia Logares R (2014) Exploring the uncultured
formosa). Mol Ecol 19(23):52045215 microeukaryote majority in the oceans: reeval-
4. Costas BA, McManus G, Doherty M, Katz LA uation of ribogroups within stramenopiles.
(2007) Use of species-specific primers and ISME J8(4):854866
248 Sujal Phadke et al.
8. Buermans HP, den Dunnen JT (2014) Next 15. Pacific Biosciences (2016) PacBio Procedure
generation sequencing technology: advances & Checklist- Amplicon Template Preparation
and applications. Biochim Biophys Acta and Sequencing. http://www.pacb.com/wp-
1842(10):19321941 content/uploads/Procedure-Checklist-
9. Quail MA, Smith M, Coupland P, Otto TD, A m p l i c o n - Te m p l a t e - P r e p a r a t i o n - a n d -
Harris SR, Connor TR, Bertoni A, Swerdlow Sequencing.pdf. Accessed 30 Jul 2016
HP, Gu Y (2012) A tale of three next genera- 16. Pacific Biosciences (2016) PacBio Procedure
tion sequencing platforms: comparison of Ion & Checklist- Target Sequence Capture Using
Torrent, Pacific Biosciences and Illumina SeqCap EZ Libraries with PacBio Barcoded
MiSeq sequencers. BMC Genomics 13:341 Adapters. http://www.pacb.com/wp-content/
10. Kozich JJ, Westcott SL, Baxter NT, Highlander u p l o a d s / P r o c e d u r e - C h e c k l i s t -Ta r g e t -
SK, Schloss PD (2013) Development of a dual- S e q u e n c e - C a p t u r e - R o c h e - N i m b l e G e n -
index sequencing strategy and curation pipe- SeqCapEZ-Library-PacBioBarcodedAdapters.
line for analyzing amplicon sequence data on pdf. Accessed 30 Jul 2016
the MiSeq Illumina sequencing platform. Appl 17. Lauber CL, Zhou N, Gordon JI, Knight R,
Environ Microbiol 79(17):51125120 Fierer N (2010) Effect of storage conditions
11. Nbel U, Engelen B, Felske A, Snaidr J, on the assessment of bacterial community
Wieshuber A, Amann RI, Ludwig W, Backhaus structure in soil and human-associated samples.
H (1996) Sequence heterogeneities of genes FEMS Microbiol Lett 307(1):8086
encoding 16S rRNAs in Paenibacillus polymyxa 18. Kerckhof FM, Courtens EN, Geirnaert A,
detected by temperature gradient gel electro- Hoefman S, Ho A, Vilchez-Vargas R, Pieper
phoresis. JBacteriol 178(19):56365643 DH, Jauregui R, Vlaeminck SE, Van de
12. Muyzer G, de Waal EC, Uitterlinden AG Wiele T, Vandamme P, Heylen K, Boon N
(1993) Profiling of complex microbial popula- (2014) Optimized cryopreservation of
tions by denaturing gradient gel electrophoresis mixed microbial communities for conserved
analysis of polymerase chain reaction-amplified functionality and diversity. PLoS One
genes coding for 16S rRNA.Appl Environ 9(6):e99517
Microbiol 59(3):695700 19. Saito MA, Bulygin VV, Moran DM, Taylor C,
13. Sanguinetti CJ, Dias Neto E, Simpson AJ Scholin C (2011) Examination of microbial
(1994) Rapid silver staining and recovery of proteome preservation techniques applicable
PCR products separated on polyacrylamide to autonomous environmental sample collec-
gels. Biotechniques 17(5):914921 tion. Front Microbiol 2:215
14. Illumina (2016) 16S metagenomic sequencing 20. Agilent Technologies (2005) Agilent 2100
library preparation. http://support.illumina. bioanalyzer 2100 expert users guide. https://
com/downloads/16s_metagenomic_sequenc- www.agilent.com/cs/library/usermanuals/
ing_library_preparation.html. Accessed 30 Jul Public/G2946-90004_Vespucci_UG_eBook_
2016 (NoSecPack).pdf. Accessed 30 Jul 2016
Chapter 17
PCR inMetagenomics
TinaKollannoorJohny andSaritaGanapathyBhat
Abstract
Metagenomics approach involves direct genetic analysis of environmental samples, evading the tedious
culturing process. Polymerase chain reaction is one invaluable tool used for such analyses. Here, we
describe one protocol for metagenomic DNA isolation that gives inhibitor-free DNA suitable for PCR and
other genetic manipulations. Subsequently, the chapter describes the use of PCR as an indicator of quality
of DNA and to amplify a marker of phylogeny. Further, the application of PCR for detection of specific
genes and screening of metagenomic libraries is outlined.
