Molecular Diagnostics-Fundamentals Methods and Clinical Applications

Copyright 2007 by F. A. Davis.
00Buckingham (F)-FM 2/14/07 1:09 PM Page i
MOLECULAR
DIAGNOSTICS
Fundamentals, Methods, & Clinical Applications
00Buckingham (F)-FM 2/14/07 1:09 PM Page ii
This page has been left intentionally blank.

00Buckingham (F)-FM 2/14/07 1:09 PM Page iii
MOLECULAR
DIAGNOSTICS
Fundamentals, Methods, & Clinical Applications
Lela Buckingham, PhD, CLSpMB, CLDir(NCA)

Assistant Director, Molecular Diagnostics
Department of Pathology
Rush Medical Laboratories
Rush University Medical Center
Chicago, Illinois
Maribeth L. Flaws, PhD, SM(ASCP)SI

Associate Chairman and Associate Professor
Department of Clinical Laboratory Sciences
Rush University Medical Center
Chicago, Illinois
00Buckingham (F)-FM 2/14/07 1:09 PM Page iv
F.A. Davis Company

1915 Arch Street
Philadelphia, PA 19103
www.fadavis.com
Copyright 2007 by F. A. Davis Company

All rights reserved. This product is protected by copyright. No part of it may be
reproduced, stored in a retrieval system, or transmitted in any form or by any
means, electronic, mechanical, photocopying, recording, or otherwise, without
written permission from the publisher.
Printed in the United States of America
Last digit indicates print number: 10 9 8 7 6 5 4 3 2 1
Acquisitions Editor: Christa Fratantoro

Manager of Content Development: Deborah Thorp
Developmental Editor: Marla Sussman
Manager of Art & Design: Carolyn OBrien
As new scientic information becomes available through basic and clinical

research, recommended treatments and drug therapies undergo changes. The
author(s) and publisher have done everything possible to make this book accurate,
up to date, and in accord with accepted standards at the time of publication. The
author(s), editors, and publisher are not responsible for errors or omissions or for
consequences from application of the book, and make no warranty, expressed or
implied, in regard to the contents of the book. Any practice described in this book
should be applied by the reader in accordance with professional standards of care
used in regard to the unique circumstances that may apply in each situation. The
reader is advised always to check product information (package inserts) for
changes and new information regarding dose and contraindications before admin-
istering any drug. Caution is especially urged when using new or infrequently
ordered drugs.
Library of Congress Cataloging-in-Publication Data

Buckingham, Lela.
Molecular diagnostics : fundamentals, methods, and clinical applications /
Lela Buckingham, Maribeth Flaws.
p. ; cm.
Includes bibliographical references and index.
ISBN-13: 978-0-8036-1659-2 (hardcover : alk. paper)
ISBN-10: 0-8036-1659-7 (hardcover : alk. paper)
1. Molecular diagnosis. I. Flaws, Maribeth. II. Title.
[DNLM: 1. Molecular Diagnostic Techniquesmethods. 2. Nucleic
Acidsanalysis. QU 58 B923m 2007]
RB43.7.B83 2007
616.9041dc22 2006038487
Authorization to photocopy items for internal or personal use, or the internal or

personal use of specic clients, is granted by F. A. Davis Company for users reg-
istered with the Copyright Clearance Center (CCC) Transactional Reporting
Service, provided that the fee of $.10 per copy is paid directly to CCC, 222
Rosewood Drive, Danvers, MA 01923. For those organizations that have been
granted a photocopy license by CCC, a separate system of payment has been
arranged. The fee code for users of the Transactional Reporting Service is: 8036-
1659/07 0 $.10.
00Buckingham (F)-FM 2/14/07 1:09 PM Page v
DEDICATION
To Zachary
LB
This textbook is especially dedicated to my parents Maureen
and Edward Laude, my husband John, and our daughters
Emily, Michelle, and Kristen. To my family, friends, teach-
ers, students, and colleagues, I am forever grateful for your
guidance, support, and encouragement.
MLF
v
00Buckingham (F)-FM 2/14/07 1:09 PM Page vi

00Buckingham (F)-FM 2/14/07 1:09 PM Page vii
PREFACE
Molecular Technology has been implemented into diagnos-
tic testing in a relatively short period. Programs that educate
clinical laboratory professionals have had to incorporate
molecular-based diagnostic testing into their curricula just
as rapidly despite a lack of formal resources. This textbook
was written to address these concerns.
The primary audience for this text is students enrolled
in Clinical Laboratory Science/Medical Technology pro-
grams at all levels. The textbook explains the principles of
molecular-based tests that are used for diagnostic purposes.
Examples of applications of molecular-based assays are
included in the text as well as case studies that illustrate the
use and interpretation of these assays in patient care.
This textbook is also appropriate for students in other
health-related disciplines who have to understand the pur-
pose, principle, and interpretation of molecular-based diag-
nostic tests that they will be ordering and assessing for their
patients.
Students who are rst learning about molecular-based
assays will nd this text useful for explaining the principles.
Practitioners who are performing and interpreting these
assays can use this text as a resource for reference and
trouble-shooting and to drive the implementation of addi-
tional molecular-based assays in their laboratory.
For educators who adopt this text for a course, we
have developed an Instructors Resource package. These
vii
00Buckingham (F)-FM 2/14/07 1:09 PM Page viii

viii Preface
resources, which include a Brownstone test generator, image

bank, and PowerPoint presentation, are available on CD-
ROM and on DavisPlus at http://davisplus.fadavis.com.
Educators should contact their F.A. Davis Sales Represen-
tative to obtain access to the Instructors Resources.
Lela Buckingham, PhD, CLSpMB, CLDir(NCA)

Maribeth L. Flaws, PhD, SM(ASCP)SI
00Buckingham (F)-FM 2/14/07 1:09 PM Page ix
REVIEWERS
Roxanne Alter, MS, MT(ASCP) Huey-Jen Lin, MT(ASCP), Phyllis Pacico, EdD, MT(ASCP)
Assistant Professor CLSpMB(NCA) Program Director
Clinical Laboratory Science Assistant Professor Clinical Laboratory Science
University of Nebraska Medical Medical Technology Wright State University
Center Ohio State University Dayton, Ohio
Omaha, Nebraska Columbus, Ohio
Robert D. Robison, PhD,
Theola N. Copeland, MS, Mary E. Miele, PhD, CLS(NCA), MT(ASCP)
MT(ASCP) MT(ASCP), RM(NRM) Professor and Program Director
Assistant Professor Associate Professor Medical Technology/Biology
Medical Technology Medical Technology Austin Peay State University
Tennessee State University University of Delaware Clarksville, Tennessee
Nashville, Tennessee Newark, Delaware
Timothy S. Uphoff, PhD,
Audrey E. Hentzen, PhD Teresa S. Nadder, PhD, MT(ASCP)
Director CLS(NCA), MT(ASCP) Clinical Chemistry and Molecular
Medical Laboratory Technology Associate Professor/Assistant Genetic Fellow
Casper College Chairman Mayo Clinic
Casper, Wyoming Clinical Laboratory Sciences Rochester, Minnesota
Virginia Commonwealth University
Lynn R. Ingram, MS, CLS(NCA) Jo Ann Wilson, PhD, MT(ASCP),
Richmond, Virginia
Associate Professor CLDir(NCA), BCLD
Clinical Laboratory Sciences Susan M. Orton, PhD, MS, Professor and Department Chair
University of Tennessee Health MT(ASCP) Environmental Health, Molecular
Science Center Assistant Professor and Clinical Sciences
Memphis, Tennessee Clinical Laboratory Sciences Florida Gulf Coast University
University of North Carolina Fort Myers, Florida
Mary Ellen Koenn, MS,
Chapel Hill, North Carolina
CLS(NCA), MT(ASCP)
Associate Professor
Medical Technology
West Virginia University
Morgantown, West Virginia
ix
00Buckingham (F)-FM 2/14/07 1:09 PM Page x

00Buckingham (F)-FM 2/14/07 1:09 PM Page xi
ACKNOWLEDGMENTS
We would like to acknowledge the hard work of all of the
people at F.A. Davis who helped get this book from the idea
stage to hard copy, especially the Acquisitions Editor,
Health Professions, Christa A. Fratantoro; Elizabeth
Zygarewicz, Developmental Associate; Elizabeth Morales,
the artist who made the drawings come to life; Deborah
Thorp, Sam Rondinelli, and everyone else at F.A. Davis
who was involved in this project.
We would also like to thank all of the reviewers who
gave their time to read and comment on the chapters as they
were being developed, and especially the students at Rush
University in Chicago, Illinois, who literally begged for a
textbook in this subject.
xi
00Buckingham (F)-FM 2/14/07 1:09 PM Page xii

00Buckingham (F)-FM 2/14/07 1:09 PM Page xiii
CONTENTS
SECTION I 1
Chapter 2 27
Fundamentals of Nucleic RNA
Acid Biochemistry: Lela Buckingham
TRANSCRIPTION 28
An Overview TYPES/STRUCTURES 29
Ribosomal RNA 30
Chapter 1 1 Messenger RNA 30
DNA Small Nuclear RNA 34
Lela Buckingham Small Interfering RNA 34
DNA 2 Transfer RNA 34
DNA STRUCTURE 2 Micro RNAs 35
Nucleotides 3 Other Small RNAs 36
Nucleic Acid 6 RNA POLYMERASES 36
DNA REPLICATION 7 OTHER RNA-METABOLIZING ENZYMES 37
Polymerases 8 Ribonucleases 37
ENZYMES THAT METABOLIZE DNA 12 RNA Helicases 38
Restriction Enzymes 12 REGULATION OF TRANSCRIPTION 38
DNA Ligase 14 Epigenetics 42
Other DNA Metabolizing Enzymes 14
RECOMBINATION IN SEXUALLY REPRODUCING Chapter 3 48
ORGANISMS 17 Proteins
RECOMBINATION IN ASEXUAL REPRODUCTION 18 Lela Buckingham
Conjugation 19 AMINO ACIDS 49
Transduction 20 GENES AND THE GENETIC CODE 54
Transformation 21 The Genetic Code 55
PLASMIDS 22
xiii
00Buckingham (F)-FM 2/14/07 1:09 PM Page xiv

xiv Contents
TRANSLATION 57 Chapter 6 94
Amino Acid Charging 57
Protein Synthesis 57 Analysis and Characterization
of Nucleic Acids and Proteins
Lela Buckingham
SECTION II 65 RESTRICTION ENZYME MAPPING 95
Common Techniques HYBRIDIZATION TECHNOLOGIES
Southern Blots
96
96
in Molecular Biology Northern Blots 101
Western Blots 102
Chapter 4 65 PROBES 103
DNA Probes 103
Nucleic Acid Extraction Methods RNA Probes 103
Lela Buckingham Other Nucleic Acid Probe Types 104
ISOLATION OF DNA 66 Protein Probes 104
Preparing the Sample 66 Probe Labeling 105
Organic Isolation Methods 67 Nucleic Acid Probe Design 106
Inorganic Isolation Methods 68 HYBRIDIZATION CONDITIONS, STRINGENCY 107
Solid-Phase Isolation 69 DETECTION SYSTEMS 109
Crude Lysis 71 INTERPRETATION OF RESULTS 111
Isolation of Mitochondrial DNA 71 ARRAY-BASED HYBRIDIZATION 112
ISOLATION OF RNA 72 Dot/Slot Blots 112
Total RNA 72 Genomic Array Technology 113
Extraction of Total RNA 72 SOLUTION HYBRIDIZATION 117
Isolation of polyA (messenger) RNA 74
MEASUREMENT OF NUCLEIC ACID QUALITY Chapter 7 121
AND QUANTITY 75 Nucleic Acid Amplication
Electrophoresis 75 Lela Buckingham and Maribeth L. Flaws
Spectrophotometry 76 TARGET AMPLIFICATION 122
Fluorometry 77 Polymerase Chain Reaction 122
Transcription-Based Amplication Systems 142
Chapter 5 80 PROBE AMPLIFICATION 144
Ligase Chain Reaction 144
Resolution and Detection Strand Displacement Amplication 144
of Nucleic Acids Q Replicase 145
Lela Buckingham SIGNAL AMPLIFICATION 147
ELECTROPHORESIS 81 Branched DNA Amplication 147
GEL SYSTEMS 81 Hybrid Capture Assays 148
Agarose Gels 81 Cleavage-Based Amplication 148
Polyacrylamide Gels 84 Cycling Probe 149
Capillary Electrophoresis 85
BUFFER SYSTEMS 86 Chapter 8 155
Buffer Additives 88
ELECTROPHORESIS EQUIPMENT 88
Chromosomal Structure and
GEL LOADING 90 Chromosomal Mutations
DETECTION SYSTEMS 91 Lela Buckingham
Nucleic AcidSpecic Dyes 91 CHROMOSOMAL STRUCTURE AND ANALYSIS 157
Silver Stain 92 Chromosomal Compaction and Histones 157
00Buckingham (F)-FM 2/14/07 1:09 PM Page xv

Contents xv
Chromosomal Morphology 159 Gender Identication 234

Visualizing Chromosomes 159 Analysis of Test Results 235
DETECTION OF GENOME AND CHROMOSOMAL Y-STR 241
MUTATIONS 161 Matching with Y-STRs 242
Karyotyping 161 ENGRAFTMENT TESTING USING DNA
Fluorescence In Situ Hybridization 166 POLYMORPHISMS 245
LINKAGE ANALYSIS 249
Chapter 9 173 QUALITY ASSURANCE OF TISSUE SECTIONS
USING STR 251
Gene Mutations SINGLE NUCLEOTIDE POLYMORPHISMS 252
Lela Buckingham
The Human Haplotype (Hap Map) Mapping Project 252
TYPES OF GENE MUTATIONS 174
MITOCHONDRIAL DNA POLYMORPHISMS 253
DETECTION OF GENE MUTATIONS 174
Hybridization-Based Methods 175
Chapter 12 263
Sequencing (Polymerization)-Based Methods 185
Cleavage Methods 189 Detection and Identication
Other Methods 193
GENE MUTATION NOMENCLATURE 194
of Microorganisms
Maribeth L. Flaws and Lela Buckingham
SPECIMEN COLLECTION 264
Chapter 10 203 SAMPLE PREPARATION 266
DNA Sequencing QUALITY CONTROL 266
Lela Buckingham BACTERIAL TARGETS OF MOLECULAR-BASED TESTS 268
DIRECT SEQUENCING 204 Selection of Sequence Targets for Detection
Manual Sequencing 204 of Microorganisms 268
Automated Fluorescent Sequencing 210 Molecular Detection of Bacteria 269
PYROSEQUENCING 214 Respiratory Tract Pathogens 270
BISULFITE DNA SEQUENCING 216 Urogenital Tract Pathogens 276
BIOINFORMATICS 218 ANTIMICROBIAL AGENTS 280
THE HUMAN GENOME PROJECT 219 Resistance to Antimicrobial Agents 280
Molecular Detection of Resistance 282
MOLECULAR EPIDEMIOLOGY 284
SECTION III 225 Molecular Strain Typing Methods for
Epidemiological Studies 284
Techniques in the Comparison of Typing Methods 289
Clinical Lab VIRUSES 291
Human Immunodeciency Virus 292
Chapter 11 225 Hepatitis C Virus 298
Summary 299
DNA Polymorphisms and FUNGI 299
Human Identication PARASITES 300
Lela Buckingham
TYPES OF POLYMORPHISMS 226 Chapter 13 310
RFLP TYPING 226
Genetic Mapping With RFLPs 228
Molecular Detection
RFLP and Parentage Testing 229 of Inherited Diseases
Human Identication Using RFLP 229 Lela Buckingham
STR TYPING BY PCR 231 THE MOLECULAR BASIS OF INHERITED DISEASES 311
STR Nomenclature 232 CHROMOSOMAL ABNORMALITIES 311
00Buckingham (F)-FM 2/14/07 1:09 PM Page xvi

xvi Contents
PATTERNS OF INHERITANCE IN SINGLE-GENE HLA POLYMORPHISMS 379

DISORDERS 312 HLA Nomenclature 380
MOLECULAR BASIS OF SINGLE-GENE DISORDERS 314 MOLECULAR ANALYSIS OF THE MHC 384
Lysosomal Storage Diseases 315 Serological Analysis 384
MOLECULAR DIAGNOSIS OF SINGLE-GENE DNA-Based Typing 388
DISORDERS 316 Combining Typing Results 392
Factor V Leiden 316 HLA Test Discrepancies 393
Hemochromatosis 317 Coordination of HLA Test Methods 393
Cystic Fibrosis 318 ADDITIONAL RECOGNITION FACTORS 393
Cytochrome P-450 319 Minor Histocompatibility Antigens 393
Nonconventional MHC Antigens 393
SINGLE-GENE DISORDERS WITH NONCLASSICAL
Killer Cell Immunoglobulin-like Receptors 394
PATTERNS OF INHERITANCE 319
MHC DISEASE ASSOCIATION 394
Mutations in Mitochondrial Genes 319
SUMMARY OF LABORATORY TESTING 395
Trinucleotide Repeat Expansion Disorders 322
Genomic Imprinting 325 Chapter 16 403
Multifactorial Inheritance 326
LIMITATIONS TO MOLECULAR TESTING 326 Quality Assurance and
Quality Control in the
Chapter 14 332 Molecular Laboratory
Molecular Oncology Lela Buckingham
Lela Buckingham SPECIMEN HANDLING 404
CLASSIFICATION OF NEOPLASMS 333 Collection Tubes for Molecular Testing 405
MOLECULAR BASIS OF CANCER 333 Precautions 406
ANALYTICAL TARGETS OF MOLECULAR TESTING 334 Holding and Storage Requirements 407
Gene and Chromosomal Mutations in Solid Tumors 335 TEST PERFORMANCE 409
Microsatellite Instability 343 Controls 412
Loss of Heterozygosity 346 Quality Assurance 412
GENE REARRANGEMENTS IN LEUKEMIA INSTRUMENT MAINTENANCE 413
AND LYMPHOMA 346 Calibrations 416
V(D)J Recombination 347 REAGENTS 417
Detection of Clonality 350 Chemical Safety 418
Translocations in Hematological Malignancies 356 Prociency Testing 419
DOCUMENTATION OF TEST RESULTS 420
Gene Sequencing Results 421
Chapter 15 376 Reporting Results 421
DNA-Based Tissue Typing Appendix 427
Lela Buckingham
THE MHC LOCUS 377 Index 441
01Buckingham (F)-01 2/6/07 12:23 PM Page 1
SECTION 1
Fundamentals of Nucleic Acid

Biochemistry: An Overview
Chapter 1 Lela Buckingham
DNA
OUTLINE OBJECTIVES
DNA Diagram the structure of nitrogen bases, nucleosides,
DNA STRUCTURE and nucleotides.
Nucleotides Describe the nucleic acid structure as a polymer
Nucleic Acid
of nucleotides.
DNA REPLICATION
Polymerases Demonstrate how deoxyribonucleic acid (DNA) is repli-
cated such that the order or sequence of nucleotides is
ENZYMES THAT METABOLIZE DNA
Restriction Enzymes
maintained (semiconservative replication).
DNA Ligase Explain the reaction catalyzed by DNA polymerase that
Other DNA Metabolizing Enzymes results in the phosphodiester backbone of the DNA chain.
RECOMBINATION IN SEXUALLY Note how the replicative process results in the antiparallel
REPRODUCING ORGANISMS nature of complementary strands of DNA.
RECOMBINATION IN ASEXUAL
List the enzymes that modify DNA, and state their
REPRODUCTION
Conjugation
specic functions.
Transduction Illustrate three ways in which DNA can be transferred
Transformation between bacterial cells.
PLASMIDS Dene recombination, and sketch how new combinations
of genes are generated in sexual and asexual reproduction.
1

2 Section 1 Fundamentals of Nucleic Acid Biochemistry: An Overview
When James Watson coined the term molecular biol-

ogy,1 he was referring to the biology of deoxyribonu-
cleic acid (DNA). Of course, there are other molecules in
Historical Highlights
nature. The term, however, is still used to describe the Johann Friedrich Miescher is credited with the dis-
study of nucleic acids. In the clinical molecular labora- covery of DNA in 1869.2 Miescher had isolated
tory, molecular techniques are designed for the handling white blood cells from seepage collected from dis-
and analysis of the nucleic acids, DNA and ribonucleic carded surgical bandages. He found that he could
acid (RNA). Protein analysis and that of carbohydrates extract a viscous substance from these cells.
and other molecular species remain, for the most part, the Miescher also observed that most of the nonnuclear
domain of clinical chemistry. Molecular techniques are, cell components could be lysed away with dilute
however, being incorporated into other testing venues hydrochloric acid, leaving the nuclei intact.
such as cell surface protein analysis, in situ histology, and Addition of extract of pig stomach (a source of
tissue typing. The molecular biology laboratory, there- pepsin to dissolve away contaminating proteins)
fore, may be a separate entity or part of an existing resulted in a somewhat shrunken but clean prepara-
molecular diagnostics or molecular pathology unit. tion of nuclei. Extraction of these with alkali yielded
Nucleic acids offer several characteristics that support the same substance isolated from the intact cells. It
their use for clinical purposes. Highly specic analyses precipitated upon the addition of acid and redis-
can be carried out through hybridization and amplication solved in alkali. Chemical analysis of this substance
techniques without requirement for extensive physical or demonstrated that it was 14% nitrogen and 2.5%
chemical selection of target molecules or organisms. This phosphorus, different from any then known group of
sensitivity allows specic and rapid analysis from limiting biochemicals. He named the substance nuclein.
specimens. Furthermore, information carried in the (Analytical data indicate that less than 30% of
sequence of the nucleotides that make up the DNA macro- Mieschers rst nuclein preparation was actually
molecule is the basis for normal and pathological traits DNA.) He later isolated a similar viscous material
from microorganisms to humans and, as such, provides a from salmon sperm and noted: If one wants to
valuable means of predictive analysis. Effective preven- assume that a single substanceis the specic
tion and treatment of disease will result from the analysis cause of fertilization, then one should undoubtedly
of these sequences in the clinical laboratory. rst of all think of nuclein.
DNA
DNA is a macromolecule of carbon, nitrogen, oxygen, his work on the nucleus in 1882 admitted that the biolog-
phosphorous, and hydrogen atoms. It is assembled in ical signicance of the substance was unknown. We now
units or nucleotides that are composed of a phosphory- know that the purpose of DNA, contained in the nucleus
lated ribose sugar and a nitrogen base. There are four of the cell, is to store information. The information in the
nitrogen bases that make up the majority of DNA found DNA storage system is based on the order or sequence of
in all organisms in nature. These are adenine, cytosine, nucleotides in the nucleic acid polymer. Just as computer
guanine, and thymine. Nitrogen bases are attached to a information storage is based on sequences of 0 and 1,
deoxyribose sugar, which forms a polymer with the biological information is based on sequences of A, C, G,
deoxyribose sugars of other nucleotides through a phos- and T. These four building blocks (with a few modica-
phodiester bond. Linear assembly of the nucleotides tions) account for all of the biological diversity that
makes up one strand of DNA. Two strands of DNA com- makes up life on Earth.
prise the DNA double helix.
In 1871, Miescher published a paper on nuclein, the
viscous substance extracted from cell nuclei. In his writ-
DNA Structure
ings, he made no mention of the function of nuclein. The double helical structure of DNA (Fig. 1-1) was rst
Walther Flemming, a leading cell biologist, describing described by James Watson and Francis Crick. Their

DNA Chapter 1 3
(A) Nitrogen bases

3 5
C C G C C G C
G T A G
DNA A A G A
A A
double helix C C T G
T C
G C G
C C
5 G C A T G
3
C
T T G C G T
Sugar-phosphate backbone
Hydrogen bond H
H
N H O N
CH3 O H N N CH
CH HC C C C
C C C C
G N
N HC C N H N C
HC T N H N A C
N C C N
N C HC N
O H NH
O
(B) Thymine Adenine Cytosine Guanine

Figure 1-1 (A) The double helix. The phosphodiester backbones of the two nucleic acid chains form the
helix. Nitrogen bases are oriented toward the center where they hydrogen-bond with homologous bases to
stabilize the structure. (B) Two hydrogen bonds form between adenine and thymine. Three hydrogen bonds
form between guanine and cytosine.
molecular model was founded on previous observa- or a nucleotide. For example, adenosine with one phos-
tions of the chemical nature of DNA and physical evi- phate is adenosine monophosphate (AMP). Adenosine
dence including diffraction analyses performed by with three phosphates is adenosine triphosphate (ATP).
Rosalind Franklin.3 The helical structure of DNA results Nucleotides can be converted to nucleosides by hydroly-
from the physicochemical demands of the linear array of sis. The ve-carbon sugar of DNA is deoxyribose, which
nucleotides. Both the specic sequence (order) of is ribose with the number two carbon of deoxyribose
nucleotides in the strand as well as the surrounding linked to a hydrogen atom rather than a hydroxyl group
chemical microenvironment can affect the nature of the (see Fig. 1-2). The hydroxyl group on the third carbon is
DNA helix. important for forming the phosphodiester bond that is the
backbone of the DNA strand.
Nitrogen bases are planar carbon-nitrogen ring
Nucleotides
structures. The four common nitrogen bases in DNA are
The four nucleotide building blocks of DNA are mole- adenine, guanine, cytosine, and thymine. Amine and
cules of about 700 kd. Each nucleotide consists of a ve- ketone substitutions around the ring as well as the single
carbon sugar, the rst carbon of which is covalently or double bonds within the ring distinguish the four bases
joined to a nitrogen base and the fth carbon to a triphos- that comprise the majority of DNA (Fig. 1-3). Nitrogen
phate moiety (Fig. 1-2). A nitrogen base bound to an bases with a single ring (thymine, cytosine) are pyrim-
unphosphorylated sugar is a nucleoside. Adenosine (A), idines. Bases with a double ring (guanine, adenine) are
guanosine (G), cytidine (C), and thymidine (T) are purines.
nucleosides. If the ribose sugar is phosphorylated, the Numbering of the positions in the nucleotide molecule
molecule is a nucleoside mono-, di-, or triphophosphate starts with the ring positions of the nitrogen base, desig-

O
Advanced Concepts Phosphate N C
group OR Guanine
The double helix rst described by Watson and Crick HC C NH
is DNA in its hydrated form (B-form) and is the stan- O P O
N C C
dard form of DNA.4 It has 10.5 steps or pairs of O O N NH2
nucleotides (bp) per turn. Dehydrated DNA takes the 1
A-form with about 11 bp per turn and the center of H2C CH CH
5 Ribose
symmetry along the outside of the helix rather than HC CH2
down the middle as it is in the B-form. Both A- and
B-form DNA are right-handed helices. Stress and OH
torsion can throw the double helix into a Z-form. Z- dGMP
DNA is a left-handed helix with 12 bp per turn and Figure 1-2 The nucleotide deoxyguanosine 5 phosphate
or guanosine monophosphate (dGMP). It is composed of
altered geometry of the sugar-base bonds. Z-DNA
deoxyribose covalently bound at its number 1 carbon to the
has been observed in areas of chromosomes where nitrogen base, guanine, and at its number 5 carbon to a
the DNA is under torsional stress from unwinding phosphate group. The molecule without the phosphate
for transcription or other metabolic functions. group is the nucleoside, deoxyguanosine.
Watson-Crick base pairing (purine:pyrimidine
hydrogen bonding) is not limited to the ribofuranosyl
nucleic acids, those found in our genetic system. of the nucleotides is maintained. As DNA is polymerized,
Natural nucleic acid alternatives can also display the each nucleotide to be added to the new DNA strand
basic chemical properties of RNA and DNA. hydrogen bonds with the complementary nucleotide on
Theoretical studies have addressed such chemical the parental strand (A:T, G:C). In this way the parental
alternatives to DNA and RNA components. An DNA strand can be replicated without loss of the
example is the pentopyranosyl-(24) oligonu- nucleotide order. Base pairs (bp) other than A:T and G:C
cleotide system that exhibits stronger and more or mismatches, e.g., A:C, G:T, can distort the DNA helix
selective base pairing than DNA or RNA.5 Study of and disrupt the maintenance of sequence information.
nucleic acid alternatives has practical applications.
For example, protein nucleic acids, which have a car- Substituted Nucleotides
bon nitrogen peptide backbone replacing the sugar Modications of the nucleotide structure are found
phosphate backbone,6,7 can be used in the laboratory throughout nature. Methylations, deaminations, additions,
as alternatives to DNA and RNA hybridization substitutions, and other chemical modications generate
probes.8 They are also potential enzyme-resistant nucleotides with new properties. Changes such as methy-
alternatives to RNA in antisense RNA therapies.9 lation of nitrogen bases have biological consequences for
gene function and are intended in nature. Changes can
nated C or N 1, 2, 3, etc. The carbons of the ribose sugar

are numbered 1 to 5, distinguishing the sugar ring posi-
tions from those of the nitrogen base rings (Fig. 1-4).
Advanced Concepts
The nitrogen base components of the nucleotides form In addition to the four commonly occurring nucleo-
hydrogen bonds with each other in a specic way. tide bases, modied bases are also often found in
Guanine forms three hydrogen bonds with cytosine. nature. Base modications have signicant affects
Adenine forms two hydrogen bonds with thymine (see on phenotype. Some modied bases result from
Fig. 1-1B). Hydrogen bonds between nucleotides are the damage to DNA; others are naturally modied for
key to the specicity of all nucleic acidbased tests used specic functions or to affect gene expression, as
in the molecular laboratory. Specic hydrogen bond for- will be discussed in later sections.
mation is also how the information held in the linear order

DNA Chapter 1 5
PURINES
O NH2
Guanine N C Adenine N C
OR OR
HC C NH HC C N
O P O O P O
N C C N C HC
O O N NH2 O O N
H2 C CH CH2 H 2C CH CH2
HC CH2 HC CH2
OH OH
dGMP dAMP
PYRIMIDINES
NH2 O
Cytosine C Thymine C
HC N H 3C C NH
OR OR
O P O HC C O O P O HC C O
N N
O O O O
H2 C CH CH H 2C CH CH
HC CH2 HC CH2
OH OH
dCMP dTMP
Figure 1-3 Nucleotides, deoxyguanosine monophosphate (dGMP), deoxyadenosine
monophosphate (dAMP), deoxythymidine monophosphate (dTMP), and deoxycytidine
monophosphate (dCMP), differ by the attached nitrogen bases. The nitrogen bases, guanine and
adenine, have purine ring structures. Thymine and cytosine have pyrimidine ring structures. Uracil,
the nucleotide base that replaces thymine in RNA, has the purine ring structure of thymine minus
the methyl group and hydrogen bonds with adenine.
O
also be brought about by environmental insults such as
7 6
chemicals or radiation. These changes can affect gene
N 5 C 1
OR 8 function as well, resulting in undesirable effects such as
HC C NH
O P O
cancer.
9 N C C2
O O 4 N NH2
3
H2 C
5
CH
4
CH
1 Advanced Concepts
HC CH2
3 2 Modied nucleotides are used in bacteria and
OH viruses as a primitive immune system that allows
Figure 1-4 Carbon position numbering of a nucleotide them to distinguish their own DNA from that of
monophosphate. The base carbons are numbered 1
host or invaders (restriction modication [rm] sys-
through 9. The sugar carbons are numbered 1 to 5.
The phosphate group on the 5 carbon and the hydroxyl
tem). Recognizing its own modications, the host
group on the 3 carbon form phosphodiester bonds can target unmodied DNA for degradation.
between bases.

Due to their specic effects on enzymes that metabo- Growing strand

lize DNA, modied nucleosides have been used effec-
tively for clinical applications (Fig. 1-5). The anticancer
drugs, 5-bromouridine (5BrdU) and cytosine arabinoside O P O
(cytarabine, ara-C), are modied thymidine and cytosine O
template strand
nucleosides, respectively. Azidothymidine (Retrovir,
H2 C O
AZT), cytosine, 2,3-dideoxy-2-uoro (ddC), and 2,3- A T
dideoxyinosine (Videx, ddI), drugs used to treat patients CH CH2
with human immunodeciency virus (HIV) infections,
HC CH2
are modications of thymidine and cytosine and a precur-
sor of adenine, respectively. An analog of guanosine, 2- O
amino-1,9-dihydro-9-[(2-hydroxyethoxy)methyl]-6H-pur O P O
in-6-one (Acyclovir, Zovirax), is a drug used to combat
O
herpes simplex virus and varicella-zoster virus.
H2C O
In the laboratory, nucleosides can be modied for pur- G C
poses of labeling or detection of DNA molecules, se- CH CH2
quencing, and other applications. The techniques used for
HC CH2
these procedures will be discussed in later chapters.
OH
Phosphodiester
Nucleic Acid linkage
Nucleic acid is a macromolecule made of nucleotides

O O O
bound together by the phosphate and hydroxyl groups on
their sugars. A nucleic acid chain grows by the attach- O P O P O P O
ment of the 5 phosphate group of an incoming nucleotide O O O C G
to the 3 hydroxyl group of the last nucleotide on the
growing chain (Fig. 1-6). Addition of nucleotides in this H2C O
Pyrophosphate
CH CH
Nitrogen base Nitrogen base HC CH2

OH
HOCH2 O HOCH2 O
C C C C Incoming nucleotide
C C C C Figure 1-6 DNA replication is a template guided polymer-
OH ization catalyzed by DNA polymerase.
Deoxynucleoside Dideoxynucleoside
way gives the DNA chain a polarity; that is, it has a 5

phosphate end and a 3 hydroxyl end. We refer to DNA as
HOCH2 O T HOCH2 O G oriented in a 5 to 3 direction, and the linear sequence
C C C C
of the nucleotides, by convention, is read in that order.
DNA found in nature is mostly double-stranded. Two
C C C C
strands exist in opposite 5 to 3/3 to 5 orientation held
N3 OH
together by the hydrogen bonds between their respective
Azidothymidine Acyclovir bases (A with T and G with C). The bases are positioned
(AZT)
such that the sugar-phosphate chain that connects them
Figure 1-5 Substituted nucleosides used in the clinic and (sugar-phosphate backbone) is oriented in a spiral or
the laboratory. helix around the nitrogen bases (see Fig. 1-1).

DNA Chapter 1 7
Advanced Concepts 5 3
OH
The sugar-phosphate backbones of the helix are
arranged in specic distances from one another in
A T
the double helix (see Fig. 1-1). The two regions of
the helix formed by the backbones are called the
major groove and minor groove. The major and
minor grooves are sites of interaction with the many
proteins that bind to specic nucleotide sequences
in DNA (binding or recognition sites). The double G C
helix can also be penetrated by intercalating
agents, molecules that slide transversely into the
center of the helix. Denaturing agents such as for-
mamide and urea displace the hydrogen bonds and
separate the two strands of the helix.
C G
3 5
The DNA double helix represents two versions of the
information stored in the form of the order or sequence of HO
the nucleotides on each chain. The sequences of the two
strands that form the double helix are complementary,
not identical (Fig. 1-7). They are in antiparallel orienta- Figure 1-8 DNA synthesis proceeds from the 5 phos-
tion with the 5 end of one strand at the 3 end of the other phate group to the 3 hydroxyl group. The template
(Fig. 1-8). Identical sequences will not hybridize with strand is copied in the opposite (3 to 5) direction. The
each other. In later sections we will appreciate the impor- new double helix consists of the template strand and
the new daughter strand oriented in opposite directions
tance of this when designing hybridization and amplica- from one another.
tion assays.
DNA Replication As Watson and Crick predicted, semiconservative

replication is the key to maintaining the sequence of the
DNA has an antiparallel orientation because of the way it nucleotides in DNA through new generations. Every cell
is synthesized. As DNA synthesis proceeds in the 5 to 3 in a multicellular organism or in a clonal population of
direction, DNA polymerase, the enzyme responsible for unicellular organisms carries the same genetic informa-
polymerizing the nucleotides, uses a guide, or template, tion. It is important that this information, in the form of
to determine which nucleotides to add. The enzyme reads the DNA sequence, be transferred faithfully at every cell
the template in the 3 to 5 direction. The resulting dou- division. The replication apparatus is designed to copy
ble strand, then, will have a parent strand in one orienta- the DNA strands in an orderly way with minimal errors
tion and a newly synthesized strand oriented in the before each cell division.
opposite orientation. The order of nucleotides is maintained because each
strand of the parent double helix is the template for a
newly replicated strand. In the process of replication,
PO 5 G T A G C T C G C T G A T 3 OH DNA is rst unwound from the duplex so that each sin-
HO 3 C A T C G A G C G A C T A 5 OP gle strand may serve as a template for the order of addi-
Figure 1-7 Homologous sequences are not identical and tion of nucleotides to the new strand (see Fig. 1-6). The
are oriented in opposite directions. new strand is elongated by hydrogen bonding of the

Historical Highlights Historical Highlights

Before the double helix was determined, Erwin A few years after solution of the double helix, the
Chargaff10 made the observation that the amount mechanism of semiconservative replication was
of adenine in DNA corresponded to the amount of demonstrated by Matthew Meselson and Franklin
thymine and the amount of cytosine to the amount of Stahl,11 using the technique of equilibrium density
guanine. Upon the description of the double helix, centrifugation on a cesium gradient. They prepared
Watson proposed that the steps in the ladder of the heavy DNA by growing bacteria in a medium
double helix were pairs of bases, thymine with ade- containing the nitrogen isotope 15N. After shifting
nine and guanine with cytosine. Watson and Crick, the bacteria into a medium of normal nitrogen (14N),
upon publication of their work, suggested that this they could separate the hybrid 14N:15N DNA mole-
arrangement was the basis for a copying mechanism. cules synthesized as the bacteria replicated. These
The complementary strands could separate and serve molecules were of intermediate density to the ones
as guides of templates for producing like strands. from bacteria grown only in 14N or 15N. They could
differentiate true semiconservative replication from
dispersive replication by demonstrating that
approximately half of the DNA double helices from
proper incoming nucleotide to the nitrogen base on the next generation grown in normal nitrogen
the template strand and then a nucleophilic attack of the were14N:15N and half were 14N:14N.
deoxyribose 3 hydroxyl oxygen on a phosphorous atom
of the phosphate group on the hydrogen-bonded
nucleotide triphosphate. Orthophosphate is released with
the formation of a phosphodiester bond between the not copied in the same way. The replication apparatus
new nucleotide and the last nucleotide of the growing jumps ahead a short distance (~1000 bases) on the 5 to 3
chain. The duplicated helix will ultimately consist of one strand and then copies backward toward the replication
template strand and one new strand. fork, while DNA replication proceeds in a continuous
DNA replication proceeds through the DNA duplex manner on the 3 to 5 strand, or the leading strand. The
with both strands of DNA replicating in a single pass. 5 to 3 strand copied in a discontinuous manner is the
DNA undergoing active replication can be observed by lagging strand13 (Fig. 1-9).
electron microscopy as a forked structure, or replication Another requirement for DNA synthesis is the avail-
fork. Note, however, that the antiparallel nature of duplex ability of the deoxyribose 3 hydroxyl oxygen for chain
DNA and the requirement for the DNA synthesis appara- growth. This means that DNA cannot be synthesized de
tus to read the template strand in a 3 to 5 direction are novo. A preceding base must be present to provide the
not consistent with copying of both strands simultane- hydroxyl group. This base is provided by another enzyme
ously in the same direction. The question arises as to how component of the replication apparatus, primase.
one of the strands of the duplex can be copied in the same Primase is a ribonucleic acid (RNA) synthesizing enzyme
direction as its complementary strand that runs antiparal- that lays down short (611 bp) RNA primers required for
lel to it. This problem was addressed in 1968 by Okazaki priming DNA synthesis. Primase must work repeatedly
and Okazaki12 studying DNA replication in Escherichia on the lagging strand to prime synthesis of each Okazaki
coli. In their experiments, small pieces of DNA, about fragment.
1000 bases in length, could be observed by density gradi-
ent centrifugation in actively replicating DNA. The frag-
Polymerases
ments chased into larger pieces with time, showing that
they were covalently linked together shortly after synthe- The rst puried enzyme shown to catalyze DNA repli-
sis. These small fragments, or Okazaki fragments, were cation in prokaryotes was designated DNA polymerase I
the key to explaining how both strands were copied at the (pol I). DNA polymerases II (pol II) and III were later
replication fork. The two strands of the parent helix are characterized, and it was discovered that DNA poly-

DNA Chapter 1 9
DNA
polymerase
3
5
Figure 1-9 Simultaneous replica- Leading strand 5
3
tion of both strands of the double Lagging strand 5 3
helix. Both strands are read in the 3
3 to 5 direction. The lagging Replication fork
strand is read discontinuously, with 5
the polymerase skipping ahead Okazaki fragments
and reading back toward the repli-
cation fork on the lagging strand. Overall direction of replication
merase III (pol III) was the main polymerizing enzyme studies. In in vitro studies where the enzymes were rst
during bacterial replication (Table 1.1). The other two described, pol II and pol III activity was less than 5% of
polymerases were responsible for repair of gaps and dis- that of pol I. In vivo, pol III functions as a multisubunit
continuities in previously synthesized DNA. It not sur- holoenzyme. The holoenzyme works along with a larger
prising that pol I was preferentially puried in those early assembly of proteins required for priming, initiation, reg-
ulation, and termination of the replication process (Fig.
1-10). Two of the 10 subunits of the holoenzyme are cat-
alytic DNA polymerizing enzymes, one for leading and
Advanced Concepts one for lagging strand synthesis.14
Most DNA polymerase functions include, in addition
The DNA replication complex (replisome) contains
to polymerization, pyrophosphorolysis and pyrophos-
all the necessary proteins for the several activities
involved in faithful replication of double-stranded
DNA. Helicase activity in the replisome unwinds
and untangles the DNA for replication. Primase,
either as a separate protein or in a primase-helicase
polyprotein in the replisome, synthesizes short At a conference on the chemical basis of heredity
(111 bases) RNA sequences to prime DNA syn- held at Johns Hopkins University in June 1956,
thesis. Primase activity is required throughout the Arthur Kornberg, I. Robert Lehman, and Maurice J.
replication process to prime the discontinuous syn- Bessman reported on an extract of E. coli that could
thesis on the lagging DNA strand. The E. coli pri- polymerize nucleotides into DNA.13 It was noted
mase, DnaG, transcribes 20003000 RNA primers at that the reaction required preformed DNA and all
a rate of 1 per second in the replication of the E. coli four nucleotides along with the bacterial protein
genome. Separate polymerase proteins add incoming extract. Any source of preformed DNA would work,
nucleotides to the growing DNA strands of the repli- bacterial, viral, or animal. At the time it was difficult
cation fork. The details of synthesis of the lagging to determine whether the new DNA was a copy of
strand are not yet clear, although recent evidence the input molecule or an extension of it. During the
suggests discontinuous replication proceeds by a next 3 years, Julius Adler, Sylvy Kornberg, and
ratcheting mechanism, with replisome molecules Steven B. Zimmerman showed that the new DNA
pulling the lagging strand in for priming and copy- had the same A-T to G-C base pair ratio as the input
ing. Once DNA is primed and synthesized, Rnase H, DNA, and was indeed a copy of it. This ratio was
an enzyme that hydrolyzes RNA from a complemen- not affected by the proportion of free nucleotides
tary DNA strand, removes the primer RNA from the added to the initial reaction, conrming that the
short RNA-DNA hybrid, and the resulting gap is input or template DNA determined the sequence of
lled by another DNA polymerase, pol I. the nucleotides on the newly synthesized DNA.