Key words Metagenomics, 16S rDNA, Phylogeny, ARDRA profiling, Metagenomic library,
ColonyPCR
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_17, Springer Science+Business Media LLC 2017
249
250 Tina Kollannoor Johny and Sarita Ganapathy Bhat
2 Materials
2.1 Isolation 1. Environmental sample: fish gut (in this case) or soil or any
ofMetagenomicDNA other biological material, collected and stored under sterile
conditions.
2. Extraction buffer: 100 mM TrisHCl (pH 8.2), 100 mM
EDTA (pH 8), 1.5M NaCl. Prepare 50 mL buffer and steril-
ize by autoclaving.
3. Cheese cloth.
4. Whatman filter paper (Grade 1 and 5). Diameter of the filter
circles must be based on the size of the filtration apparatus. We
use 47mm filters.
5. 1 TE buffer (pH 8): 10 mM TrisHCl, 1 mM EDTA.Na2.
Sterilize by autoclaving or filtration.
6. Cooling centrifuge: all centrifugations are to be carried out
at 4 C.
7. 50 mg/mL lysozyme solution.
8. 10 mg/mL RNase solution.
9. 10% w/v SDS solution.
10. 10 mg/mL proteinase K.
PCR inMetagenomics 251
2.3 16S rDNA PCR 1. Metagenomic DNA of good purity, obtained using the metage-
nomic DNA isolation protocol given below or commercial kits.
2.
Universal primers for 16S rDNA: 5AGAGTTTGAT
CCTGGCTCAG 3 and 5 ACGGCTACCTTGTTACGACTT
3 [10].
3. Sterile nuclease-free water.
4. 10 PCR buffer (Sigma-Aldrich).
5. 25 mM magnesium chloride solution.
6. dNTP mix (10 mM each).
7. Taq DNA polymerase (5 U/L).
2.4 ARDRA Profiling 1. pGEM-T Vector system (Promega). Other TA cloning systems
andDetermination may also be used.
ofthe16S rDNA 2. E coli JM109 cells.
Clones Identity
3. Transform Aid Bacterial Transformation Kit (Thermo Fisher
Scientific).
252 Tina Kollannoor Johny and Sarita Ganapathy Bhat
3 Methods
3.2 Agarose Gel 1. Prepare a mini gel of 0.8% agarose in 1 TAE buffer. Heat to
Electrophoresis dissolve the contents and allow it to cool for some time. Pour
the mixture into the casting tray with the comb kept in posi-
tion. Once solidified, transfer the gel to the gel tank containing
1 TAE buffer, sufficient to submerge the gel by a few
millimeters.
2. Aliquot 5 L of the DNA, mix with 1 L of 6 gel loading dye,
and load the mixture into the wells.
3. Run the gel at a constant voltage of 60 V for 1 h.
4. Stain the gel in ethidium bromide or SYBR safe.
5. Photograph the gel using any gel documentation system
(Fig.1).
3.3 16S rDNA PCR 1. Prepare a master mix consisting of 2 L of 10 PCR buffer, 2
L of 10 mMdNTP mix (200 M), 1 L of forward and reverse
primers (0.02 mM each), 0.4 L of 25 mMMgCl2 (2 mM),
and 0.2 L of 5 U/L Taq polymerase. Make up the volume
to 19 L using sterile nuclease-free water (see Notes 8 and 9).
Fig. 1 Agarose gel electrophoresis of metagenomic DNA isolated from fish gut.
Lane 1: Lambda DNA/EcoRI plus HindIII Marker, Lane 2: Metagenomic DNA
PCR inMetagenomics 255
3.4 ARDRA Profiling 1. Ligate the PCR products into the pGEM-T Vector (Fig.3).
andDetermination Set up the following ligation mix:
ofthe16S rDNA
Clones Identity 2 Rapid Ligation buffer 5 L
pGEM-T Vector (50 ng) 1 L
PCR product (75 ng/L) 1 L
T4 DNA Ligase (3 Weiss Units/L) 1 L
Nuclease-free water 2 L
8. Re-amplify the 16S rDNA from the plasmids by using the same
16S PCR (see Subheading 3.3.). However, use 1 L of plasmid
DNA (50 ng) as the template. Analyze the amplicons on 1%
agarose gel as described above.
9. Digest the amplicons, individually with 5 U of restriction
endonuclease HpaII.Set up the following reaction:
Fig. 4 Agarose gel electrophoresis of 16S rDNA plasmid library restriction with HpaII. Lane 1: GeneRuler 1-kb
DNA Ladder, Other lanes identified with clone numbers
258 Tina Kollannoor Johny and Sarita Ganapathy Bhat
50 55 60 65 70 75 80 85 90 95 100
T135
T106
T143
T112
T177
T5
T21
T118
T13
T119
T4
T6
T100
T1
T11
T154
T68
14. Compile and align the sequences using the Clustal W program
of the MEGA software. Construct a phylogenetic tree using
the Neighbor Joining method of the MEGA software (Fig.5).
15. Assign taxonomic hierarchy to the sequence using the RDP
Nave Bayesian rRNA classifier. The software groups sequences
into different phyla and thus helps to establish the phyloge-
netic diversity of the metagenome sample (see Note 9).
3.6 Vector- 1. Set up the master mix as described in Subheading 3.3. Use
SpecificPCR vector-specific primers such as M13 forward and reverse prim-
ers, or SP6 and T7 primers, as detailed in the Subheading 2.
2. Add 1 L of plasmid DNA (50 ng) as the template.
3. Place the tubes in a thermal cycler and set up the following
cycling program:
94 C, 3min (Initial denaturation),
Followed by 34 cycles of
94 C, 0.5min.
260 Tina Kollannoor Johny and Sarita Ganapathy Bhat
50 C, 0.5min.
72 C, 3min.
72 C, 10min (Final extension)
4. Analyze the PCR products on 1.2% agarose gel as described in
Subheading 3.2.
5. Sequence the amplicons by using Sangers dideoxy method.
6. Determine the identity of the sequences using nucleotide
BLAST of the NCBI database.
4 Notes
Tm ( C ) = 4 (NG + NC ) + 2 (NA + NT )
here NG, NC, NA, and NT are the numbers of guanine,
w
cytosine, adenine, and thymine bases in the primer.
Though the formula predicts the annealing temperature, it
is always advisable to keep a gradient PCR as the sequence of
the genes in the sample is unknown. Annealing temperatures
must be predicted Ta 5 C.
23. Some PCR master mixes such as the EmeraldAmp GT PCR
Master Mix contain the loading dye and hence need not be
mixed with loading dye prior to loading onto agarose gel.
24. Several gel extraction kits are available such as the Silica bead
DNA gel extraction kit (Thermoscientific), QIAquik gel
extraction kit (Qiagen), GenElute Gel Extraction Kit (Sigma-
Aldrich). If the gene specific PCR reaction gives a single band
on the gel electrophoresis, it needs not to be gel purified. It
can be applied to purification directly, using the silica bead
purification kit, following the protocol for DNA purification
from reaction mixture or as the kit used specifies.
25. The amount of colony picked for PCR is very crucial, as it may
give false positives as well as false negatives. When more num-
ber of cells are picked, they tend to inhibit the PCR reaction.
Barely touching the bacterial clone will suffice. So, to improve
the accuracy of the process, the bacterial colonies picked may
be first pipetted into a fresh PCR tube with sterile water and
boiled at 95 C for 15min for cell lysis. 1 L of this may be
used as a template.