Table 1.1 Examples of Polymerases Classied by Sequence Homology

Family Polymerase Source Activity
A Pol I E. coli Recombination, repair, replication
A T5 pol, T7 pol T5, T7 bacteriophage Replication
A Pol Mitochondria Replication
B Pol II E. coli Repair
B Archael P. furiosus Replication, repair
B 29 pol, T4 pol 29, T4 bacteriophage Replication
B Pol, Pol, Pol Eukaryotes Repair
B Viral pols Various viruses Repair
C Pol III core E. coli Replication
C dnaE, dnaEBS B. subtilis Replication
X Pol Eukaryotes Repair, replication
? Pol , Pol Eukaryotes Bypass replication
? Pol Eukaryotes Bypass replication, cohesion
? Pol IV, Pol V E. coli Bypass replication
? Rev1, Rad30 S. cerevisiae Bypass replication
? Rad 6, Pol S. cerevisiae uv-induced repair
Leading strand DNA

polymerase
5 Single-strand
binding proteins
3 5
Lagging strand Figure 1-10 DNA polymerase activity
Helicase
involves more than one protein molecule.
5 3
Several cofactors and accessory proteins
are required to unwind the template helix
3
(green), prime synthesis with RNA primers
Primase (gray), and protect the lagging strand
RNA primer (dark gray).
phate exchange, the latter two activities being a reversal

Advanced Concepts of the polymerization process. DNA polymerase enzymes
thus have the capacity to synthesize DNA in a 5 to 3
Genome sequencing has revealed that the organiza- direction and degrade DNA in both a 5 to 3 and 3 to 5
tion of the proteins in and associated with the direction (Fig 1-11). The catalytic domain of E. coli DNA
holoenzyme is similar in bacteria of the Bacillus/ pol I can be broken into two fragments, separating the
Clostridium group and in the unrelated thermophile, two functions, a large fragment carrying the polymerase
Thermotoga maritima.14 The conserved nature of the activity and a small fragment carrying the exonuclease
polymerase complex suggests a limited range of pos- activity. The large fragment without the exonuclease
sible structures with polymerase activity. It also ex- activity (Klenow fragment) has been used extensively in
plains how a bacterial polymerase can replicate DNA the laboratory for in vitro DNA synthesis.
from diverse sources. This is important in the labora- One purpose of the exonuclease function in the vari-
tory where prokaryote polymerases are used exten- ous DNA polymerases is to protect the sequence of
sively to copy DNA from many different sources. nucleotides, which must be faithfully copied. Copying
errors will result in base changes or mutations in the

DNA Chapter 1 11
3 3
G G
C C
T T
A A
T T
5 5
35 exonuclease
T T C
A A
3 C 3
A A
T T
A A
G G
Figure 1-11 DNA polymerase C C
5 5
can remove misincorporated Mispair (AC) at 3 end of Mispaired base (C) removed
bases during replication using its growing DNA strand by exonuclease. DNA polymerase
3 to 5 exonuclease activity. tries a second time.
DNA. The 3 to 5 exonuclease function is required to tance until the polymerase is dislodged. The nick can
assure that replication begins or continues with a cor- then be reclosed by DNA ligase, an enzyme that forms
rectly base-paired nucleotide. The enzyme will remove a phosphodiester bonds between existing DNA strands.
mismatch (for example, A opposite C instead of T on the Nick translation is often used in vitro as a method to
template) in the primer sequence before beginning poly- introduce labeled nucleotides into DNA molecules. The
merization. During DNA synthesis, this exonuclease resulting labeled products are used for DNA detection in
function gives the enzyme the capacity to proofread hybridization analyses.
newly synthesized DNA; that is, to remove a misincorpo- Another type of DNA polymerase, terminal trans-
rated nucleotide by breaking the phosphodiester bond ferase, can synthesize polynucleotide chains de novo
and replace it with the correct one. without a template. This enzyme will add nucleotides to
During DNA replication, E. coli DNA pol III can syn- the end of a DNA strand in the absence of hydrogen base
thesize and degrade DNA simultaneously. At a nick, or pairing with a template. The initial synthesis of a large
discontinuity, in one strand of a DNA duplex, the enzyme dA-dT polymer by terminal transferase was a signicant
can add nucleotides at the 3 end of the nick while event in the history of DNA polymerase studies.15
removing nucleotides ahead of it with its 5 to 3 exonu- Terminal transferase is used in the laboratory to generate
clease function (Fig. 1-12). This concurrent synthesis and 3-labeled DNA species.
hydrolysis then move the nick in one strand of the DNA
forward in an activity called nick translation. The poly-
merization and hydrolysis will proceed for a short dis-
Advanced Concepts
After replication, distortions in the DNA duplex
caused by mismatched or aberrantly modied bases
Advanced Concepts are removed by the 5 to 3 exonuclease function of
Like prokaryotes, eukaryotic cells contain multiple repair polymerases such as DNA pol I. This activ-
polymerase activities. Two polymerase protein com- ity degrades duplex DNA from the 5 end and can
plexes, designated and , are found in the nucleus also cleave diester bonds several bases from the end
and one, , in the mitochondria. The three poly- of the chain. It is important for removing lesions in
merases resemble prokaryotic enzymes, except they the DNA duplex such as thymine or pyrimidine
have less demonstrable exonuclease activity. A dimers, boxy structures formed between adjacent
fourth polymerase, , originally isolated from bone thymines or cytosines and thymines on the same
marrow, has 3 to 5 exonuclease activity. Poly- DNA strand that are induced by exposure of DNA to
merase , the most active, is identied with chro- ultraviolet light. If these structures are not removed,
mosome replication, and and are associated with they can disrupt subsequent transcription and repli-
DNA repair. cation of the DNA strand.

5 3 of these enzymes is contained in a monomeric or single

3 5 protein. Chemical manipulation of the amino acid struc-
ture of these enzymes produces polymerases with char-
Nick
5 3 5 3
acteristics that are useful in the laboratory. These include
3 5 altered processivity (staying with the template longer to
make longer products), delity (faithful copying of the
5 to 3 synthesis
DNA poymerase template), and substrate specicity (affinity for altered
5 3 nucleotides).19
3 5
DNA ligase
Enzymes That Metabolize DNA
Newly synthesized DNA
5 3 Once DNA is polymerized, it is not static. The informa-
3 5 tion stored in the DNA must be tapped selectively to
make RNA and, at the same time, protected from muta-
Closed nick
tion. In addition, an important aspect of reproduction is
5 3
3 5 mixing of sequence information to generate genetic
Figure 1-12 Nick translation of DNA. DNA polymerase diversity (hybrid vigor) in the offspring, which requires
extends the 3 end of a nick in double-stranded DNA with cutting and reassembly of the DNA strands in advance of
newly synthesized strand (gray) while digesting the original cell division and gamete formation. A host of enzymes
strand from the 5 end. After polymerization, the nick is performs these and other functions during various stages
closed by DNA ligase.
of the cell cycle. Some of these enzymes, including DNA
polymerase, have been isolated for in vitro manipulation
DNA polymerases play a central role in modern of DNA in the laboratory. They are key tools of recombi-
biotechnology. Cloning as well as some amplication and nant DNA technology, the basis for commonly used
sequencing technologies all require DNA polymerase molecular techniques.
activity. The prerequisite for specic polymerase charac-
teristics has stimulated the search for new polymerases
Restriction Enzymes
and the engineering of available polymerase enzymes.
Polymerases from various sources were classied into Genetic engineering was stimulated by the discovery of
families (A, B, C, X) based on sequence structure.16,17 deoxyriboendonucleases, or endonucleases. Endonucle-
Short summary is shown in Table 1.1. Other classica- ases break the sugar phosphate backbone of DNA at
tions are based on similarities in protein structure. internal sites.
Polymerases in the A and B family are most useful for Restriction enzymes are endonucleases that recognize
biotechnological engineering, as the polymerase activity specic base sequences and break or restrict the DNA
Advanced Concepts Advanced Concepts

Polymerases replicate DNA under different cellular These enzymes are of several types. Some prefer sin-
conditions as shown in Table 1.1. A large part of gle-stranded and some prefer double-stranded DNA.
DNA synthesis activity in the cell occurs after repli- Repair endonucleases function at areas of distortion
cation of the cellular DNA is complete. New infor- in the DNA duplex such as baseless (apurinic or
mation as to the nature of these enzymes indicates apyrimidic) sites on the DNA backbone, thymine
that polymerases can participate in cohesion (hold- dimers, or mismatched bases. As the chemical struc-
ing together) of sister chromatids to assure proper ture of DNA is the same in all organisms, most
recombination and segregation of chromosomes.18 enzymes are active on DNA from diverse sources.

DNA Chapter 1 13
polymer at the sugar-phosphate backbone. These enzymes

were originally isolated from bacteria where they function
as part of a primitive defense system to cleave foreign
Advanced Concepts
DNA entering the bacterial cell. The ability of the cell to Restriction enzyme recognition sequences in the
recognize foreign DNA depended on both DNA sequence DNA are generally areas of bilateral rotational sym-
recognition and methylation. metry around an axis perpendicular to the DNA
Restriction enzymes are named for the organism from helix. The enzymes bind to the recognition site,
which they were isolated. For example, BamHI was iso- which is usually 48 bp in length, as dimers to form
lated from Bacillus amyloliquefaciens H, HindIII from a complex with twofold symmetry. The enzymes
Haemophilus influenzae Rd, SmaI from Serratia then cleave the DNA backbone at sites symmetri-
marcescens Sbb and so forth. cally located around the same twofold axis.
Restriction endonucleases have been classied into
three types. Type I restriction enzymes have both nucle-
ase and methylase activity in a single enzyme. They bind
palindromic in nature; that is, they read the same 5 to 3
to host-specic DNA sites of 46 bp separated by 68 bp
on both strands of the DNA (Fig. 1-13), referred to as
and containing methylated adenines. The site of cleavage
bilateral symmetry. Type II restriction enzymes cleave
of the DNA substrate can be over 1000 bp from this bind-
the DNA directly at their binding site, producing frag-
ing site. An example of a type I enzyme is EcoK from E.
ments of predictable size.
coli K 12. It recognizes the site:
Type II restriction enzymes have been found in almost
5 - A C N N N N N N G T G C all prokaryotes, but none, to date, have been found in
T G N N N N N N C A C G - 5 eukaryotes. The specicity of their action and the hun-
where N represents nonspecic nucleotides and the dreds of enzymes available that recognize numerous sites
adenine residues (A) are methylated. are key factors in the ability to perform DNA recombina-
Type III restriction enzymes resemble type I tion in vitro. Cutting DNA at specic sequences is the
enzymes in their ability to both methylate and restrict basis of many procedures in molecular technology,
(cut) DNA. Like type I, they are complex enzymes with including mapping, cloning, genetic engineering, and
two subunits. Recognition sites for these enzymes are mutation analysis. Restriction enzymes are frequently
asymmetrical, and the cleavage of the substrate DNA used in the clinical laboratory, for example, in the analy-
occurs 2426 bp from the site to the 3 side. An example sis of gene rearrangements and in mutation detection.
of a type III enzyme is HinfIII from H. inuenzae. It rec- Although all type II restriction enzymes work with
ognizes the site: bilateral symmetry, their patterns of double-stranded
5 - C G A A T breaks differ (see Fig. 1-13). Some enzymes cut the
G C T T A - 5 duplex with a staggered separation at the recognition
where the adenine methylation occurs on only one site, leaving 24 base single-strand overhangs at the
strand. ends of the DNA. The single-strand ends can hybridize
Type II restriction enzymes are those used most fre- with complementary ends on other DNA fragments,
quently in the laboratory. These enzymes do not have directing the efficient joining of cut ends. Because of
inherent methylation activity in the same molecule as the their ability to form hydrogen bonds with complementary
nuclease activity. They bind as simple dimers to their overhangs, these cuts are said to produce sticky ends
symmetrical DNA recognition sites. These sites are at the cut site. Another mode of cutting separates the
Figure 1-13 Restriction enzymes recognize 5 G A A T T C 3 5 C C C G G G 3 5 C T G C A G 3

symmetrical DNA sequences and cut the sugar DNA
3 C T T A A G 5 3 G G G C C C 5 3 G A C G T C 5
phosphate background in different ways.
Exposed single-stranded ends are sticky ends
that can hybridize with complementary over- Eco RI SmaI PstI
hangs. 5 overhang blunt 3 overhang


The advantage of blunt ends for in vitro recombina- DNA ligase can join both DNA and RNA ends.
tion is that blunt ends formed by different enzymes RNA ligase, rst found in phage T4infected bacte-
can be joined, regardless of the recognition site. ria, has the same activity. DNA ligases are more effi-
This is not true for sticky ends, which must have cient in joining DNA ends and have been found in a
matching overhangs. Sticky ends can be converted wide variety of bacteria. The ability to convert open
to blunt ends using DNA polymerase to extend the or nicked circles of DNA to closed circles, to protect
recessed strand in a sticky end, using the nucleotides free DNA ends, to extend DNA into an overhanging
of the overhang as a template or by using a single template, and to recover transformation-capable
strand exonuclease to remove the overhanging DNA after nicking are all activities of DNA ligase
nucleotides. Synthetic short DNA fragments with that led to its discovery and isolation.
one blunt end and one sticky end (adaptors) can be
used to convert blunt ends to specic sticky ends.
they will not work on closed circular DNA. These en-

zymes are used, under controlled conditions, to manipu-
DNA duplex at the same place on both strands, leaving late DNA in vitro,23 for instance to make stepwise
ush, or blunt, ends. These ends can be rejoined as well, deletions in linearized DNA or to modify DNA ends after
although not as efficiently as sticky ends. cutting with restriction enzymes. Exonucleases have dif-
Restriction enzymes can be used for mapping a DNA ferent substrate requirements and will therefore degrade
fragment, as will be described in later sections. The col- specic types of DNA ends.
lection of fragments generated by digestion of a given Exonuclease I from E. coli degrades single-stranded
DNA fragment, e.g., a region of a human chromosome, DNA from the 3 hydroxyl end, producing mononu-
with several restriction enzymes will be unique to that cleotides. Its activity is optimal on long single-stranded
DNA. This is the basis for forensic identication and ends, slowing signicantly as it approaches a double-
paternity testing using restriction fragment analysis of stranded region.
human DNA. Exonuclease III from E. coli removes 5 mononu-
cleotides from the 3 end of double-stranded DNA in the
DNA Ligase presence of Mg2 and Mn2. It also has some endonu-
clease activity, cutting DNA at apurinic sites. Exo III
DNA ligase catalyzes the formation of a phosphodiester
removes nucleotides from blunt ends, recessed ends, and
bond between adjacent 3-hydroxyl and 5-phosphoryl
nicks, but will not digest 3 overhangs. Exo III has been
nucleotide ends. Its existence was predicted by the obser-
used in the research setting to create nested deletions in
vation of replication, recombination, and repair activities
double-stranded DNA or to produce single-stranded
in vivo. These operations require reunion of the DNA
DNA for dideoxy sequencing.
backbone after discontinuous replication on the lagging
Exonuclease VII from E. coli digests single-stranded
strand, strand exchange, or repair synthesis. In 1967,
DNA from either the 5 phosphate or 3 hydroxyl end. It
DNA ligase was discovered in ve different laborato-
is one of the few enzymes with 5 exonuclease activity.
ries.20 The isolated enzyme could catalyze end to end
Exo VII can be employed to remove long single strands
cleavage of separated strands of DNA.
protruding from double-stranded DNA.
Nuclease Bal31 from Alteromonas espejiani can
Other DNA Metabolizing Enzymes
degrade single- and double-stranded DNA from both
Other Nucleases ends. Because its activity at 20oC is slow enough to con-
In contrast to endonucleases, exonucleases degrade DNA trol with good resolution, it has been used extensively in
from free 3 hydroxyl or 5 phosphate ends. Consequently, research applications to make nested deletions in DNA.

DNA Chapter 1 15
S1 nuclease from Aspergillus oryzae is another single-

Historical Highlights strandspecic nuclease. It hydrolyzes single-stranded
DNA or RNA into 5 mononucleotides. It also has
The initial analysis of the joining reaction was per- endonuclease capability to hydrolyze single-stranded
formed with physically fractured DNA helices that regions such as gaps and loops in duplex DNA. It was
had no homology at their ends. The joining reaction used extensively in early RNAse protection assays of
required the chance positioning of two adjacent ends gene expression. It is also used for nuclease mapping
and was, therefore, not very efficient. A better sub- techniques.24
strate for the enzyme would be ends that could be recBC nuclease from E. coli is an ATP-dependent sin-
held together before ligation, i.e., by hydrogen bonds gle- and double-stranded DNA nuclease. Although it has
between single strands. H. Gobind Khorana showed no activity at nicks (short single-strand gaps) in the DNA,
that short synthetic segments of DNA with single- it digests DNA from either the 3 hydroxyl or the 5 phos-
strand complementary overhangs joined into larger phate ends. It has some endonuclease activity on duplex
fragments efficiently.21Several investigators ob- DNA, generating short fragments, or oligonucleotides.
served the increased efficiency of joining of ends of Micrococcal nuclease digests single- and double-
DNA molecules from certain bacterial viruses. These stranded DNA and RNA at AT- or AU-rich regions.
ends have naturally occurring single-stranded over- Although this enzyme can digest duplex DNA, it prefers
hangs. It was also observed that treatment of DNA single-stranded substrates. It is used in the laboratory to
ends with terminal transferase to add short runs of remove nucleic acid from crude extracts and also for
As to one fragment and Ts to another increased the analysis of chromatin structure.25
efficiency of joining ends of any two treated frag- Deoxyribonuclease I (DNAse I) from bovine pan-
ments. Although not yet available when ligase activ- creas digests single-and double-stranded DNA at pyrim-
ity was being studied, it was subsequently observed idines to oligodeoxyribonucleotides; so, technically, it is
that the single-strand overhangs left by some restric- an endonuclease. It is used in both research and clinical
tion enzymes were better substrates for DNA ligase laboratories to remove DNA from RNA preparations.
than blunt ends due to hydrogen bonding of the com- DNAse I has also been used to detect exposed regions of
plementary single-stranded bases. DNA in DNA protein binding experiments.
DNA pol I from E. coli has exonuclease activity.
5 T C G A C T G C T A T 3
DNA
3 A G C T G A C G A T A 5
Formerly called exonuclease II, this activity is responsi-
ble for the proofreading function of the polymerase.
5 T C A T G C C C A C T A T G 3 As nucleases are natural components of cellular
3 A G T A C G G C C G A T A C 5 lysates, it is important to eliminate or inactivate them
when preparing nucleic acid specimens for clinical
5 G C A A T C A A A A A G T G C C 3 analysis. Most DNA isolation procedures are designed to
3 C G T T A G T T T T T C A C G G 5
minimize both endonuclease and exonuclease activity
Substrates for DNA ligase are broken double helices. during DNA isolation. Puried DNA is often stored in TE
Blunt ends (top) or noncomplementary overhangs (center) buffer (10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA) to
are joined less efficiently than complementary overhangs
(bottom). Also note the complementary overhangs in
chelate cations required by nucleases for activity.
Figure 1-13.
Helicases
DNA in bacteria and eukaryotes does not exist as the
relaxed double helix as shown in Figure 1-1 but as a series
Mung bean nuclease from Mung bean sprouts digests of highly organized loops and coils. Release of DNA for
single-stranded DNA and RNA. Because it leaves double- transcription, replication, and recombination without tan-
stranded regions intact, it is used to remove overhangs gling is brought about through cutting and reclosing of
from restriction fragments to produce blunt ends for the DNA sugar-phosphate backbone. These functions are
cloning. carried out by a series of enzymes called helicases.

As described with restriction endonucleases, the DNA

double helix can be broken apart by the separation of
the sugar phosphate backbones in both strands, a double-
Advanced Concepts
strand break. When only one backbone is broken (a Both DNA and RNA helicases have been identied
single-strand break or nick), the broken ends are free to in molds, worms, and plants.2831 These enzymes
rotate around the intact strand. These ends can be digested may function in establishment of local chromosome
by exonuclease activity or extended using the intact architecture as well as regulation of transcription.
strand as a template (nick translation, as described above).
The nicking and reclosing of DNA by helicases relieve
topological stress in highly compacted, or supertwisted,
strands. Most prokaryotic DNA is methylated, or hemi-
DNA as required; for example, in advance of DNA repli-
methylated (methylated on one strand of the double helix
cation or transcription. Helicases are of two types: topoi-
and not the other), as a means to differentiate host DNA
somerases and gyrases. Topoisomerases interconvert
from nonhost and to provide resistance to restriction
topological isomers or relax supertwisted DNA. Gyrases
enzymes. Unlike prokaryotic DNA, eukaryotic DNA is
(type II topoisomerases) untangle DNA through double-
methylated in specic regions. In eukaryotes, DNA bind-
strand breaks. They also separate linked rings of DNA
ing proteins may limit accessibility or guide methyltrans-
(concatamers).
ferases to specic regions of the DNA.
Topoisomerases in eukaryotes have activity similar to
There are two main types of methyltransferases.
that in bacteria but with different mechanisms of cutting
Maintenance methyltransferases work throughout the
and binding to the released ends of the DNA. Because of
life of the cell and methylate hemimethylated DNA. In
their importance in cell replication, topoisomerases are
contrast, de novo methyltransferases work only during
the targets for several anticancer drugs, such as camp-
embryonic development and may be responsible for the
tothecin, the epipodophyllotoxins VP-16 and VM-26,
specic methylation patterns in differentiated cells.
amsacrine, and the intercalating anthracycline derivatives
doxorubicin and mitoxantrone. These topoisomerase
inhibitors bring about cell death by interfering with the
breaking and joining activities of the enzymes, in some
cases trapping unnished and broken intermediates.
Advanced Concepts
Cytosine methyltransferases are key factors in ver-
Methyltransferases tebrate development and gene expression. These
DNA methyltransferases catalyze the addition of methyl enzymes catalyze the transfer of an activated methyl
groups to nitrogen bases, usually cytosine in DNA group from S-adenosyl methionine to the 5 position
of the cytosine ring (producing 5-methyl cytosine).
Methylation marks DNA for recognition by or resist-
ance to enzymes such as nucleases or architectural
proteins in higher eukaryotes. Methylation is the
Advanced Concepts source of imprinting of DNA, a system that pro-
Enzymatic interconversion of DNA forms was rst vides a predetermined program of gene expression
studied in vitro by observing the action of two E. during development. A specic methyl transferase,
coli enzymes, topoisomerase I26 and gyrase27 on cir- Dmnt1, prefers hemimethylated DNA, indicating a
cular plasmids. Topo I can relax supercoils in circu- mechanism for keeping methylation patterns in the
lar plasmid DNA by nicking one strand of the genome.32 Defects in methylation have been
double helix. Gyrase, also called topoisomerase II, observed in cancer cells, 33 some disease states,34 and
can introduce coiling by cutting both strands of the clones.35 To date, three DNA cytosine methyltrans-
helix, passing another part of the duplex through ferases have been cloned, DNMT1, DNMT3a, and
and religating the cut strand. DNMT3b.36,37

DNA Chapter 1 17
Recombination in Sexually molecular process of crossing over or physical exchange

between molecules. A recombinant molecule or organism
Reproducing Organisms is one that holds a new combination of DNA sequences
Recombination is the mixture and assembly of new Based on Mendels laws, each generation of sexually
genetic combinations. Recombination occurs through the reproducing organisms is a new combination of the
Early studies of recombination were done with progeny. These observations had been made before,
whole organisms. Mendels analysis of peas (Pisum but by making quantitative predictions of the proba-
species)38 established the general rules of recombi- bility of phenotypes Mendel proposed that traits are
nation in sexually reproducing organisms. Mendel inherited in a particulate manner, rather than blend-
could infer the molecular exchange events that ing as was previously thought.
occurred in the plants by observing the phenotype of
What Mendel saw: What Mendel inferred:
phenotypes genotypes
RRGG x rrgg
Round Wrinkled
gray white
rg rg rg rg
Gamete production
and fertilization RG RGrg RGrg RGrg RGrg
RG RGrg RGrg RGrg RGrg

All round and gray
Self-pollinization
and fertilization
All RrGg
315 108 101 32

RrGg x RrGg
round round wrinkled wrinkled
gray white gray white
RG Rg rG rg
RG RRGG RRGg RrGG RrGg
Rg RRGg RRgg RrGg Rrgg
rG RrGG RrGg rrGG rrGg

Mendelian genetics showed that traits
are inherited as unit characteristics. The
probability of inheriting a given trait can rg RrGg Rrgg rrGg rrgg
then be calculated from the traits of the
parents. (R-round, r-wrinkled, G-gray, g- Genotypic ratio:
white) 1:1:2:2:4:2:2:1:1

of each the recombined parental chromosomes. Finally,

the gamete will merge with a gamete from the other par-
ent carrying its own set of recombined chromosomes.
The resulting offspring will contain a new set or recom-
bination of genes of the parents. The nature of this
Genetic recombination by crossing over Recombinant recombination is manifested in the combinations of
chromosomes inherited traits of subsequent generations.
Figure 1-14 Generation of genetic diversity by crossing Recombinant DNA technology is a controlled mixing
over of homologous chromosomes. of genes. Rather than relying on natural mixing of whole
genomes, single genes can be altered, replaced, deleted,
or moved into new genomes. This directed diversity can
parental genomes. The mixing of genes generates genetic produce organisms with predictable traits, as natural
diversity, increasing the opportunity for more robust and purebreds, but with single gene differences. The ability to
well-adapted offspring. The benecial effect of natural manipulate single traits has implications not only in the
recombination is observed in heteresis, or hybrid vigor, laboratory but also in treatment and prevention of dis-
observed in genetically mixed or hybrid individuals com- ease; for example, through gene therapy.
pared with purebred organisms.
Sexually reproducing organisms mix genes in three
ways. First, at the beginning of meiosis, duplicated Recombination in
homologous chromosomes line up and recombine by
crossing over or breakage and reunion of the four DNA
Asexual Reproduction
duplexes (Fig. 1-14). This generates newly recombined Movement and manipulation of genes in the laboratory
duplexes with genes from each of the homologs. Then, began with observations of natural recombination in
these recombined duplexes are randomly assorted into asexually reproducing bacteria. Genetic information
gametes (Fig. 1-15), so that each gamete contains one set in asexually reproducing organisms can be recombined in
Homologous
chromosomes
Recombined
chromosomes
Gametes
Figure 1-15 Recombined chromosomes are randomly assorted into gametes. Twenty-two other
chromosomes will be randomly assorted into the four gametes, giving each one a new collection
of recombined chromosomes.

DNA Chapter 1 19
Sexual reproduction Asexual reproduction
Donor cell Recipient cell

Gametes
Chromosome
Conjugation,
Zygote transduction, or
transformation
Duplicated
chromosomes,
recombination
Transformed
(recombinant) cell
Figure 1-16 Recombination in sexual (left) and asexual (right) reproduction.
three ways: conjugation, transduction, and transforma-

tion (Fig. 1-16).
Conjugation
Bacteria that participate in conjugation are of two types,
or sexes, termed F and F-. For conjugation to occur, F-
and F cells must be in contact with each other. F
Requirement for contact can be demonstrated by physi- F+
cally separating F and F- cells. If this is done, mating
does not occur (Fig. 1-17). Microscopically, a lamentous
bridge is observed between mating bacteria. Further work
by J. Lederberg and William Hayes demonstrated polar-
ity in the conjugation process; that is, genetic information
could move from F to F- bacteria but not from F- to F
bacteria. The explanation for this was soon discovered.
The F bacteria had a fertility factor that not only car-
Filter impermeable
ried the information from one cell to another but also was
to bacteria
responsible for establishing the physical connection
Figure 1-17 Conjugating cells must be in physical contact
between the mating bacteria. The fertility factor was with each other (top) for successful transfer of the F pheno-
transferred from F to F- bacteria in the mating process, type. If cells are separated by a membrane (bottom), F-
so that afterward the F- bacteria became F (Fig. 1-18). bacteria do not become F.

F Chromosome
Historically, recombination was studied through
controlled mating and propagation of organisms.
George Beadle39 and others conrmed the connec-
tion between the units of heredity and physical phe- Loss Conjugation
notype using molds (Neurospera crassa), bacteria, F+
and viruses. Joshua Lederberg and Edward L.
Tatum40 demonstrated that bacteria mate and
exchange genetic information to produce recombi-
nant offspring. Lederberg and Tatum proved that
genetic exchange between organisms was not
Detachment Integration
restricted to the sexually reproducing molds. These
early studies rst demonstrated the existence of Hfr F
recombination in E. coli.
E. coli Abnormal
detachment
met + bio +
thr leu Figure 1-18 Fertility (the ability to donate genetic informa-
tion) is controlled by the F factor (green). The F factor can
Requires threonine exist by itself or be integrated into the host chromosome
and leucine for growth thr + leu + (large black circle).
met + bio +
met bio factor remains in the F bacteria, and the other is intro-
thr + leu + duced into the F- bacteria. After mating, both bacteria are
F. The F factor may be lost or cured during normal cell
Requires methionine division, turning an F bacteria back to the F state.
and biotin for growth
The F factor can also insert itself into the host chro-
No growth on Growth on mosome through a crossover or recombination event.
minimal medium minimal medium
(auxotrophic) (prototrophic)
Embedded in the chromosome, the F factor maintains its
ability to direct mating and can carry part or all of the
Transfer of genetic information by conjugation can be host chromosome with it across the mating bridge into
demonstrated using double mutants. Bacteria with double
mutations that required exogenous methionine and biotin
the F- bacteria. Strains with chromosomally embedded F
(met and bio) or threonine and leucine (thr and leu) can- factors are called Hfr bacteria, for high frequency of
not grow on a medium without addition of these nutrients recombination. The embedded F factor in these rarely
(minimal medium). When these strains are mixed together, occurring strains pulls host chromosomal information
however, growth occurs. The resulting bacteria have into recipient bacteria where another recombination
acquired the normal genes () through transfer or conju-
gation.
event can insert that information into the recipient chro-
mosome, forming a recombinant or new combination of
genes of the Hfr and F- bacteria. Hfr bacteria were used
in the rst mapping studies.
The F factor was subsequently shown to be an extra-
chromosomal circle of double-stranded DNA carrying the
Transduction
genes coding for construction of the mating bridge. Genes
carried on the F factor are transferred across the bridge In the early 1960s, Francois Jacob and Elie Wollman41
and simultaneously replicated, so that one copy of the F studied the transmission of units of heredity carried by

DNA Chapter 1 21
viruses from one bacterium to another (transduction).

Just as animal and plant viruses infect eukaryotic cells, Coat
bacterial viruses, or bacteriophages, infect bacterial
cells. The structure of bacteriophage T4 is one example Head
of the specialized protein coats that enable these viruses

DNA
to insert their DNA through the cell wall into the bacter-
ial cell (Fig. 1-19). Alfred Hershey and Martha Chase
Collar
conrmed that the DNA of a bacterial virus was the car-
rier of its genetic determination in the transduction
process.42 Hershey and Chase used 35S to label the viral Helical sheath
protein and 32P to label the viral DNA. The experiment
showed that viral protein remained outside of the cell
while viral DNA entered the cell. Furthermore, 32P-
labeled DNA could be detected in new viruses generated
in the transduction process (Fig. 1-20). Methods soon
Base plate Tail fibers
developed using bacteriophages to move genetic infor-
mation between bacteria by growing the phage on one Figure 1-19 Bacteriophage T4 infects specic strains of E.
strain of bacteria and then infecting a second strain with coli. It has specialized structures. The tail bers nd the bacter-
those viruses. Transduction is also useful in determining ial surface and allow contact of the tail plate and injection of
the DNA in the viral head through the sheath into the bac-
gene order. Seymour Benzer used transduction of the T4 terium.
bacterial virus to ne-map genes.43
were not. If he rst killed the smooth-type bacteria by
Transformation
boiling, virulence was lost, and they were no longer lethal
Although conjugation and transduction were the methods to mice. Surprisingly, when he mixed killed smooth-type
for the initial study of the connection between DNA and and live rough-type bacteria, virulence returned.
phenotype, transformation, which had first been Furthermore, he could recover live smooth-type bacteria
observed in 1928 by Frederick Griffith,44 is the basis for from the dead mice. He concluded that something from
modern-day recombinant techniques. Griffith was inves- the dead smooth-type bacteria had transformed the
tigating virulence in Diplococcus (now known as rough-type bacteria into smooth-type.
Streptococcus) pneumoniae. He had two strains of the What Griffith had observed was the transfer of DNA
bacteria: one with a rough colony type that was avirulent from one organism to another without the protection of a
and one with a smooth colony type that was virulent. conjugative bridge or a viral coat. Fifteen years later,
Griffith intended to use these strains to develop a protec- Oswald T. Avery, Colin MacLeod, and M.J. McCarty
tive vaccine (Fig. 1-21). He knew that the live smooth- identied the transforming material as DNA.45,46 They
type bacteria were lethal in mice, and the live rough-type prepared boiled virulent bacterial cell lysates and sequen-
35S 32P
(protein coat) (DNA)
Figure 1-20 Radioactive (green)

Host
protein does not enter the host cell
cell
during transduction (left). Radioactive
DNA, however, does enter (right) and
is passed to subsequent generations
of viruses.