PCR inMetagenomics 265
References
1. Handelsman J(2004) Metagenomics: appli- tools, techniques, and challenges. Genome Res
cation of genomics to uncultured microor- 19:11411152
ganisms. Microbiol Mol Biol Rev 8. Kotik M (2009) Novel genes retrieved from
68:669685 environmental DNA by polymerase chain reac-
2. Miller DN (2001) Evaluation of gel filtration tion: current genome-walking techniques for
resins for the removal of PCR-inhibitory sub- future metagenome applications. JBiotechnol
stances from soil and sediments. JMicrobiol 144:7582
Methods 44:4958 9. Itoh N, Isotani K, Makino Y, Kato M, Kitayama
3. Tina KJ, Bindiya ES, Raghul Subin S, Bhat SG K, Ishimota T (2014) PCR-based amplification
(2014) Appraisal of extraction protocols for and heterologous expression of pseudomonas
metagenomic DNA from fish gut microbiota. alcohol dehydrogenase genes from the soil
IJAIR 3:713 metagenome for biocatalysis. Enzyme
4. Devi SG, Fathima AA, Radha S, Arunraj R, MicrobTechnol 55:140150
Curtis WR, Ramya M (2015) A rapid and eco- 10. Shivaji S, Bhanu NV, Aggarwal RK (2000)
nomical method for efficient DNA extraction Identification of Yersinia pestis as the causative
from diverse soils suitable for metagenomic organism of plague in India as determined by
applications. PLoS One 10:e0132441 16S rDNA sequencing and RAPD-based
5. Gutirrez-Lucas LR, Montor-Antonio JJ, genomic fingerprinting. FEMS Microbiol Lett
Corts-Lpez NG, del Moral S (2014) 189:247252
Strategiesfor the extraction, purification and 11. Yaacob MA, Hasan WA, Ali MS, Rahman RN,
amplification of metagenomic DNA from soil Salleh AB, Basri M, Leow TC (2014)
growing sugarcane. Adv Biol Chem Characterisation and molecular dynamic simu-
4:281289 lations of J15 asparaginase from Photobacterium
6. Woese CR (1987) Bacterial evolution. sp. strain J15. Acta Biochim Pol 61:745752
Microbiol Rev 51:221271 12. Sambrook J, Russell DW (2001) Molecular
7. Hamady M, Knight R (2009) Microbial com- cloning: a laboratory manual. Cold Spring
munity profiling for human microbiome projects: Harbor Laboratory Press, Cold Spring Harbor
Chapter 18
Abstract
A method is described that uses arbitrarily primed PCR followed by many cycles of amplification under
stringent conditions and selection by computational means to obtain a set of sequence tags that can be
used for the comparison of metagenomes. Relative to unselective shot-gun sequencing, the results are
small data sets that can be csompared electronically or plotted as scattergrams that are simple to interpret.
The method can be used to compare groups of samples of any size to build in-house databases from which,
for example, the provenance of trace soil samples may be inferred. The method also allows for selection of
primers with locus-specificity and an example is given in which a South Australian sequence-related to a
Portuguese thermophile (Rubrobacter radiotolerans) is extracted and tested on a set of soils.
Key words Metagenome analysis, Soils, Forensic, PCR, 50mers, Sequence tags, Primer design
1 Introduction
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5_18, Springer Science+Business Media LLC 2017
267
268 Leigh Burgoyne et al.
found insome taxons. The process of mining the sequence data for
discriminating 50mers uses a set of rules (see Subheading 3) that
only accepts 50mers which have characteristics of genes or pseudo-
genes or similar, where the sequence approximates to a random
sequence. The selection algorithm uses the sum of square devia-
tion of dinucleotide frequency from that of a truly random DNA
sequence having equal numbers of each of the four bases. The
selection process also limits the number of 50mers that are allowed
from any amplimer to avoid giving preference to long amplimers.
Sequences that pass these filters are binned and the collection of
bins and their contents comprises a signature of the genome or
metagenome from which they were derived, as detailed in
Subheading 3.
For each of the separate metagenomes, the list of the discrimi-
nating 50mers present and the number of times each was observed
is taken as the identifier for that metagenome. Those data can be
compared in silico, and pairwise comparisons can usefully be visu-
alized by two dimensional scatter-plots in which the number of
occurrences of each of the discriminating sequences in the metage-
nomes being compared gives the coordinates of a data point in the
plot. Where there are no shared 50mers, all data points are on one
or other axis, as in Fig.1, but if there are shared 50mers those data
140
120
100
80
Soil GLG, 50mer
observances per
megabase of reads
60
40
20
0
0 20 40 60 80 100 120 140 160 180 200
Soil SDN. 50mer observations per megabase of reads
Fig. 1 Comparison of two soil metagenomes that show no relationship. Suburban nature-strip soils 6.8km
apart, GLG at S34.97441 E138.51410 and SDN at S35.032489 E138.539134 are compared in a scattergram.
Each data point on the scattergram represents the frequency of occurrence of a specific 50mer in the two
metagenomes. All the data points are onan axis; the two soils do not share any 50mers
270 Leigh Burgoyne et al.
200
180
160
140
120
80
60
40
20
0
0 20 40 60 80 100 120 140 160 180 200
Soil RB1. 50mer observances per megabase of reads
Fig. 2 Comparison of the metagenomes of two related soils. Samples RB1 and RB2 were taken 6m apart
along a vineyard-row at S34.59558 E138.882081 that had recently been ploughed. The occurrence of many
50mers shared by the two samples, those data points that are off axis, shows that the two soils are related.
The nonrandom distribution of the shared data-points close to the origin is an artefact arising from the digitiz-
ing effect of small numbers. However, clusters of data points around sloping lines in the body of the scatter-
gram reflect 50mers that are in definite ratios to each other in the two metagenomes. This effect arises from
at least three sources. First, long reads donating more than one 50mer to the array, second, 50mers that arise
from the same species and third, 50mers that have arisen from different species but are present in definite
ratios to each other due to their soils community structure
points are off axis, as in Fig.2. Such comparisons can be used for a
variety of forensic purposes, such as comparison of trace detritus or
soil samples for determining the possible source of a proband or
for environmental monitoring. Soil metagenomes show a decreas-
ing number of shared 50mers with distance of separation of the
sample sites, and soils of different types often have no discriminat-
ing 50mers in common [8], making the detection of trace con-
tamination from another soil feasible. Here, one strategy is to
return to the raw sequence data used for extracting discriminating
50mers and design primer sets from the parent sequences of dis-
criminating 50mers specific to that soil or detritus. Those primers
would then allow detection of trace amounts of the target soil or
detritus, for example inferring that a person has been at a place
relevant to a criminal case.
Arbitrarily Primed PCR forComparison ofMeta Genomes andExtracting Useful Loci 271
2 Materials
Table 1
26mer sequence-coding primers suitable for terminal labelling of PCR
fragments of primer antiseq05. The 12 bases at the 5 end provide the
code, the remaining 14 are homologous with primer antiseq05
5 AATTTAATGTAAGTGGTGTTCGAGGG
5 TTTAATATTGATGTGGTGTTCGAGGG
5 TTTAATATGTATGTGGTGTTCGAGGG
5 AAATTATATGTAGTGGTGTTCGAGGG
5 AAATTATAGTTAGTGGTGTTCGAGGG
5 TTTAATTAGATAGTGGTGTTCGAGGG
5 TTTAATTATAGAGTGGTGTTCGAGGG
5 TTTAATAATGAAGTGGTGTTCGAGGG
5 AAATTATTATGAGTGGTGTTCGAGGG
3 Methods
3.1 Extraction 1. Field collection: 25 g of soil is taken from the upper zone of
ofMetagenome DNA the soil, typically 02cm deep, placed into an excess of isopro-
fromSoils panol (1/10 w/v) as a dehydrating agent and preservative
during storage.
2. Separate soils from isopropanol by centrifugation and air-dry
or vacuum-dry at room temperature.
3. Extract DNA from a 0.25-g sample of dried soil using a com-
mercially available soil DNA extraction kit (for example
MOBIO PowerSoilR DNA isolation kit) according to the man-
ufacturers instructions.
4. Measure DNA concentrations with a NanoDrop spectro-
photometer and dilute soil DNA to 5 ng/L with sterile UV
irradiated water.
Arbitrarily Primed PCR forComparison ofMeta Genomes andExtracting Useful Loci 273
3.4 Sequence- 1. The 50 L PCR reaction mix contains 3 L of the first round
Coding Amplification PCR product as template, 0.6 M truncated anti-seq05 tagged
primer (Table1), 1 colorless GoTaq reaction buffer, 2 mM
MgCl2, 0.2 mM dNTP mix, and 1.25 units GoTaq Flexi DNA
polymerase.
2. Amplification conditions: 94 C for 5 min, 2 cycles of (94 C
for 30 s, 51 C for 30 s, 72 C for 3 min) followed by 35 cycles
of (94 C for 30 s, 62 C for 30 s, 72 C for 3 min) and a final
extension of 72 C for 7min (see Note 6).
3.5 Massed Parallel 1. Pool equal volumes from second round amplifications, purify
Sequencing using an AdBiotech PCR purification column, or similar, fol-
ofAmplicons lowing instructions provided by the supplier and elute with
sterile nuclease-free water.
274 Leigh Burgoyne et al.
3.6 Data Processing The methods described here are specifically applicable to data gen-
erated by arbitrary priming and are not well adapted or useful with
most data from shotgun sequencing.