Rough type (avirulent) Cell lysate
Mouse lives Transformation
Smooth type (virulent)

Mouse dies
+ proteinase Transformation
Heat-killed smooth type

Mouse lives
+ RNase Transformation
Heat-killed smooth type

plus rough type Mouse dies
Figure 1-21 The transforming factor discovered by Griffith

was responsible for changing the phenotype of the avirulent + DNase Transformation
rough type bacteria to that of the virulent smooth type.
Figure 1-22 Avery, MacLeod, and McCarty showed that

destruction of protein or RNA in the cell lysate did not affect
tially treated them with recently discovered enzymes
the transforming factor. Only destruction of DNA prevented
(Fig. 1-22). Protease and ribonuclease treatment, which transformation.
degraded protein and RNA, respectively, did not affect
the transformation phenomenon that Griffith had demon-
strated earlier. Treatment with deoxyribonuclease, which
degrades DNA, however, prevented transformation. They Plasmids
concluded that the transforming factor that Griffith
had rst proposed was DNA. The transduction experi- DNA helices can assume both linear and circular forms.
ment of Alfred Hershey and Martha Chase also con- Most bacterial chromosomes are in circular form.
rmed their ndings that DNA carried genetic traits. Chromosomes in higher organisms, such as fungi, plants,
and animals, are mostly linear. The ends of linear chro-
mosomes are protected by specialized structures called
telomeres. A cell can contain, in addition to its own chro-
mosome complement, extrachromosomal entities, or
Advanced Concepts plasmids (Fig. 1-23). Most plasmids are double-stranded
Investigators performing early transformation stud- circles, 2000100,000 bp (2100 kilobase pairs) in size.
ies observed the transfer of broken chromosomal Just as chromosomes do, plasmids carry genetic informa-
DNA from one population of bacterial cells to tion. Due to their size and effect on the host cell, plas-
another. Naked DNA transferred in this way, how- mids can carry only a limited amount of information. The
ever, is a very inefficient source for transformation. plasmid DNA duplex is compacted, or supercoiled.
Unprotected DNA is subject to physical shearing as Breaking one strand of the plasmid duplex, or nicking,
well as chemical degradation from naturally occur- will relax the supercoil (Fig. 1-24), whereas breaking
ring nucleases, especially on the broken ends of the both strands will linearize the plasmid. Different physical
DNA molecules. Natural transformations are much states of the plasmid DNA can be resolved by distinct
more efficient, because the transforming DNA is in migration characteristics during gel electrophoresis.
circular form. Plasmids were discovered to be the source of resistant
phenotypes in multidrug-resistant bacteria.47 The demon-

DNA Chapter 1 23
Circular plasmids fer factors (RTF), or R factors. R factors carry resistance

(several thousand Main circular chromosome to common antibiotics such as chloramphenicol, tetracy-
base pairs each) (4 million base pairs) cline, ampicillin, and streptomycin. Another class of
plasmid, colicinogenic factors, carries resistance to bac-
teriocins, toxic proteins manufactured by bacteria.
Plasmids can replicate in the host cell but cannot survive
outside of the cell as viruses do. The acquisition of the
resistance genes from host chromosomes of unknown
bacteria is the presumed origin of these resistance fac-
Antibiotic-resistance tors.49 Drug-resistance genes are commonly gained and
genes lost from episomes in a bacterial population. Simultane-
ous introduction of R factors into a single cell can result
in recombination between them, producing a new, recom-
Mobile binant plasmid with a new combination of resistance
plasmid
genes.
Plasmids were initially classied into two general
Genes necessary for types: large plasmids and small plasmids. Large plas-
DNA transfer
mids include the F factor and some of the R plasmids.
Figure 1-23 Plasmids are small extrachromosomal DNA Large plasmids carry genes for their own transfer and
duplexes that can carry genetic information. propagation and are self-transmissible. Large plasmids
occur in small numbers, one or two copies per chromo-
some equivalent. Small plasmids are more numerous in
stration that multiple drug resistance in bacteria can be the cell, about 20 copies per chromosomal equivalent;
eliminated by treatment with acridine dyes48 was the rst however, they do not carry genes directing their mainte-
indication of the episomal (plasmid) nature of the resist- nance. They rely on high numbers for distribution into
ance factor, similar to the F factor in conjugation. The daughter cells at cell division or uptake by host cells in
plasmids, which carry genes for inactivation or circum- transformation.
vention of antibiotic action, were called resistance trans- Compared with fragments of DNA, plasmids are more
efficient vehicles for the transfer of genes from one cell
to another. Upon cell lysis, supercoiled plasmids can
Locally denatured enter other cells more efficiently. Plasmids have been
base pairs used extensively in recombinant DNA technology to
introduce specic traits. By manipulation of the plasmid
DNA in vitro, specic genes can be introduced into cells
Gyrase + ATP
Advanced Concepts
Topoisomerase
The circular nature of R factors was demonstrated by
buoyant density centrifugation.50 Plasmid DNA has
a density higher than that of the host chromosome
and can be isolated from separate, or satellite, bands
in the gradient. Examination of the fractions of the
higher density DNA revealed small circular species.
Relaxed circle Supercoiled DNA These circles were absent from drug-sensitive
Figure 1-24 Supercoiled plasmids can be relaxed by nick- bacteria.
ing (left) or by local unwinding of the double helix (right).

a. How many HpaII sites are present in this

Advanced Concepts plasmid?
b. What are the distances between each site?
Plasmids are found not only in bacteria but in mul- c. What is the size of the plasmid?
ticellular plants and animals as well. Some viruses, d. Draw a picture of the plasmid with the Hpa
such as the single-stranded DNA virus M13, have a II sites.
transient plasmid phase in their life cycle. A second cut of the plasmid with BamH1 yields two
Laboratory techniques requiring single-stranded pieces, 80 and x bp.
versions of specic DNA sequences have been e. How many BamH1 sites are in the plasmid?
based on the manipulation of the plasmid (duplex f. What is x in base pairs (bp)?
circle) phase of these viruses and isolation of the
single-stranded recombinant single-stranded circles 2. How would you determine where the BamH1 sites are
from the virus. This technology was used in meth- in relation to the HpaII sites?
ods devised to determine the order or sequence of
nucleotides in the DNA chain. 3. The plasmid has one EcoR1 site into which you want
to clone a blunt-ended fragment. What type of enzyme
could turn an EcoR1 sticky end into a blunt end?
to produce new phenotypes or recombinant organisms. Recombination and DNA Transfer

The ability to express genetic traits from plasmids makes
1. Compare how DNA moves from cell to cell by a) con-
it possible to manipulate phenotype in specic ways. As
jugation, b) transduction, and c) transformation.
will be described in later chapters, plasmids play a key
role in the development of procedures used in molecular
analysis.
References
1. Watson J. Molecular Biology of the Gene: New
York: W.A. Benjamin, Inc., 1965.
2. Mirsky AE. The discovery of DNA. Scientic
American 1968;218(6):78.
STUDY QUESTIONS
3. Crick F, Watson J. DNA structure. Nature
1953;171:737.
DNA Structure and Function
4. Watson J, Hopkins N, Roberts J, et al. The Molecular
1. What is the function of DNA in the cell? Biology of the Gene, 4th ed. Redwood City, CA:
Benjamin/Cummings, 1987.
2. Compare the structure of the nitrogen bases. How do
5. Eschenmoser A. Chemical etiology of nucleic acid
purines and pyrimidines differ?
structure. Science 1999;284:211824.
3. Write the complementary sequence to the following: 6. Egholm M, Buchardt O, Christensen L, et al. PNA
5AGGTCACGTCTAGCTAGCTAGA3 hybridizes to complementary oligonucleotides obey-
ing the Watson-Crick hydrogen-binding rules. Nature
4. Which of the ribose carbons participate in the phos-
1993;365:566658.
phodiester bond?
7. Demidev VV, Yavnilovich MV, Belotserkovskii
5. Which of the ribose carbons carries the nitrogen base? BP, et al. Kinetics and mechanism of polyamide
(peptide) nucleic acid binding to duplex DNA.
6. Why does DNA polymerase require a primer?
Proceedings of the National Academy of Sciences
1995;92:263741.
Restriction Enzyme Analysis
8. Ray A, Norden B. Peptide nucleic acid (PNA):
1. A plasmid was digested with the enzyme, HpaII. On Its medical and biotechnical applications and prom-
agarose gel electrophoresis, you observe three bands, ise for the future. FASEB Journal 2000;14 (9):
100, 230, and 500 bp. 104160.

DNA Chapter 1 25
9. Dean D. Peptide nucleic acids: Versatile tools for cleotide templates. Proceedings of the National
gene therapy strategies. Advanced Drug Delivery Academy of Sciences 1970;67(1):6873.
Reviews 2000;44(2-3):8195. 23. Lehman IR. The Enzymes, vol. 4. New York:
10. Chargaff E. Chemical specicity of nucleic acids Academic Press, 1971.
and mechanisms of their enzymatic degradation. 24. Berk AJ, Sharp PA. Sizing and mapping of early
Experimentia 1950;6:2019. adenovirus mRNAs by gel electrophoresis of S1
11. Meselson M, Stahl FW. The replication of DNA in endonuclease-digested hybrids. Cell 1977;12(3):
Escherichia coli. Proceedings of the National 72132.
Academy of Sciences 1958;44:67182. 25. Kornberg RD. Structure of chromatin. Annual
12. Okazaki R, Okazaki T, Sakabe K, et al. In vivo Review of Biochemistry 1977;46:93154.
mechanism of DNA chain growth. Cold Spring 26. Wang J. Interaction between DNA and an
Harbor Symposium on Quantitative Biology Escherichia coli protein omega. Journal of
1968;33:12944. Molecular Biology 1971;55(3):52333.
13. Kornberg A. The synthesis of DNA. Scientic 27. Gellert M, Mizuuchi K, ODea MH, et al. DNA
American 1968. gyrase: An enzyme that introduces superhelical
14. Dervyn E, Suski C, Daniel R, et al. Two essential turns into DNA. Proceedings of the National
DNA polymerases at the bacterial replication fork. Academy of Sciences 1976;73(11):387276.
Science 2001;294:171619. 28. Matzke MA, Matzke AJM, Pruss G, et al. RNA-
15. Schachman HK, Adler J, Radding CM, et al. based silencing strategies in plants. Current
Enzymatic synthesis of deoxyribonucleic acid. VII. Opinions in Genetic Development 2001;11
Synthesis of a polymer of deoxyadenylate and (2):22127.
deoxythymidylate. Journal of Biological Chemistry 29. Vance V, Vaucheret H. RNA silencing in plants:
1960;235:324249. Defense and counterdefense. Science 2001;292
16. Ito J, Braithwaite DK. Compilation and alignment (5525):227780.
of DNA polymerase sequences. Nucleic Acids 30. Cogoni C, Macino G. Post-transcriptional gene
Research 1991;19(15):404557. silencing across kingdoms. Current Opinions in
17. Braithwaite DK, Ito J. Complication, alignment, Genetic Development 2000;10(6):63843.
and phylogenetic relationships of DNA poly- 31. Plasterk R, Ketting R. The silence of the genes.
merases. Nucleic Acids Research 1993;21: Current Opinions in Genetic Development 2000;
787802. 10(5):56267.
18. Wang Z, Castano IB, De Las Penas A, et al. Pol K: 32. Reik W, Dean W, Walter J. Epigenetic reprogram-
A DNA polymerase required for sister chromatid ming in mammalian development. Science 2001;
cohesion. Science 2000;289:77479. 293:108993.
19. Hamilton SC, Farchaus JW, Davis MC. DNA 33. Esteller M, Corn PG, Baylin SB, et al. A gene
polymerases as engines for biotechnology. hypermethylation prole of human cancer. Cancer
BioTechniques 2001;31(2):37083. Research 2001;61:322529.
20. Lehman IR. DNA ligase: Structure, mechanism, 34. Jones P, Takai D. The role of DNA methylation
and function. Science 1974;186(4166):79097. in mammalian epigenetics. Science 2001;293:
21. Sgaramella V, Van de Sande JH, Khorana HG. 106870.
Studies on polynucleotides, C: A novel joining 35. Kang Y, Koo DB, Park JS, et al. Aberrant methyla-
reaction catalyzed by the T4-polynucleotide ligase. tion of donor genome in cloned bovine embryos.
Proceedings of the National Academy of Sciences Nature Genetics 2001;28(2):17377.
1971;67(3):146875. 36. Bestor T, Laudano A, Mattaliano R, et al. CpG
22. Kleppe K, Van de Sande JH, Khorana HG. Poly- islands in vertebrate genomes. Journal of Molecular
nucleotide ligasecatalyzed joining of deoxyribo- Biology 1987;196(2):26182.
oligonucleotides on ribopolynucleotide templates 37. Okano M, Xie S, Li E. Cloning and characteriza-
and of ribo-oligonucleotides on deoxyribopolynu- tion of a family of novel mammalian DNA (cyto-

sine-5) methyltransferases. Nature Genetics formation of pneumococcal types. I. Induction of

1998;19(3):21920. transformation by a DNA fraction isolated from
38. Mendel G . Versuche ber Panzen-Hybriden pneumococcal type III. Journal of Experimental
(1865), In Peters JA, ed. Classic papers in genetics. Medicine 1944;79:13758.
vol. iv. Englewood Cliffs, NJ: Prentice-Hall:1959. 46. Hotchkiss RD: The genetic chemistry of the pneu-
39. Beadle GW. Genes and the chemistry of organism. mococcal transformations The Harvey Lectures
American Scientist 1946;34:3153. 1955;49:12444.
40. Lederberg J, Tatum, EL. Sex in bacteria: Genetic 47. Clowes R. The molecule of infectious drug resist-
studies, 19451952. Science 1953;118(3059): ance. Scientic American 1973;228(4): 1927.
16975. 48. Watanabe T, Fukasawa T. Episome-mediated
41. Jacob F, Wollman E. Viruses and genes. Scientic transfer of drug resistance in Enterobacteri-
American 1961. aceae. II. Elimination of resistance factors
42. Hershey AD, Chase M. Independent function of with acridine dyes. Journal of Bacteriology
viral protein and nucleic acid in growth of bacterio- 1961;81:67983.
phage. Journal of General Physiology 1952;26: 49. Watanabe T. Episome-mediated transfer of drug
3656. resistance in Enterobacteriaceae. VI. High fre-
43. Benzer S. The ne structure of the gene. Scientic quency resistance transfer system in E. coli.
American 1962;206(1):7084. Journal of Bacteriology 1963;85:78894.
44. Griffith F. Signicance of pneumococcal types. 50. Moller JK, Bak AL, Christiansen G, et al.
Journal of Hygiene 1928;27:11359. Extrachromosomal DNA in R factor harboring
45. Avery O, MacLeod CM, McCarty M. Studies on Enterobacteriaceae. Journal of Bacteriology
the chemical nature of the substance-inducing trans- 1976;125:398403.
RNA
OUTLINE OBJECTIVES
TRANSCRIPTION Compare and contrast the structure of RNA
TYPES/STRUCTURES with that of DNA.
Ribosomal RNA List and compare the different types of RNA.
Messenger RNA
Small Nuclear RNA Describe the cellular processing of messenger RNA.
Small Interfering RNA List several types of RNA polymerases, their substrates
Transfer RNA and products.
Micro RNAs
Other Small RNAs Recognize the reactions catalyzed by ribonucleases and
RNA helicases and their roles in RNA metabolism.
RNA POLYMERASES
OTHER RNA-METABOLIZING ENZYMES Describe how ribonucleotides are polymerized into RNA
Ribonucleases (transcription) and the relation of the sequence of the
RNA Helicases RNA transcript to the DNA sequence of its gene.
REGULATION OF TRANSCRIPTION Describe gene regulation using the Lac operon as
Epigenetics an example.
Dene epigenetics and list examples of epigenetic
phenomena.
27

O O
C C
H3C C NH HC NH
OR OR
O P O HC C O O P O HC C O
N N
O O O O
H2C CH CH H2C CH CH
Figure 2-1 Uracil (U), the nucleotide
HC CH2 HC CH
base that replaces thymine in RNA, has
OH OH OH the purine ring structure of thymine (dT)
minus the methyl group. Uracil forms
dT U hydrogen bonds with adenine.
Ribonucleic acid (RNA) is a polymer of nucleotides sim- Transcription

ilar to DNA. It differs from DNA in the sugar moieties,
having ribose instead of deoxyribose and, in one nitrogen DNA can only store information. In order for this infor-
base component, having uracil instead of thymine mation to be utilized, it must be transcribed and then
(thymine is 5-methyl uracil; Fig. 2-1). Furthermore, RNA translated into protein, a process called gene expression.
is synthesized as a single strand rather than as a double A specic type of RNA, messenger RNA (mRNA), car-
helix. Although RNA strands do not have complementary ries the information in DNA to the ribosomes where it is
partner strands, they are not completely single-stranded. translated into protein.
Through internal homologies, RNA species fold and loop Transcription is the copying of one strand of DNA
upon themselves to take on as much of a double-stranded into RNA by a process similar to that of DNA replication.
character as possible. RNA can also pair with comple- This activity occurs mostly in interphase nuclei.
mentary single strands of DNA or RNA and form a dou- Evidence1 suggests that transcription takes place at dis-
ble helix. creet stations of the nucleus into which the DNA mole-
There are several types of RNAs found in the cell. cules move. One of these sites, the nucleolus, is the
Ribosomal RNA, messenger RNA, transfer RNA, and location of ribosomal RNA synthesis.
small nuclear RNAs have distinct cellular functions. The polymerization of RNA from a DNA template is
RNA is copied, or transcribed, from DNA. catalyzed by RNA polymerase. After binding to its start
site in DNA, a specic sequence of bases called the pro-
moter, RNA polymerase and its supporting accessory
proteins synthesize RNA using the base sequence of one
Advanced Concepts strand of the double helix (the antisense strand) as a
Evolutionary theory places RNA as the original

genetic material from which DNA has evolved. In
most organisms, RNA is an intermediate between
the storage system of DNA and the proteins respon-
Advanced Concepts
sible for phenotype. One family of RNA viruses, the DNA must be released locally from histones and the
retroviruses, which include leukemia viruses and helix unwound in order for transcription to occur.
the human immunodeciency virus, have RNA These processes involve the participation of numer-
genomes and, in order to replicate using host cell ous factors, including DNA binding proteins, tran-
machinery, must rst make a DNA copy of their scription factors, histone modication enzymes, and
genome by reverse transcription. RNA polymerase.

RNA Chapter 2 29
(A)
RNA
mRNA polymerase
DNA 3 5
5 3
Direction of transcription
(B)
mRNA
RNA
A C G
U G polymerase
5 C
U
G DNA template
A 5
A
G T G A C A A G T A C C G T A G C T A
A C U G U U C A U G G C A U C
T T
3 3
DNA A
5 A
C A C T G T T C A T G G C A T C G
DNA complement of template

Figure 2-2 RNA polymerase uses one strand of the double helix (the antisense strand) as a template
for synthesis of RNA. About 10 base pairs of DNA are unwound or opened to allow the polymerase to
work.
guide (Fig. 2-2). The sense strand of the DNA template There is no consensus sequence in DNA that species
has a sequence identical to that of the RNA product termination of transcription. This might be explained by
(except for the U for T substitution in RNA), but it does recent descriptions of termination by specic exonucle-
not serve as the template for the RNA. ase activity.2 As the polymerase proceeds past the polyA
Compared with sites of initiation of DNA replication, site, the nascent mRNA is released by an endonuclease
there are many more sites for initiation of transcription associated with the carboxy terminal end of the poly-
(RNA synthesis) in both prokaryotes and eukaryotes. merase. RNA synthesized beyond the site trails out of the
There are also many more molecules of RNA polymerase RNA polymerase and is bound by another exonuclease
than DNA polymerase in the cell. RNA polymerases that begins to degrade the RNA 5 to 3 toward the RNA
work more slowly than DNA polymerases (50100 polymerase. When the exonuclease catches up with the
bases/sec for RNA synthesis vs. 1000 bases/sec for DNA polymerase, transcription stops.
replication) and with less delity. Gene expression is the fundamental process for cell
Unlike DNA synthesis, RNA synthesis does not regulation, differentiation, and development. Signal
require a primer. Upon initiation of RNA synthesis, the transduction pathways that are the targets of several ther-
rst ribonucleoside triphosphate retains all of its phos- apeutic strategies funnel internal and external signals to
phate groups as the RNA is polymerized in the 5 to 3 the nucleus where transcription factors bind to specic
direction. Subsequent ribonucleoside triphosphates retain sequences in DNA and initiate or turn off transcription.
only the alpha phosphate, the one closest to the ribose
sugar. The other two phosphate groups are released as
orthophosphate during the synthesis reaction.
Types/Structures
RNA synthesis proceeds along the DNA template until There are several types of RNAs found in the cell. Ribo-
the polyadenylation signal is encountered. At this point somal RNA, mRNA, transfer RNA, and small nuclear
the process of termination of transcription is activated. RNAs have distinct cellular functions.

Prokaryotic ribosome Eukaryotic ribosome
Large subunit Large subunit

23S rRNA 28S rRNA
5S rRNA 5S rRNA
50S 5.8S rRNA 60S
L1L31
L1L50
70S 80S
Small subunit
16S rRNA Small subunit
18S rRNA
30S
40S
S1S21
S1S32
Figure 2-3 Prokaryote and eukaryote ribosomal subunits are of similar structure but different size.
Ribosomal RNAs (left) are assembled with 52 or 82 ribosomal proteins (center) to make the subunits
that will form the complete ribosome in association with mRNA.
Ribosomal RNA mosome. In prokaryotes, mRNA is synthesized even as it

is being translated into protein. Prokaryotic mRNA is
The largest component of cellular RNA is ribosomal sometimes polycistronic; that is, coding for more than
RNA (rRNA), comprising 80%-90% of the total cellular one protein on the same mRNA. Eukaryotic mRNA, in
RNA. The various types of ribosomal RNAs are named contrast, is monocistronic, having only one protein per
for their sedimentation coefficient (S) in density gradi- mRNA. Eukaryotes can, however, produce different pro-
ent centrifugation.3 rRNA is an important structural and teins from the same DNA sequences by starting the RNA
functional part of the ribosomes, cellular organelles synthesis in different places or by processing the mRNA
where proteins are synthesized (Fig. 2-3). differently. In eukaryotes, copying of RNA from DNA
In prokaryotes, there are three rRNA species, the 16S and protein synthesis from the RNA are separated by the
found in the ribosome small subunit, and the 23S and 5S, nuclear membrane barrier. Eukaryotic mRNA undergoes
found in the ribosome large subunit, all synthesized from a series of post-transcriptional processing events
the same gene. In eukaryotes, rRNA is synthesized from before it is translated into protein (Fig. 2-4).
highly repeated gene clusters. Eukaryotic rRNA is copied
from DNA as a single 45S precursor RNA (preribosomal
RNA) that is subsequently processed into 18S of the ribo-
some small subunit and 5.8S and 28S species of the large
subunit. Another rRNA species, 5S, found in the large Advanced Concepts
ribosome subunit in eukaryotes, is synthesized separately.
The secondary structure of rRNA is important for
the integrity and function of the ribosome. Not only
Messenger RNA
is it important for ribosomal structure, it is also
Messenger RNA (mRNA) is the initial connection be- involved in the correct positioning of the ribosome
tween the information stored in DNA and the translation on the mRNA and with the transfer RNA during
apparatus that will ultimately produce the protein prod- protein synthesis.50, 51
ucts responsible for the phenotype dictated by the chro-

RNA Chapter 2 31
Promoter Exon 1 Intron 1 Exon 2 Intron 2 Exon 3

5 3
3 5
DNA
Transcription
Pre-mRNA 5 3
Figure 2-4 DNA (top) and heteronuclear
Processing
RNA (middle) contain intervening (intron) and
expressed (exon) sequences. The introns are
removed and the mature RNA is capped and mRNA 7 Me G AAAAA
polyadenylated during processing (bottom). 5 3
The amount of a particular mRNA in a cell is related

to the requirement for its nal product. Some messages
are transcribed constantly and are relatively abundant Historical Highlights
in the cell (constitutive transcription), whereas others A DNA copy (complementary DNA, copy DNA
are transcribed only at certain times during the cell cycle [cDNA]) of mature mRNA can be made by reverse
or under particular conditions (inducible, or regula- transcription of mRNA (synthesis of DNA from
tory, transcription). Even the most abundantly trans- the mRNA template). Compared with the original
cribed mRNAs are much less plentiful in the cell than gene on the chromosome, the cDNA version of
rRNA. eukaryotic genes is smaller than the chromosomal
version. Restriction enzyme mapping can be used
Messenger RNA Processing
to conrm that this is not due to premature termina-
Polyadenylation tion of the genomic transcript. The entire functional
Study of mRNA in eukaryotes was facilitated by the gene is present in the shorter sequence because
discovery that most messengers carry a sequence of cDNA versions of eukaryotic genes can be
polyadenylic acid at the 3 terminus, the poly(A) tail. expressed (transcribed and translated) into complete
The run of adenines was rst discovered by hydrogen proteins.8 The larger chromosomal version of the
bonding of mRNA to polydeoxythymine on poly(dT) cel- gene must, therefore, have extra sequences, and
lulose.4 Polyuridine or polythymine residues covalently these sequences must be inserted between the
attached to cellulose or sepharose substrates are often protein coding sequences. Direct location and size
used to specically isolate mRNA in the laboratory. of these intervening sequences were rst demon-
The poly(A) tail is not coded in genomic DNA. It is strated by electron microscopy of hybrids between
added to the RNA after synthesis of the pre-mRNA. A mRNA and cDNA69 using the method of R loop
protein complex recognizes the RNA sequence, mapping developed by White and Hogness.70 In
AAUAAA, and cleaves the RNA chain 1130 bases 3 to these experiments, mRNA and duplex genomic
that site. The enzyme that cuts pre-mRNA in advance of DNA were incubated together at elevated tempera-
polyadenylation has not been identied. Recent studies tures in a high concentration of formamide. Under
suggest that a component of the protein complex related these conditions, the more stable RNA-DNA
to the system that is responsible for removing the 3 hybrids are favored over the DNA duplexes. The
extension from pre-transfer RNAs may also be involved resulting structures released loops of unpaired DNA
in generation of the 3 ends on mRNA.5,6 The enzyme (introns) that could be measured. The DNA
polyadenylate polymerase is responsible for adding the duplexed with RNA corresponded to the coding
adenines to the end of the transcript. A run of up to 200 sequences (exons).
nucleotides of poly(A) is typically found on mRNA in
mammalian cells.


About 30% of the mRNAs, notably histone mRNAs, Caps are present on all eukaryotic mRNA bound for
are not polyadenylated.52 The function of the translation, except for some mRNA transcribed from
poly(A) tail, or functional differences between mitochondrial DNA. Capping occurs after initiation
poly(A) and poly(A)- mRNA, is not clear. The of transcription, catalyzed by the enzyme guany-
polyA tail may be involved in movement of the lyl transferase. This enzyme links a guanosine
mRNA from the nucleus to the cytoplasm, associa- monophosphate provided by guanosine triphosphate
tion with other cell components, maintenance of sec- to the 5 phosphate terminus of the RNA with the
ondary structure, or proper stability of the message. release of pyrophosphate. In some viruses, guano-
sine diphosphate provides the guanidine residue,
and monophosphate is released. Caps of mRNA are
recognized by ribosomes just before translation.53
Capping
Eukaryotic mRNA is blocked at the 5 terminus by an
unusual 5-5 pyrophosphate bridge to a methylated
guanosine.7 The structure is called a cap. The cap is a
5-5 pyrophosphate linkage of 7-methyl guanosine to
either 2 O-methyl guanine or 2 O-methyl adenine of the
Advanced Concepts
mRNA, There are four types of introns, group I, group II,
7-methylG5ppp 5 G or A 2O-methyl pNpNpNp
nuclear, and tRNA, depending on the mechanism
where p represents a phosphate group, N represents of their removal from hnRNA. Group I introns are
any nucleotide. found in nuclear, mitochondrial, and chloroplast
The cap confers a protective function as well as serves genes. Group II introns are found in mitochondrial
as a recognition signal for the translational apparatus. and chloroplast genes. Group I introns require a
Caps differ with respect to the methylation of the end guanosine triphosphate molecule to make a nucle-
nucleotide of the mRNA. In some cases, 2O-methylation ophilic attack on the 5 phosphate of the 5 end of
occurs not only on the rst but also on the second the intron. This leaves a 3 OH at the end of the 5
nucleotide from the cap. Other caps methylate the rst exon (splice donor site), which attacks the 5 end of
three nucleotides of the RNA molecule. the next exon (splice acceptor site), forming a new
phosphodiester bond and releasing the intervening
Splicing sequence. Group II introns are removed in a similar
Prokaryotic structural genes contain uninterrupted reaction initiated by the 2 OH of an adenosine
lengths of open reading frame, sequences that code for within the intron attacking the 5 phosphate at the
amino acids. In contrast, eukaryotic coding regions are splice donor site. When the 3 OH of the splice
interrupted with long stretches of noncoding DNA donor site bonds with the splice acceptor site of the
sequences called introns. Newly transcribed mRNA, het- next exon, the intervening sequence is released as a
eronuclear RNA (hnRNA), is much larger than mature lariat structure (see Fig. 2-4). This lariat contains an
mRNA because it still contains the intervening sequences. unusual 2, 3, and 5 triply-linked nucleotide, the
Labeling studies demonstrated that the hnRNA is capped presence of which proved the mechanism. Removal
and tailed and that these modications survive the transi- of nuclear introns occurs by the same transesteri-
tion from hnRNA to mRNA, which is simply a process of cation mechanism, except this reaction is catalyzed
removing the intervening sequences from the hnRNA. by specialized RNA-protein complexes (small
Introns are removed from hnRNA by splicing (Fig. nucleoprotein particles). These complexes contain
2-5). The remaining sequences that code for the protein the small nuclear RNAs U1, U2, U4, U5, and U6.
product are exons.

RNA Chapter 2 33
Exon Intron Exon

5 AG GUAAGU UAUAC NCAG G 3
U G A AU G GA 5
UAUAC NCAG G 3
UG
A 5 AG 3
Figure 2-5 RNA splicing at the 5 splice site (AGGUAAGU), A
branch (UAUAC), and 3 splice site (NCAGG) consensus U
sequences. The intron (light gray) is removed through a trans- G
esterication reaction involving a guanine nucleotide UAUAC N C A G 3 5 G 3
of the 5 site and an adenine in the branch sequence. Discarded intron
The product of this reaction is the discarded intron in a
lariat structure. Another transesterication reaction connects
the exons. 5 AG G 3
Although removal of all nuclear introns requires pro- The branch point sequence YNCURAC is variable in
tein catalysts, some introns are removed without the par- mammals but almost invariant in the yeast Saccharomyces
ticipation of protein factors in a self-splicing reaction. cervisiae (UACUAAC).
The discovery of self-splicing was the rst demonstration Splicing may be important for timing of translation of
that RNA could act as an enzyme. mRNA in the cytoplasm, although it is not necessarily
Inspection of splice junctions from several organisms required as cloned genes synthesized in vitro without
and genes has demonstrated the following consensus introns are expressed in eukaryotic cells. Introns may have
sequences for the donor and acceptor splice junctions of evolved as a means of increasing recombination frequency
group I, II, and nuclear introns8: within genes as well as between genes.8 The discontinu-
A G // G U A A G U (intron) YNCURAC YN N C A G // G ous nature of eukaryotic genes may also protect the cod-
splice branch point splice ing regions from genetic damage by toxins or radiation.
donor site sequence acceptor site Alternative splicing can modify products of genes by
alternate insertion of different exons. For example, the
production of calcitonin in the thyroid or calcitonin gene-
related peptide in the brain depends on the exons included
in the mature mRNA in these tissues.9 Alternative splic-
Advanced Concepts ing has been found in about 40 different genes.
The splicing of transfer RNA (tRNA) transcripts Abnormalities in the splicing process are responsible
involves breakage and reunion of the RNA chain. for several disease states. Some -thalassemias result
Endonucleases cleave the tRNA precisely at the from mutations in splice recognition sequences of the -
intron ends. The resulting tRNA ends, a 2, 3 cyclic globin genes. Certain autoimmune conditions result from
phosphate and a 5 OH, are then ligated in a com- production of antibodies to RNA protein complexes.
plex reaction that requires ATP, followed by further Auto-antibodies against U1 RNA, one of the small
base modication in some tRNAs. nuclear RNAs required for splicing, are associated with
systemic lupus erythematosus.

Small Nuclear RNA Small Interfering RNA

Another type of cellular RNA is the small nuclear RNA Small interfering RNAs (siRNA) are the functional
(snRNA), which functions in splicing (removal of introns intermediates of RNA interference (RNAi, discussed
from freshly transcribed RNA) in eukaryotes. Small later in this chapter), a defense in eukaryotic cells against
nuclear RNA stays in the nucleus after its transcription viral invasion. In a process that is not yet completely
by RNA polymerase I or III. Small nuclear RNAs from understood, double-stranded RNA (dsRNA) species are
eukaryotic cells sediment in a range of 6-8S. Small believed to originate from transcription of inverted repeats
nuclear RNAs isolated from hepatoma and cervical car- or by the activity of cellular or viral RNA-directed RNA
cinoma cell lines are summarized in Table 2.1. polymerases.13 Biochemical analysis of RNA interference
Small nuclear RNAs serve mostly a structural role has revealed that these 2122 nucleotide dsRNAs, also
in the processing of mRNA. Several of a family of pro- called small intermediate RNAs, are derived from suc-
teins (Sm proteins) assemble into a (60A by 30-40A) cessive cleavage of dsRNAs 500 or more nucleotide base
doughnut-shaped complex that interacts with the U-rich pairs in length.14 The ribonuclease III enzyme, dicer, is
regions of poly (U) RNAs.10,11 responsible for the generation of siRNA and another small
U1 RNA is complementary to sequences at the splice RNA, micro RNA (see below), from dsRNA precursors.15
donor site, and its binding distinguishes the sequence GU
in the splice site from other GU sequences in the RNA.
Transfer RNA
U2 RNA recognizes the splice acceptor site. In lower
eukaryotes, another protein, splicing factor 1,12 binds to Translation of information from nucleic acid to protein
the branch point sequence, initiating further protein requires reading of the mRNA by ribosomes, using adap-
assembly and association of U4, U5, and U6, with the tor molecules or transfer RNA (tRNA). Transfer RNAs
looped RNA forming a complex called the splicesosome are relatively short single-stranded polynucleotides of
in which the transesterication reaction linking the exons 7393 bases in length, MW 2431,000. There is at least
together takes place. one tRNA for each amino acid.
Table 2.1 Small Nuclear RNA Isolated From

HeLa Cervical Carcinoma and
Advanced Concepts
Novikoff Hepatoma Cells8 The rst demonstration of directed RNAi in the lab-
Species Approximate oratory occurred in the experiments of Fire et al.
Species (HeLa) (Novikoff) Length (Bases) with C. elegans.45 These investigators injected
dsRNA into worms and observed dramatic inhibition
SnA U5 180
of the genes that generated the RNA. Since then,
SnB 210
siRNAs have been introduced into plants and ani-
SnC U2 196
mals, including human cells growing in culture.
SnD U1B 171
Injection of long dsRNA kills human cells, but gene
SnE/ScE (5.8S rRNA) 5.8S
silencing can be achieved by introduction of the
SnF U1A 125
siRNAs or plasmids coding for the dsRNA. Libraries
SnG/ScG (5S rRNA) 5S I and II
of siRNAs or DNA plasmids encoding them have
SnG 5S III 120
been made that are complementary to over 8000 of
SnH 4.5S I, II and III 96
the approximately 35,000 human genes.54 These
SnI (tRNA)
genetic tools have potential applications not only in
SnK 260
identifying genes involved in disease but also as
SnP 130
treatment for some of these diseases, particularly
ScL (viral 7S) 260
cancer where overexpression or abnormal expression
ScM 180
of specic genes is part of the tumor phenotype.55,56
ScD 180

RNA Chapter 2 35

Mitochondria contain distinct, somewhat smaller The tRNA genes contain 1420 extra nucleotides in
tRNAs.57 the sequences coding for the anticodon loop that are
transcribed into the tRNA. Enzymes that recognize
other tRNA modications remove these sequences
(introns) by a cleavage-ligation process. Intron
Eight or more of the nucleotide bases in all tRNAs removal, addition of CCA to the 3 end, and nucleo-
are modied, usually methylated, after the tRNA synthe- tide modications all occur following tRNA tran-
sis. Most tRNAs have a guanylic residue at the 5 end scription. Enzymatic activities responsible for intron
and the sequence C-C-A at the 3 end. With maximum removal and addition of CCA may also contribute to
intrastrand hybridization, tRNAs take on a cruciform intron removal and polyA addition to mRNA.
structure of double-stranded stems and single-stranded
loops (Fig. 2-6). Transfer RNAs with longer sequences
have an additional loop. The sequence C-C-A is found at
the 3 acceptor end of the tRNA. This is where the amino tional level of hydrogen bonding between the D loop
acid will be covalently attached to the tRNA. A seven- and the TC loop to form a -shaped structure (see
base loop (the TC loop, where stands for the modi- Fig. 2-6).
ed nucleotide pseudouridine) contains the sequence
5-TCG-3. The variable loop is larger in longer
Micro RNAs
tRNAs. Another seven-base loop (the anticodon loop)
contains the three-base pair anticodon that is comple- Micro RNAs (miRNA) are tiny regulatory RNAs, 21-25
mentary to the mRNA codon of its cognate amino acid. nt in length, derived from endogenous RNA hairpin
An 8-12base loop (D loop) is relatively rich in dihy- structures (RNA folded into double-stranded states
drouridine, another modied nucleotide. X-ray diffrac- through intrastrand hydrogen bonds). Micro RNAs were
tion studies of pure crystalline tRNA reveal that the discovered in the worm Caenorhabditis elegans. Two 22-
cruciform secondary structure of tRNA takes on an addi- nt RNAs were shown to contribute to temporal progres-
3 Amino acid
A O H
C CCA terminus
C C N2H
C Acceptor end
O R
5 A 3
G C 5
G C
G U Acceptor arm Acceptor arm
C G
G C
D loop U U TyCC loop TyCC loop
G C U
U A G G C C U A
D G A mG G
C U G C G
U C C G G T C
G C D stem
G D A G C G C mG D
2
C G A G D loop
G
U A
Anticodon stem Variable loop
Figure 2-6 Alanine tRNA is an C G
Anticodon loop C G
example of the general structure G
C
of tRNA, which is often depicted U
in a cruciform structure (left). The U m1
C Anticodon loop
inverted L (right) is more accurate G
of the structure formed by
Anticodon Anticodon
intrastrand hydrogen bonding.

Table 2.2 RNA Polymerases

Historical Highlights Enzyme Template Product
In 1964 Robert Holley and colleagues at Cornell
E. coli RNA polymerase II DNA mRNA
University solved the rst tRNA sequence. The
RNA polymerase I DNA rRNA
sequence was that of alanine tRNA of yeast.71 Yeast
RNA polymerase II DNA mRNA
tRNAala is 76 bases long; 10 of these bases are
RNA polymerase III DNA tRNA, snRNA
modied.
Mitochondrial RNA polymerase DNA mRNA
Mammalian DNA polymerase DNA primers
HCV RNA polymerase RNA Viral genome
Dengue virus RNA polymerase RNA Viral genome
sion of cell fates by triggering down regulation of target PolyA polymerase None PolyA tails
mRNAs.16-18 These RNA species were called small tem-
poral RNA (stRNA).
Like siRNAs, these evolutionarily conserved RNAs
are involved in control of gene expression. Unlike RNA Polymerases
siRNAs that destroy mRNA, miRNAs pair with partially
complementary sequences in mRNAs and inhibit transla- RNA synthesis is catalyzed by RNA polymerase
tion. So far, over 100 miRNAs have been identied in enzymes (Table 2.2). One multi-subunit prokaryotic
eukaryotic cells and viruses.19-22 Bacteria have genes that enzyme is responsible for the synthesis of all types of
resemble miRNA precursors; however, the full miRNA RNA in the prokaryotic cell. Eukaryotes have three dif-
system has not been demonstrated in bacteria. The true ferent RNA polymerase enzymes. DNA-dependent RNA
number of these RNAs may amount to thousands per polymerases require a DNA template. RNA-dependent
genome. RNA polymerases require an RNA template.
Micro RNAs perform diverse functions in eukaryotic In prokaryotes, all types of RNA are synthesized by a
cells affecting gene expression, cell development, and de- single RNA polymerase. Bacterial RNA polymerase con-
fense. Because production of miRNAs is strictly regulated sists of ve subunits, two and one of each , and 27
as to time or stage of cell development, nding them is a (Fig. 2-7).
technical challenge. Many of these species are only pres-
ent in virally infected cells or after introduction of foreign
nucleic acid by transformation.20 Novel approaches will
be required for discovery of rare miRNAs expressed in

specic cell types at specic times. Core enzyme (,2,,)
Other Small RNAs

Since the late 1990s a growing variety of small RNAs

(sRNA) have been described in prokaryotes and eukary- Holoenzyme (,2,,,)
otes, including tiny noncoding RNAs (tncRNA, 20-22
b),23 small modulatory RNA (smRNA, 21-23b),24 small
nucleolar RNAs (snoRNA),25 tmRNA26 and others. In
addition to RNA synthesis and processing, these mole- Rho termination factor ()
cules inuence numerous cellular processes, including
plasmid replication, bacteriophage development, chro- Figure 2-7 Prokaryotic RNA polymerase is made up of
separate proteins. The four subunits that make up the core
mosome structure, and development. These small enzyme have the capacity to synthesize RNA. The sigma
untranslated RNA molecules have been termed sRNAs in cofactor aids in accurate initiation of RNA synthesis. The
bacteria and noncoding RNAs (ncRNAs) in eukaryotes. rho cofactor aids in termination of RNA synthesis.