1. On receipt of raw data from a massed parallel sequencing tech-
nology, it is first converted into text and the quality informa-
tion discarded.
2. Any characters other than A, T, G, or C are interpreted as
break points in a sequence and the resultant fragments become
separate sequences.
3. Primer sequences are removed from the termini of all sequences
which are also scanned for internal sequences related to the
primers, with relatedness being defined as clusters of hexamers
that match the primer or its complement. Clusters of this sort
can be derived from the primer and are excised, and the flank-
ing regions treated as separate sequences.
4. Any sequences produced by these processes that are shorter
than 50 bp are discarded and the purged residuum is regarded
as the useful reads. This population of sequences should be
archived against any future need for further data mining, such
as extracting locus-specific primers.
5. All possible 50mers are extracted from a read, then the infor-
mational value of each 50mer is taken to be the converse of its
SSQD, which is defined as the sum of squares deviation from
random-expectation for the content of the dinucleotides in the
50mer concerned. From each read, only the 50mer of highest
informational value, i.e., with the lowest SSQD, is stored and
then only if the SSQD is less than a user set threshold. For the
examples included here, a value of 70 was used.
6. At the finish of collecting acceptable 50mers, the number of
times that each 50mer was observed amongst the reads is
recorded and those observed only once are discarded. The data
are stored as a two column array in which each acceptable
50mer is associated with the number of times it was seen, nor-
malized to per megabase of read for reads from a single soil or
other metagenome source. Collections of such arrays form a
database from which comparisons of metagenomes are made.
AATTTAGGCCCAAATACGGCAGAGGATATTCAATG
GCATTAGCTGATCTT, 190.28, 264.58.
The pairs of scores are then used as the coordinates of a data
point in a scattergram, as shown in Figs.1 and 2. As the associative
arrays typically contain only a few thousand lines, the data can eas-
ily be held within and plotted by spreadsheets such as Excel.
Figures 1 and 2 show scatterplots derived from comparison of
datasets obtained from the metagenomes of unrelated and closely
related soils. The soils compared in Fig.1 are both samples of
urban roadside soils taken from sites some kilometers apart. They
show no similarity as all 50mers are found either in one soil or the
other; none of the data points are off-axis. This illustrates the dis-
crimination potential of the method. The soil samples compared in
Fig. 2 are expected to be closely related as they are taken from
locations separated by a few meters. As expected, they share many
50mers, shown by data points off-axis, yet they also have 50mers
that are unique to each sample, those data points that are on-axis,
showing the potential of the method for detection of short range
variation in soil metagenomes related to, for example, contamina-
tion of a soil or other metagenome with toxic compounds or burial
of organic materials.
For fast operation of a database query, the original associative
arrays are all that is required. For the highest quality comparisons,
all the 50mers concerned in both probands arrays are best rescored
against each probands reads used to generate the two original
associative arrays; this is because random and systemic variations
between the lengths of reads from different sequencing runs may
lead to different choices of the best 50mers from even identical
populations of PCR products. This effect can be dealt with by
extracting the 50mers from full length PCR products assembled by
contiging before scoring them against reads or, more simply, by
rescoring both sets of reads against the combined 50 mers from
both sets as described. In the examples given here, the latter
method was used.
3.8 Extraction While the data sets from arbitrarily primed PCR are very small
ofTargeted Primers compared to those from shotgun sequencing of similar utility, they
forSpecific, User- are sufficiently complex to be mined for targeted primers.
Chosen Applications A 50mer occurring at high frequency in a metagenome that is
of interest can be used to extract parent reads from the archived
useful reads. Due to the amplification conditions, unlike shot-
gun sequencing, such high frequency reads will not necessarily
come from the most common organisms in the metagenome and
the high read numbers eliminate sequencing errors. Polymorphic
regions may be included or excluded according to the users
application.