RNA Chapter 2 37
Table 2.3 Cellular Location and Activity of

RNA pol I, II, and III in Eukaryotes Advanced Concepts
Type Location Products -Amanitin The most well-studied eukaryotic RNA polymerase
I Nucleolus 18s, 5.8s, Insensitive II is from the yeast Saccharomyces cervisiae. It is a
28s rRNA 0.4 megadalton complex of 12 subunits. The yeast
II Nucleus mRNA, snRNA Inhibited enzyme works in conjunction with a large complex
III Nucleus tRNA, 5s rRNA Inhibited by high of proteins required for promoter recognition and
concentration melting, transcription initiation, elongation and ter-
mination, and transcript processing (splicing, cap-
ping, and polyadenylation).
Burgess et al.28 showed that the 2,, core enzyme
retained the catalytic activity of the 2,, complete,
or holoenzyme, suggesting that the sigma factor played The differential drug sensitivity, cellular location, and
no role in RNA elongation. In fact, the sigma factor is ionic requirements of the three eukaryotic RNA poly-
released at RNA initiation. The role of sigma factor is to merases were used to assign the polymerases to the type
guide the complete enzyme to the proper site of initiation of RNA they synthesize. Pol I synthesizes rRNA (except
on the DNA. 5S rRNA). Pol II synthesizes mRNAs and snRNAs. Pol
In eukaryotes, there are three multisubunit nuclear III synthesizes tRNAs, 5S rRNA, and some snRNAs. Pol
DNA-dependent RNA polymerases, RNA polymerase I, II (also called RNA polymerase b [Rpb]) is the central
II, and III (Table 2.3). A single subunit mitochondrial transcribing enzyme of mRNA in eukaryotes.
RNA polymerase, imported to organelles, is also encoded RNA viruses carry their own RNA-dependent RNA
in the nucleus. The three RNA polymerases in eukaryotic polymerases. Hepatitis C virus and Dengue virus carry
cells were rst distinguished by their locations in the this type of polymerase to replicate their RNA genomes.
cell. RNA polymerase I (pol I) is found in the nucleolus. RNA-dependent RNA polymerase activity has also been
RNA polymerase II (pol II) is found in the nucleus. found in lower eukaryotes.29 The purpose of these
RNA polymerase III (pol III), one of the rst nucleic enzymes in cells may be associated with RNAi and gene
acid polymerases discovered, is also found in the nucleus silencing.
(and sometimes the cytoplasm). PolyA polymerase is a template-independent RNA
polymerase. This enzyme adds adenine nucleotides to the
3 end of mRNA.30 The resulting polyA tail is important
for mRNA stability and translation into protein (see
Advanced Concepts below).
The three polymerases were also distinguished
by their differential sensitivity to the toxin - Other RNA-Metabolizing
amanitin.58-60 This toxin is a bicyclic octapeptide Enzymes
isolated from the poisonous mushroom Amanita
Ribonucleases
phalloides. Pol II is sensitive to relatively low
amounts of this toxin. Pol III is sensitive to inter- Ribonucleases degrade RNA in a manner similar to the
mediate levels, and pol I is resistant. This toxin degradation of DNA by deoxyribonucleases (Table 2.4).
has been invaluable in the research setting to deter- An endoribonuclease, cleavage and polyadenylation spe-
mine which polymerase activity is responsible for cic factor (CPSF) is required for proper termination of
synthesis of newly discovered types of RNA and RNA synthesis.32,33 Along with RNA polymerase II sub-
to dissect the biochemical properties of the poly- units and other proteins, this enzyme cuts the nascent
merases.61-63 RNA transcript before addition of the polyA tail by
polyA polymerase.


With advances in crystallography, the molecular There are two major groups of RNA helicases
mechanisms of RNA synthesis are being revealed. dened by the amino acid sequence of their con-
During transcription, DNA enters a positively served regions. DEAD-box helicases (asp-glu-ala-
charged cleft between the two largest subunits of the asp) are typied by the yeast translation initiation
RNA polymerase. At the oor of the cleft is the factor e1F4A, which unwinds messenger RNA at
active site of the enzyme to which nucleotides are the 5 untranslated end for proper binding of the
funneled through a pore in the cleft beneath the small ribosomal subunit. DEAD-box proteins are
active site (pore 1). In the active site, the DNA not strong helicases and may be referred to as
strands are separated, and the RNA chain is elon- unwindases or RNA chaparones.66 The DEAH-
gated driven by cleavage of phosphates from each box helicases (asp-glu-ala-his) (DExDH-box heli-
incoming ribonucleoside triphosphate. The resulting cases) resemble DNA helicases. They act on mRNA
DNA-RNA hybrid moves out of the active site and snRNA during splicing. They may also be
nearly perpendicular to the DNA coming into the required for ribosome biosynthesis. In addition to
cleft. After reaching a length of 10 bases, the newly RNA unwinding, protein dissociation, splicing, and
synthesized RNA dissociates from the hybrid and translation, RNA helicases also participate in RNA
leaves the complex through an exit channel. Three turnover and chromatin remodeling.
protein loops, rudder, lid, and zipper, are
involved in hybrid dissolution and exit of the RNA
product.64,65
Another activity of these enzymes is in the removal of
proteins from RNA-protein complexes.
RNA Helicases
RNA helicases catalyze the unwinding of double-
Regulation of Transcription
stranded RNA. RNA synthesis and processing require the Gene expression is a key determinant of phenotype. The
activity of helicases. These enzymes have been charac- sequences and factors controlling when and how much
terized in prokaryotic and eukaryotic organisms. Some protein is synthesized are equally as important as the
RNA helicases work exclusively on RNA. Others can DNA sequences encoding the amino acid makeup of a
work on DNA:RNA heteroduplexes and DNA substrates. protein. Early studies aimed at the characterization of
Table 2.4 RNases Used in Laboratory Procedures49

Enzyme Source Type Substrate
RNAse A Bovine Endoribonuclease Single-stranded RNA 3 to pyrimidine residues
RNAse T1 Aspergillus Endoribonuclease 3 Phosphate groups of guanines
RNAse H E. coli Exoribonuclease RNA hybridized to DNA
RNAse CL3 Gallus Endoribonuclease RNA next to cytidylic acid
Cereus RNAse Physarum Endoribonuclease Cytosine and uracil residues in RNA
RNAse Phy M Physarum Endoribonuclease Uracil, adenine, and guanine residues in RNA
RNAse U2 Ustilago Endoribonuclease 3 Phosphodiester bonds next to purines
RNAse T2 Aspergillus Endoribonuclease All phosphodiester bonds, preferably next to adenines
S1 nuclease Aspergillus Exoribonuclease RNA or single-stranded DNA
Mung bean nuclease Mung bean sprouts Exoribonuclease RNA or single-stranded DNA
RNAse Phy I Physarum Exoribonuclease Guanine, adenine, or uracil residues in RNA

RNA Chapter 2 39
gene structure were confounded by phenotypes that cis element

resulted from aberrations in gene expression rather than 5 3
in protein structural alterations. 3 5
Gene expression is tightly regulated throughout the life DNA
Trans
of a cell. Because gene products often function together factor
to bring about a specic cellular response, specic com-
binations of proteins in stoichiometric balance are crucial
for cell differentiation and development. Protein avail-
ability and function are controlled at the levels of tran-
scription, translation, and protein modication and 5 3
stability. The most immediate and well-studied level of 3 5
control of gene expression is transcription initiation. Figure 2-8 cis factors or cis elements (top) are DNA
Molecular technology has led to an extensive study of sequences recognized by transcription factors, or trans
factors, or DNA binding proteins (bottom).
transcription initiation, so a large amount of information
on gene expression refers to this level of transcription.
Two types of factors are responsible for regulation of
RNA synthesis: cis factors and trans factors (Fig. 2-8). such as bacteria and viruses, operons bring about coordi-
cis factors are DNA sequences that mark places on the nate expression of proteins required at the same time; for
DNA involved in the initiation and control of RNA syn- example, the enzymes of a metabolic pathway. The lac-
thesis. Trans factors are proteins that bind to the cis tose operon contains three structural genes, LacZ, LacY,
sequences and direct the assembly of transcription com- and LacA, which are all required for the metabolism of
plexes at the proper gene. In order for transcription to lactose. The LacZ gene product, -galactosidase,
occur, several proteins must assemble at the genes tran- hydrolyzes lactose into glucose and galactose. The LacY
scription initiation site including specic and general gene product, lactose permease, transports lactose into the
transcription factors and the RNA polymerase complex. cell. The LacA gene product, thiogalactoside transacety-
An operon is a series of structural genes transcribed lase, transacetylates galactosides. The LacI gene, which
together on one mRNA and subsequently separated into encodes a protein repressor and the repressors binding
individual proteins. In organisms with small genomes site in the DNA just 5 to the start of the operon, is respon-
sible for the regulated expression of the operon. When E.
coli is growing on glucose as a carbon source, the lactose-
metabolizing enzymes are not required, and this operon is
minimally expressed. Within 23 minutes after shifting
Historical Highlights the organism to a lactose-containing medium, the expres-
The production of particular proteins in media con- sion of these enzymes is increased a thousandfold.
taining specic substrates was observed early in the Fig. 2-9 shows a map of the lac operon. The three
last century, a phenomenon termed enzyme adapta- structural genes of the operon are preceded by the pro-
tion. It was later called induction, and detailed moter, where RNA polymerase binds to the DNA to start
analysis of the lactose operon was the rst descrip- transcription and the cis regulatory element, the opera-
tion of an inducible gene expression at the molecu- tor, where the regulatory repressor protein binds. The
lar level. The effect of gene expression on sequences coding for the repressor protein are located
phenotype was initially demonstrated by Monod just 5 to the operon. In the absence of lactose, the repres-
and Cozen-Bazire in 1953 when they showed that sor protein binds to the operator sequence and prevents
synthesis of tryptophane in Aerobacter was inhib- transcription of the operon. When lactose is present, it
ited by tryptophane.72 Jacob and Monod subse- binds to the repressor protein and changes its conforma-
quently introduced the concept of two types of tion and lowers its affinity to bind the operator sequence.
genes, structural and regulatory in an inducible sys- This results in expression of the operon (Fig. 2-10). Jacob
tem, the lactose operon in E. coli.73 and Monod deduced these details through analysis of a
series of mutants. Since their work, numerous regulatory

Regulator gene P O lacZ lacY lacA

5 3
3 5
DNA
Figure 2-9 General structure of the lac operon. The regulator or repressor gene codes for the
repressor protein trans factor that binds to the operator.
systems have been described in prokaryotes and eukary- Another mechanism of control in bacteria is attenua-
otes, all using the same basic idea of combinations of cis tion. This type of regulation works through formation of
and trans factors. stems and loops in the RNA transcript by intrastrand
Other operons are controlled in a similar manner by hydrogen bonding. These secondary structures allow or
the binding of regulatory trans factors to cis sequences prevent transcription, for instance by exposing or seques-
preceding the structural genes (Fig. 2-11). A different tering ribosome binding sites at the beginning of the tran-
type of negative control is that found in the arg operon script.
where a corepressor must bind to a repressor in order to The general arrangement of cis factors on DNA is
turn off transcription (enzyme repression). Compare this shown in Fig. 2-12. These sequences are usually 420
with the inducer that prevents the repressor from binding bp in length. Some are inverted repeats with the capacity
the operator to turn on expression of the lac operon to form a cruciform structure in the DNA duplex recog-
(enzyme induction). The mal operon is an example of nizable by specic proteins. Prokaryotic regulatory
positive control where an activator binds with RNA sequences are found within close proximity of the gene.
polymerase to turn on transcription. Eukaryotic genes have both proximal and distal regula-
(A)
Repressor RNA
polymerase
5 3
3 5
DNA Regulator P O lacZ lacY lacA
gene
(B)
Inducer
(lactose)
Figure 2-10 Two states of the

lac operon. (A) The repressor pro-
tein (R) binds to the operator cis
5 3 element (O) preventing transcrip-
3 5 tion of the operon from the pro-
DNA Regulator P O lacZ lacY lacA moter (P). (B) In the presence of
gene the inducer lactose, the inducer
binds to the repressor, changing its
Transcription conformation, decreasing its affin-
ity for the operator, allowing tran-
mRNA scription to occur.

RNA Chapter 2 41
(A)
Inducer
Repressor
5 3
3 5
P O
Transcription
mRNA
(B)
Corepressor
Repressor
5 3
3 5
P O
(C)
Activator
5 3
3 5
P O
Figure 2-11 Modes of regulation in prokary-
otes include induction as found in the lac operon Transcription
(A), repression as found in the arg operon (B),
and activation as in the mal operon (C). mRNA
Prokaryotes
Proximal elements Structural gene
5 3
Figure 2-12 cis regulatory elements in
3 5
prokaryotes are located close to the struc-
Promoter
tural genes they control in the vicinity of
the promoter. In eukaryotes, distal ele-
Eukaryotes
ments can be located thousands of base
pairs away from the genes they control. Distal elements Proximal elements Structural gene
Proximal elements can be located in or
around the genes they control. Elements 5 3
may also be located behind their target 3 5
genes. Promoter

Coactivator
Advanced Concepts (histone acetyl

transferase)
Unlike prokaryotes, eukaryotes do not have oper-

ons. Coordinately expressed genes can be scattered Activator
in several locations. Synchronous expression is
brought about in eukaryotes by combinatorial con- DNA
trol. Genes that are expressed in a similar pattern
share similar cis elements so that they respond Regulatory region
Nucleosome
simultaneously to specic combinations of control-
TFIID
ling trans factors. (TATA binding
Regulatory region protein)
tory elements. Distal eukaryotic elements can be located Enhancer Promoter

thousands of base pairs away from the genes they control. 5 TATAT 3
Enhancers and silencers are examples of distal regula- 3 ATATA 5
DNA
tory elements that respectively stimulate or dampen Regulator
protein
expression of distant genes. Activator protein Other basal
factors
TFIID
Epigenetics 5 TATAT 3
3 ATATA 5
Histone Modication RNA
Gene activity (transcription) can be altered in ways other polymerase II
than by cis elements and transcription factors. Histone
modication, DNA methylation, and gene silencing by
double-stranded or antisense RNA regulate gene expres- TFIID
sion. These types of gene regulation are called epigenetic 5 3

regulation. 3 5
Chromatin is nuclear DNA that is compacted onto

nucleosomes. A nucleosome is about 150 bases of DNA
wrapped around a complex of eight histone proteins, two
each of H2A, H2B, H3, and H4. Histones are not only
structural proteins but can also regulate access of trans TFIID
factors and RNA polymerase to the DNA helix. 3
Modication of histone proteins affects the activity of 5
chromatin-associated proteins and transcription factors
that increase or decrease gene expression. Through these Figure 2-13 Interaction of transcription factors and nucleo-
protein interactions, chromatin can move between tran- some acetylation at the regulatory region of a gene (top)
scriptionally active and transcriptionally silent states. induce assembly of protein factors and RNA polymerase at
Different types of DNA modications, including methy- the promoter (bottom).
lation, phosphorylation, ubiquitination, and acetylation,
establish a complex system of control. These modica-
tions create a docking surface that forms an environment The involvement of histone modication with gene
for interaction with other chromatin binding factors and, expression has led to the study of aberrations in these
ultimately, regulatory proteins (Fig. 2-13).34 A collection modications in disease states such as viral infections
of such architectural and regulatory proteins assembled and neoplastic cells. Thus, analysis of histone states may
on an enhancer element has been termed an enhanceo- be another target for diagnostic, prognostic, and thera-
some.35 peutic applications.

RNA Chapter 2 43
DNA Modication
Advanced Concepts DNA methylation is another type of epigenetic regulation
of gene expression in eukaryotes and prokaryotes. In ver-
One theory holds that pre-existing and gene-specic tebrates, methylation occurs in cytosine-guaninerich
histone modications constitute a histone code that sequences in the DNA (CpG islands) (Fig. 2-14). CpG
extends the information potential of the genetic islands were initially dened as regions 200 bp in
code.67 Accordingly, euchromatin, which is tran- length with an observed/expected ratio of the occurrence
scriptionally active, has more acetylated histones of CpG 0.6.36 This denition may be modied to a
and less methylated histones than transcriptionally more selective GC content to exclude unrelated regions
silent heterochromatin made up of more condensed of naturally high GC content.37 CpG islands are found
nucleosome bers. Although methylated histones around the rst exons, promoter regions, and sometimes
can activate transcription by recruiting histone acety- toward the 3 ends of genes. Aberrant DNA methylation
lases, establishment of localized areas of histone at these sites is a source of dysregulation of genes in dis-
methylation can also prevent transcription by recruit- ease states. Methylation of cytosine residues in the pro-
ing proteins for heterochromatin formation and is moter regions of tumor suppressor genes is a mechanism
one form of gene or transcriptional silencing.68 of inactivation of these genes in cancer.38 Methods to
Transcriptional silencing is responsible for inactiva- analyze promoter methylation have been developed.39,40
tion of the human X chromosome in female embryo Methylation of DNA is the main mechanism of
development and position effects, the silencing of genomic imprinting, the gamete-specic silencing of
genes when placed in heterochromatic areas. genes.41,42 Imprinting maintains the balanced expression
Nucleosome
of genes in growth and embryonic development by selec-
Active tive methylation of homologous genes. This controlled
DNA
methylation occurs during gametogenesis and is different
in male and female gametes. A convenient illustration of
Acetylation imprinting is the comparison of mules and hinnies. A
mule (progeny of a female horse and male donkey) has a
distinct phenotype from that of a hinny (progeny of a
male horse and a female donkey). The difference is due
Inactive
to distinct imprinting of genes inherited through the egg
versus those inherited through the sperm. Genetic dis-
Deacetylation eases in humans, Angelmans syndrome and Prader-Willi
syndrome, are clinically distinct conditions that result
from the same genetic defect on chromosome 15. The
phenotypic differences depend on whether the genetic
Silenced
lesion involves the maternally or paternally inherited
chromosome. Imprinting may be partly responsible for
Methylation abnormal development and phenotypic characteristics of
Methylation
DNA cytosine
GGAGGAGCGCGCGGCGGCGGCCAGAGA
Stably
silenced
AAAGCCGCAGCGGCGCGCGCGCACCCGGA
CAGCCGGCGGAGGCGGG
Deacetylation and methylation of histones can establish Figure 2-14 CpG islands are sequences of DNA rich in the
silenced regions of DNA. C-G dinucleotides. These structures have no specic sequence
other than a higher than expected occurrence of CpG.

cloned animals as the process of cloning by nuclear trans-

fer bypasses gametogenesis.43,44 Advanced Concepts
RNAi RNA interference has been utilized as a method to
Another phenomenon that affects transcription is RNAi. specically inactivate genes in the research labora-
First discovered in the worm Caenorhabditis elegans in tory. Preferable to gene deletions or knock-out
1993,16,18,45 RNAi is mediated siRNAs.46 The siRNAs methods that take months to inactivate a single gene,
and other proteins assemble into an enzyme complex, RNAi can specically inactivate several genes in a
called the RNA induced silencing complex (RISC) (Fig. few days.
2-15). The RISC uses the associated siRNA to bind and Initially, this method did not work well in mam-
degrade mRNA with sequences complementary to the malian cells, due to a cellular response elicited by
siRNA. In this way translation of specic genes can be introduction of long dsRNAs that turns off multiple
inhibited. siRNAs may also guide methylases to homolo- genes and promotes cell suicide. Studies with
gous sequences on the chromosome, either through direct shorter dsRNAs, however, have been demonstrated
interaction with the methylating enzymes or by hybridiz- to work in mammalian cell cultures 31. This type of
ing to specic sequences in the target genes, forming a specic gene control in vitro may lead to control cell
bulge in the DNA molecule that attracts methylases. cultures or transcriptional states useful in the clinical
laboratory setting as well as the research laboratory.
Trigger dsRNA
RNAi, however is not always required for DNA methyla-

Dicer
tion.47 Alternatively, siRNAs may bind to specific
sequences in already transcribed homologous RNA, tar-
geting them for degradation into more siRNAs.
siRNA RNAi can also control gene expression during devel-
opment. There are more than 200 regulatory RNAis in
humans. Mice without RNAi function do not survive
long into gestation, emphasizing a key role of this mech-
RISC anism in embryogenesis.
Because of the high specicity of siRNAs, RNAi
5 cap has also been proposed as a manner of gene and viral
therapy.48 Silencing has been targeted to growth-activat-
Target mRNA ing genes such as the vascular endothelial growth factor
in tumor cells. Small interfering RNA silencing may also
be aimed at HIV and inuenza viruses. As with other
RISC gene therapy methods, stability and delivery of the thera-
peutic siRNAs are major challenges.
Direct cleavage
STUDY QUESTIONS
RNA Secondary Structure
1. Draw the secondary structure of the following RNA.

Figure 2-15 Trigger double-stranded RNA is cleaved into
siRNAs that become part of the RISC. Led by the complemen- The complementary sequences (inverted repeat) are
tary siRNA sequences, RISC binds to the target RNA and underlined.
begins RNA cleavage.13 5CAUGUUCAGCUCAUGUGAACGCU 3

RNA Chapter 2 45
2. Underline the rest of the two inverted repeats in by Ehrlich ascites cells. Journal of Biological
the following RNA, then draw the secondary struc- Chemistry 1969;244:131424.
ture. 5. Wickens M, Gonzalez TN. Knives, accomplices and
5CUGAACUUCAGUCAAGCAUGCACU- RNA. Science 2004;306:1299300.
GAUGCUU 3 6. Paushkin S, Patel M, Furia BS, et al. Identication
of a human endonuclease complex reveals a link
The Lac Operon between tRNA splicing and pre-mRNA 3-end
1. Using the depiction of the lac operon in Figures formation. Cell 2004;117:31121.
2-9 and 2-10, indicate whether gene expression 7. Perry RP, Kelly DE. Existence of methylated
(transcription) would be on or off under the following mRNA in mouse L cells. Cell 1974;1:3742.
conditions: 8. Lewin BM. Gene Expression 2: Eucaryotic
(P = promoter; O = operator; R = repressor) Chromosomes, 2nd ed. New York: John Wiley
a. P O R, no inducer present - OFF & Sons, 1980.
b. P O R, inducer present - ON 9. Amara SG, Jonas V, Roseneld MG, et al.
c. P- O R, no inducer present - Alternative RNA processing in calcitonin gene
d. P- O R, inducer present - expression generates mRNA encoding different
e. P O- R, no inducer present - polypeptide products. Nature 1982;298:24044.
f. P O- R, inducer present - 10. Toro I, Thore S, Mayer C, et al. RNA binding in an
g. P O R-, no inducer present - Sm core domain: X-ray structure and functional
h. P O R-, inducer present - analysis of an archaeal Sm protein complex. EMBO
i. P- O- R, no inducer present - Journal 2001;20(9):2293303.
j. P- O- R, inducer present - 11. Mura C, Cascio D, Sawaya MR, et al. The crystal
k. P- O R-, no inducer present - structure of a heptameric archaeal Sm protein:
l. P- O R-, inducer present - Implications for the eukaryotic snRNP core.
m. P O- R-, no inducer present - Proceedings of the National Academy of Sciences
n. P O- R-, inducer present - 2001;98(10):553237.
o. P- O- R-, no inducer present - 12. Liu Z, Luyten I, Bottomley MJ, et al. Structural
p. P- O- R-, inducer present - basis for recognition of the intron branch site RNA
by splicing factor 1. Science 2001;294:1098101.
13. Adams A. RNAi inches toward the clinic. The
Epigenetics Scientist 2004;March 29, 2004:3235.
1. Indicate whether the following events would increase 14. Hamilton A, Baulcombe D. A species of small anti-
or decrease expression of a gene: sense RNA in posttranscriptional gene silencing in
a. Methylation of cytosine bases 5 to the gene plants. Science 1999;286(5441):95052.
b. Histone acetylation close to the gene 15. Knight S, Bass BL. A role for the RNase III
c. siRNAs complementary to the gene transcript enzyme DCR-1 in RNA interference and germ line
development in Caenorhabditis elegans. Science
2001;293(5538):226971.
References 16. Lee R, Feinbaum RL, Ambros V. The C. elegans
1. Lamond A, Earnshaw WC. Structure and function in heterochronic gene lin-4 encodes small RNAs with
the nucleus. Science 1998;280:54753. antisense complementarity to lin-14. Cell 1993;
2. Tollervey D. Termination by torpedo. Nature 2004; 75(5):84354.
432:45657. 17. Reinhart B, Slack FJ, Basson M, et al. The 21-
3. Weinberg RA, Penman S. Processing of 45S nucleo- nucleotide let-7 RNA regulates developmental tim-
lar RNA. Journal of Molecular Biology 1970;47: ing in Caenorhabditis elegans. Nature 2000;403
16978. (6772):901906.
4. Edmonds M, Caramela MG. The isolation and char- 18. Wightman HI, Ruvkun G. Posttranscriptional regu-
acterization of AMP-rich polynucleotide synthesized lation of the heterochronic gene lin-14 by lin-4

mediates temporal pattern formation in C. elegans. 32. Ryan K, Calvo O, Manley JL. Evidence that
Cell 1993;75(5):85562. polyadenylation factor CPSF-73 is the mRNA 3
19. Lagos-Quintana M, Rauhut R, Lendeckel W, et al. processing endonuclease. RNA 2004;10(4):56573.
Indentication of novel genes coding for small 33. Dantonel J, Murthy KG, Manley JL, et al. Trans-
expressed RNAs. Science 2001;294:85358. cription factor TFIID recruits factor CPSF for for-
20. Lau NC, Lim LP, Weinstein, EG, et al. An abundant mation of 3 end of mRNA. Nature 1997;389
class of tiny RNAs with probable regulatory roles (6649):399402.
in Caenorhabditis elegans. Science 2001;294: 34. Berger SL. The histone modication circus. Science
85862. 2001;292:6465.
21. Lee RC, Ambros V. An extensive class of small 35. Munshi NT, Agalioti S, Lomvardas M, et al.
RNAs in Caenorhabditis elegans. Science 2001; Coordination of a transcriptional switch by
294:86264. HMGI(Y) acetylation. Science 2001;293:113336.
22. Pfeffer ZM, Grasser FA, Chien M, et al. Identica- 36. Gardiner-Garden M, Frommer M. CpG islands in
tion of virus-encoded microRNAs. Science 2004; vertebrate genomes. Journal of Molecular Biology
304:73436. 1987;196(2):26182.
23. Ambros V, Lee RC , Lavanway A, et al. 37. Jones D. The role of DNA methylation in mam-
MicroRNAs and other tiny endogenous RNAs in malian epigenetics. Science 2001;293(5532):
C. elegans. Current Biology 2003;13:80718. 106870.
24. Kuwabara T, Hsieh J, Nakashima K, et al. A small 38. Jones PAaL, P. W. Cancer epigenetics comes of
modulatory dsRNA species the fate of adult neural age. Nature Genetics 1999;21:16367.
stem cells. Cell 2004;116:77993. 39. Lehmann UB, Hasemeier R, Kreipe H. Quantitative
25. Eliceiri G. Small nucleolar RNAs. Cellular and analysis of promoter hypermethylation in laser-
Molecular Life Sciences 1999;56(1-2):2231. microdissected archival specimens. Laboratory
26. Sunohara T, Jojima K, Yamamoto Y, et al. Nascent- Investigation 2001;81(4):63537.
peptide-mediated ribosome stalling at a stop codon 40. Gonzalgo ML, Bender CM, You EH, et al. Low
induces mRNA cleavage resulting in nonstop frequency of p16/CDKN2A methylation in sporadic
mRNA that is recognized by tmRNA. RNA 2004; melanoma: Comparative approaches for methyla-
10(3):37886. tion analysis of primary tumors. Cancer Research
27. Travers A, Burgess RR. Cyclic reuse of the RNA 1997;57:533647.
polymerase sigma factor. Nature 1969;222: 41. Li E, Beard C, Forster AC, et al. DNA methylation,
53740. genomic imprinting, and mammalian development.
28. Burgess R, Travers AA, Dunn JJ, et al. Factor-stim- Cold Spring Harbor Symposium on Quantitative
ulating transcription by RNA polymerase. Nature Biology 1993;58:297305.
1969;221:4347. 42. Gold J, Pedersen RA. Mechanisms of genomic
29. Dalmay T, Hamilton A, Rudd S, et al. An RNA- imprinting in mammals. Current Topics in Deve-
dependent RNA polymerase gene in Arabidopsis is lopmental Biology 1994;29:22747.
required for posttranscriptional gene silencing 43. Solter D. Lambing by nuclear transfer. Nature
mediated by a transgene but not by a virus. Cell 1996;380(6569):2425.
2000;101(5):54353. 44. Yang L, Chavatte-Palmer P, Kubota C, et al.
30. Dickson K, Thompson SR, Gray NK, et al. Poly Expression of imprinted genes is aberrant in
(A) polymerase and the regulation of cytoplasmic deceased newborn cloned calves and relatively
polyadenylation. Journal of Biological Chemistry normal in surviving adult clones. Molecular
2001;276(45):4181016. Reproduction and Development 2005.
31. Tuschl T, Weber K. Duplexes of 21-nucleotide 45. Fire A, Xu S, Montgomery MK, et al. Potent and
RNAs mediate RNA interference in cultured specic genetic interference by double-stranded
mammalian cells. Nature 2001;411(6836): RNA in Caenorhabditis elegans. Nature 1998;391
49498. (6669):80611.

RNA Chapter 2 47
46. Matzke M, Kooter JM. RNA: Guiding gene silenc- 60. Lindell TJ, Weinber F, Morris PW, et al. Specic
ing. Science 2001;293:108083. inhibition of nuclear RNA polymerase by amanitin.
47. Freitag M, Lee DW, Kothe GO, et al. DNA methy- Science 1970;170:44748.
lation is independent of RNA interference in 61. Lee Y, Kim M, Han J, et al. MicroRNA genes are
Neurospora. Science 2004;304:1939. transcribed by RNA polymerase II. EMBO Journal
48. Wall N, Shi Y. Small RNA: Can RNA interference 2004;23(20):405160.
be exploited for therapy? Lancet 62. Bird G, Zorio DA, Bentley DL. RNA polymerase II
2003;362:1401403. carboxy-terminal domain phosphorylation is
49. Perbal B. A Practical Guide to Molecular Cloning, required for cotranscriptional pre-mRNA splicing
2nd ed. New York: John Wiley & Sons, 1988. and 3-end formation. Molecular and Cellular
50. Yusupov M, Yusupova GZH, Baucom A, et al. Biology 2004;24(20):896369.
Crystal structure of the ribosome at 5.5A resolution. 63. Gong X, Nedialkov YA, Burton ZF. Alpha-amanitin
Science 2001;292:88396. blocks translocation by human RNA polymerase
51. Ogle JM, Brodersen DE, Clemons WM Jr.et al. II. Journal of Biological Chemistry 2004;279(26):
Recognition of cognate transfer RNA by the 30S 2742227.
ribosomal subunit. Science 2001;292:897902. 64. Cramer P, Bushnell DA, Kornberg R. Structural
52. Milcarek CR. The metabolism of a poly(A) basis of transcription: RNA polymerase II at
minus mRNA fraction in HeLa cells. Cell 2.8 angstrom resolution. Science 2001;292:
1974;3:110. 186376.
53. Both GW, Furuichi Y, Muthukrishman S, et al. 65. Gnatt AL, Cramer P, Fu J, et al. Structural basis of
Effect of 5 terminal structure and base composi- transcription: An RNA polymerase II elongation
tion on polyribonucleotide binding to ribosomes. complex. Science 2001;292:187681.
Journal of Molecular Biology 1975;104:63758. 66. Linder P. The life of RNA with proteins. Science
54. Novina C, Sharp PA. The RNAi revolution. Nature 2004;304:69495.
2004;430:16164. 67. Jenuwein T. Translating the histone code. Science
55. Sum E, Segara D, Duscio B, et al. Overexpression 2001;293:107479.
of LMO4 induces mammary hyperplasia, promotes 68. Bird A. Methylation talk between histones and
cell invasion, and is a predictor of poor outcome in DNA. Science 2001;294:211315.
breast cancer. Proceedings of the National Academy 69. Tilghman SM, Tiemeier DC, Seidman JG, et al.
of Sciences 2005. Intervening sequence of DNA identied in the
56. Calderon A, Lavergne JA. RNA interference: structural portion of a mouse -globin gene.
A novel and physiologic mechanism of gene Proceedings of the National Academy of Sciences
silencing with great therapeutic potential. 1978;75:72529.
Puerto Rico Health Sciences Journal 2005; 70. White R, Hogness DS. R loop mapping of the 18S
24(1):2733. and 28S sequences in the long and short repeating
57. Lehninger A. Principles of Biochemistry. New units of D. melanogaster rDNA. Cell 1977;10:
York: Worth Publishers, 1982. 17792.
58. Roeder R, Rutter WJ. Specic nucleolar and 71. Holley RW. The nucleotide sequence of a nucleic
nucleoplasmic RNA polymerases. Proceedings acid. San Francisco: Freeman, 1968.
of the National Academy of Sciences 1970;65: 72. Monod J, Cozen-Bizare G. Leffect dinhibition
67582. specique dans la biosynthese de la tryptophane-
59. Jacob ST, Sajdel EM, Munro HN. Different desmase chez Aerobacter aerogenes. Comptes
responses of soluble whole nuclear RNA poly- Rendus de lAcademie des Sciences 1953;236:
merase and soluble nucleolar RNA polymerase at 53032.
divalent cations and to inhibition by -amanitin. 73. Jacob F, Monod J. Genetic regulatory mechanisms
Biochemical Biophysical Research Communications in the synthesis of proteins. Journal of Molecular
1970;38:76570. Biology 1961;3:31856.
Proteins
OUTLINE OBJECTIVES
AMINO ACIDS Describe the structure and chemical nature of the 20
GENES AND THE GENETIC CODE amino acids.
The Genetic Code Show how the chemistry of the amino acids affects the
TRANSLATION chemical characteristics and functions of proteins.
Amino Acid Charging
Protein Synthesis Dene primary, secondary, tertiary, and quaternary
structure of protein organization.
Give the denition of a gene.
Recount how the genetic code was solved.
Describe how amino acids are polymerized into proteins,
using RNA as a guide (translation).
48

Proteins Chapter 3 49
Proteins are the products of transcription and translation

Table 3.1 Classication of Amino Acids Based
of the nucleic acids. Even though nucleic acids are most on Polarity of Their Side Chains
often the focus of molecular analysis, the ultimate effect
Classication Amino Acid Abbreviations
of the information stored and delivered by the nucleic
acid is manifested in proteins. Analysis of the amount Nonpolar Alanine Ala, A
and mutational status of specic proteins has long been Isoleucine Ile, I
performed in situ using immunohistochemistry, on live Leucine Leu, L
cells using ow cytometry, and on isolated proteins by Methionine Met, M
Western blots. More recently, global protein analysis by Phenylalanine Phe, F
mass spectrometry (proteomics) has been applied to clin- Tryptophan Trp, W
ical work on a research basis. Even if proteins are not Valine Val, V
being tested directly, they manifest the phenotype Polar Asparagine Asn, N
directed by the nucleic acid information. In order to inter- Cysteine Cys, C
pret results of nucleic acid analysis accurately, therefore, Glutamine Gln, Q
it is important to understand the movement of genetic Glycine Gly, G
information from DNA to protein as dictated by the Proline Pro, P
genetic code. Serine Ser, S
Threonine Thr, T
Tyrosine Tyr, Y
Amino Acids Negatively charged Aspartic acid Asp, D
Proteins are polymers of amino acids. Each amino acid (acidic) Glutamic acid Glu, E
has characteristic biochemical properties determined by Positively charged Arginine Arg. R
the nature of its amino acid side chain (Fig. 3-1). Amino (basic) Histidine His, H
acids are grouped according to their polarity (tendency Lysine Lys, K
to interact with water at pH 7) as follows: nonpolar,
uncharged polar, negatively-charged polar, and positively-
charged polar (Table 3.1). thetic precursor (Table 3.2). Histidine has a unique syn-
The properties of amino acids that make up a protein thetic pathway using metabolites common with purine
determine the shape and biochemical nature of the pro- nucleotide biosynthesis, which affords connection of
tein, such as highly charged, hydrophilic, or hydropho- amino acid synthesis with nucleotide synthesis.
bic. A single protein can have separate domains with At pH 7, most of the carboxyl groups of the amino
different properties. For example, transmembrane pro- acids are ionized, and the amino groups are not. The ion-
teins might have several stretches of hydrophobic amino ization can switch between the amino and carboxyl
acids that will sit in the lipid membrane of the cell; they groups, making the amino acids zwitterions at physio-
might also have hydrophilic or charged extracellular logical pH (Fig. 3-3). At a specic pH, amino acids will
domains (Fig. 3-2). become completely positively or negatively charged.
Amino acids are synthesized in vivo by stereospecic These are the pK values. At the pH where an amino acid
enzymes so that naturally occurring proteins are made of is neutral, its positive and negative charges are in balance.
amino acids of L-stereochemistry. The central asymmet- This is the pI value. Each amino acid will have its char-
ric carbon atom is attached to a carboxyl group, an amino acteristic pI. The pI of a peptide or protein is determined
group, a hydrogen atom, and the side chain. Proline dif- by the ionization state (positive and negative charges) of
fers somewhat from the rest of the amino acids in that its the side chains of its constituent amino acids.
side chain is cyclic, the amino group attached to the end The amino and carboxyl terminal groups of the amino
carbon of the side chain making a ve-carbon ring (see acids are joined in a carbon-carbon-nitrogen (-C-C-N-)
Fig. 3-1). substituted amide linkage (peptide bond) to form the
Amino acids are also classied by their biosynthetic protein backbone (Fig. 3-4). Two amino acids joined
origins or similar structures based on a common biosyn- together by a peptide bond make a dipeptide. Peptides
Charged R groups
H H H H H
+ + +
H3N
+
C COO H3N
+
C COO H3N C COO H3N C COO H3N C COO
CH2 CH2 CH2 CH2 CH2

+
CH2 CH2 COO CH2 C NH
CH2 CH
CH2 COO
HC NH
NH
CH2
+
+NH C NH2
3
NH2
Lysine Arginine Aspartic acid Glutamic acid Histidine

(Lys) (Arg) (Asp) (Glu) (His)
Polar R groups
H H H H H H
+ + + + +
H3N C COO H3N C COO H3N C COO H3N C COO +
H3N C COO H2N C COO
CH2OH H C OH CH2 CH2 CH2 H2C CH2

CH3 SH C CH2 CH2
H2N O C
H2N O
Serine Threonine Cysteine Asparagine Glutamine Proline

(Ser) (Thr) (Cys) (Asn) (Gln) (Pro)
Nonpolar R groups
H H H H H H
+ + + +
H3N C COO H3N C COO H3N C COO H3N C COO H3N
+
C COO H3N
+
C COO
H CH3 CH CH2 CH2 H C CH3

H3C CH3 CH2 CH CH2
S H3C CH3 CH3
CH3
Glycine Alanine Valine Methionine Leucine Isoleucine
(Gly) (Ala) (Val) (Met) (Leu) (Ile)
Aromatic R groups
H H H
+ + +
H3N C COO H3N C COO H3N C COO
CH2 CH2 CH2
C CH
NH
OH
Phenylalanine Tyrosine Tryptophan

(Phe) (Tyr) (Trp)
Figure 3-1 Structures of the 20 amino acids. The side chains are grouped according to their chemical characteristics.
50

Outside of cell Table 3.2 Amino Acid Biosynthetic Groups

Biosynthetic Group Precursor Amino Acids
Extracellular domains -Ketoglutarate group -Ketoglutarate Gln, Q
Glu, E
Cell membrane Pro, P
Arg. R
Pyruvate group Pyruvate Ala, A
Val, V
Leu, L
Oxalate group Oxalacetic acid Asp, D
Asn, N
Intracellular domains Lys, Q
Transmembrane domains
Ile, I
Inside of cell
Thr, T
Met, M
Figure 3-2 Transmembrane proteins have hydrophobic Serine group 3-Phosphoglycerate Gly, G
transmembrane domains and hydrophilic domains exposed
Ser, S
to the intracellular and extracellular spaces. The biochemical
nature of these domains results from their distinct amino acid
Cys, C
compositions. Aromatic group Chorismate Phe, F
Trp, W
Tyr, Y
with additional units are tri-, tetra-, pentapeptides, and so (Unique biosynthesis) His, H
forth, depending on how many units are attached to each
other. At one end of the peptide will be an amino group
(the amino terminal or NH2 end), and at the opposite that will ultimately bring about the genetically coded
terminus of the peptide will be a carboxyl group (the car- phenotype.
boxy terminal or COOH end). Like the 5 to 3 direction The collection of proteins produced by a genome is a
of nucleic acids, peptide chains grow from the amino to proteome. The proteome of humans is larger than the
the carboxy terminus. genome, possibly 10 times its size.1 This is because a sin-
Proteins are polypeptides that can reach sizes of more gle gene can give rise to more than one protein through
than a thousand amino acids in length. Proteins constitute alternate splicing and other post-transcriptional/post-
the most abundant macromolecules in cells. The infor- translational modications.
mation stored in the sequence of nucleotides in DNA is The sequence of amino acids in a protein determines
transcribed and translated into an amino acid sequence the nature and activity of that protein. This sequence is
the primary structure of the protein and is read by con-
vention from the amino terminal end to the carboxy ter-
minal end. Minor changes in the primary structure can
Advanced Concepts alter the activity of proteins dramatically. The single
An unusual 21st amino acid, selenocysteine, is a amino acid substitution that produces hemoglobin S in
component of selenoproteins such as glutathione
peroxidase and formate dehydrogenase. There are O O O
25 known mammalian selenoproteins. Selenocys- R pK1 R pK2 R
teine is cysteine with the sulfur atom replaced by OH O O
selenium.31 Selenocysteine is coded by a predened +
NH3 +
NH3 NH2
UGA codon that inserts selenocysteine instead of a Figure 3-3 An amino acid is positively charged at pK1 and
termination signal. negatively charged at pK2. At the pH where the positive and
negative charges balance (pI), the molecule is neutral.

Advanced Concepts Historical Highlights

Peptides can have biological activity. Hormones The primary sequence of proteins can be determined
such as insulin, glucagons, corticotropin, oxytocin, by a method rst described in the report of the
bradykinin, and thyrotropin are examples of pep- amino acid sequence of insulin by Fred Sanger.38,39
tides (9-40 amino acids long) with strong biological This procedure was carried out in six steps. First, the
activity. Several antibiotics such as penicillin and protein was dissociated to amino acids. The dissoci-
streptomycin are also peptides. ation products were separated by ion exchange chro-
matography in order to determine the type and
amount of each amino acid. Second, the amino ter-
sickle cell anemia is a well-known example. Replacement minal and carboxy terminal amino acids were deter-
of a soluble glutamine residue with a hydrophobic valine mined by labeling with 1-uoro-2,4-dinitrobenzene
at the sixth residue changes the nature of the protein so and digestion with carboxypeptidase, respectively.
that it packs aberrantly in corpuscles and drastically alters The complete protein was then fragmented selec-
cell shape. Minor changes in primary structure can have tively at lysines and arginines with trypsin to 1015
such drastic effects because the amino acids must often amino acid peptides. Fourth, Edmund degradation
cooperate with one another to bring about protein struc- with phenylisothiocyanate and dilute acid labeled
ture and function. and removed the amino terminal residue. This was
repeated on the same peptide until all the amino
acids were identied. Fifth, after another selected
Amino acid 1 Amino acid 2 cleavage of the original protein using cyanogen bro-
H O
mide, chymotrypsin, or pepsin and identication of
H R1 the peptides by chromatography, the peptides were
+ C O + N C H again sequenced using the Edmund degradation.
H3N C H H C O
H R2 Sixth, the complete amino acid sequence could be
O assembled by identication of overlapping regions.
H2O
H R1 Interactions between amino acid side chains fold a

H O
+ C protein into predictable congurations. These include
H3N C N C H ordered beta or beta-pleated sheets and less ordered
C O
O H R2 alpha helices or random coils. The alpha helix and beta
sheet structures in proteins (Fig. 3-5) were rst described
Peptide bond
by Linus Pauling and Robert Corey in 1951.2-5 This level
+ amino acid 3
H2O Advanced Concepts

Protein sequence can be inferred from DNA
H R1 H O H R3 sequence, although the degeneracy of the genetic
+ C C O code will result in several possible protein sequences
H3N C N C N C H
C for a given DNA sequence. Many databases are
O H R2 H O available on the frequency of codon usage in various
Figure 3-4 The peptide bond is a covalent linkage of the
organisms.32-34 These can be used to predict the cor-
carboxyl C of one amino acid with the amino N of the next rect amino acid sequence.
amino acid. One molecule of water is released in the reaction.

of organization is the secondary structure of the protein. The secondary structures of proteins are further folded
Some proteins, especially structural proteins, consist and arranged into a tertiary structure. Tertiary structure
almost entirely of alpha helices or beta sheets. Globular is important for protein function. If a protein loses its ter-
proteins have varying amounts of alpha helix and beta tiary structure, it is denatured. Mutations in DNA that
sheets. substitute different amino acids in the primary structure
Advanced Concepts
Specialized secondary structures can identify function such that the leucine side chains radiate out-
tions of proteins. Zinc nger motifs are domains wardly to facilitate association with other peptides
frequently found in proteins that bind to DNA. of similar structure. Because other amino acids
These structures consist of two beta sheets followed besides leucine can participate in this interaction,
by an alpha helix with a stabilizing zinc atom. There the term basic zipper, or bZip, has been used to
are three types of zinc ngers, depending on the describe this type of protein structure. Another sim-
arrangement of cysteine residues in the protein ilar structure found in transcriptional regulators is
sequence. Another example of specialized second- the helix loop helix.36 This motif consists of basic
ary structure is the leucine zipper, also found in amino acids that bind consensus DNA sequences
transcription factors.35 This conserved sequence has (CANNTG) of target genes. This structure is some-
a leucine or other hydrophobic residue at each sev- times confused with the helix turn helix. The helix
enth position for approximately 30 amino acids. The turn helix is two alpha helices connected by a short
sequence is arranged in an alpha helical conforma- sequence of amino acids. This structure can easily
t into the major groove of DNA.
His
HOOC
+ Cys
Zn2
Cys
His
H2N
3-1 Zinc nger motif of the Sp1 protein, a eukaryotic tran-

scription regulator. The side chains of histidine (H) and cys- 3-2 The lambda repressor, a transcription factor of the
teine (C), part of the zinc nger amino acid sequence, bacteriophage lambda, has a helix turn helix motif. One
C-X 2-4-C-X3-F-X5-L-X2-H-X3-H (~23 amino acids), bind a Zn of each of the helices ts into the major groove of the
atom in the active protein. Sp1 binds DNA in the regulatory DNA. Lambda repressor prevents transcription of genes
region of genes. Note: For single-letter amino acid code, necessary for active growth of the bacteriophage lead-
see Figure 3-7. X in this consensus denotes any amino acid. ing to host cell lysis.

prosthetic group. Examples of conjugated proteins are

those covalently attached to lipids (lipoproteins), e.g.,
low density lipoproteins; sugars (glycoproteins), e.g.,
mucin in saliva; and metal atoms (metalloproteins),
e.g., ferritin. One of the most familiar examples of a con-
jugated protein is hemoglobin. Hemoglobin is a tetramer
with four Fe2-containing heme groups, one covalently
attached to each monomer.
Genes and the Genetic Code

A gene is dened as the ordered sequence of nucleotides
(A) Helix (B) Pleated sheet
on a chromosome that encodes a specic functional prod-
Figure 3-5 Secondary structure of proteins includes the uct. A gene is the fundamental physical and functional
alpha helix (A) and the beta pleated sheet (B). The ribbon- unit of inheritance. The physical denition of a gene was
like structures in the pictures are composed of chains of
complicated in early texts because of the methods used to
amino acids hydrogen-bonded through their side chains.
dene units of genetic inheritance. Genes were rst stud-
ied by tracking mutations that took away their function.
can also alter tertiary structure. Denatured or improperly A gene was considered that part of the chromosome
folded proteins are not functional. Proteins are also dena- responsible for the function affected by mutation. Genes
tured by heat, e.g., the albumin in egg white, or by con- were not delineated well in terms of their physical size
formations forced on innocuous peptides by infectious but were mapped relative to each other based on the fre-
prions. Aggregations of prion-induced aberrantly folded quency of recombination between them.
proteins cause transmissible spongiform encephalo- In the early 1960s, Seymour Benzer6,7 used the T4 bac-
pathies such as Creutzfeldt-Jakob disease and bovine teriophage to investigate the gene more closely. By mix-
spongiform encephalitis (mad cow disease). ing phage with several different phenotypes, he could
As previously mentioned, proteins often associate with observe the complementation of one mutant for another.
other proteins in order to function. Two proteins bound Benzer could distinguish mutations that could comple-
together to function form a dimer, three a trimer, four a ment each other, even though they affected the same phe-
tetramer, and so forth. Proteins that work together in this notype and mapped to the same locus. He determined
way are called oligomers, each component protein being that these were mutations in different places within the
a monomer. This is the quaternary structure of pro- same gene. He organized many mutants into a series of
teins. The combinatorial nature of protein function may sites along the linear array of the phage chromosome so
account for genetic complexity of higher organisms with- that he could structurally dene the gene as a continuous
out concurrent increase in gene number. linear span of genetic material.
Proteins are classified according to function as We know now that a gene contains not only structural
enzymes and transport, storage, motility, structural, sequences that code for an amino acid sequence but also
defense, or regulatory proteins. Enzymes and transport, regulatory sequences that are important for the regu-
defense, and regulatory proteins are usually globular in lated expression of the gene (Fig. 3-6). Cells expend
nature, making them soluble and allowing them to diffuse much energy to coordinate protein synthesis so that the
freely across membranes. Structural and motility pro- proper proteins are available at specic times and in spe-
teins, such as myosin, collagen, and keratin, are brous cic amounts. Loss of this controlled expression will
and insoluble. result in an abnormal phenotype, even though there may
In contrast to simple proteins that have no other com- be no mutation in the structural sequence of the gene.
ponents except amino acids, conjugated proteins do Lack of appreciation for the importance of proximal and
have components other than amino acids. The nonprotein distal regulatory sequences was another source of confu-
component of a conjugated protein is the nonprotein sion in early efforts to dene a gene. Regulatory effects

Regulatory Structural Regulatory Early on, scientists had surmised the triplet nature of
sequence Promoter sequence sequence the code based on mathematical considerations. It was
5 PO OH 3
3 HO
reasoned that the smallest set of 4 possible letters that
OP 5
DNA would yield enough unique groups to denote 20 different
amino acids was 3. A 1-nucleotide code could only
Figure 3-6 A gene contains not only structural (coding) account for 4 different amino acids, whereas a 2-
sequences but also sequences important for regulated tran- nucleotide code would yield just 16 different possibilities.
scription of the gene. These include the promoter, where
RNA polymerase binds to begin transcription, and regulatory
A 3-nucleotide code would give 64 different possibilities,
regions, where transcription factors and other regulatory enough to account for all 20 amino acids.
factors bind to stimulate or inhibit transcription by RNA The next challenge was to decipher the triplet code and
polymerase. to prove its function. The simplest way to prove the code
would have been to determine the sequence of
nucleotides in a stretch of DNA coding for a protein and
and the interaction between proteins still challenge inter-
compare it with the protein sequence. In the early 1960s,
pretation of genetic analyses in the clinical laboratory.
protein sequencing was possible, but only limited DNA
sequencing was available. Marshall Nirenberg made the
The Genetic Code initial attempts at the code by using short synthetic DNA
sequences to support protein synthesis in a cell-free
The nature of a gene was further claried with the deci-
extract of Escherichia coli. In each of 20 tubes he mixed
phering of the genetic code by Francis Crick, Marshall
a different radioactive amino acid, cell lysate from E.
Nirenberg, Philip Leder, Gobind Khorana, and Sydney
coli, and an RNA template. In the rst denitive experi-
Brenner.8-10 The genetic code is not information in itself
ment, the input template was a polymer of uracil, UUU-
but is a dictionary to translate the four-nucleotide se-
UUUU. If the input template supported synthesis of
quence information in DNA to the 20amino acid
protein, the radioactive amino acid would be incorpo-
sequence information in proteins.
rated into the protein and the radioactivity detected in a
precipitable protein extract from the mixture. On May 27,
1961, Nirenberg measured radioactive protein levels
from all but 1 of the 20 vials at around 70 counts/mg. The
Historical Highlights vial containing phenylalanine yielded protein of 38,000
The interesting history of the breaking of the genetic counts/mg. After the rst demonstration of success of this
code began with a competitive scramble. A physicist strategy, other templates were tested. Each synthetic
and astronomer, George Gamow, organized a group nucleic acid incorporated different amino acids, based on
of scientists to concentrate on the problem. They the composition of bases in the RNA sequence. Codes for
called themselves the RNA Tie Club. Each of the 20 phenylalanine (UUU), proline (CCC), lysine (AAA), and
members wore a tie emblazoned with a depiction of glycine (GGG) were soon deduced from the translation
RNA and a pin depicting a different amino acid. The of nucleic acids synthesized from a single nucleotide
club members were William Astbury, Oswald Avery, population. More of the code was indirectly deduced
Sir William Laurence Bragg, Erwin Chargaff, using mixtures of nucleotides at different proportions.
Martha Chase, Robert Corey, Francis Crick, Max For instance, an RNA molecule synthesized from a 2:1
Delbruck, Jerry Donohue, Rosalind Franklin, Bruce mixture of U and C polymerized mostly phenylalanine
Fraser, Sven Furgerg, Alfred Hershey, Linus Pauling, and leucine into protein. Similar tests with other
Peter Pauling, Max Perutz, J.T. Randall, Verner nucleotide mixtures resulted in distinct amino acid incor-
Schomaker, Alexander R. Todd, James Watson, and porations. Although each RNA molecule in these tests
Maurice Wilkins. This group met regularly during was of known composition of nucleotides, the exact order
the 1950s but did not exclusively break the genetic of nucleotides in the triplet was not known.
code. Nirenberg and Leder used another technique to get at
the basic structure of the code. They observed binding of

specic amino acids to RNA triplets in ribosome-tRNA Triplets coding for the same amino acid are similar,
mixtures. By noting which triplet/amino acid combina- mostly differing only in the third base of the triplet. Crick
tion resulted in binding of the amino acid to ribosomes, rst referred to this as wobble in the third position.11
they were able to assign 50 of the 64 triplets to specic Wobble is also used to describe movement of the base in
amino acids. the third position of the triplet to form novel pairing
Meanwhile, Gobind Khorana had developed a system between the carrier tRNA and the mRNA template dur-
to synthesize longer polymers of known nucleotide ing protein translation. Recent investigations have
sequence. With polynucleotides of repeated sequence, he revealed that wobble may affect the severity of disease
could predict and then observe the peptides that would phenotype.12
come from the known sequence. For example, a polymer All amino acids except leucine, serine, and arginine
consisting of two bases such as ...UCUCUCUCUCU- are selected by the rst two letters of the genetic code.
CUC... was expected to code for a peptide of two differ- The rst two letters, however, do not always specify
ent amino acids, one coded for by UCU and one by CUC. unique amino acids. For example, CA starts the code for
This polymer yielded a peptide with the sequence ...Ser- both histidine and glutamine. Three codons, UAG, UAA,
Leu-Ser-Leu.... This experiment did not tell which triplet and UGA, that terminate protein synthesis are termed
coded for which amino acid, but combined with the nonsense codons. UAG, UAA, and UGA were named
results from Nirenberg and Leder, the UCU was assigned amber, ocher, and opal, respectively, when they were
to serine and CUC to leucine. rst dened in bacterial viruses.
By 1965, all 64 triplets, or codons, were assigned to The characteristics of the genetic code have conse-
amino acids (Fig. 3-7). Once the code was conrmed, quences for molecular analysis. Mutations or changes in
specic characteristics of it were apparent. The code is the DNA sequence will have different effects on pheno-
redundant, so that all but two amino acids (methionine type depending on the resultant changes in the amino
and tryptophan) are coded for by more than one codon. acid sequence. Accordingly, mutations range from silent
Second position of codon

U C A G
UUU UAU UGU U
UCU Tyrosine
UUC Phenylalanine UCC UAC UGC Cysteine C
U Serine
UUA UCA UAA Ter (end) UGA Ter (end) A
Leucine UCG
UUG UAG Ter (end) UGG Tryptophan G
CAU U
CUU CCU Histidine CGU
CUC CCC CAC CGC C
C Leucine Proline Arginine
Third position
First position
CUA CCA CAA CGA A

CUG CCG CAG Glutamine CGG
G
AUU AAU AGU U
ACU Serine
AUC Isoleucine ACC AAC Asparagine AGC C
A AUA Threonine
ACA AAA AGA A
AUG Methionine ACG AAG Lysine AGG Arginine G
GAU Aspartic U
GUU GCU GGU
GUC GCC GAC acid GGC C
G Valine Alanine Glycine
GUA GCA GAA Glutamic GGA A
GUG GCG GAG GGG
acid G
Figure 3-7 The genetic code. Codons are read as the nucleotide in the left column, then the
row at the top, and then the right column. Note how there are up to six codons for a single amino
acid. Only methionine and tryptophan have a single codon. Note also the three termination
codons (ter), TAA, TAG, and TGA.

into proteins. Through the genetic code, specic nucleic

Advanced Concepts acid sequence is translated to amino acid sequence and,
ultimately, to phenotype.
The UGA codon also codes for selenocysteine. Protein synthesis starts with activation of the amino
Selenoproteins have UGA codons in the middle of acids by covalent attachment to tRNA, or tRNA charg-
their coding regions. In the absence of selenium, ing, a reaction catalyzed by 20 aminoacyl tRNA syn-
protein synthesis stops prematurely in these genes. thetases. The Mg-dependent charging reaction was
rst described by Hoagland and Zamecnik, who observed
that amino acids incubated with ATP and the cytosol frac-
to drastic in terms of their effects on phenotype. This will tion of liver cells became attached to heat-soluble RNA
be discussed in more detail in later chapters. (tRNA).15 The reaction takes place in two steps. First, the
An interesting observation about the genetic code is amino acid is activated by addition of AMP:
that, with limited exceptions, the repertoire of amino amino acid ATP aminoacyl-AMP PPi
acids is limited to 20 in all organisms, regardless of grow- Second, the activated amino acid is joined to the tRNA:
ing environments. Thermophilic and cryophilic organ- aminoacyl-AMP tRNA
isms adapt to growth at 100oC and freezing temperatures, aminoacyl-tRNA AMP
respectively, not by using structurally different amino The product of the reaction is an ester bond between
acids but by varying the combinations of the naturally the 3 hydroxyl of the terminal adenine of the tRNA and
occurring amino acids. As will be discussed in the next the carboxyl group of the amino acid.
section, cells have strict control and editing systems to There are 20 amino acyl tRNA synthetases, one for
protect the genetic code and avoid incorporation of unnat- each amino acid. Designated into two class I and class II
ural amino acids into proteins. Recent studies have shown synthetases, these enzymes interact with the minor or
that it is possible to manipulate the genetic code to incor- major groove of the tRNA acceptor arm, respectively.
porate modied amino acids.13,14 The ability to introduce Both classes also recognize tRNAs by their anticodon
chemically or physically reactive sites into proteins in sequences and amino acids by their side chains. Only the
vivo has signicant implications in biotechnology. appropriate tRNA and amino acid will t into its cognate
synthetase (Fig. 3-8). An errant amino acid bound to the
Translation wrong synthetase will dissociate rapidly before any con-
formation changes and charging can occur. In another
Amino Acid Charging level of editing, mischarged aminoacylated tRNAs are
After transcription of the sequence information in DNA hydrolyzed at the point of release from the enzyme. The
to RNA, the transcribed sequence must be transferred delity of this system is such that mischarging is 103106
less efficient than correct charging.16
Protein Synthesis
Advanced Concepts Translation takes place on ribosomes, small ribonucleo-
According to evolutionary theory, the genetic code protein particles rst observed by electron microscopy of
has evolved over millions of years of selection. An animal cells. In the early 1950s, Zamecnik demonstrated
interesting analysis was done to compare the natural by pulse labeling that these particles were the site of pro-
genetic code shared by all living organisms with tein synthesis in bacteria.17 There are about 20,000 ribo-
millions of other possible triplet codes (4 nucleosomes in an E. coli cell, making up almost 25% of the
tides coding for 20 amino acids) generated by com- cells dry weight. Ribosomal structure is similar in
puter.37 The results showed that the natural code was prokaryotes and eukaryotes (see Fig. 2-3). In prokary-
signicantly more resistant to damaging changes otes, 70S ribosomes are assembled from a 30S small sub-
(mutations in the DNA sequence) compared with unit and a 50S large subunit, in association with mRNA
the other possible codes. and initiating factors (S stands for sedimentation units in
density gradient centrifugation, a method used to deter-

somes are slightly larger (80S) and more complex with a

Advanced Concepts 40S small subunit (1.3 million daltons) and a 60S subunit
(2.7 million daltons). The 40S subunit is made up of an
Once the amino acid is esteried to the tRNA, it 18S rRNA and about 30 ribosomal proteins. The 60S
makes no difference in specicity of its addition to subunit contains a 5S rRNA, a 5.8S rRNA, a 28S rRNA,
the protein. The delity of translation is now deter- and about 40 ribosomal proteins.
mined by the anticodon (complementary three bases Protein synthesis in the ribosome almost always starts
to the amino acid codon) of the tRNA as an adaptor with the amino acid methionine in eukaryotes and N-
between mRNA and the growing protein. This asso- formylmethionine in bacteria, mitochondria, and chloro-
ciation has been exploited by attaching amino acids plasts. Initiating factors that participate in the formation
synthetically to selected tRNAs. If amino acids of the ribosome complex differentiate the initiating
attached are to tRNAs carrying anticodons to UAG, methionyl tRNAs from those that add methionine inter-
UAAm or UGA, the peptide chain will continue to nally to the protein.
grow instead of terminating at the stop codon. These In protein translation, the small ribosomal subunit rst
tRNAs are called suppressor tRNAs as they can binds to initiation factor 3 (IF-3) and then to specic
suppress point mutations that generate stop codons sequences near the 5 end of the mRNA, the ribosomal
within a protein coding sequence. binding site. This guides the AUG codon (the start
codon) to the proper place in the ribosomal subunit.
Another initiation factor, IF-2 bound to GTP and the ini-
tiating tRNAMet or tRNAfMet, then joins the complex
mine sizes of proteins and protein complexes). The 30S
(Fig. 3-9). The large ribosomal subunit then associates
subunit (1 million daltons) is composed of a 16S riboso-
coordinate with the hydrolysis of GTP and release of
mal RNA (rRNA) and 21 ribosomal proteins. The 50S
GDP and phosphate, IF-2 and IF-3. The resulting func-
subunit (1.8 million daltons) is composed of a 5S rRNA,
tional 70S or 80S ribosome is the initiation complex. In
a 23S rRNA, and 34 ribosomal proteins. Eukaryotic ribo-
this complex, the tRNAMet or tRNAfMet is situated in the
peptidyl site (P site) of the functional ribosome. tRNAMet
or tRNAfMet can only bind to the P site in the ribosome,
which is formed in combination by both ribosomal sub-
Amino acyl-tRNA synthetase
units. In contrast, all other tRNAs bind to an adjacent
site, the aminoacyl site (A site) of the ribosome.
tRNA
Synthesis proceeds in the elongation step where the
Ile
Val tRNA carrying the next amino acid binds to the A site of
the ribosome in a complex with elongation factor Tu (EF-
Tu) and GTP (Fig. 3-10). The t of the incoming tRNA
takes place by recognition and then proofreading of the
Gln codon-anticodon base pairing. Hydrolysis of GTP by EF-
Phe Tu occurs between these two steps.18 The EF-Tu-GDP is
released, and the EF-Tu-GTP is regenerated by another
elongation factor, EF-Ts. Although these interactions
ensure the accurate paring of the rst two codon posi-
Thr tions, the pairing at the third position is not as stringent,
which accounts for the wobble in the genetic code.19
The rst peptide bond is formed between the amino
acids in the A and P sites by transfer of the N-formylme-
Figure 3-8 Five amino acyl tRNA synthetases. Each
enzyme is unique for a tRNA (shown in green) and its match- thionyl group to the amino group of the second amino
ing amino acid. The specicity of these enzymes is key to the acid, leaving a dipeptidyl-tRNA in the A site. This step is
delity of translation. catalyzed by an enzymatic activity in the large subunit,

Amino
acid
Ribosomal subunits
tRNA
5
mRNA 3
Components
Initiation
Recycling
5 Amino acid
3
tRNA
Elongation
Polypeptide Termination
5 5
3 3
Polypeptides More ribosomes

First ribosome attach to the 5
reaches termination end of mRNA
codon
5 3
Polyribosomal complex
Figure 3-9 Assembly of the small ribosome subunit with mRNA and then the large ribosomal subunit and charged tRNA initi-
ates RNA synthesis (initiation). Binding of charged tRNAs and formation of the peptide bond produce the growing polypeptide
(elongation). Several ribosomes can simultaneously read a single mRNA (polyribosome complex). When the complex encoun-
ters a nonsense codon, protein synthesis stops (termination), and the components are recycled.
peptidyl transferase. This activity might be mediated the A site to the P site with the release of the empty
entirely through RNA, as no proteins are in the vicinity tRNA from a third position, the E site, of the ribosome.
of the active site of the ribosome where the peptide bond This movement (translocation) of tRNAs across a dis-
formation occurs.20 After formation of the peptide bond, tance of 20 angstroms from the A to the P site and 28
the ribosome moves, shifting the dipeptidyl-tRNA from angstroms from the P to the E site requires elongation

Growing peptide
Amino
tRNA acid
Ribosome
P site
A A C
G A site
A G
A UG P site A site
C CG AU C C U A C U UGU U C CG A GU
5 3
mRNA
Ribosome
Translocation A2451
:
Peptide O H R
:N O
O
H O
A UG A A C tRNA
C CG AU C C U A C U UGU U C CG A GU tRNA
P site
5 3 A site
O R
Peptide
O
H N
O H O
tRNA tRNA
A A G
Figure 3-11 Protein synthesis (translation) as it takes place
G
A U in the ribosome. The peptide bond is formed in an area
between the large and small subunits of the ribosome. The
A A C ribozyme theory holds that the ribosome is an enzyme that
C CG AU C C U A C U UGU U C CG A GU
functions through RNA and not protein. The close proximity
5 3
of only RNA to this site is evidence for the ribozyme theory.
Figure 3-10 Incoming charged tRNAs bind to the A site of

the ribosome, guided by matching codon-anticodon pairing. During translation, the growing polypeptide begins to
After formation of the peptide bond between the incoming fold into its mature conformation. This process is assisted
amino acid and the growing peptide, the ribosome moves to
the next codon in the mRNA, translocating the peptide to the
by molecular chaperones.22 These specialized proteins
P site and creating another A site for the next tRNA. bind to the large ribosomal subunit, forming a hydropho-
bic pocket that holds the emerging polypeptide (Fig.
3-12). Chaperones apparently protect the hydrophobic
factor EF-G. As the ribosomal complex moves along the regions of unnished polypeptides until they can be
mRNA, the growing peptide chain is always attached to safely associated inside the protein. In the absence of this
the incoming amino acid. Two GTPs are hydrolyzed to activity, unnished proteins might bind to each other and
GDP with the addition of each amino acid. This energy- form nonfunctional aggregates. The DnaK protein of E.
dependent translocation occurs with shifting and rotation coli can also act as a chaperone by binding to the
of ribosomal subunits (Fig. 3-11).21 hydrophobic regions of the emerging polypeptide.23

Ribosome
3 3 3
5 5 5
mRNA
Growing polypeptide
Chaperone
Folded
peptide
Figure 3-12 Molecular chaperones catch the growing peptide as it emerges from the active site. The pep-
tide goes through stages of holding (left), folding (center), and release (right). When the protein is completely
synthesized and released from the ribosome, it should be in its folded state. This protects the nascent (grow-
ing) peptide from harmful interactions with other proteins in the cell before it has had an opportunity to form
its protective and active tertiary structure.
Termination of the amino acid chain is signaled by one may not occur in the nuclei of lower eukaryotes.28 As in
of the three nonsense, or termination, codons, UAA, procaryotes, nuclear translation may require concurrent
UAG, or UGA, which are not charged with an amino transcription.29,30
acid. When the ribosome encounters a termination codon,
termination, or release factors (R1, R2, and S in E. coli),
causes hydrolysis of the nished polypeptide from the
nal tRNA, release of that tRNA from the ribosome, and
STUDY QUESTIONS
dissociation of the large and small ribosomal subunits. In
eukaryotes, termination codonmediated binding of 1. Indicate whether the following peptides are hydro-
polypeptide chain release factors (eRF1 and eRF3) trig- philic or hydrophobic.
ger hydrolysis of peptidyl-tRNA at the ribosomal pep- a. MLWILSS
tidyl transferase center.24,25 b. VAIKVLIL
E. coli can synthesize a 300400 amino acid protein in c. CSKEGCPN
1020 seconds. Because the protein takes on its second- d. SSIQKNET
ary structure as it is being synthesized, it already has its e. YAQKFQGRT
nal conformation when it is released from the ribosome. f. AAPLIWWA
In bacteria, translation and transcription occur simulta- g. SLKSSTGGQ
neously. In nucleated cells, the majority of translation
occurs in the cytoplasm. Several lines of evidence, how- 2. Is the following peptide positively or negatively
ever, suggest that translation might also occur in the charged at neutral pH?
nucleus. One line of evidence is that nuclei contain fac- GWWMNKCHAGHLNGVYYQGGTY
tors required for translation.26,27 Furthermore, isolated
nuclei can aminoacylate tRNAs and incorporate amino 3. Consider an RNA template made from a 2:1 mixture
acids into proteins. Another support for nuclear transla- of C:A. What would be the three amino acids most
tion is that nonsense-mediated decay (NMD), degrada- frequently incorporated into protein?
tion of messenger RNAs with premature termination
codons, was proposed to occur in mammalian nuclei. 4. What is the peptide sequence encoded in
Further investigations, however, have shown that NMD AUAUAUAUAUAUAUA?

5. Write the anticodons 5 to 3 of the following amino 10. Jones D, Nishimura S, Khorana HG. Studies on
acids: polynucleotides, LVI: Further synthesis, in vitro, of
a. L copolypeptides containing two amino acids in alter-
b. T nating sequence dependent upon DNA-like poly-
c. M mers containing two nucleotides in alternating
d. H sequence. Journal of Molecular Biology 1966;
e. R 16(2):45472.
f. I 11. Crick FHC. Codon-anticodon pairing: The wobble
hypothesis. Journal of Molecular Biology 1966;
6. A protein contains the sequence LGEKKW- 19:54855.
CLRVNPKGLDESKDYLSLKSKYLLL. What is the 12. Kirino Y, Goto Y, Campos Y, et al. Specic correla-
likely function of this protein? (Note: see Box A3-4.) tion between the wobble modication deciency
7. A histone-like protein contains the sequence: in mutant tRNAs and the clinical features of a
PKKGSKKAVTKVQKKDGKKRKRSRK. What cha- human mitochondrial disease. Proceedings of the
racteristic of this sequence makes it likely to associate National Academy of Sciences 2005;102(20):
with DNA? (Note: see the Box on p. 53.) 712732.
13. Wang L, Brock A, Herberich B et al. Expanding the
References genetic code of Escherichia coli. Science 2001;292:
1. Fields S. Proteomics in genomeland. Science 498500.
2001;291:122124. 14. Doring V, Mootz HD, Nangle LA, et al. Enlarging
2. Pauling L, Corey RB. The structure of proteins; two the amino acid set of Escherichia coli by inltration
hydrogen-bonded helical congurations of the of the valine coding pathway. Science 2001;292:
polypeptide chain. Proceedings of the National 501504.
Academy of Sciences 1951;205(4):20511. 15. Hoagland MB, Keller EB, Zamecnik PC. Enzymatic
3. Pauling L, Corey RB. The pleated sheet, a new layer carboxyl activation of amino acids. Journal of
conguration of polypeptide chains. Proceedings Biological Chemistry 1956;218:34558.
of the National Academy of Sciences 1951;37(5): 16. Szymansk M, Deniziak M, Barciszewski J. The new
25156. aspects of aminoacyl-tRNA synthetases. Acta
4. Pauling L, Corey RB. The structure of synthetic Biochimica Polonica 2000;47(3):82134.
polypeptides. Proceedings of the National Academy 17. Zamecnik PC. An historical account of protein syn-
of Sciences 1951;37(5):24150. thesis with current overtone: A personalized view.
5. Pauling L, Corey RB. Atomic coordinates and struc- Cold Spring Harbor Symposium on Quantitative
ture factors for two helical congurations of Biology 1969;34:116.
polypeptide chains. Proceedings of the National 18. Ruusala T, Ehrenberg M, Kurland CG. Is there
Academy of Sciences 1951;37(5):23540. proofreading during polypeptide synthesis? EMBO
6. Benzer S. On the topography of genetic ne struc- Journal 1982;1(6):74145.
ture. Proceedings of the National Academy of 19. Ogle JM, Brodersen DE, Clemons WM Jr, et al.
Sciences 1961;47(3):40315. Recognition of cognate transfer RNA by the 30S
7. Benzer S. The ne structure of the gene. Scientic ribosomal subunit. Science 2001;292:897902.
American 1962;206(1):7084. 20. Steitz T, Moore PB. RNA, the rst macromolecular
8. Crick F, Barnett, L, Brenner, S, et al. General nature catalyst: The ribosome is a ribozyme. Trends in
of the genetic code for proteins. Nature 1961;192 Biochemical Sciences 2003;28(8):41118.
(4809):122732. 21. Yusupov M, Yusupova GZ, Baucom A, et al. Crystal
9. Nirenberg M, Leder, P, Berneld, M, et al. RNA structure of the ribosome at 5.5A resolution. Science
code words and protein synthesis, VII: On the 2001;292:88396.
general nature of the RNA code. Proceedings of the 22. Horwich A. Sight at the end of the tunnel. Nature
National Academy of Sciences 1965;53(5):116168. 2004;431:52022.

23. Deuerling E, Schulze-Specking A, Tomoyasu, T, 31. Schomburg L, Schweizer U, Kahrle J. Selenium

et al. Trigger factor and DnaK cooperate in folding and selenoproteins in mammals: Extraordinary,
of newly synthesized proteins. Nature 1999;400: essential, enigmatic. Cellular and Molecular Life
69396. Science 2004;61(16):198895.
24. Zhouravleva G, Frolova L, Le Goff X, et al. Termi- 32. Carbone F, Zinovyev A, Kepes F. Codon adaptation
nation of translation in eukaryotes is governed by index as a measure of dominating codon bias.
two interacting polypeptide chain release factors, Bioinformatics 2003;19(16):200515.
eRF1 and eRF3. EMBO Journal 1995;14(16): 33. Ma J, Zhou T, Gu W, et al. Cluster analysis of
406572. the codon use frequency of MHC genes from differ-
25. Frolova L, Merkulova TI, Kisselev LL. Transla- ent species. Biosystems 2002;65(2-3):199207.
tion termination in eukaryotes: Polypeptide 34. Van Den Bussche RA, Hansen EW. Characteriza-
release factor eRF1 is composed of functionally tion and phylogenetic utility of the mammalian
and structurally distinct domains. RNA 2000; protamine p1 gene. Molecular and Phylogenetic
6(3):38190. Evolution 2002;22(3):33341.
26. Gunasekera N, Lee SW , Kim S , et al. Nuclear 35. Landschulz W, Johnson PF, McKnight SL. The
localization of aminoacyl-tRNA synthetases using leucine zipper: A hypothetical structure common
single-cell capillary electrophoresis laser-induced to a new class of DNA binding proteins. Science
uorescence analysis. Analytical Chemistry 2004; 1988;240(4860):175964.
76(16):474146. 36. Ferre-DAmare A, Prendergast GC, Ziff EB, et al.
27. Brogna S, Sato TA, Rosbash M. Ribosome compo- Recognition by Max of its cognate DNA through
nents are associated with sites of transcription. a dimeric b/HLH/Z domain. Nature 1993;363
Molecular Cell 2002;10(4):93104. (6424):3845.
28. Kuperwasser N, Brogna S, Dower K, et al. 37. Vogel G. Tracking the history of the genetic code.
Nonsense-mediated decay does not occur within the Science 1998;281:32931.
yeast nucleus. RNA 2004;10(2):190715. 38. Sanger F, Tuppy H. The amino-acid sequence in the
29. Iborra FJ, Jackson DA, Cook PR. Coupled tran- phenylalanyl chain of insulin. II: The investigation
scription and translation within nuclei of mam- of peptides from enzymic hydrolysates. Biochemical
malian cells. Science 2001;293:113942. Journal 1951;49(4):48190.
30. Sommer P, Nehrbass U. Quality control of messen- 39. Sanger F, Tuppy H. The amino-acid sequence in
ger ribonucleoprotein particles in the nucleus and the phenylalanyl chain of insulin. I. The identica-
at the pore. Current Opinions in Cell Biology 2005; tion of lower peptides from partial hydrolysates.
17(3):294301. Biochemical Journal 1951; 49(4):46381.