276 Leigh Burgoyne et al.
Table 2
Consensus sequence from soil SDN that provided the 50mer with homology to Rubrobacter
radiotolerans. The consensus sequence was assembled by aligning primary reads having homology
to the 50mer and reads overlapping those reads. The SDN-derived primer pair SDNf1
CAGGTACGGCTCGTTCTTGT and SDNr1 TCGCTACGAGTTCCAGATGC is shown by underscores and the
50mer in bold
AGAGGACGATCTCCCCGTCCGTCTCCACCCGCTCCCCGCCGATGATTAGGGGGTAGCTC
CTGCCAAGCGAGCCCTCTACCTCTTCCAGGGCTTTCCGCATGGCCTTCCGGTTCGAC
TCGTCCGTCCAGTC CAGGTACGGCTCGTTCTTGT ACGGCAACAGTCCCATAATCT
TCCTCCTGCGAGCGGCTACCGTCTGACGGTGTTCAAGATGCTCTCAATGACGTCTCTG
GCCACGTAGCTGGCGATCTTCGGGTTCTCCTTTAACCTGCGCGTGGAGTACTCGTACC
AGTCCTTGCCGAACGGCACGTATACCCTCACCTTGTGCCCCGCATCGACGAGTATACG
CCGTAGTTCTTCGTCGACCCCAAGCAGCATCTGGAACTCGTAGCGATCCCTGGACAAA
CCCATCTGGTGGATCAAGCGCAGACCGTGCCAGACGAGATATTCGTCGTGGGTAGCGA
TCCCTACGTACG
Arbitrarily Primed PCR forComparison ofMeta Genomes andExtracting Useful Loci 277
Table 3
Localities tested for product from primers SDNf1 and SDNr1. Yes: a product close to the expected
length of 262 bases was observed by gel electrophoresis. No: no product of any length was observed
4 Notes
Fig. 3 Specimen gel of amplification products obtained from reference DNA.Chicken tissue prepared as
described in Subheading 3.2 was amplified using the preferred protocol described in Subheading 3.3 and
electrophoresed in a 2% agarose gel as described in Subheading 2.3. Lanes 1 and 2 replicate amplifications
of sand-only blanks. Lanes 3 and 4, replicate amplifications of chicken DNA.The overlapping series of bands
range from approximately 3001500 bp. Control amplifications using chicken DNA or another large genome
provide verification that amplification conditions are appropriate (see Note 3). Soil DNA templates yield unpre-
dictable patterns ranging from banding patterns to a polydisperse smear
Arbitrarily Primed PCR forComparison ofMeta Genomes andExtracting Useful Loci 279
References
1. Riesenfeld CS, Schloss PD, Handelsman 6. Waters JM, Eariss G, Yeadon PJ, Kirkbride KP,
J(2004) Metagenomics: genomic analysis of Burgoyne LA, Catcheside DEA (2012)
microbial communities. Annu Rev Genet Arbitrary single primer amplification of trace
38:525552. doi:10.1146/annurev. DNA substrates yields sequence content pro-
genet.38.072902.091216 files that are discriminatory and reproducible.
2. Wooley JC, Godzik A, Friedberg I (2010) A Electrophoresis 33:492498. doi:10.1002/
primer on metagenomics. PLoS Comput Biol elps.201100359
6(2):e1000667. doi:10.1371/journal. 7. Khodakova AS, Burgoyne L, Abarno D,
pcbi.1000667 Linacre A (2013) Forensic analysis of soils
3. Sharpton TJ (2014) An introduction to the using single arbitrarily primed amplification
analysis of shotgun metagenomics data. Front and high throughput sequencing. Forensic Sci
Plant Sci 16:209. doi:10.3389/fpls.2014.00209 Int Genet 4:e39e40. doi:10.1016/j.
4. Oulas A, Pavloud C, Polymenakou P, fsigss.2013.10.019
Pavlopoulos GS, Papanikolaou N, Kotoulas G, 8. Burgoyne L, Koh L, Catcheside D (2015) A
Arvanitidis C, Iliopoulos I (2015) study of one soil, its relatives and contaminants
Metagenomics: tools and insights for analyzing by arbitrary primed PCR with 50mer based
next-generation sequencing data derived from analysis. Forensic Sci Int Genet 5:e503e505.
biodiversity studies. Bioinform Biol Insights doi:10.1016/j.fsigss.2015.09.199
9:7588. doi:10.4137/BBI.S12462 9. Egas C, Barroso C, Froufe HJC, Pacheco J,
5. Khodakova AS, Smith RJ, Burgoyne L, Abarno Albuquerque L, da Costa MS (2014) Complete
D, Linacre A (2014) Random whole metage- genome sequence of the radiation-resistant bac-
nomic sequencing for forensic discrimination of terium Rubrobacter radiotolerans RSPS-4.