SECTION 2
Common Techniques
in Molecular Biology
Nucleic Acid
Extraction Methods
OUTLINE OBJECTIVES
ISOLATION OF DNA Compare and contrast organic, inorganic, and solid-phase
Preparing the Sample approaches for isolating cellular and mitochondrial DNA.
Organic Isolation Methods
Inorganic Isolation Methods Note the chemical conditions in which DNA precipitates
Solid-Phase Isolation and goes into solution.
Crude Lysis Compare and contrast organic and solid-phase approaches
Isolation of Mitochondrial DNA for isolating total RNA.
ISOLATION OF RNA
Distinguish between the isolation of total RNA with that
Total RNA
of messenger RNA.
Extraction of Total RNA
Isolation of polyA (messenger) RNA Describe the gel-based, spectrophotometric, and uoro-
MEASUREMENT OF NUCLEIC ACID metric methods used to determine the quantity and quality
QUALITY AND QUANTITY of DNA and RNA preparations.
Electrophoresis Calculate the concentration and yield of DNA and RNA
Spectrophotometry from a given nucleic acid preparation.
Fluorometry
65

66 Section 2 Common Techniques in Molecular Biology
The purpose of extraction is to release the nucleic acid (Table 4.1). The initial steps in nucleic acid isolation
from the cell for use in subsequent procedures. Ideally, depends on the nature of the starting material.
the target nucleic acid should be free of contamination
with protein, carbohydrate, lipids, or other nucleic acid, Nucleated Cells in Suspension
i.e., DNA free of RNA or RNA free of DNA. The initial Depending on the type of clinical sample that is sent for
release of the cellular material is achieved by breaking analysis, the specimen may have to be pretreated to make
the cell and nuclear membranes (cell lysis). Lysis must nucleated cells available from which the nucleic acid will
take place in conditions that will not damage the nucleic be extracted. For instance, white blood cells (WBCs)
acid. Following lysis, the target material is puried, and must be isolated from blood or bone marrow specimens.
then the concentration and purity of the sample can be This is done by either differential density gradient cen-
determined. trifugation or differential lysis. For differential density
gradient centrifugation, whole blood or bone marrow
mixed with isotonic saline is overlaid with Ficoll.
Isolation of DNA Ficoll is a highly branched sucrose polymer that does
Although Miescher rst isolated DNA from human cells not penetrate biological membranes. Upon centrifuga-
in 1869,1 the initial routine laboratory procedures for tion, the mononuclear WBCs (the desired cells for isola-
DNA isolation were developed from density gradient tion of nucleic acid) settle into a layer in the Ficoll
centrifugation strategies. Meselson and Stahl used such a gradient that is below the less dense plasma components
method in 1958 to demonstrate semiconservative replica- and above the polymorphonuclear cells and red blood
tion of DNA.2 Later procedures made use of the differ- cells (RBCs). The layer containing the mononuclear cells
ences in solubility of large chromosomal DNA, plasmids, is removed from the tube and washed by at least two
and proteins in alkaline buffers. Large (50 kbp) chro- rounds of resuspension and centrifugation in saline before
mosomal DNA and proteins cannot renature properly proceeding with the nucleic acid isolation procedure.
when neutralized in acetate at low pH after alkaline treat- Another method used to isolate nucleated cells takes
ment, forming large aggregates instead. As a result, they advantage of the differences in the osmotic fragility of
precipitate out of solution. The relatively small plasmids RBCs and WBCs. Incubation of whole blood or bone
return to their supercoiled state and stay in solution. marrow in hypotonic buffer or water will result in the
Alkaline lysis procedures were used extensively for lysis of the RBCs before the WBCs. The WBCs are then
extraction of 150kb plasmid DNA from bacteria dur- pelleted by centrifugation, leaving the empty RBC mem-
ing the early days of recombinant DNA technology. branes (ghosts) and hemoglobin, respectively, in suspen-
sion and solution.
Preparing the Sample
Tissue Samples
Nucleic acid is routinely isolated from human, fungal,
Fresh or frozen tissue samples must be dissociated before
bacterial, and viral sources in the clinical laboratory
DNA isolation procedures can be started. Grinding the
frozen tissue in liquid nitrogen, homogenizing the tissue,
or simply mincing the tissue using a scalpel can disrupt
whole tissue samples. Fixed embedded tissue has to be
Advanced Concepts deparaffinized by soaking in xylene (a mixture of three
In surveying the literature, especially early refer- isomers of dimethylbenzene). Less toxic xylene substi-
ences, the starting material for DNA extraction had tutes, such as Histosolve, Anatech Pro-Par, or ParaClear,
to be noted because that determined which extrac- are also often used for this purpose. After xylene treat-
tion procedure was used. Extraction procedures are ment, the tissue is usually rehydrated by soaking it in
often modied to optimize the yield of specic decreasing concentrations of ethanol.
products. A procedure designed to yield plasmid
DNA does not efficiently isolate chromosomal DNA Microorganisms
and vice versa. Some bacteria and fungi have tough cell walls that must
be broken to allow the release of nucleic acid. Several

Nucleic Acid Extraction Methods Chapter 4 67
Table 4.1 Yield of DNA from Different Specimen Sources1118

Specimen Expected Yield*
Specimens adequate for analysis
without DNA amplication
Blood (1 mL, 3.510 106 WBCs/mL) 2050 g
Buffy coat (1 mL whole blood) 50200 g
Bone marrow (1 mL) 100500 g
Cultured cells (107 cells) 3070 g
Solid tissue (1 mg) 110 g
Lavage uids (10 mL) 2250 g
Mitochondria (10-mg tissue, 107 cells) 110 g
Plasmid DNA, bacterial culture, (100-mL overnight culture) 350 g1 mg
Bacterial culture (0.5 mL, 0.7 absorbance units) 1035 g
Feces (1 mg; bacteria, fungi) 2228 g
Specimens adequate for analysis
with DNA amplication
Serum, plasma, cerebrospinal uid (0.5 mL) 0.33 g
Dried blood (0.5-1cm diameter spot) 0.040.7 g
Saliva (1 mL) 515 g
Buccal cells (1 mg) 110 g
Bone, teeth (500 mg) 3050 g
Hair follicles# 0.10.2 g
Fixed tissue** (5-10 10micron sections) 650 g
Feces (animal cells, 1 mg) 2100 pg
*Yields are based on optimal conditions. Assays will vary in yield and purity of sample DNA.
DNA yield will vary with WBC count.
DNA yield will depend on type and condition of tissue.
Different bacterial types and fungi will yield more or less DNA.
DNA yield will depend on degree of cellularity.
Dried blood yield from paper is less than from textiles.
#Mitochrondrial DNA is attainable from hair shafts.
**Isolation of DNA from xed tissue is affected by the type of xative used and the age and the preliminary handling of the original specimen.
Cells in fecal specimens are subjected to digestion and degradation.
enzyme products, e.g., lyzozyme or zymolyase, that that can be immediately precipitated with alcohol (see
digest cell wall polymers are commercially available. below). DNA extracted with NaOH or boiling procedures
Alternatively, cell walls can be broken mechanically by is denatured (single-stranded) and may not be suitable for
grinding or by vigorously mixing with glass beads. methods such as restriction enzyme analysis that require
Gentler enzymatic methods are less likely to damage double-stranded DNA. The advantage of these types of
chromosomal DNA and thus are preferred for methods extraction is their speed and simplicity. Amplication
involving larger chromosomal targets as opposed to plas- methods will work with this type of DNA isolation.
mid DNA.
Treatment with detergent (1% sodium dodecyl sulfate)
Organic Isolation Methods
and strong base (0.2 M NaOH) in the presence of Tris
base, ethylenediaminetetraacetic acid (EDTA), and glu- After release of DNA from the cell, further purication
cose can also break bacterial cell walls. requires removal of contaminating proteins, lipids, car-
Boiling in 8% sucrose, 8% Triton X-100 detergent, Tris bohydrates, and cell debris. This is accomplished using a
buffer, and EDTA after lysozyme treatment releases DNA combination of high salt, low pH, and an organic mix-

DNA in DNA
aqueous precipitation
solution (ethanol)
Lysis Acidification Extraction
(NaOH, SDS) (acetic acid, (phenol,
salt) chloroform)
Cells in
suspension
Lysed cells
Cell debris
DNA
Figure 4-1 General scheme of organic DNA isolation.
ture of phenol and chloroform. The combination readily Inorganic Isolation Methods
dissolves hydrophobic contaminants such as lipids and
lipoproteins, collects cell debris, and strips away most Safety concerns in the clinical laboratory make the use of
DNA-associated proteins (Fig. 4-1). Isolation of small caustic reagents such as phenol undesirable. Methods of
amounts of DNA from challenging samples such as fungi DNA isolation that do not require phenol extraction have,
can be facilitated by pretreatment with cetyltrimethylam-
monium bromide, a cationic detergent that efficiently sep-
arates DNA from polysaccharide contamination. To avoid
RNA contamination, RNAse, an enzyme that degrades
Advanced Concepts
RNA, can be added at this point. Alternatively, RNAse Ethanol and isopropanol are used for molecular
may also be added to the resuspended DNA at the end of applications. The ethanol is one of the general use
the procedure. formulas, reagent grade. Reagent-grade alcohol
When phenol and chloroform are added to the (90.25% ethanol, 4.75% methanol, 5% isopropanol)
hydrophilic cleared cell lysate, a biphasic emulsion is denatured; that is, the ethanol is mixed with other
forms. Centrifugation will settle the hydrophobic layer components because pure 100% ethanol cannot be
on the bottom, with the hydrophilic layer on top. Lipids distilled. The isopropanol used is undenatured, or
and other hydrophobic components will dissolve in the pure, as it is composed of 99% isopropanol and 1%
lower hydrophobic phase. DNA will dissolve in the upper water with no other components.
aqueous phase. Amphiphilic components, which have The choice of which alcohol to use depends on
both hydrophobic and hydrophilic properties as well as the starting material, the size and amount of DNA
cell debris, will collect as a white precipitate at the inter- to be isolated, and the design of the method.
face between the two layers. Isopropanol is less volatile than ethanol and precip-
The upper phase containing the DNA is collected, and itates DNA at room temperature. Precipitation at
the DNA is then precipitated using ethanol or iso- room temperature reduces coprecipitation of salt.
propanol in a high concentration of salt (ammonium, Also, compared with ethanol, less isopropanol is
potassium or sodium acetate, or lithium or sodium chlo- added for precipitation; therefore, isopropanol can
ride). The ethyl or isopropyl alcohol is added to the upper be more practical for large-volume samples. For low
phase solution at 2:1 or 1:1 ratios, respectively, and the concentrations of DNA, longer precipitation times
DNA forms a solid precipitate. at freezer temperatures may be required to maxi-
The DNA precipitate is collected by centrifuga- mize the amount of DNA that is recovered. An
tion. Excess salt is removed by rinsing the pellet in important consideration to precipitating the DNA at
70% ethanol, centrifuging and discarding the ethanol freezer temperatures is that the increased viscosity
supernatant, and then dissolving the DNA pellet in rehy- of the alcohol at low temperatures will require
dration buffer, usually 10 mM Tris, 1 mM EDTA (TE), or longer centrifugation times to pellet the DNA.
water.


Sometimes, DNA preparations are intended for Precipitation of the DNA excludes hydrophilic pro-
long-term storage. The presence of the chelating teins, carbohydrates, and other residual contami-
agent EDTA protects the DNA from damage by nants still present after protein extraction. In
DNAses present in the environment. EDTA is a addition, the concentration of the DNA can be con-
component of TE buffer (10 mM Tris, 1 mM EDTA) trolled by adjusting the buffer or water volume used
and other resuspension buffers. The EDTA will also for resuspension of the pellet.
inhibit enzyme activity when the DNA is used in
various procedures such as restriction enzyme
digestion or polymerase chain reaction (PCR). One
must be careful not to dilute the DNA too far so that Solid-Phase Isolation
large volumes (e.g., more than 10% of a reaction
volume) of the DNA-EDTA solution are required. More rapid and comparably effective DNA extraction can
When DNA yield is low, as is the case with some be performed using solid matrices to bind and wash the
clinical samples, it is better to dissolve it in water. DNA. Silica-based products were shown to effectively
More of this can be used in subsequent procedures bind DNA in high salt conditions.3 Many variations on
without adding excess amounts of EDTA. Because this procedure have been developed, including use of
the entire sample will be used for analysis, protec- diatomaceous earth as a source of silica particles.4 More
tion on storage is not a concern. modern systems can be purchased with solid matrices in
the form of columns or beads. Columns come in various
sizes, depending on the amount of DNA to be isolated.
Columns used in the clinical laboratory are usually small
therefore, been developed and are used in many laborato- spin columns that t inside microcentrifuge tubes.
ries. Initially, these methods did not provide the efficient These columns are commonly used to isolate viral and
recovery of clean DNA achieved with phenol extraction; bacterial DNA from serum, plasma, or cerebrospinal
however, newer methods have proven to produce high- uid. They are also used routinely for isolation of cellular
quality DNA preparations in good yields. DNA in genetics and oncology. Preparation of samples
Inorganic DNA extraction is sometimes called salt- for isolation of DNA on solid-phase media starts with cell
ing out (Fig. 4-2). It makes use of low pH and high salt lysis and release of nucleic acids, similar to organic and
conditions to selectively precipitate proteins, leaving the inorganic procedures (Fig. 4-3). Specic buffers are used
DNA in solution. The DNA can then be precipitated as to lyse bacterial, fungal, or animal cells. Buffer systems
described above using isopropanol pelleted and resus- designed for specic applications (e.g., bacterial cell lysis
pended in TE buffer or water. or human cell lysis) are commercially available.
DNA in DNA
solution (isopropanol)
Lysis Protein
(Tris, EDTA, precipitation
SDS) (sodium
Cells in
acetate)
suspension
Lysed cells
Cell debris
Figure 4-2 Inorganic DNA

isolation. DNA


Alkaline lysis can be used to specically select for Solid matrices conjugated to specic sequences of
plasmid DNA because chromosomal DNA will not nucleic acid can also be used to select for DNA con-
renature properly upon neutralization and precipitate. taining complementary sequences by hybridization.
The denatured chromosomal DNA and protein can After removal of noncomplementary sequences, the
be removed by centrifugation before the supernatant DNA can be eluted by heating the matrix or by
containing plasmid DNA is applied to the column. breaking the hydrogen bonds chemically.
For solid-phase separation, the cell lysate is applied to Solid-phase isolation is the methodology employed for
a column in high salt buffer, and the DNA in solution several robotic DNA isolation systems such as Roche
adsorbs to the solid matrix. After the immobilized DNA MagnaPure and Qiagen BioRobot, which use magnetized
is washed with buffer, the DNA is eluted in a specic vol- glass beads or membranes to bind DNA. These systems
ume of water, TE, or other low salt buffer. The washing are nding increased use in clinical laboratories for auto-
solutions and the eluant can be drawn through the column mated isolation of DNA from blood, tissue, bone marrow,
by gravity, vacuum, or centrifugal force. DNA absorbed plasma, and other body uids. A measured amount of
to magnetic beads is washed by suspension of the beads sample, e.g., 200400 L of whole blood or 1050 mg of
in buffer and collection of the beads using a magnet tissue, in sample tubes is placed into the instrument along
applied to the outside of the tube while the buffer is aspi- with cartridges or racks of tubes containing the reagents
rated or poured off. The DNA IQ system (Promega) uses used for isolation. Reagents are formulated in sets
a magnetic resin that holds a specic amount of DNA depending on the type and amount of starting material.
(100 ng). When the DNA is eluted in 100 L, the DNA The instrument is then programmed to lyse the cells and
concentration is known, 1 ng/L, and ready for analysis. isolate and elute the DNA automatically.
DNA in
aqueous
solution
DNA adsorption
Lysis Acidification (low pH)
(supplied (supplied
reagents) reagents)
Cells in
suspension
Lysed cells
Cell debris
Wash DNA Elute DNA
(supplied (low salt)
buffer)
DNA
Figure 4-3 Isolation of DNA on solid media.


Crude Lysis (A) (B)

Deparaffinize
Tissue embedded (xylene, ethanol
Although high-quality DNA preparations are tantamount in paraffin Tumor cells wash)
to successful procedures, there are circumstances that
either preclude or prohibit extensive DNA purication. ~20 micron
These include screening large numbers of samples by sections
simple methods (e.g., electrophoresis with or without re-
Paraffin
striction enzyme digestion and some amplication proce-
Digest
dures), isolation of DNA from limited amounts of starting (proteinase K,
material, and isolation of DNA from challenging samples Tris buffer)
such as xed, paraffin-embedded tissues. In these cases,
simple lysis of cellular material in the sample will yield
Microdissection
sufficiently useful DNA for amplication procedures.
Figure 4-4 Crude extraction of DNA from xed paraffin-
embedded tissue. Selected regions of tissue are scraped
Proteolytic Lysis of Fixed Material
from slides (A) and extracted (B).
Simple screening methods are mostly used for research
purposes in which large numbers of samples must be
processed. This is usually not done in the clinical labora- lyzed by boiling. After centrifugation of the suspension,
tory. In contrast, the analysis of paraffin samples is fre- DNA in the supernatant is cooled and may be further
quently performed in the clinical laboratory. Fixed tissue extracted with chloroform before use in amplication
is more conveniently accessed in the laboratory and may procedures. This method is most commonly used in
sometimes be the only source of patient material. Thin forensic applications but may also be useful for purica-
sections are usually used for analysis, although sectioning tion of DNA from clinical samples and xed, paraffin-
is not necessary with very small samples such as needle embedded specimens.7,8
biopsies. Paraffin-embedded specimens must be dewaxed
with xylene or other agents and then rehydrated before Other Rapid Extraction Methods
nucleic acid isolation. For some tests, such as somatic With the advent of PCR, new and faster methods for
mutation analyses, a separate stained serial section can be DNA isolation have been developed. The minimal sam-
examined microscopically to identify tumor cells. The ple requirements of amplication procedures allow for
identiable areas of tumor can then be isolated directly the use of material previously not utilizable for analysis.
from the slide by simple scraping in buffer (microdissec- Rapid lysis methods (produced by Sigma or Epicentre
tion) or laser capture (Fig. 4-4) and deposited into micro- Technologies) and DNA extraction/storage cards (pro-
centrifuge tubes. duced by Whatman) provide sufficiently clean DNA that
Before lysis, cells may be washed by suspension and can be used for amplication.
centrifugation in saline or other isotonic buffer. Reagents
used for cell lysis depend on the subsequent use of the
DNA. For simple screens, cells can be lysed in detergents Isolation of Mitochondrial DNA
such as SDS or Triton. For use in PCR amplication (see There are two approaches to the isolation of mitochon-
Chapter 7), cells may be lysed in a mixture of Tris buffer drial DNA from eukaryotic cells. One method is to rst
and proteinase K. The proteinase K will digest proteins in isolate the mitochondria by centrifugation. After cell
the sample, lysing the cells and inactivating other preparations are homogenized by grinding on ice, the
enzymes. The released DNA can be used directly in the homogenate is centrifuged at low speed (7002600 g)
amplication reaction. to pellet intact cells, nuclei, and cell debris. The mito-
chondria can be pelleted from the supernatant in a second
Extraction With Chelating Resin high-speed centrifugation (10,00016,000 g). The
Chelex is a cation-chelating resin that can be used for mitochondria can be lysed with detergent and the lysate
simple extraction of DNA.5,6 A suspension of 10% chelex treated with proteinase to remove protein contaminants.
resin beads is mixed with specimen, and the cells are Mitochondrial DNA can then be precipitated with cold


When homogenizing cells for isolation of mito- Several chemical methods have been developed to
chondria, care must be taken not to overgrind the tis- inactivate or eliminate RNAses. Diethyl pyrocar-
sue and dissociate the mitochondrial membranes. bonate (DEPC) can be added to water and buffers
Grinding in alkaline buffers with reducing agents (except for Tris buffer) to inactivate RNAses perma-
such as -mercaptoethanol will protect the mito- nently. DEPC converts primary and secondary
chondria during the isolation process. A high ionic amines to carbamic acid esters. It can cross-link
strength buffer can also be used to selectively lyse RNAse proteins through intermolecular covalent
the nuclear membranes. bonds, rendering them insoluble. Because of its
effect on amine groups, DEPC will adversely affect
Tris buffers. DEPC will also interact with poly-
styrene and polycarbonate and is not recommended
ethanol and resuspended in water or appropriate buffers for use on these types of materials.
for analysis. Other RNAse inhibitors include vanandyl-ribonu-
The second approach to mitochondrial DNA prepara- cleoside complexes, which bind the active sites of
tion is to isolate total DNA as described above. The the RNAse enzymes, and macaloid clays, which
preparation will contain mitochondrial DNA that can be absorb the RNAse proteins. Ribonuclease inhibitor
analyzed within the total DNA background by hybridiza- proteins can be added directly to RNA preparations.
tion or PCR. These proteins form a stable noncovalent complex
with the RNAses in solution. Some of these interac-
Isolation of RNA tions require reducing conditions; therefore, dithio-
threitol must be added in addition to the inhibitor.
Working with RNA in the laboratory requires strict pre-
cautions to avoid sample RNA degradation. RNA is espe- H2 O O O CH2
C C C C
cially labile due to the ubiquitous presence of RNAses.
These enzymes are small proteins that can renature, even O O
after autoclaving, and become active. Unlike DNAses,
Diethyl pyrocarbonate.
RNAses must be eliminated or inactivated before isola-
tion of RNA. They remain active at a wide range of tem-
peratures (e.g., below -20oC and can renature even after
heating). more detailed discussion of RNA type and structure.) The
It is useful to allocate a separate RNAse-free (RNF) most abundant (80%-90%) RNA in all cells is ribosomal
area of the laboratory for storage of materials and speci- RNA (rRNA). This RNA consists of two components,
men handling. Gloves must always be worn in the RNF large and small, which are visualized by agarose gel elec-
area. Disposables (tubes, tips, etc.) that come in contact trophoresis (see Fig. 4-9). Depending on the cell type and
with the RNA should be kept at this location and never be conditions, the next most abundant RNA fraction (2.5%-
touched by ungloved hands. Articles designated DNAse- 5%) is messenger RNA (mRNA). This mRNA may be
free/RNF by suppliers may be used directly from the detected as a faint background underlying the rRNA
package. Reusable glassware is seldom used for RNA detected by agarose gel electrophoresis. Transfer RNA
work. After cleaning, glassware must be baked for 46 and small nuclear RNAs are also present in the total RNA
hours at 400oC to inactivate the RNAses. sample.
Total RNA Extraction of Total RNA

There are several types of naturally occurring RNA in Preparation of specimen material for RNA extraction dif-
prokaryotes and eukaryotes. (Refer to Chapter 2 for a fers in some respects than for DNA extraction. Reticulo-

alcohol (25:24:1) solution efficiently extracts RNA.

Advanced Concepts Chloroform enhances the extraction of the nucleic acid
by denaturing proteins and promoting phase separation.
Specialized collection tubes are available for the Isoamyl alcohol prevents foaming. For RNA, the organic
isolation of RNA from whole blood (e.g., from phase must be acidic (ph 45). The acidity of the organic
Qiagen or Applied Biosystems). These tubes contain phase can be adjusted by overlaying it with buffer of the
proprietary reagents that stabilize the intracellular appropriate pH. In some isolation procedures, DNAse is
RNA for several days at room temperature and added at the lysis step to eliminate contaminating DNA.
longer at refrigerator temperature. The RNA can be Alternatively, RNAse-free DNAse also may be added
isolated on a solid matrix. directly to the isolated RNA at the end of the procedure.
After phase separation, the upper aqueous phase contain-
ing the RNA is removed to a clean tube, and the RNA is
cytes in blood and bone marrow samples are lysed by precipitated by addition of two volumes of ethanol or one
osmosis or separated from WBCs by centrifugation. volume of isopropanol. Glycogen or yeast-transfer RNA
When dissociating tissue, the sample should be kept may be added at this step as a carrier to aid RNA pellet
frozen in liquid nitrogen or immersed in buffer that will formation. The RNA precipitate is then washed in 70%
inactivate intracellular RNAses. This is especially true ethanol and resuspended in RNF buffer or water.
for tissues such as pancreas that contain large amounts of Solid-phase separation of RNA begins with similar
innate RNAses. Bacterial and fungal RNA are also iso- steps as described above for organic extraction. The
lated by chemical lysis or by grinding in liquid nitrogen. strong denaturing buffer conditions must be adjusted
Viral RNA can be isolated directly from serum or other before application of the lysate to the column (Fig. 4-6).
cell-free uids by means of specially formulated spin In some procedures, ethanol is added at this point. Some
columns or beads. As most total RNA isolation methods systems provide a lter column to remove particulate
cannot distinguish between RNA from microorganisms material before application to the adsorption column. As
and those from host cells, cell-free material should be with DNA columns, commercial reagents are supplied
used for these isolations. with the columns to optimize RNA adsorption and wash-
The cell lysis step for RNA isolation is done in deter- ing on the silica-based matrix.
gent or phenol in the presence of high salt (0.20.5 M The lysate is applied to a column in high-salt
NaCl) or RNAse inhibitors. Guanidine thiocyanate is a chaotropic buffer, and the adsorbed RNA is washed with
strong denaturant of RNAses and can be used instead supplied buffers. DNAse can be added directly to the
of high salt buffers. Strong reducing agents such as 2- adsorbed RNA on the column to remove contaminating
mercaptoethanol can also be added during this step. DNA. Washing solutions and the eluant can be drawn
Once the cells are lysed, proteins can be extracted through the column by gravity, vacuum, or centrifugal
with phenol (Fig. 4-5). Acid phenol:chloroform:isoamyl force. Small columns of silica-based material that t
RNA in RNA
solution) (ethanol)
Lysis Extraction
(guanidinium (phenol,
isothiocyanate) chloroform)
Cells in
suspension
Lysed cells
Figure 4-5 Organic extraction

of total RNA. RNA

RNA adsorption
Lysis (low pH)
(supplied
reagents)
Cells in
suspension
Lysed cells
Wash RNA Elute RNA

(supplied
buffer)
RNA
Figure 4-6 Isolation of RNA on a solid matrix.
inside microfuge tubes (spin columns) are widely used

for routine nucleic acid isolation from all types of speci- Table 4.2 Yield of RNA From Various
Specimen Sources19-21
mens. The eluted RNA is usually of sufficient concentra-
Specimen Expected
tion and purity for direct use in most applications.
Yield*
Generally, 1 million eukaryotic cells or 1050 mg of
tissue will yield about 10 g of RNA. The yield of RNA Blood (1 mL, 3.5-10 106 110 g
from biological uids will depend on the concentration WBCs/mL)
of microorganisms or other target molecules present in Buffy coat (1 mL whole blood) 510 g
the specimen (Table 4.2). Bone marrow (1 mL) 50200 g
Cultured cells (107 cells) 50150 g
Isolation of polyA (messenger) RNA Buccal cells (1 mg) 110 g
Solid tissue (1 mg) 0.54 g
As previously stated, approximately 80%90% of total
Fixed tissue (1 mm3) 0.23 g
RNA is rRNA. Often the RNA required for analysis is
Bacterial culture (0.5 mL, 10100 g
mRNA, accounting for only about 2.5%5% of the
0.7 absorbance units)
total RNA yield. The majority of mRNA consists of
*Specimen handling especially effects RNA yield. Isolation of polyA RNA
mRNA from highly expressed genes. Rare or single
will result in much lower yields. See text.
copy mRNA is, therefore, a very minor part of the total RNA yield will depend on WBC count.
RNA isolation. To enrich the yield of mRNA, especially RNA yield will depend on type of cells and the conditions of cell
rare transcripts, protocols employing oligomers of culture.
thymine or uracil immobilized on a matrix resin column Liver, spleen, and heart tissues yield more RNA than brain, lung, ovary,
kidney, or thymus tissues.
or beads are often used (Fig. 4-7). The polyT or polyU
Isolation of RNA from xed tissue is especially affected by the type
oligomers will bind the polyA tail found exclusively on of xative used and the age and the preliminary handling of the original
mRNA. After washing away residual RNA, polyA RNA specimen.
is eluted by washing the column with warmed, low-salt Different bacterial types and fungi will yield more or less RNA.

Measurement of Nucleic
mRNA Acid Quality and Quantity
5 A A A A A A A A A 3
3 T T T T T T T T T 5
Laboratory analysis of nucleic acids produces variable
results, depending on the quality and quantity of input
material. This is an important consideration in the clini-
cal laboratory, as test results must be accurately inter-
Bead or column preted with respect to disease pathology. Consistent
Figure 4-7 Oligo polythymine columns or beads bind the results require that run-to-run variation be minimized.
polyA tail of mRNA. The oligo can be poly uracil. Peptide
Fortunately, measurement of the quality and quantity of
nucleic acid dU or dT can also be used.
DNA and RNA is straightforward.
buffer containing detergent. With this approach, approxi-

Electrophoresis
mately 3040 ng of mRNA can be obtained from 1 g of
total RNA. DNA and RNA can be analyzed for quality by resolving
There are limitations to the isolation of polyA RNA an aliquot of the isolated sample on an agarose gel (Fig.
using oligo dT or dU. The efficiency of polyA and polyU 4-8; see Chapter 5 for a more detailed discussion of elec-
binding is variable. Secondary structure (intrastrand or trophoresis). Fluorescent dyes such as ethidium bro-
interstrand hydrogen bonds) in the target sample may mide or SybrGreen I bind specically to DNA and are
compete with binding to the capture oligomer. Also, used to visualize the sample preparation. Ethidium bro-
mRNAs with short polyA tails may not bind efficiently or mide or SybrGreen II can be used to detect RNA. Less
at all. AT-rich DNA fragments might also bind to the col- frequently, silver stain has been used to detect small
umn and not only compete with the desired mRNA target amounts of DNA by visual inspection.
but also contaminate the nal eluant. Potential digestion The appearance of DNA on agarose gels depends on
of the oligo-conjugated matrices precludes the use of the type of DNA isolated. A good preparation of plasmid
DNase on the RNA before it is bound to the column. DNA will yield a bright, moderate-mobility single band
Treatment of the eluant with RNase-free DNase is possi- of supercoiled plasmid DNA with minor or no other
ble, but the DNase should be inactivated if the mRNA is bands that represent nicked or broken plasmid (see Fig.
to be used in procedures involving DNA components. 4-8). High-molecular-weight genomic DNA should col-
Furthermore, rRNA can copurify with the polyA RNA. lect as a bright band with low mobility (near the top of
The nal puried product, then, is enriched in polyA the gel in Fig. 4-9). A high-quality preparation of RNA
RNA but is not a pure polyA preparation. will yield two distinct bands of rRNA. The integrity of
L N, SC
M SC N/R L Nicked/relaxed
Figure 4-8 After agarose gel elec-
trophoresis, compact supercoiled plasmid
DNA (SC) will travel farther through the gel 23 kb
than nicked plasmid (N), which has single-
strand breaks. Relaxed plasmid DNA (R)
has double-strand breaks and will migrate
according to its size, 23 kb in the drawing
on the left. Linear (L) plasmids migrate Linear
according to the size of the plasmid. A gel 0.6 kb
photo shows a plasmid preparation. Supercoiled
(nicked, N; supercoiled, SC; linear, L;
relaxed, R; molecular weight markers, M)

28S rRNA
18S rRNA
Genomic
DNA
Figure 4-9 Intact ethidium bromidestained human chromosomal DNA (left) and total RNA (right) after
agarose gel electrophoresis. High-quality genomic DNA runs as a tight smear close to the loading wells.
High-quality total RNA appears as two rRNA bands (shown with molecular weight markers, M).
these bands is an indication of the integrity of the other DNA, 40 for RNA). The relationship of concentration to
RNA species present in the same sample. If these bands absorbance is expressed as
are degraded (smeared) or absent, the quality of the RNA A bc
in the sample is deemed unacceptable for use in molecu- where A absorbance, molar absorptivity (L/mol-
lar assays. cm), b path length (cm), and c concentration (mg/L).
When uorescent dyes are used, DNA and, less accu- The absorbance at this wavelength is thus directly propor-
rately, RNA can be quantitated by comparison of the u- tional to the concentration of the nucleic acid in the sam-
orescence intensity of the sample aliquot run on the gel ple. Using the absorptivity as a conversion factor from
with that of a known amount of control DNA or RNA optical density to concentration, one optical density unit
loaded on the same gel. Densitometry of the band inten- (or absorbance unit) at 260 nm is equivalent to 50 mg/L
sities gives the most accurate measurement of quantity. (or 50 g/mL) of DNA and 40 g/mL of RNA. To deter-
For some procedures, estimation of DNA or RNA quan- mine concentration, multiply the spectrophotometer read-
tity can be made by visual inspection. ing in absorbance units by the appropriate conversion
factor. Phenol absorbs ultraviolet light at 270275 nm,
close to the wavelength of maximum absorption by
Spectrophotometry
nucleic acids. This means that residual phenol from
Nucleic acids absorb light at 260 nm through the adenine organic isolation procedures can increase 260 readings, so
residues. Using the Beer-Lambert Law, concentration can phenol contamination must be avoided when measuring
be determined from the absorptivity constants (50 for concentration at 260 nm.

Most DNA and RNA preparations are of sufficient con-

centration to require dilution before spectrophotometry
in order for the reading to fall within the linear reading
Advanced Concepts
range (0.050.800 absorbance units, depending on the Newer models of ultraviolet spectrophotometers
instrument). If the sample has been diluted before read- dedicated to nucleic acid analysis can be pro-
ing, the dilution factor must be included in the calculation grammed to do the calculations described. The oper-
of quantity. Multiply the absorbance reading by the con- ator must enter the type of nucleic acid, the dilution
version factor and the dilution factor to nd the concen- factor, and the desired conversion factor. The instru-
tration of nucleic acid. ment will automatically read the sample at both
Example 1. A DNA preparation diluted 1:100 yields wavelengths and do the required calculations, giving
an absorbance reading of 0.200 at 260 nm. To obtain the a reading of concentration in g/mL and a 260
concentration in g/mL, multiply: nm/280 nm ratio.
0.200 absorbance units 50 g/mL per absorbance
unit 100 1000 g/mL
The yield of the sample is calculated using the volume analysis are not affected by contaminating RNA, in which
of the preparation. If in the case illustrated above, the case the DNA is still suitable for use. If, however, RNA
DNA was eluted or resuspended in a volume of 0.5 mL, may interfere or react with DNA detection components,
the yield would be: RNase should be used to remove the contaminating RNA.
Because it is difficult to detect contaminating DNA in
1000 g/mL 0.5 mL 500 g
RNA preparations, RNA should be treated with RNase-
Example 2. An RNA preparation diluted 1:10 yields free DNase where DNA contamination may interfere.
an absorbance reading of 0.500 at 260 nm. The concen-
tration is:
Fluorometry
0.500 absorbance units 40 g/mL per absorbance
unit 10 200 g/mL Fluorometry or uorescent spectroscopy measures uo-
rescence related to DNA concentration in association
The yield of the sample is calculated using the volume
with DNA-specic uorescent dyes. Early methods used
of the preparation. If in the case illustrated above, the
3,5-diaminobenzoic acid 2HCl (DABA).9 This dye com-
DNA was eluted or resuspended in 0.2 mL, the yield
bines with alpha methylene aldehydes (deoxyribose) to
would be:
yield a uorescent product. It is still used for the detec-
200 g/mL 0.2 mL 40 g tion of nuclei and as a control for hybridization and spot
Spectrophotometric measurements also indicate the integrity in microarray analyses.
quality of nucleic acid. Protein absorbs light at 280 nm More modern procedures use the DNA-specic dye
through the tryptophane residues. The absorbance of the Hoechst 33258 {2-[2-(4-hydroxyphenyl)-(6-benzimida-
nucleic acid at 260 nm should be 1.62.00 times more zol)]-6-(1-methyl-4-piperazyl)-benzimidazol/.3HCl}.
than the absorbance at 280 nm. If the 260 nm/280 nm This dye combines with adenine-thymine base pairs in
ratio is less than 1.6, the nucleic acid preparation may be the minor groove of the DNA double helix and is thus
contaminated with unacceptable amounts of protein and specic for intact double-stranded DNA. This binding
not of sufficient purity for use. Such a sample can be specicity for A-T residues however, complicates meas-
improved by reprecipitating the nucleic acid or repeating urements of DNA that have unusually high or low GC
the protein removal step of the isolation procedure. It content. A standard measurement is required to determine
should be noted that low pH can affect the 260 nm/280 concentration by uorometry, and this standard must have
nm ratio. Somewhat alkaline buffers (pH 7.5) are recom- GC content similar to that of the samples being measured.
mended for accurate determination of purity. RNA Calf thymus DNA (GC content 50%) is often used as a
affords a somewhat higher 260 nm/280 nm ratio, 2.02.3. standard for specimens with unknown DNA GC content.
A DNA preparation with a ratio higher than 2.0 may be Fluorometric determination of DNA concentration using
contaminated with RNA. Some procedures for DNA Hoechst dye is very sensitive (down to 200 ng DNA/mL).

PicoGreen and OliGreen (Molecular Probes, Inc.) are

other DNA-specic dyes that can be used for uoromet- STUDY QUESTIONS
ric quantitation. Due to brighter uorescence upon bind-
ing to double-stranded DNA, PicoGreen is more sensitive DNA Quantity/Quality
than Hoechst dye (detection down to 25 pg/mL concen-
trations). Like Hoechst dye, single-stranded DNA and 1. Calculate the DNA concentration in g/mL from the
RNA do not bind to PicoGreen. OliGreen is designed to following information:
bind to short pieces of single-stranded DNA (oligonu- a. Absorbance reading at 260 nm from a 1:100 dilu-
cleotides). This dye will detect down to 100 pg/mL of tion 0.307
single-stranded DNA. OliGreen will not uoresce when b. Absorbance reading at 260 nm from a 1:50 dilu-
bound to double-stranded DNA or RNA. tion 0.307
RNA may be measured in solution using SybrGreen II c. Absorbance reading at 260 nm from a 1:100 dilu-
RNA gel stain.10 Intensity of SyBrGreen II uorescence is tion 0.172
less with polyadenylated RNA than with total RNA by d. Absorbance reading at 260 nm from a 1:100 dilu-
20%26%. The sensitivity of this dye is down to 2 ng/mL. tion 0.088
SybrGreen II, however, is not specic to RNA and will
bind and uoresce with double-stranded DNA as well. 2. If the volume of the above DNA solutions was 0.5
Contaminating DNA must, therefore, be removed in order mL, calculate the yield for a.d.
to get an accurate determination of RNA concentration.
Fluorometry measurements require calibration of the 3. Three DNA preparations have the following A260
instrument with a known amount of standard before and A280 readings:
every run. For methods using Hoechst dye, the dye is
diluted to a working concentration of 1 g/mL in water. Sample OD260 OD280
The dye is then mixed with the sample (usually a dilution 1 0.419 0.230
of the sample). Once the dye and sample solution are 2 0.258 0.225
mixed, uorescence must be read within 2 hours because
the dye/sample complex is stable only for approximately 3 0.398 0.174
this amount of time. The uorescence is read in a quartz
cuvette. A programmed uorometer will read out a con- For each sample, based on the A260/ A280 ratio, is
centration based on the known standard calibration. each preparation suitable for further use? If not,
Absorption and uorometry readings may not always what is contaminating the DNA?
agree. First, the two detection methods recognize differ-
ent targets. Single nucleotides do not bind to uorescent RNA Quantity/Quality
dyes, but they can absorb ultraviolet light and affect spec-
trometric readings. Furthermore, absorption measure- 1. Calculate the RNA concentration in g/mL from the
ments do not distinguish between DNA and RNA, so following information:
contaminating RNA may be factored into the DNA meas- a. Absorbance reading at 260 nm from a 1:100 dilu-
urement. RNA does not enhance uorescence of the u- tion 0.307
orescent dyes and is thus invisible to uorometric b. Absorbance reading at 260 nm from a 1:50 dilu-
detection. In fact, specic detection of RNA in the pres- tion 0.307
ence of DNA in solution is not yet possible. The decision c. Absorbance reading at 260 nm from a 1:100 dilu-
which instrument to use is at the discretion of the labora- tion 0.172
tory. Most laboratories use spectrophotometry because d. Absorbance reading at 260 nm from a 1:100 dilu-
the samples can be read directly without staining or mix- tion 0.088
ing with dye. For methods that require accurate measure-
ments of low amounts of DNA or RNA (in the 2. If the volume of the above RNA solutions was 0.5 mL,
10100ng/mL range), uorometry may be preferred. calculate the yield for a.d.

3. An RNA preparation has the following absorbance 12. Dani S, Gomes-Ruiz AC, Dani MAC. Evaluation
readings: of a method for high yield purication of largely
A260 0.208 intact mitochondrial DNA from human placentae.
A280 0.096 Genetic and Molecular Research 2003;2(2):
17884.
Is this RNA preparation satisfactory for use? 13. Leal-Klevezas D, Martnez-Vzquez IO, Cuevas-
Hernndez B, et al. Antifreeze solution improves
References DNA recovery by preserving the integrity of
1. Mirsky AE. The discovery of DNA. Scientic pathogen-infected blood and other tissues. Clini-
American 1968;218(6):7888. cal and Diagnostic Laboratory Immunology
2. Meselson M, Stahl FW. The replication of DNA in 2000;7(6):94546.
Escherichia coli. Proceedings of the National 14. ORourke D, Hayes MG, Carlyle SW. Ancient
Academy of Sciences 1958;44:67182. DNA studies in physical anthropology. Annual
3. Vogelstein GD. Preparative and analytical purica- Review of Anthropology 2000;29:21742.
tion of DNA from agarose. Proceedings of the 15. Shia S-R, Cotea RJ, Wub L, et al. DNA extraction
National Academy of Sciences 1979;76:61519. from archival formalin-xed, paraffin-embedded
4. Carter MJ., Milton ID. An inexpensive and simple tissue sections based on the antigen retrieval princi-
method for DNA purications on silica particles. ple: Heating under the inuence of pH. Journal
Nucleic Acids Research 1993;21(4):1044. of Histochemistry and Cytochemistry 2002;50:
5. Walsh P, Metzger DA, Higuchi R. Chelex 100 as a 100511.
medium for simple extraction of DNA for PCR- 16. Cao W, Hashibe M, Rao J-Y, et al. Comparison
based typing from forensic material. BioTechniques of methods for DNA extraction from paraffin-
1991;10(4):50613. embedded tissues and buccal cells. Cancer Detec-
6. de Lamballerie X, Zandotti C, Vignoli C, et al. A tion and Prevention 2003;27:397404.
one-step microbial DNA extraction method using 17. Blomeke B, Bennett WP, Harris CC, et al. Serum,
Chelex 100 suitable for gene amplication. plasma and paraffin-embedded tissues as sources
Research in Microbiology (Paris) 1992;143(8): of DNA for studying cancer susceptibility genes.
78590. Carcinogenesis 1997;18:127175.
7. de Lamballerie X, Chapel F, Vignoli C, et al. 18. McOrist A, Jackson M, Bird AR. A comparison of
Improved current methods for amplication of ve methods of extraction of bacterial DNA from
DNA from routinely processed liver tissue by PCR. human faecal samples. Journal of Microbiological
Journal of Clinical Pathology 1994;47:46667. Methods 2002;50:13139.
8. Coombs N, Gough AC, Primrose JN. Optimisa- 19. Barbaric D, Dalla-Pozza L, Byrne JA. A reliable
tion of DNA and RNA extraction from archival method for total RNA extraction from frozen
formalin-xed tissue. Nucleic Acids Research human bone marrow samples taken at diagnosis
1999;27(16):e12. of acute leukaemia. Journal of Clinical Pathology
9. Kissane J, Robins E. The uorometric measurement 2002;55(11):86567.
of deoxyribonucleic acid in animal tissues with 20. Byers R, Roebuck J, Sakhinia E, et al. PolyA
special reference to the central nervous system. PCR amplication of cDNA from RNA extracted
Journal of Biological Chemistry 1958;233:18488. from formalin-xed paraffin-embedded tissue.
10. Schmidt D, Ernst JD. A uorometric assay for the Diagnostic Molecular Pathology 2004;13(3):1
quantication of RNA in solution with nanogram 4450.
sensitivity. Analytical Biochemistry 1995;232: 21. Medeiros M, Sharma VK, Ding R, et al. Optimiza-
14446. tion of RNA yield, purity, and mRNA copy number
11. Aplenc R, Orudjev E, Swoyer J, et al. Differential by treatment of urine cell pellets with RNA later.
bone marrow aspirate DNA yields from commercial Journal of Immunological Methods 2003;279
extraction kits. Leukemia 2002;16(9):186566. (1-2):13542.
Resolution and
Detection of
Nucleic Acids
OUTLINE OBJECTIVES
ELECTROPHORESIS Explain the principle and performance of electrophoresis
GEL SYSTEMS as it applies to nucleic acids.
Agarose Gels Compare and contrast the agarose and polyacrylamide gel
Polyacrylamide Gels polymers commonly used to resolve nucleic acids, and
Capillary Electrophoresis
state the utility of each polymer.
BUFFER SYSTEMS
Buffer Additives Explain the principle and performance of capillary elec-
trophoresis as it is applied to nucleic acid separation.
ELECTROPHORESIS EQUIPMENT
GEL LOADING Give an overview of buffers and buffer additives used in
electrophoretic separation, including the constituents, pur-
DETECTION SYSTEMS
Nucleic AcidSpecic Dyes
pose, and importance.
Silver Stain Describe the general types of equipment used for elec-
trophoresis and how samples are introduced for elec-
trophoretic separation.
Compare and contrast pulse eld gel electrophoresis and
regular electrophoresis techniques with regards to method
and applications.
Compare and contrast detection systems used in nucleic
acid applications.
80

Resolution and Detection of Nucleic Acids Chapter 5 81
Resolution and detection of nucleic acids are done in sev-

eral ways. Gel and capillary electrophoresis are the most
practical and frequently used methods. DNA can also be
spotted and detected using specic hybridization probes,
as will be described in Chapter 10.
+
Electrophoresis
Electrophoresis is the movement of molecules by an
electric current. This can occur in solution, but it is prac- +
tically done in a matrix to limit migration and contain the
migrating material. Electrophoresis is routinely applied Figure 5-1 Horizontal (left) and vertical (right) gel elec-
to the analysis of proteins and nucleic acids. Each phos- trophoresis. In both formats, sample is introduced into the gel
at the cathode end (small arrows) and migrates with the cur-
phate group on a DNA polymer is ionized, making DNA rent toward the anode.
a negatively charged molecule. Under an electric current,
DNA will migrate toward the positive pole (anode).
When DNA is applied to a macromolecular cage such as Gel Systems
agarose or polyacrylamide, its migration under the pull
of the current is impeded, depending on the size of the Gel matrices provide resistance to the movement of mol-
DNA and the spaces in the gel. Because each nucleotide ecules under the force of the electric current. They pre-
has one negative charge, the charge-to-mass ratio of mol- vent diffusion and reduce convection currents so that the
ecules of different sizes will remain constant. DNA frag- separated molecules form a dened group, or band.
ments will therefore migrate at speeds inversely related The gel can then serve as a support medium for analysis
to their size. Electrophoresis can be performed in tubes, of the separated components. These matrices must be
slab gels, or capillaries. Slab gel electrophoresis can have unaffected by electrophoresis, simple to prepare and
either a horizontal or vertical format (Fig. 5-1). amenable to modication. Agarose and polyacrylamide
are polymers that meet these criteria.
Agarose Gels
Advanced Concepts Agarose is a polysaccharide polymer extracted from sea-
weed. It is a component of agar used in bacterial culture
Double-stranded DNA and RNA are analyzed by
dishes. Agarose is a linear polymer of agarobiose, which
native gel electrophoresis. The relationship between
consists of 1,3-linked--D-galactopyranose and 1,4-
size and speed of migration can be improved by sep-
linked 3,6-anhydro--L-galactopyranose (Fig. 5-2).
arating single-stranded nucleic acids; however, both
DNA and RNA favor the double-stranded state.
Unpaired, or denatured, DNA and RNA must, O
6 CH2OH
therefore, be analyzed in conditions that prevent the 5 3 2
O
hydrogen bonding between complementary sequen- OH O OH
OH 1
ces. These conditions are maintained through a 4
1 4
6 CH2
combination of formamide mixed with the sample, O

O 2 5 O
urea mixed with the gel, and/or heat-denaturing 3
electrophoresis. OH
Figure 5-2 Agarobiose is the repeating unit of agarose.

Hydrated agarose gels in various concentrations,

buffers, and sizes can be purchased ready for use. Alter-
natively, agarose can be purchased and stored in the labo-
Advanced Concepts
ratory in powdered form. For use, powdered agarose is The physical characteristics of the agarose gel can
suspended in buffer, heated, and poured into a mold. The be modied by altering its polymer length and heli-
concentration of the agarose dictates the size of the spaces cal parameters. Several types of agarose are thus
in the gel and will, therefore, be determined by the size of available for specic applications. The resolving
DNA to be resolved (Table 5.1). Small pieces of DNA properties differ in these preparations as well as the
(50500 bp) are resolved on more concentrated agarose gelling properties. Low-melting agarose is often
gels, e.g., 2%3% (Fig. 5-3). Larger fragments of DNA used for re-isolating resolved fragments from the
(200050,000) are best resolved in lower agarose concen- gel. Other agarose types give better resolution of
trations, e.g., 0.5%1%. Agarose concentrations above larger or smaller fragments. Modern agarose prepa-
5% and below 0.5% are not practical. High-concentration rations are sufficiently pure to avoid problems such
agarose will impede migration, whereas very low concen- as electroendosmosis, a solvent ow toward one of
trations produce a weak gel with limited integrity. the electrodes, usually the cathode (negative), in
opposition to the DNA or RNA migration. This
slows and distorts the migration of the samples,
2% 4% 5%
reducing resolution and smearing the bands.
500 bp
Pulsed Field Gel Electrophoresis
Very large, i.e., 50,000250,000 bp, pieces of DNA can-
500 bp not be resolved efficiently by simple agarose elec-
trophoresis. Even in the lowest concentrations of agarose,
megabase fragments are too severely impeded for correct
200 bp
resolution (referred to as limiting mobility). Limiting
mobility is reached when a DNA molecule can move
200 bp only lengthwise through successive pores of the gel, a
process called reptation.
For genomic-sized DNA molecules, pulses of current
800 bp
applied to the gel in alternating dimensions enhance
500 bp Table 5.1 Choice of Agarose Concentration

for DNA Gels*10
Agarose Concentration (%) Separation Range (size in bp)
50 bp
0.3 500060,000
0.6 100020,000
200 bp 0.8 80010,000
1.0 4008000
50 bp 1.2 3007000
1.5 2004000
2.0 1003000
50 bp *The table shows the range of separation for linear double-stranded DNA
molecules in TAE agarose gels with regular power sources. Note that these
Figure 5-3 Resolution of double-stranded DNA fragments values may be affected if another running buffer is used and if voltage is
on 2%, 4%, and 5% agarose. over 5 V/cm.

Table 5.2 Choice of Polyacrylamide Concentration

for DNA Gels*10 Advanced Concepts
Acrylamide Concentration (%) Separation Range (size in bp) Field inversion gel electrophoresis (FIGE) is a spe-
3.5 1001000 cial modication of PFGE in which the alternating
5.0 80500 currents are aligned 180 with respect to each other.
8.0 60400 The current pulses must be applied at different
12.0 40200 strength and/or duration so that the DNA will make
20.0 10100 net progress in one dimension. The parameters for
*The indicated gures are referring to gels run in TBE buffer. Voltages this type of separation must be matched to the DNA
over 8 V/cm may affect these values. being separated so that both large and small frag-
ments of the DNA sample have time to reorient
properly. For example, if timing is not sufficient for
migration. This process is called pulsed eld gel elec-
reorientation of the large fragments, small fragments
trophoresis (PFGE) (Fig. 5-4). The simplest approach to
will preferentially reorient and move backward and
this method is eld inversion gel electrophoresis (FIGE).1
gradually lose distance with respect to the large mol-
FIGE works by alternating the positive and negative elec-
ecules, which will continue forward progress on the
trodes during electrophoresis. In this type of separation,
next pulse cycle. Unlike PFGE that requires special
the DNA goes periodically forward and backward. This
equipment, FIGE can be done in a regular gel appa-
method requires temperature control and a switching
ratus; however, its upper resolution limit is 2
mechanism. Contour-clamped homogeneous electric
megabases compared with 5 megabases for PFGE.
eld,2 transverse alternating eld electrophoresis,3 and
rotating gel electrophoresis 4,5 are examples of commonly
used pulsed eld or transverse angle reorientation elec-
trophoresis. These systems require a special gel box with
a special electrode and gel conguration as well as appro-
priate electronic control for switching the electric elds
FIGE TAFE during electrophoresis. Using PFGE, the large fragments
are resolved, not only by sifting through the spaces in the

polymer but also by their reorientation and the time nec-

essary to realign themselves to move in a second dimen-
+
Above
gel sion, usually an angle of 120 (180 for FIGE) from the
Below original direction of migration.
gel DNA to be resolved by these methods must be pro-
+ + tected from breakage and shearing. Therefore, specimens
are immobilized in an agarose plug before cell lysis.
RGE CHEF Further treatment of the DNA, e.g., with restriction

enzymes, is also performed while the DNA is immobi-

lized in the agarose plug. After treatment, the plug is
inserted directly into the agarose gel for electrophoresis.
+ PFGE instruments are designed to apply current in alter-
nating directions at specic times (called the switch
interval) that are set by the operator. These parameters
+
+ are based on the general size of the fragments to be ana-
lyzed; i.e., a larger fragment will require a longer switch
Figure 5-4 Field inversion gel electrophoresis (FIGE),
interval. PFGE is a slow migration method. Sample runs
contour-clamped homogeneous electric eld (CHEF), trans-
verse alternating eld electrophoresis (TAFE), and rotating gel will take 24 hours or more.
electrophoresis (RGE) are all examples of pulsed eld gel con- Alternating eld electrophoresis is used for applica-
gurations. Arrows indicate the migration path of the DNA. tions that require the resolution of chromosome-sized

CH2 CH CH2 CH CH2 CH CH2 CH CH2 CH

Persulfate
C O + C O C O C O C O
TEMED
NH2 NH NH2 NH NH2
Acrylamide CH2 CH2
NH NH2 NH NH2
C O C O C O C O
CH2 CH CH2 CH Figure 5-5 The repeating

CH2 CH CH2 CH
H unit of polyacrylamide is acry-
BIS lamide; bis introduces branches
Polyacrylamide into the polymer.
fragments of DNA such as in bacterial typing for epi-

demiological purposes. Digestion of genomic DNA with
restriction enzymes will yield a band pattern specic to
each type of organism. By comparing band patterns, the
similarity of organisms isolated from various sources can
800 bp
be assessed. This information is especially useful in
determining the epidemiology of infectious diseases,
e.g., identifying whether two biochemically identical iso-
lates have a common source. This will be discussed in
more detail in Chapter 12.
Polyacrylamide Gels
500 bp
Very small DNA fragments and single-stranded DNA are
best resolved on polyacrylamide gels in polyacrylamide
gel electrophoresis (PAGE). Acrylamide, in combination
with the cross-linker methylene bisacrylamide (Fig. 5-5),
polymerizes into a gel that has consistent resolution char-
acteristics (Fig. 5-6).
200 bp
Figure 5-6 Resolution of double-stranded DNA fragments

Advanced Concepts on a 5%, 19:1 acrylamide:bis gel.
Different cross-linkers affect the physical nature of Polyacrylamide was originally used mostly for protein
the acrylamide mesh. Piperazine diacrylate can separation, but it is now routinely applied to nucleic acid
reduce the background staining that may occur analysis. Polyacrylamide gels are used for sequencing
when the gel is stained. N,N-bisacrylylcystamine nucleic acids, mutation analyses, nuclease protection
and N,N-diallyltartardiamide enable gels to be sol- assays, and other applications requiring the resolution of
ubilized to enable for the easier extraction of sepa- nucleic acids down to the single-base level. Acrylamide
rated products. is supplied to the laboratory in several forms. The pow-
dered form is a dangerous neurotoxin and must be han-

dled with care. Solutions of mixtures of acrylamide and below 5% will increase pore size. Usually, C is set at
bis-acrylamide are less hazardous and more convenient 3.3% (29:1) for native and 5% (19:1) for standard DNA
to use. Preformed gels are the most convenient, as the and RNA gels.
procedure for preparation of acrylamide gels is more
involved than that for agarose gels.
Capillary Electrophoresis
The composition of polyacrylamide gels is represented
as the total percentage concentration (w/v) of monomer The widest application of capillary electrophoresis has
(acrylamide with cross-linker) T and the percentage been in the separation of organic chemicals such as phar-
of monomer that is cross-linker C. For example, a 6% maceuticals and carbohydrates. It has also been applied
19:1 acrylamide:bis gel has a T value of 6% and a C to the separation of inorganic anions and metal ions. It is
value of 5%. an alternate method to high performance liquid chro-
Unlike agarose gels that polymerize upon cooling, matography (HPLC) for these applications. Capillary
polymeration of polyacrylamide gels requires the use electrophoresis has the advantage of faster analytical runs
of a catalyst. The catalyst may be the nucleation agents, and lower cost per run than HPLC. Increasingly, capillary
ammonium persulfate (APS) plus N,N,N,N-tetram- electrophoresis is being used for the separation and
ethylethylenediamine (TEMED), or light activation. APS analysis of nucleic acids, which is explained below.
produces free oxygen radicals in the presence of TEMED In this type of electrophoresis, the analyte is resolved
to drive the free-radical polymerization mechanism. Free in a thin glass (fused silica) capillary that is 30100 cm
radicals can also be generated by a photochemical in length and has an internal diameter of 25100 m.
process using riboavin plus TEMED. Excess oxygen Fused silica is used as the capillary tube because it is the
inhibits the polymerization process. Therefore, deaera- most transparent material allowing for the passage of u-
tion, or the removal of air, of the gel solution is often orescent light. The fused silica is covered with a poly-
done before the addition of the nucleation agents. imide coating for protection. There is an uncoated
Polyacrylamide gels for nucleic acid separation are window where the light is shone on the fragments as they
very thin, e.g., 50 m, making gel preparation difficult. pass the detector. The fused silica has a negative charge
Systems have been designed to facilitate the preparation along the walls of the capillary generated by the dissoci-
of single and multiple gels. Increasing numbers of labo- ation of hydroxyl ions from the molecules of silicone.
ratories are using preformed polyacrylamide gels to This establishes an electro-osmotic ow when a current
avoid the hazards of working with acrylamide and the is introduced along the length of the capillary. Under the
labor time involved in gel preparation. Use of preformed force of the current, small and negatively charged mole-
gels must be scheduled, keeping in mind the limited shelf cules migrate faster than large and positively charged
life of the product. molecules (Fig. 5-7).
The main advantage of polyacrylamide over agarose is Capillary electrophoresis was originally applied to
the higher resolution capability for small fragments that molecules in solution. Separation was based on their size
can be accomplished with polyacrylamide. A variation of and charge (charge/mass ratio). Optimal separation
1 base pair in a 1-kb molecule (0.1% difference) can be requires the use of the proper buffer to ensure that the
detected in a polyacrylamide gel. Another advantage of solute is charged. Negatively charged molecules are com-
polyacrylamide is that, unlike agarose, the components of pletely ionized at high pH, whereas positively charged
polyacrylamide gels are synthetic; thus, there is not as solutes are completely protonated in low pH buffers.
much difference in batches obtained from different Nucleic acids do not separate well in solution. As the
sources. Further, altering T and C in a polyacrylamide gel size or length of a nucleic acid increases (retarding
can change the pore size and, therefore, the sieving prop- migration), so does its negative charge (speeding migra-
erties in a predictable and reproducible manner. tion), effectively confounding the charge/mass resolu-
Increasing T decreases the pore size proportionally. The tion. Introduction of a polymer inside the capillary
minimum pore size (highest resolution for small mole- restores resolution by retarding migration according to
cules) occurs at a C value of 5%. Variation of C above or size more than charge. It is important that the nucleic acid

testing performed by analyzing short tandem repeat poly-

+ morphisms. It has other applications in the clinical labo-
+ ratory, such as clonality testing, microsatellite instability
+ + +
detection, and bone marrow engraftment analysis.
Specially designed software can use differentially labeled
Net flow molecular weight markers or allelic markers that, when
run through the capillary with the sample, help to iden-
Laser tify sample bands.
The capillary system has the advantages over tradi-
+ tional slab gel electrophoresis of increased sensitivity, so
that smaller amounts of nucleic acid can be analyzed, and
Net flow
immediate detection of desired bands. With multiple
Detector
color detection systems, standards, controls, and test
samples can be run through the capillary together,
thereby eliminating the lane-to-lane variations that can
occur across a gel. Although instrumentation for capillary
Buffer Buffer electrophoresis is costly and detection requires uores-
cent labeling of samples that can also be expensive, labor
High voltage and run time are greatly decreased as compared with gel
Figure 5-7 Capillary electrophoresis separates particles by electrophoresis. In addition, analytical software can auto-
size (small, fast migration; large, slow migration) and charge matically analyze results that are gathered by the detector
(negative, fast migration; positive, slow migration) in the capillary electrophoresis instrument.
be completely denatured (single-stranded) so that it will

be separated according to its size, because secondary Buffer Systems
structure will affect the migration speed. Generally, 150 The purpose of a buffer system is to carry the current and
nL of denatured nucleic acid in buffer containing for- protect the samples during electrophoresis. This is
mamide is introduced to the capillary, which is held at a accomplished through the electrochemical characteristics
denaturing temperature through the run. of the buffer components.
The sample is injected into the capillary by electroki- A buffer is a solution of a weak acid and its conjugate
netic, hydrostatic, or pneumatic injection. For nucleic base. The pH of a buffered solution remains constant as
acid analysis, electrokinetic injection is used. The plat- the buffer molecules take up or release protons given off
inum electrode close to the end of the capillary undergoes or absorbed by other solutes. The equilibrium between
a transient high-positive charge to draw the sample into acid and base in a buffer is expressed as the dissociation
the end of the capillary. When the current is established, constant, Ka:
the fragments migrate through the capillary. For the res-
[H][A]
olution of nucleic acids, capillary electrophoresis is anal-
Ka
ogous to gel electrophoresis with regard to the
[HA]
electrophoretic parameters. The capillarys small volume,
as compared with that of a slab gel, can dissipate heat where [H], [A-], and [HA] represent the dissociated
more efficiently during the electrophoresis process. More proton, dissociated base, and associated salt concentra-
efficient heat dissipation allows the technologist to run tions, respectively. Ka is most commonly expressed as its
the samples at higher charge per unit area, which means negative logarithm, pKa, such that
that the samples migrate faster, thereby decreasing the pKa -log Ka
resolution (run) time. A pKa of 2 (Ka 10-2) favors the release of protons.
Nucleic acid resolution by capillary electrophoresis is A pKa of 12 (Ka 10-12) favors the association of
used extensively in forensic applications and parentage protons.

A given buffer maintains the pH of a solution near its

pKa. The amount the pH of a buffer will differ from the
pKa is expressed as the Henderson-Hasselbach equation:
Advanced Concepts
The migration of buffer ions is not restricted by the
[basic form]
gel matrix, so the speed of their movement under a
pH pKa log
current is governed strictly by the size of the ion and
[acidic form] its charge (charge/mass ratio). Tris is a relatively
If the acidic and the basic forms of the buffer in solu- large molecule, so its charge-to-mass ratio is low,
tion are of equal concentration, pH pKa. If the acidic and it moves through the current relatively slowly,
form predominates, the pH will be less than the pKa; if even at high concentrations, giving increased buffer-
the basic form predominates, the pH will be greater than ing capacity.
the pKa.
The Henderson-Hasselbach equation predicts that, in
order to change the pH of a buffered solution by one
point, either the acidic or basic form of the buffer must be
etc., move through the gel more quickly; that is, they
brought to a concentration of 1/10 that of the other form.
increase conductivity without increasing buffering capac-
Therefore, addition of acid or base will barely affect the
ity. This results in too much current passing through the
pH of a buffered solution as long as the acidic or basic
gel as well as faster depletion of the buffer. Therefore,
forms of the buffer are not depleted.
buffer components such as Tris base or borate are pre-
Control of the pH of a gel by the buffer also protects
ferred because they remain partly uncharged at the
the sample molecules from damage. Furthermore, the
desired pH and thus maintain constant pH without high
current through the gel is carried by buffer ions, prevent-
conductivity.
ing severe uctuations in the pH of the gel.
In addition to pKa, charge, and size, other buffer char-
A buffer concentration must be high enough to provide
acteristics that can be taken into account when choosing
sufficient acidic and basic forms to buffer its solution.
a buffer include toxicity, interaction with other compo-
Raising the buffer concentration, however, also increases
nents, solubility, and ultraviolet absorption.
the conductivity of the electrophoresis system, generat-
The Tris buffers Tris borate EDTA (TBE; 0.089 M Tris-
ing more heat at a given voltage. This can cause problems
base, 0.089 M boric acid, 0.0020 M EDTA), Tris phos-
with gel stability and can increase sample denaturation.
phate EDTA (TPE; 0.089 M Tris-base, 1.3% phosphoric
High buffer concentrations must therefore be offset by
acid, 0.0020 M EDTA) and Tris acetate EDTA (TAE; 0.04
low voltage.
M Tris-base, 0.005 M sodium acetate, 0.002 M EDTA)
In order for nucleic acids to migrate properly, the gel
are most commonly used for electrophoresis of DNA.
system must be immersed in a buffer that conducts the
There are some advantages and disadvantages of both
electric current efficiently in relation to the buffering
TBE and TAE that must be considered before one of these
capacity. Ions with high-charge differences, 2, -2, 3,
buffers is used for a particular application. TBE has a
greater buffering capacity than TAE. Although the ion
species in TAE are more easily exhausted during extended
or high-voltage electrophoresis, DNA will migrate twice
Advanced Concepts as fast in TAE than in TBE in a constant current. TBE is
The Henderson-Hasselbach equation also predicts not recommended for some post-electrophoretic isolation
the concentration of the acidic or basic forms at a procedures. When using any buffer, especially TBE and
given pH. It can be used to calculate the state of ion- TPE, care must be taken that the gel does not overheat
ization, i.e., the predominance of acidic or basic when run at high voltage in a closed container. Finally,
forms, of a species in solution. A buffer should be stock solutions of TBE are prone to precipitation. This
chosen that has a pKa within a half point of the can result in differences in concentration between the
desired pH, which is about 8.0 for nucleic acids. buffer in the gel and the running buffer. Such a gradient
will cause localized distortions in nucleic acid migration

patterns, often causing a salt wave that is visible as a sharp

+
horizontal band through the gel.
Gel
Buffer Additives Buffer
Magnet
Buffer additives are often used to modify sample mole-
cules in ways that affect their migration. Examples of Magnetic stirrer
these additives are formamide, urea, and various deter-

gents. Denaturing agents, such as formamide or urea, Tubing Tubing
break hydrogen bonds between complementary strands Peristaltic
pump
or within the same strand of DNA or RNA. The confor-
mation or solubility of molecules can be standardized by Figure 5-8 A peristaltic pump can be used to recirculate
buffer from the cathode to the anode end while running a
the addition of one or both of these agents. Formamide
denaturing gel.
and heat added to DNA and RNA break and block the
hydrogen bonding sites, hindering complementary
sequences from reannealing. As a result, the molecules pump or by stopping the gel at intervals and transferring
become long, straight, unpaired chains. Urea and heat in the buffer from the cathode to the anode ends.
the gel systems maintain this conformation such that
intrachain hybridization (folding) of the nucleic acid
molecules does not affect migration speeds, and separa-
Electrophoresis Equipment
tion can occur strictly according to the size or length of Gel electrophoresis can be done in one of two confor-
the molecule. mations, horizontal or vertical. In general, agarose gels
Electrophoresis of RNA requires different conditions are run horizontally, and polyacrylamide gels are run ver-
imparted by different additives than are used with DNA. tically.
Because RNA is single-stranded and it tends to fold to Horizontal gels are run in acrylic containers called gel
optimize internal homology, it must be completely dena- boxes or baths that are divided into two parts with a plat-
tured to prevent folding in order to accurately determine form in the middle on which the gel rests (Fig. 5-9).
its size by migration in a gel system. The secondary Platinum wires make up the electrodes in the gel com-
structures formed in RNA are strong and more difficult to partments. The wires are connected to a power source by
denature than DNA homologies. Denaturants used for banana clips or connectors through the walls of the con-
RNA include methylmercuric hydroxide (MMH), which tainer. The gel in the box is submerged with elec-
reacts with amino groups on the RNA preventing base trophoresis buffer lling both compartments and making
pairing between homologous nucleotides, and aldehydes a continuous system through which the current ows.
(e.g., formaldehyde, glyoxal), which also disrupt base The thickness of the gel and the volume of the buffer
pairing. MMH is not used routinely because of its affect migration, so these parameters should be kept con-
extreme toxicity. stant for consistent results. As the gel is submerged
RNA can be separated in 10-mM sodium phosphate, through the loading and electrophoresis process, horizon-
pH 7, or MOPS buffer (20 mM 3-[N-morpholino] tal gels are sometimes referred to as submarine gels. The
propanesulfonic acid, pH 7, 8-mM sodium acetate, 1 mM power supply will deliver voltage, setting up a current
EDTA, pH 8). The RNA sample is incubated in dimethyl that will run through the gel buffer and the gel, carrying
sulfoxide, 1.1 M glyoxal (ethane 1.2 dione) and 0.01 M the charged sample through the matrix of the gel at a
sodium phosphate, pH 7, to denature the RNA prior to speed corresponding to the charge/mass ratio of the sam-
loading the sample on the gel. Due to pH drift (decrease ple molecules.
of pH at the cathode [-] and increase of the pH at the Horizontal agarose gels are cast as square or rectangu-
anode []) during the run, the buffer should be recircu- lar slabs of varying size. Purchased gel boxes come with
lated from the anode end of the bath to the cathode end casting trays that mold the gel to the appropriate size for
(Fig. 5-8). This can be accomplished using a peristaltic the gel box. The volume of the gel solution will deter-

Buffer solution Gel Electrode Vertical gel boxes have separate chambers that are
connected by the gel itself. Electrodes are attached to the
upper and lower buffer chambers to set up the current that
will run through the gel. The gel must be in place before
lling the upper chamber with buffer. Some systems have
a metal plate attached to the back of the gel to maintain
constant temperature across the gel. Maintaining constant
temperature throughout the gel is more of a problem with
vertical gels because the outer edges of the gel cool more
+ than the center, slowing migration in the outer lanes com-
(Black) (Red) pared with lanes in the center of the gel. This is called
Figure 5-9 A typical horizontal submarine gel system. A red gel smiling because similar-sized bands in the cooler
connector is attached to the positive outlet on the power outer lanes will migrate slower than comparable bands in
supply and a black to the negative port. the inside lanes. Ensuring that there is no variation in
temperature across the gel prevents gel smiling from
mine the thickness of the gel. Agarose, supplied as a dry occurring.
powder, is mixed at a certain percentage (w/v) with elec- Vertical gel systems can range from large sequencing
trophoresis buffer and heated on a heat block or by systems (35 cm 26 cm) to mini-systems (8 cm 10
microwave to dissolve and melt the agarose. The molten cm). Some mini-systems are big enough to accommodate
agarose is cooled to 5565C, and a certain volume is two gels at a time (Fig. 5-10). Mini-systems are used
poured into the casting tray as dictated by the gel box extensively for analyses that do not require single base
manufacturer or application. A comb is then inserted into
the top of the gel to create holes, or wells, in the gel into
Electrode
which the sample will be loaded. The size of the teeth in Buffer solution
the comb will determine the volume of loaded sample
and the number of teeth will determine the number of
wells that are available in the gel to receive samples. The
gel is then allowed to cool, during which time it will
solidify. After the gel has polymerized, the comb is care-
fully removed and the gel is placed into the gel box and
submerged in electrophoresis buffer.
Advanced Concepts
Self-contained agarose gel systems have been devel-
oped to facilitate the electrophoresis process. They Gel
are manufactured in closed plastic cassettes contain- +
Buffer solution
ing buffer, gel, and stain. These are convenient for
routine use, but restrict the gel conguration, i.e., Electrode
number and size of wells, etc. Also, the percentage Figure 5-10 A typical vertical gel apparatus. Polymerized
of agarose or acrylamide is limited to what is avail- gels are clamped into the gel insert (left) and placed in the
able from the manufacturer. Furthermore, the sepa- gel bath (right). The positive electrode will be in contact with
the bottom of the gel and the buffer, lling about a third of
rated nucleic acids can not be removed from these the gel bath. The negative electrode will be in contact with
closed cassettes, limiting their analysis. the top of the gel and a separate buffer compartment in the
top of the insert.

pair resolution. The larger systems are used for sequenc- the gel is loaded, whereas the sharks-tooth combs are
ing or other procedures requiring single-base resolution. made so that the wells can be loaded while the comb is in
The gels are loaded from the top, below a layer of buffer place. When the standard combs are removed from the
in the upper chamber. Long, narrow gel-loading pipette gel, care must be taken not to break or displace the ears
tips that deposit the sample neatly on the oor of the well that were formed by the spaces between the teeth in the
increase band resolution and sample recovery. comb that separate the gel wells.
Vertical gels are cast between glass plates that are sep- Polyacrylamide gels can also be cast in tubes for iso-
arated by spacers. The spacers determine the thickness of electric focusing or two-dimensional gel electrophoresis.
the gel, ranging 0.054 mm. The bottom of the gel is The tubes containing the gels are placed into a chamber
secured by tape or by a gasket in specially designed gel separated as for vertical slab gels. The tubes are held in
casting trays. After addition of polymerization agents, the place by gaskets in the upper chamber. This gel congu-
liquid acrylamide is poured or forced between the glass ration, however, limits the number of samples, as only
plates with a pipet or a syringe. The comb is then placed one sample can be run per gel.
on the top of the gel. During this process, it is important
not to introduce air into the gel or beneath the comb. Gel Loading
Bubbles will form discontinuities in the gel, and oxygen
will inhibit the polymerization of the acrylamide. The Prior to loading the sample containing isolated nucleic
comb is of a thickness equal to that of the spacers so that acid onto the gel, tracking dye and a density agent are
the gel will be the same thickness throughout. As with added to the sample. The density agent (either Ficoll,
horizontal gels, the number and size of the comb teeth sucrose, or glycerol) increases the density of the solution
determine the number of wells in the gel and the sample as compared with the electrophoresis buffer. When the
volume that can be added to each well. Specialized sample solution is dispensed into the wells of the gel
combs, called sharks-tooth combs, are often used for below the surface of the buffer, it sinks into the well
sequencing gels (Fig. 5-11). These combs are placed instead of oating away in the buffer. The tracking dyes
upside down (teeth up, not in contact with the gel) to are used to monitor the progress of the electrophoresis
form a trough on the gel during polymerization. After run. The dyes migrate at specic speeds in a given gel
polymerization is complete, the comb is removed and concentration and usually run ahead of the smallest frag-
placed tooth-side down on top of the gel for loading. ments of DNA (compare Table 5.1, 5.2, and 5.3). They are
With this conguration, the spaces between the comb not associated with the sample DNA, and thus they do not
teeth form the wells as opposed to the teeth themselves affect the separation of the sample DNA. The movement
forming the wells in the horizontal gels. The advantage to of the tracking dye is monitored, and when the tracking
this arrangement is that the lanes are placed immediately dye approaches the end of the well electrophoresis is ter-
adjacent to one another to facilitate lane-to-lane compar- minated. Bromophenol blue is a tracking dye that is used
isons. When used, standard combs are removed before for many applications. Xylene cyanol green is another
example of chromophores that are used as tracking dyes
for both agarose and polyacrylamide gels.
Advanced Concepts
A type of bufferless electrophoresis system sup-
plies buffer in gel form or strips. These are laid next
to the preformed gel on a platform that replaces the
Figure 5-11 Combs for polyacrylamide electrophoresis. electrophoresis chamber. These systems can offer
Regular combs (top) have teeth that form the wells in the
gel. Sharks-tooth combs (bottom) are placed onto the
the additional advantage of precise temperature con-
polymerized gel, and the sample is loaded between the trol during the run.
teeth of the comb.

rose or acrylamide and exposed to EtBR will emit orange

Advanced Concepts light when illuminated by ultraviolet light at 300 nm.
EtBr was the most widely used dye in early DNA and
Gels in cassette systems and gel strip systems can be RNA analyses. Care must be taken in handling EtBr
loaded without loading buffer because the wells are because it is carcinogenic. After electrophoresis, the
dry, precluding the need for density gradients. As agarose or acrylamide gel can be soaked in a solution of
these systems also have automatic shut-off at the 0.11mg/ml EtBr in running buffer (TAE, TBE, or TPE)
end of the run, tracking dye is usually not necessary, or TE. Alternatively, dye can be added directly to the gel
although some of these systems have a tracking dye before polymerization or to the running buffer. The latter
built into the gel and/or buffer. two measures save time and allow visualization of the
DNA during the run. Dye added to the gel, however, may
form a bright front across the gel that could mask inform-
ative bands. Dye added to the running buffer produces
Detection Systems more consistent staining, although more hazardous
Following are the status of samples during and after elec- waste is generated by this method. Some enclosed gel
trophoresis is accomplished using dyes that specically systems contain EtBr inside a plastic enclosed gel cas-
associate with nucleic acid. The agents used most fre- sette, limiting exposure and waste. After soaking or run-
quently for this application are uorescent dyes and sil- ning in EtBr, the DNA illuminated with ultraviolet light
ver stain. will appear as orange bands in the gel. The image can be
captured with a camera or by digital transfer to analytical
software.
Nucleic AcidSpecic Dyes
SyBr green is one of a set of stains introduced in 1995
Intercalating agents intercalate, or stack, between the as another type of nucleic acidspecic dye system. It
nitrogen bases in double-stranded nucleic acid. Ethidium differs from EtBr in that it does not intercalate between
bromide, 3,8-diamino-5-ethyl-6-phenylphenanthridinium bases; it sits in the minor groove of the double helix.
bromide (EtBr), is one of these agents. Under excitation SyBr green in association with DNA or RNA also emits
with ultraviolet light at 300 nm, EtBr in DNA emits vis- light in the orange range. SyBr green staining is 25100
ible light at 590 nm. Therefore, DNA separated in aga- times more sensitive than EtBr (detection level: 60 pg of
double-stranded DNA vs. 5 ng for EtBr). This is due, in
part, to background uorescence from EtBr in agarose. A
Table 5.3 Tracking Dye Comigration* 1 dilution of the manufacturers 10,000X stock solution
of SyBr green in TAE, TBE, or TE can be used in meth-
Bromophenol Xylene Cyanol
Gel % Blue (Nucleotides) (Nucleotides) ods described for EtBr. A 1/100 dilution of SyBr green
can also be added directly to the DNA sample before
Agarose
electrophoresis. DNA prestaining decreases the amount
0.51.5 300500 40005000
of dye required for DNA visualization but lowers the sen-
2.03.0 80120 700800
sitivity of detection and may, at higher DNA concentra-
4.05.0 2030 100200
tions, interfere with DNA migration through the gel.6
PAGE Because SyBr green is not an intercalating agent, it is not
4 95 450 as mutagenic.7
6 60 240 Although SyBr green has some advantages over EtBr,
8 45 160 many laboratories continue to use the latter dye due to the
10 35 120 requirement for special optical lters for detection of
12 20 70 SyBr green. Scanning and photographic equipment opti-
20 12 45 mized for EtBr would have to be modied for optimal
*Migration depends on buffer type (TAE, TBE, or TPE) and the formula- detection of the SyBr green stains. New instrumentation
tion of agarose, acylamide, and bis. with more exible detection systems allows utilization of

the SyBr green stains. SyBr green is the preferred dye for a. The gel is blank (no bands, no molecular weight
real-time PCR methods. standard).
b. Only the molecular weight standard is visible.
Silver Stain
3. How does PFGE separate larger fragments more effi-
A more sensitive staining system originally developed for ciently than standard electrophoresis?
protein visualization is silver stain. After electrophoresis,
the sample is xed with methanol and acetic acid. The gel 4. A 6% solution of 19:1 acylamide is mixed, deaerated,
is then impregnated with ammoniacal silver (silver and poured between glass plates for gel formation.
diamine) solutions or silver nitrate in a weakly acid solu- After an hour, the solution is still liquid. What might
tion.8 Interaction of silver ions with acidic or nucle- be one explanation for the gel not polymerizing?
ophilic groups on the target results in crystallization or
deposition of metallic silver under optimal pH condi- 5. A gel separation of RNA yields aberrantly migrating
tions. The insoluble black silver salt precipitates upon bands and smears. Suggest two possible explanations
introduction of formaldehyde in a weak acid solution or for this observation?
alkaline solution for sliver nitrate. Of the two procedures,
silver diamine is best for thick gels, whereas silver nitrate 6. Why does DNA not resolve well in solution (without
is considered to be more stable.9 a gel matrix)?
Silver staining avoids the hazards of the intercalators,
but silver nitrate is itself also a biohazard. In addition, sil- 7. Why is SyBr green less toxic than EtBr?
ver staining is more complicated than simple intercala-
tion. Color development must be carefully watched as the
precipitate accumulates in order to stop the reaction once References
optimal signal is reached. Overexposure of the gel will 1. Carle G, Frank M, Olson MV. Electrophoretic
result in high backgrounds and masking of results. The separation of large DNA molecules by periodic
increased sensitivity of this staining procedure, however, inversion of the electric eld. Science 1986;232:
makes up for its limitations. It is especially useful for 6568.
protein analysis and for detection of limiting amounts of 2. Chu G, Vollrath D, Davis RW. Separation of
product. large DNA molecules by contour-clamped
homogeneous electric elds. Science 1986;
234:158285.
3. Gardiner K, Laas W, Patterson DS. Fractionation
STUDY QUESTIONS of large mammalian DNA restriction fragments
using vertical pulsed-eld gradient gel electro-
1. You wish to perform a resolution of your restriction phoresis. Somatic Cell Molecular Genetics 1986;
enzymedigested DNA fragments. The size of the 12:18595.
expected products ranges 500100 bp. You discover 4. Southern E, Anand R, Brown WRA, et al. (1987).
two agarose gels polymerizing on the bench. One is A model for the separation of large DNA molecules
5% agarose; the other is 2% agarose. Which one by crossed eld gel electrophoresis. Nucleic Acids
might you use to resolve your fragments? Research 15, 592543.
5. Gemmill R. Pulsed eld gel electrophoresis. In
2. After completion of the run of fragments along with Chrambach A, Dunn MJ, Radola, BJ, eds. Advances
the proper molecular weight standard on the agarose of Electrophoresis, vol. 4 Weinheim, Germany:
gel, suppose a. or b. below was observed. What might VCH, 1991:148.
be explanations for these? (Assume you have included 6. Miller S, Taillon-Miller P, Kwok P. Cost-effective
a molecular weight marker in your run.) staining of DNA with SyBr green in preparative

agarose gel electrophoresis. BioTechniques 1999; 8. Rabilloud T. A comparison between low back-
27(1):3436. ground silver diamine and silver nitrate protein
7. Singer V, Lawlor TE, Yue S. Comparison of SyBr stains. Electrophoresis 1992;13(6):42939.
green I nucleic acid gel stain mutagenicity and ethid- 9. Merrill C. Gel-staining techniques. Methods in
ium bromide mutagenicity in the salmonella/mam- Enzymology 1990;182:47788.
malian microsome reverse mutation assay (Ames 10. Perbal B. A Practical Guide to Molecular Cloning,
test). Mutation Research 1999;439(1):3747. 2nd. ed. New York: John Wiley & Sons, 1988.
Analysis and
Characterization
of Nucleic Acids
and Proteins
OUTLINE OBJECTIVES
RESTRICTION ENZYME MAPPING Describe how restriction enzyme sites are mapped
HYBRIDIZATION TECHNOLOGIES on DNA.
Southern Blots Construct a restriction enzyme map of a DNA plasmid
Northern Blots
Western Blots
or fragment.
PROBES
Diagram the Southern blot procedure.
DNA Probes Explain depurination and denaturation of resolved DNA.
RNA Probes Describe the procedure involved in blotting (transfer)
Other Nucleic Acid Probe Types DNA from a gel to a membrane.
Protein Probes
Probe Labeling Discuss the purpose and structure of probes that are used
Nucleic Acid Probe Design for blotting procedures.
HYBRIDIZATION CONDITIONS, Dene hybridization, stringency, and melting temperature.
STRINGENCY Calculate the melting temperature of a given sequence of
DETECTION SYSTEMS dsDNA.
INTERPRETATION OF RESULTS Compare and contrast radioactive and nonradioactive
ARRAY-BASED HYBRIDIZATION DNA detection methods.
Dot/Slot Blots Compare and contrast dot and slot blotting methods.
Genomic Array Technology Describe microarray methodology.
SOLUTION HYBRIDIZATION Discuss solution hybridization.
94

Analysis and Characterization of Nucleic Acids and Proteins Chapter 6 95
urally occurring plasmids and to engineer the construc-

Restriction Enzyme Mapping tion of recombinant plasmids.
Clinical and forensic analyses require characterization of To make a restriction map, DNA is exposed to several
specic genes or genomic regions at the molecular level. restriction enzymes separately and then in particular com-
Because of their sequence-specic activity (see Chapter binations. Take, for example, a linear fragment of DNA
1), restriction endonucleases provide a convenient tool cut with the enzyme PstI. After incubation with the
for molecular characterization of DNA. enzyme, the resulting fragments are separated by gel elec-
Restriction enzymes commonly used in the laboratory trophoresis. The gel image reveals four fragments,
have four to six base pair recognition sites, or binding/ labeled A, B, C, and D, produced by PstI (Fig. 6-1). From
cutting sites, on the DNA. Any four to six base pair nu- the number of fragments one can deduce the number of
cleotide sequence occurs at random in a sufficiently long PstI sites: three. The sizes of the fragments, as determined
stretch of DNA. Therefore, restriction sites will occur by comparison with known molecular-weight standards,
naturally in DNA. Restriction site mapping, i.e., deter- indicate the distance between these sites or from the site
mining where in the DNA sequence a particular restric- to the end of the fragment. Although PstI analysis of this
tion enzyme recognition site is located, was initially fragment yields a characteristic four-band restriction pat-
developed using small circular bacterial plasmids. The tern, it does not indicate the order of the four restriction
resultant maps were used to identify and characterize nat- products in the original fragment. To begin to determine
DNA
Pst I PstI Pst I
A B C D
DNA
BamHI
E F
Pst I
+
Uncut Pst I Uncut BamHI Uncut Pst I BamHI BamHI
F
A *
*
D
B
C
E *
Figure 6-1 Restriction mapping of a linear DNA fragment (top green bar). The fragment is rst
cut with the enzyme PstI. Four fragments result as determined by agarose gel electrophoresis indi-
cating that there are three PstI sites in the linear fragment. The size of the pieces indicates the
distance between the restriction sites. A second cut with BamHI (bottom) yields two fragments, indi
cating one site. Since one BamHI fragment (E) is very small, the BamHI site must be near one end
of the fragment. Cutting with both enzymes indicates that the BamHI site is in the PstI fragment A.