soils. PLoS One 9:e104996. doi:10.1371/ Stand Genomic Sci 9:10621075. doi:10.4056/
journal.pone.0104996 sigs.5661021
Index
A F
Agarose gel electrophoresis 6567, 6970, 91, 104, Food quality control
118, 123, 125, 155156, 158159, 185, 198, 215, 219, allergen detection173
234, 242, 251, 254, 256, 257, 259, 261 dairy authentication185
Amplified ribosomal DNA restriction analysis (ARDRA) food-borne pathogens detection153162
profiling 226, 251252, 255258
Arbitrarily primed PCR267280 G
Gene design
B
codon optimization 110, 114116, 120121
Bioinformatic tools 36, 114115, 120, fusion genes101112
222, 252, 262 site-directed-mutagenesis 8790, 95, 97,
Breed identification 184, 191 98, 102, 114
Gene synthesis
C high-throughput gene synthesis113128
Capillary electrophoresis154, 156, 159160, 221 synthesis of fusion genes101112
Colony PCR Genetic diversity analysis
for Escherichica coli 129137, 244 of cultivars196
for Saccharomyces cerevisiae137 of metagenomes 258, 262
Concentration Recovery Extraction of Nucleic Acids and
I
Molecular Enrichment (CRENAME) 141149
Inborn errors of metabolism
D postnatal molecular diagnosis224
Degenerate PCR36 prenatal molecular diagnosis213224
Degenerate primers 4, 5, 9, 17, 22, 84, 263 In silico PCR 129, 36, 38, 43, 45, 57, 61
Denaturing gradient gel electrophoresis Inter Simple Sequence Repeat (ISSR) analysis
(DGGE) 226, 227, 230231, 235240, 244 Unweighted Pair Group Method with Arithmetic
DNA cloning average (UPGMA) 203, 204, 209
plasmids construction 110, 114115, 134 Inverse PCR (iPCR) 5, 10, 8799
transformation 118120, 123125
L
DNA extraction
from fish gut250 Ligase-independent cloning (LIC) 116, 117, 121, 123
from food matrices157 Locked nucleic acid (LNA) probe 11, 36, 45, 61
from human blood/tissues/fluids135 Long fragment PCR6573
from milk samples 186, 187 Loop-mediated isothermal amplification
from plants 26, 199, 205 (LAMP)2, 26, 34, 36, 52, 53
from portable/drinking water149
from soil samples233 M
DNA fingerprinting 3, 22, 35, Megaprimer-based PCR111
46, 196 Metagenomic analysis
DNA quantification 118, 234, 246 canonical correspondence analysis
Drinking water analysis (CCA) 239240, 243
fecal contamination indicators (FCI) 141144, 148 metagenomic library screening260
detection of waterborne pathogens 142, 143, 148 next generation sequencing (NGS) 228, 229
Luclia Domingues (ed.), PCR: Methods and Protocols, Methods in Molecular Biology, vol. 1620,
DOI10.1007/978-1-4939-7060-5, Springer Science+Business Media LLC 2017
281
PCR: Methods and Protocols
282 Index
Mismatch Amplification Mutation Assay PCR with design9, 35
Degenerated primers (MAMA-DEG PCR)80 optimization15, 41
Molecular ecology225 Proof-reading enzyme65, 66
Molecular enrichment
membrane filtration 142, 145148 R
pre-enrichment medium 154, 155, 157 Random amplified polymorphic DNA (RAPD)15,
whole genome amplification 143146, 148, 149 22, 46, 183192, 196, 263
Multiparametric detection143 Real-time PCR (rtPCR)35, 36, 143, 144,
Multiple PCR 5, 10, 13, 35, 39, 50, 51, 148, 163170, 173181, 184
5456, 154, 160 Recombinant expression
expression plasmids114, 118, 120, 125127
N
heterologous protein production116
Nonoverlapping primers8890 Restriction enzyme digestion 242, 243
P S
PCR products Sequence Characterized Amplified Region (SCAR)192
clean-up 114115, 120, 123, 127, 215, 220 16S rDNA phylogeny250
visualization 73, 244
Polymerase chain reaction (PCR) T
assembly 3363, 114116, 120123, 127, 273 Terminal restriction fragment length polymorphism
efficiency8, 9, 11, 36, 41, 4445, 61, 84, 123, 130 (T-RFLP) 226, 227, 231232, 240243, 263
optimization134, 155, 200201, 263
specificity 35, 7584 U
Primers and probes
Universal-tailed primers218
assembly and analysis36, 61