DNA BamHI
+
A B C D BamHI XhoI XhoI
BamHI PstI Pst I Pst I BamHI
4.3 kb 4.0 kb
A C D B 3.7 kb 2.8 kb 1.1 kb
2.3 kb 1.7 kb
1.7 kb XhoI
BamHI PstI Pst I PstI 1.9 kb
Figure 6-2 Two possible maps inferred from the observa- 1.4 kb 1.2 kb 1.2 kb 1.2 kb
1.3 kb
tions described in Figure 6-1. The BamHI site positions fragment
1.1 kb XhoI
A at one end (or the other) of the map. Determination of the 0.7 kb
correct map requires information from additional enzyme cuts.
Figure 6-3 Restriction mapping of a plasmid. After incubat-
ing plasmid DNA with restriction enzymes, agarose gel elec-
trophoresis banding patterns indicate the number of
the order of the restriction fragments, another enzyme is restriction sites and the distance between them.
used, for example BamHI. Cutting the same fragment
with BamHI yields two pieces, indicating one BamHI site
in this linear fragment (see Fig. 6-1). Observe that one ferences in the nucleotide sequences in human DNA, the
restriction product (F) is very much larger than the other number or location of restriction sites for a given restric-
(E). This means that the BamHI site is close to one end of tion enzyme are not all the same in all individuals. The
the fragment. When the fragment is cut simultaneously location and order of restriction enzyme sites on a DNA
with PstI and BamHI, ve products are produced, with fragment is a molecular characteristic of that DNA. The
PstI product A cut into two pieces by BamHI. This indi- resulting differences in the size or number of restriction
cates that A is on one end of the DNA fragment. By meas- fragments are called restriction fragment length poly-
uring the number and length of products produced by morphisms (RFLPs). RFLPs were the basis of the rst
other enzymes, the restriction sites can be placed in linear molecular-based human identification and mapping
order along the DNA sequence. Figure 6-2 shows two methods. RFLPs can also be used for the clinical analy-
possible maps based on the results of cutting the fragment sis of structural changes in chromosomes associated with
with PstI and BamHI. With adequate enzymes and disease (translocations, deletions, insertions, etc.).
enzyme combinations, a detailed map of this fragment
can be generated.
Mapping of a circular plasmid is slightly different, as
Hybridization Technologies
there are no free ends (Fig. 6-3). The example shown in Procedures performed in the clinical molecular labora-
the gure is a 4-kb pair circular plasmid with one BamHI tory are aimed at specic targets in genomic DNA. This
site and two XhoI sites. Cutting the plasmid with BamHI requires visualization or detection of a specic gene or
will yield one fragment. The size of the fragment is the region of DNA in the background of all other genes.
size of the plasmid. Two fragments released by XhoI indi- There are several ways to nd a particular region of DNA
cate that there are two XhoI sites in the plasmid and that from within an isolated DNA sample. The initial method
these sites are 1.2 and 2.8 kb pairs away from each other. for molecular analysis of specic DNA sites within a
As with linear mapping, cutting the plasmid with XhoI complex background was the Southern blot. Modica-
and BamHI at the same time will start to order the sites tions of the Southern blot are applied to analysis of RNA
with respect to one another on the plasmid. One possible and protein in order to study gene expression and regula-
arrangement is shown in Figure 6-3. As more enzymes tion (Table 6.1).
are used, the map becomes more detailed.
The pattern of fragments produced by restriction
Southern Blots
enzyme digestion can be used to identify that DNA and
to monitor certain changes in the size, structure, or se- The Southern blot is named for Edwin Southern, who
quence of the DNA. Because of inherited or somatic dif- rst reported the procedure.1 In the Southern blot, DNA

cal laboratory, specimen availability may limit the

Table 6.1 Hybridization Technologies
amount of DNA that can be used.
Hybridization After restriction enzyme digestion, the resulting frag-
Method Target Probe Purpose
ments are resolved by gel electrophoresis. The percent-
Southern blot DNA Nucleic acid Gene structure age and nature of the gel will depend on the size of the
Northern blot RNA Nucleic acid Transcript structure, DNA region to be analyzed (see Chapter 5, Tables 5.1
processing, gene and 5.2). As with all electrophoresis, a molecular weight
expression standard should be run with the test samples. After elec-
Western blot Protein Protein Protein processing, trophoresis, it is important to observe the cut DNA.
gene expression Figure 6-4a shows a gel stained with ethidium bromide
Southwestern Protein DNA DNA binding proteins, and illuminated by ultraviolet (UV) light. Genomic DNA
blot gene regulation cut with restriction enzymes should produce a smear rep-
resenting the billions of fragments of all sizes released by
the enzyme cutting. The brightness of the DNA smears
is isolated and cut with restriction enzymes. The frag- should be similar from lane to lane, assuring that equal
ments are separated by gel electrophoresis, depurinated amounts of DNA were added to all lanes. In any lane, a
and denatured, and then transferred to a solid support large aggregate of DNA near the top of the gel indicates
such as nitrocellulose. In the nal steps of the procedure, that the restriction enzyme activity was incomplete. A
the DNA fragments are exposed to a labeled probe (com- smear located primarily in the lower region of the lane is
plementary DNA or RNA) that is specic in sequence to a sign that the isolated DNA is degraded. Either of these
the region of interest, unbound probe is removed, and the two latter conditions will prevent accurate analysis. If
signal of the probe is detected to indicate the presence or either is observed, the DNA isolation and/or the restric-
absence (lack of signal) of the sequence in question. The tion digest should be repeated accordingly.
original method entailed hybridization of a radioactively-
labeled probe to detect the DNA region to be analyzed. Preparation of Resolved DNA
As long as there is a probe of known identity, this proce- for Blotting (Transfer)
dure can analyze any gene or gene region in the genome The goal of the Southern blot procedure is to analyze a
at the molecular level. The following sections will specic region of the sample DNA. First, the DNA sam-
describe the parts of the Southern blot procedure in detail ple is digested, i.e., cut using a variety of restriction
as well as discuss modications of the procedure in order endonucleases, and then the DNA fragments are separated
to analyze RNA and protein. by electrophoresis. The resultant restriction fragments
containing the target sequence to be analyzed are obvi-
Restriction Enzyme Cutting and Resolution ously not distinguishable in the smear from other frag-
After DNA isolation, the rst step in the Southern blot ments that do not have the target sequence. Target
procedure is digestion of the DNA with restriction fragments can be detected by hybridization with a homol-
enzymes. The choice of enzymes used will depend on the ogous sequence of single-stranded DNA or RNA labeled
applications. For routine laboratory tests, restriction with a detectable marker. To achieve optimal hydrogen
maps of the target DNA regions will have previously bonding between the probe and its complementary
been determined, and the appropriate enzymes will be sequence in the resolved sample DNA, the double-
recommended. For other methods, such as typing of stranded DNA fragments in the gel must be denatured and
unknown organisms or cloning, several enzymes may be transferred to a nitrocellulose membrane.
tested to nd those that will be most informative.
Ten to 50 g of genomic DNA are used for each Depurination
restriction enzyme digestion for Southern analysis. More Before moving the DNA fragments from the gel to the
or less DNA may be used depending on the sensitivity of membrane for blotting, the double-stranded DNA frag-
the detection system, the volume and congurations of ments must be denatured, or separated, into single
wells, and the abundance of the target DNA. In the clini- strands. This is performed as the DNA remains in place

A B
Figure 6-4 (a.) Genomic DNA fragments cut with restriction enzymes Bgl II, BamHI and Hind III
and separated by gel electrophoresis. (b.) Autoradiogram of the fragments hybridized to a radioac-
tive or chemiluminescent probe. Control lanes, C, show the restriction pattern of normal DNA. Test
lanes, , show the different restriction patterns that result from the abnormal or translocated DNA.
in the gel. Although short fragments can be denatured

directly as described below, larger fragments (500 bp)
are more efficiently denatured if they are depurinated T A
before denaturation (Fig. 6-5). Therefore, for large frag-
ments, the gel is rst soaked in HCl solution, a process
that removes purine bases from the sugar phosphate C G
backbone. This will loosen up the larger fragments for
more complete denaturation.
G C
Denaturation
Following depurination, the DNA is denatured by
exposing the DNA in the gel to sodium hydroxide. The
strong base (NaOH) promotes breakage of the hydro- A T
gen bonds holding the DNA strands to one another. The
resulting single strands are then available to hydro-
gen-bond with the single-stranded probe. Further, the
single-stranded DNA will bind more tightly than Figure 6-5 An apurinic site in double-stranded DNA.
double-stranded DNA to the nitrocellulose membrane Loss of the guanine (right) leaves an open site but does
upon transfer. not break the sugar phosphate backbone of the DNA.


Treatment of DNA with dilute (0.10.25 mM) Binding of single-stranded DNA to nitrocellulose
hydrochloric acid results in hydrolysis of the glyco- does not prevent hydrogen-bond formation of the
sidic bonds between purine bases and the sugar of immobilized DNA with complementary sequences.
the nucleotides. This loss of purines (adenines and Although not covalent, the bond between the mem-
guanines) from the sugar-phosphate backbone of brane and the DNA is much stronger than the hydro-
DNA leaves apurinic sites (Fig. 6-5). The DNA gen bonds that hold complementary strands
backbone remains intact and holds the rest of the together. This allows removal of probes and reprob-
bases in linear order. Removal of some of the purine ing of immobilized fragments if necessary.
bases promotes the subsequent breaking of hydro-
gen bonds between the two strands of the DNA dur-
ing the denaturation step in Southern blotting.
high binding capacity (400 g/cm2), which increases
sensitivity. A covalent attachment of nucleic acid to these
membranes is achieved by UV cross-linking.
Blotting (Transfer) Membranes with a positive charge more effectively
Before exposing the denatured sample DNA to the probe, bind small fragments of DNA. These membranes, how-
the DNA must be transferred, or blotted, to a solid sub- ever, are more likely to retain protein or other contami-
strate that will facilitate probe binding and signal detec- nants that will contribute to background after the
tion. This substrate is usually nitrocellulose, nitrocellulose membrane is probed.
on an inert support, nylon or cellulose modied with a Before transfer of the sample, membranes are moist-
diethyl amino ethyl, or a carboxy methyl (CM) chemical ened by oating them on the surface of the transfer
group. Membranes of another type, polyvinyl diuoride buffer. Any dry spots (areas where the membrane does
(PVDF), are used for immobilizing proteins for probing not properly hydrate) will remain white while the rest of
with antibodies (Western blots). the membrane darkens with buffer. If the membrane does
not hydrate evenly, dry spots will inhibit binding of the
Membrane Types sample.
Single-stranded DNA avidly binds to nitrocellulose
membranes with a noncovalent, but irreversible, con- Transfer Methods
nection. The binding interaction is hydrophobic and elec- Transfer can be performed in several ways. The goal of
trostatic between the negatively charged DNA and the all methods is to move the DNA from the gel to a mem-
positive charges on the membrane. Nitrocellulose-based brane substrate for probing.
membranes bind 70150 g of nucleic acid per square
centimeter. Membrane pore sizes (0.05 microns to 0.45
microns) are suitable for small DNA fragments up to
fragments 20,000 bp in length.
Pure nitrocellulose has a high binding capacity for
Advanced Concepts
proteins as well as nucleic acids. It is the most versatile Diethylaminoethyl (DEAE)-conjugated cellulose
medium for molecular transfer applications. It is also effectively binds nucleic acids and negatively
compatible with different transfer buffers and detection charged proteins. Polyvinylidene diuoride (PVDF)
systems. Nitrocellulose is not as sturdy as other media and charged carboxy methyl cellulose membranes
and becomes brittle with multiple reuses. Reinforced are used only for protein (Western) blotting. These
nitrocellulose is more appropriate for applications where membranes bind nucleic acid and proteins by
multiple probings may be necessary. Mechanically stable hydrophobic and ionic interactions with a binding
membranes can be formulated with a net neutral charge to capacity of 2040 g/cm2 to 150 g/cm2 for PVDF.
decrease the background. These membranes have a very

the membrane through electrophoresis buffer as shown in

Advanced Concepts the gure. In the semidry method, the electrodes contact
the gel-membrane sandwich directly, requiring only
Capillary transfer is simple and relatively inexpen- enough buffer to soak the gel and membrane. The tank
sive, as no instruments are required. The transfer, electrophoretic transfer is preferred for large proteins
however, can be less than optimal, especially with resolved on acrylamide gels, whereas the semidry method
large gels. Bubbles or crystals in between the mem- is frequently used for small proteins.
brane and the gel can cause loss of information or Vacuum transfer is a third method of DNA blotting
staining artifacts. The procedure is also slow, taking (Fig. 6-8). This blotting technique uses suction to move
from a few hours to overnight for large fragments. the DNA from the gel to the membrane in a recirculating
buffer. Like electrophoretic transfer, this method trans-
fers the DNA more rapidly, e.g., in hours rather than
days, than capillary transfer. Also, discontinuous transfer
The original method developed by Southern used cap- due to air trapped between the membrane and the gel is
illary transfer (Fig. 6-6). For capillary transfer, the gel is avoided. One disadvantage of the second and third meth-
placed on top of a reservoir of buffer, which can be a shal- ods is the expense and maintenance of the electrophore-
low container or membrane papers soaked in high salt sis and vacuum equipment.
buffer, e.g., 10X saline sodium citrate (10X SSC: 1.5 M After binding the nucleic acid to membranes, the cut,
NaCl, 0.15 M Na citrate) or commercially available trans- denatured DNA is permanently immobilized to the mem-
fer buffers. The nitrocellulose membrane is placed brane by baking the membrane in a vacuum oven (80C,
directly on the gel, and dry absorbent membranes or paper 3060 min.) or by UV cross-linking, i.e., covalently
towels are stacked on top of the membrane. The buffer is attaching the DNA to the nitrocellulose using UV light
moved by capillary action from the lower reservoir to the energy. The purpose of baking or cross-linking is to pre-
dry material on top of the gel. The movement of the buffer vent the transferred DNA fragments from washing away
through the gel will carry the denatured DNA out of the or moving on the membrane.
gel. When the DNA contacts the nitrocellulose mem- Following immobilization of the DNA, a prehy-
brane, the DNA will bind to it while the buffer will pass bridization step is required to prevent the probe from
through to the membranes or paper towels on top. binding to nonspecic sites on the membrane surface,
A second method, called electrophoretic transfer, which will cause high background. Prehybridization
uses electric current to move the DNA from the gel to the involves incubating the membrane in the same buffer in
membrane (Fig. 6-7). This system utilizes electrodes which the probe will subsequently be introduced. At this
attached to membranes above (anode) and below (cath- point, the buffer does not contain probe. The buffer con-
ode) the gel. The current carries the DNA transversely sists of blocking agents such as Denhardt solution (Ficoll,
from the gel to the membrane. Electrophoretic transfer is polyvinyl pyrrolidane, bovine serum albumin) and salmon
carried out with a tank or by a semidry approach. In sperm DNA. Sodium dodecyl sulfate (SDS, 0.01%) may
the tank method, the electrodes transfer current through also be included, along with formamide, the latter espe-
Dry paper
Nitrocellulose
membrane
Gel
Figure 6-6 Capillary transfer. Driven by capillary
Soaked paper movement of buffer from the soaked paper to the dry
Buffer paper, denatured DNA moves from the gel to the
membrane.

Whatman Nitrocellulose
paper Gel membrane
Figure 6-7 Electrophoretic

transfer. This system uses electric
current to mobilize the DNA from Buffer Support Glass Buffer
the gel to the membrane. plates
cially for RNA probes. The membrane is exposed to the total RNA or 0.53.0 g polyA RNA, depending on the
prehybridization buffer at the optimal hybridization tem- relative abundance of the transcript under study) can be
perature for 30 minutes to several hours, depending on the applied directly to agarose gels. Agarose concentrations
specic protocol. At this stage the sample is ready for of 0.8%-1.5% are usually employed. Polyacrylamide gels
hybridization with the probe, which will allow visualiza- can also be used, especially for smaller transcripts; for
tion of the specic gene or region of interest. instance, for analysis of viral gene expression.2 Gel elec-
trophoresis of RNA must be carried out under denaturing
Northern Blots conditions for accurate transcript size assessment (see
Chapter 5). Complete denaturation is also required for
The Northern blot is a modication of the Southern blot efficient transfer of the RNA from the gel to the mem-
technique and was designed to investigate RNA structure brane, as with the transfer of DNA in the Southern blot.
and quantity. Although most Northern analyses are per- Because the denaturation is carried out during elec-
formed to investigate levels of gene expression (tran- trophoresis, a separate denaturation step is not required
scription from DNA) and stability, the method can also be for Northern blots. After electrophoresis, representative
used to investigate RNA structural abnormalities result- lanes can be cut from the gel, soaked in ammonium
ing from aberrations in synthesis or processing, such as acetate to remove the denaturant, and stained with acri-
alternate splicing. Splicing abnormalities are responsi- dine orange or ethidium bromide to assess quality and
ble for a number of diseases, such as beta-thalassemias equivalent sample loading (see Chapter 4).
and familial isolated growth hormone deciency. Analy- Denaturant, such as formaldehyde, must be removed
sis of RNA structure and quantity indirectly reveals muta- from the gel before transfer because it inhibits binding of
tions in the regulatory or splicing signals in DNA. the RNA to nitrocellulose. This is accomplished by rins-
Care must be taken with RNA preparation to maintain ing the gel in de-ionized water. RNA is transferred in 10X
an RNase-free environment. After isolation and quantita- or 20X SSC or 10X SSPE (1.8 M NaCl, 0.1 M sodium
tion of RNA, the samples (up to approximately 30 g phosphate, pH 7.7, 10 mM EDTA) to nitrocellulose as
Gel
Nitrocellulose
membrane
Porous plate
Figure 6-8 Vacuum transfer. This system uses
suction to move the DNA out of the gel and onto Recirculating buffer
the membrane. Vacuum

gel electrophoresis. Prestained molecular weight stan-

Advanced Concepts dards are run with the samples to orient the membrane
after transfer and to approximate the sizes of the pro-
Some protocols call for destaining of the gel in teins after probing. Standards ranging from 11,700 d
sodium phosphate buffer (acridine orange) or 200 (cytochrome C) to 205,000 d (myosin) are commercially
mM sodium acetate, pH 4.0 (ethidium bromide) available.
before transfer. The latter destaining method may The gel system used may affect subsequent probing of
interfere with the movement of RNA from the gel proteins with antibodies. Specically, denaturing gels
during transfer. If formaldehyde has been used as a could affect epitopes (antigenic sites on the protein) such
denaturant during electrophoresis, the gel must be that they will not bind with the labeled antibodies. Gel
rinsed and held in de-ionized water. Rinsing is not pretreatment with mild buffers such as 20% glycerol in
necessary if the formaldehyde concentration is less 50 mM Tris-HCl, pH 7.4, can renature proteins before
than 0.4 M. transfer.4
After electrophoresis, proteins can be blotted to mem-
branes by capillary or electrophoretic transfer. Nitro-
cellulose has high affinity for proteins and is easily
described above for DNA. 20X SSC should be used for treated with detergent (0.1% Tween 20 in 0.05 M Tris and
small transcripts (500 bases or less). The blotting proce- 0.15 M sodium chloride, pH 7.6) to prevent binding of
dure for RNA in the Northern blot is carried out in 20X the primary antibody to the membrane itself (blocking)
SSC, similar to the procedure for DNA transfer in the before hybridization. Binding of proteins to nitrocellu-
Southern blot. Prehybridization and hybridization in for- lose is probably hydrophobic as nonionic detergents can
mamide/SSC/SDS prehybridization/hybridization buffers remove proteins from the membrane. Other membrane
are performed also as with Southern blot. If the RNA has types that can be used for protein blotting are PVDF and
been denatured in glyoxal, the membrane must be soaked anion (DEAE) or cation (CM) exchange cellulose.
in warm Tris buffer (65C) to remove the denaturant
immediately before prehybridization.
Western Blots Advanced Concepts

Another modication of the Southern blot is the Western The Western blot method is used to conrm enzyme-
blot.3 The immobilized target for a Western blot is pro- linked immunoassay results for human immunode-
tein. There are many variations on Western blots. ciency virus (HIV) and hepatitis C virus among other
Generally, serum, cell lysate, or extract is separated on organisms. In this procedure, known HIV proteins
SDS-polyacrylamide gels (SDS-PAGE) or isoelectric are separated by electrophoresis and transferred and
focusing gels (IEF). The former resolves proteins accord- bound to a nitrocellulose membrane. The patients
ing to molecular weight, and the latter according to serum is overlaid on the membrane, and antibodies
charge. Dithiothreitol or 2-mercaptoethanol can also be with specicity to HIV proteins bind to their corre-
used to separate proteins into subunits. Polyacrylamide sponding protein. Unbound patient antibodies are
concentrations vary 5%-20%. Depending on the com- washed off, and binding of antibodies is detected by
plexity of the protein and the quantity of the target adding a labeled antihuman immunoglobulin anti-
protein, 150 g of protein is loaded per well. Before body. If HIV antibodies are present in the patients
loading, the sample is treated with denaturant, such serum, they can be detected with antihuman anti-
as mixing 1:1 with 0.04 M Tris HCl, pH 6.8, 0.1% body probes appearing as a dark band on the blot
SDS. The accuracy and sensitivity of the separation corresponding to the specic HIV protein to which
can be enhanced by using a combination of IEF gels the antibody is specic.
followed by SDS-PAGE or by using two-dimensional

genome, resulting in high background binding to

Probes sequences not related to the target region of interest.
The probe for Southern and Northern blots is a single- Short probes are more appropriate for mutational analysis
stranded fragment of nucleic acid. The purpose of the as they are sensitive to single base mismatches (see
probe is to identify one or more sequences of interest Chapter 8). The probe is constructed so that it has a com-
within a large amount of nucleic acid. The probe there- plementary sequence to the targeted gene. In order to bind
fore should hybridize specically with the target DNA or to the probe then, the target nucleic acid has to contain the
RNA that is to be analyzed. The probe can be RNA, dena- sequence of interest. There are typically fewer copies of a
tured DNA, or other modied nucleic acids. Peptide specic sequence in the genome, and therefore only a few
nucleic acids (PNAs) and locked nucleic acids have also bands will be apparent after detection.
been used as probes. These structures contain normal Properly prepared and stored DNA probes are rela-
nitrogen bases that can hybridize with complementary tively stable and easy to manufacture. Double-stranded
DNA or RNA, but the bases are connected by backbones DNA probes must be denatured before use. This is usu-
different from the natural phosphodiester backbone of ally accomplished by heating the probe (e.g., 95C,
DNA and RNA. These modied backbones are resistant 1015 min) in hybridization solution or treating with
to nuclease degradation and, because of a reduced nega- 50% formamide/2X SSC at a lower temperature for a
tive charge on their backbone, can hybridize more read- shorter time (e.g., 75C, 56 min)
ily to target DNA or RNA.
Probes for Western blots are specic binding proteins RNA Probes
or antibodies. A labeled secondary antibody directed
against the primary binding protein is then used for the RNA probes are often made by transcription from a
visualization of the protein band of interest. synthetic DNA template in vitro. These probes are simi-
lar to DNA probes with equal or greater binding affin-
ity to homologous sequences. Because RNA and DNA
DNA Probes
form a stronger helix than DNA/DNA, the RNA probes
DNA probes are created in several ways. A fragment of may offer more sensitivity than DNA probes in the
the gene to be analyzed can be cloned on a bacterial plas- Southern blot.
mid and then isolated by restriction enzyme digestion RNA probes can be synthesized directly from a plas-
and gel purication. The fragment, after labeling (see mid template or from template DNA produced by PCR
below) and denaturation, can then be used in Southern or (see Chapter 7). Predesigned systems are commercially
Northern blot procedures. available for this purpose. These products include plas-
Other sources of DNA probes include the isolation of mid vector DNA such as pGEM (Promega) or pBluescript
a sequence of interest from viral genomes and in vitro (Stratagene), containing a binding site for RNA poly-
organic synthesis of a piece of nucleic acid that has a par- merase (promoter) and a cloning site for the sequences of
ticular sequence. The latter is used only for short, interest, and a DNA-dependent RNA polymerase from
oligomeric probes. Probes can also be synthesized using Salmonella bacteriophage SP6 or E. coli bacteriophage
the polymerase chain reaction (PCR) (see Chapter 7) to T3 or T7. DNA sequences complementary to the RNA
generate large amounts of specic DNA sequences. transcript to be analyzed are cloned into the plasmid vec-
The length of the probe will, in part, determine the tor using restriction enzymes. The recombinant vector
specicity of the hybridization reaction. Probe lengths containing the gene of interest is then linearized, and the
range from tens to thousands of base pairs. In analysis of RNA probe is transcribed in vitro from the promoter.
the entire genome in a Southern blot, longer probes are RNA probes are labeled by incorporating a radioactive or
more specic for a DNA region because they must match modied nucleotide during the in vitro transcription
a longer sequence on the target. Shorter probes are not process.
usually used in Southern blots because short sequences Either coding or complementary RNA will hybridize
are more likely to be found in multiple locations in the to a double-stranded DNA target. Care must be taken,

however, in designing RNA probes for Northern blots.

The complementary sequence to the target must be used
for the probe. A probe of identical sequence to the target
Advanced Concepts
RNA (coding sequence) will not hybridize. Because of These structures are not only useful in the laboratory,
labeling during synthesis, RNA probes can have a high they are also potentially valuable in the clinic.
specic activity (signal to micrograms of probe) that Several structures have been proposed for use in
increases the sensitivity of the probe. To avoid high antisense gene therapy Fig. 6-10. Introduction of
background, some protocols include digestion of nonhy- sequences complementary to messenger RNA of a
bridized RNA, using a specic RNase, such as RNase A, gene (antisense sequences) will prevent translation
after hybridization is complete. of that mRNA and expression of that gene. If this
RNA probes are generally less stable than DNA probes could be achieved in whole organisms, selected aber-
and cannot be stored for long periods. Synthesis of an rantly expressed genes or even viral genes could be
RNA probe by transcription from a stored template is rel- turned off. One drawback of this technology is the
atively simple and should be performed within a few days degradation of natural RNA and DNA by intracellu-
of use. The DNA template can be removed from the lar nucleases. The nuclease-resistant structures are
probe by treatment with RNase-free DNase. Although more stable and available to hybridize to the target
RNA is already single-stranded, denaturation before use mRNA.
is recommended in order to eliminate secondary structure
internal to the RNA molecule.
Protein Probes
Other Nucleic Acid Probe Types
Western blot protein probes are antibodies that bind
Peptide nucleic acid and locked nucleic acid probes specically to the immobilized target protein. Polyclonal
(Fig. 6-9 and 6-10) can be synthesized using chemical or monoclonal antibodies can be used for this purpose.
methods.58 These modied nucleic acids have the advan- Polyclonal antibodies are made by immunization with a
tage of being resistant to nucleases that would degrade specic antigen, usually a peptide or protein. Small mol-
DNA and RNA by breaking the phosphodiester back- ecules (haptens) attached to protein carriers, carbohy-
bone. Further, the negative charge of the phosphodiester drates, nucleic acids, and even to whole cells and tissue
backbones of DNA and RNA counteract hydrogen bond- extracts can be used to generate an antibody response.
ing between the bases of the probe and target sequences. Adjuvants, such as Freunds adjuvant, are used to enhance
Structures such as PNA that do not have a negative the antibody titer by slowing the degradation of the pro-
charge hybridize more efficiently. tein and lengthening the time the immune system is
OR OR
NH2
O P O O P O
Base
O O
O Base O Base
N
O
O
NH O Figure 6-9 Peptide nucleic acids have
O O
the phosphodiester bond (left) replaced
O P O R O P O with carbon nitrogen peptide bonds (cen-
ter). Locked nucleic acids are bicyclic
O O nucleoside monomers where the ribose
sugar contains a methylene link between
R R its 2 oxygen and 4 carbon atoms (right).

NH2 NH2
N N
N
HO O O HO ON N
O N3-phosphoramidate NH2
O H3C O NH
O
NH N
Phosphodiester P
P N
O N O O O O O
O O
NH2 O
O N O O OR N
H3C N NH
Methylphosphonate P 2-O-alkyl RNA P
O O ON N O O ON N NH2
O
O N H3C
N N NH
S O NH P
Phosphorothioate P O O N O
O
O O ON N NH2 Morpholino
phosphorodiamidate NH2
NH2 N
H3B O N N
N
P O N N
Borane phosphonate N
O O ON N
H N
Peptide nucleic acid O
O O
P O NH2
3-O-phosphopropylamino
O O NH3
OH
Figure 6-10 Modications of the phosphodiester backbone of nucleic acids. 28, 29
exposed to the stimulating antigen. The immunoglobulins greater specicity, monoclonal antibodies can be used for
are subsequently isolated from sera by affinity chro- almost any procedure.
matography. In Western blot technology, polyclonal antibodies can
Polyclonal antibodies are a mixture of immunoglobu- give a more robust signal, especially if the target epitopes
lins that are directed at more than one epitope (molecular are partially lost during electrophoresis and transfer.
structure) on the antigen. Monoclonal antibodies are Monoclonal antibodies are more specic and may give
more difficult to produce. Kohler and Milstein rst less background; however, if the targeted epitope is lost,
demonstrated that spleen cells from immunized mice these antibodies do not bind, and no signal is generated.
could be fused with mouse myeloma cells to form hybrid Dilution of primary antibody can range from 1/100 to
cells (hybridomas) that could grow in culture and 1/100,000, depending on the sensitivity of the detection
secrete antibodies.9 By cloning the hybridomas (growing system (see below).
small cultures from single cells), preparations of specic
antibodies could be produced continuously. The clones
Probe Labeling
could then be screened for antibodies that best react with
the target antigen. Monoclonal antibodies can be isolated In order to visualize the probe bound to target fragments
from cell culture uid. Higher titers of antibodies are on the blot, the probe must be labeled and generate a
obtained by inoculating the antibody-producing hy- detectable signal. The original Southern analyses used
bridoma into mice and collecting the peritoneal uid. The radioactive labeling with 32P. This labeling was achieved
monoclonal antibody is then isolated by chromatography. by introduction of nucleotides containing radioactive
Polyclonal antibodies are useful for immunoprecipitation phosphorus to the probe. Today, many clinical laborato-
methods and can be used for Western blots. With their ries use nonradioactive labeling to avoid the hazard and

expense of working with radiation. Nonradioactive label- RNA probes are transcribed from cloned DNA or
ing methods are based on indirect detection of a tagged amplied DNA. These probes are labeled during their
nucleotide incorporated in or added to the probe. The two synthesis by the incorporation of radioactive, biotiny-
most commonly used nonradioactive tags are biotin lated, or digoxygenin-tagged nucleotides. Unlike double-
and digoxygenin (Fig. 6-11), either of which can be stranded complementary DNA probes and targets that
attached covalently to a nucleotide triphosphate, usually contain both strands of the complementary sequences,
UTP or CTP. RNA probes are single-stranded with only one strand of
There are three basic methods that are used to label a the complementary sequence represented.
DNA probe: end-labeling, nick translation, and random
priming. End-labeling involves the addition of labeled
Nucleic Acid Probe Design
nucleotides to the end of the fragment using terminal
transferase or T4 polynucleotide kinase. In nick transla- The most critical parts of any hybridization procedure are
tion, the labeled nucleotides are inserted into the fragment the design and optimal hybridization of the probe, which
at single-stranded breaks, or nicks, in a double-stranded determines the specicity of the results. With nucleic
probe. DNA polymerase extends the broken end of one acids, the more optimal the hybridization conditions for a
strand using the intact complementary strand for a tem- probe/target interaction, the more specic the probe.
plate and displaces the previously hybridized strand. Longer probes (5005000 bp) offer greater specicity
Random priming generates new single-stranded versions with decreased background, but they may be difficult or
of the probe with the incorporation of the labeled nuc- expensive to synthesize. Long probes are less affected by
leotides. The synthesis of these new strands is primed point mutations or polymorphisms within the sequence
by oligomers of random sequences that are six to ten targeted by the probe or within the probe itself.
bases in length. These short sequences will, at some fre- Shorter probes (500 bp) are less specic than longer
quency, complement sequences in the probe and prime ones in Southern blotting applications. A short sequence
synthesis of a copy of the probe with incorporated labeled has a higher chance of being repeated randomly in unre-
nucleotides. lated regions of the genome. Short probes are ideal, how-
O
HN NH
O
HO
CH3
X
S CH3
OH
O O
C
O O O CH2
CH CH CH2 NH C (CH2)5 NH C CH2
HN
O N
O
LiO P O H2C O
OLi 3
OH
Figure 6-11 Biotin (top) has a variable side chain (X). The polycyclic digoxygenin (bottom) is
shown covalently attached to UTP (dig-11-UTP). This molecule can be covalently attached or
incorporated into DNA or RNA to make a labeled probe.

target is exposed to the probe. Conditions of high strin-

Advanced Concepts gency are more demanding of probe:target complemen-
tarity. Low stringency conditions are more forgiving. If
Protein probes used in Western blot can be cova- conditions of stringency are set too high, the probe will
lently bound to an enzyme, usually horseradish per- not bind to its target. If conditions are set too low, the
oxidase or alkaline phosphatase. Unconjugated probe will bind unrelated targets, complicating interpre-
antibodies can be detected after binding with a con- tation of the nal results.
jugated secondary antibody to the primary probe, Several factors affect stringency. These include temper-
such as mouse antihuman or rabbit antimouse anti- ature of hybridization, salt concentration of the hybridiza-
bodies (Fig 6-12). The secondary antibodies will tion buffer, and the concentration of denaturant such as
recognize any primary antibody by targeting the FC formamide in the buffer. The nature of the probe sequence
region. can also impinge on the level of stringency. A probe with
Label a higher percentage of G and C bases will bind under
more stringent conditions than one with greater numbers
Secondary antibody
of A and T bases. The ideal hybridization conditions
Target protein Primary antibody can be estimated from calculation of the melting tem-
perature, or Tm, of the probe sequence. The Tm is a way
to express the amount of energy required to separate
the hybridized strands of a given sequence (Fig. 6-13).
At the Tm, half of the sequence is double-stranded, and
half is single-stranded. The Tm for a double-stranded
DNA sequence in solution is calculated by the following
Figure 6-12 Probe binding to Western blots may
formula:
include an unlabeled primary antibody that is subse-
quently bound by a secondary antibody carrying a
Tm 81.5C 16.6 logM 0.41 (%G C) 0.61
label for detection.
(% formamide) (600/n)
where M sodium concentration in mol/L and n
number of base pairs in the shortest duplex.
ever, for mutation analysis, as their binding affinity is RNA:RNA hybrids are more stable than DNA:DNA
sensitive to single base pair changes within a target bind- hybrids due to less constraint by the RNA phosphodiester
ing sequence.
The sequence of the probe can affect its binding
performance as well. A sequence with numerous internal
DS
complementary sequences will fold and hybridize with
itself, which will compete with hybridization to the
intended target. The probe folding or secondary struc-
DS=SS
ture is especially strong in sequences with high GC con-
tent, decreasing the binding efficiency to the target
sequence.
SS
Tm
Hybridization Conditions, Increasing temperature
Stringency Figure 6-13 Melting temperature, Tm, is the point at which
exactly half of a double-stranded sequence becomes single-
Southern blot and Northern blot probing conditions must stranded. The melting temperature is determined at the
be empirically optimized for each nucleic acid target. inection point of the melt curve. DS, double-stranded; SS,
Stringency is the combination of conditions in which the single-stranded.

backbone. The formulas, therefore, are slightly different.

For RNA:RNA hybrids the formula is: Advanced Concepts
Tm 79.8C 18.5 logM 0.58 (%G C) 11.8
Cot was used to demonstrate that mammalian DNA
(%G C) 0.35 (% formamide) (820/n)
consisted of sequences of varying complexity.
DNA:RNA hybrids have intermediate affinity: Britten and Kohne24 used Eschericia coli and calf
Tm 79.8C 18.5 logM 0.58 (%G C) 11.8 thymus DNA to demonstrate this. When they meas-
(%G C) 0.50 (% formamide) (820/n) ured reassociation of E. coli DNA vs. time, a sig-
The Tm is also a function of the extent of complemen- moid curve was observed, as expected for DNA
tarity between the sequence of the probe and that of the molecules with equal complexity. In comparison,
target sequence. For each 1% difference in sequence, the the calf DNA reassociation was multifaceted and
Tm decreases 1.5C. Furthermore, the Tm of RNA probes spanned several orders of magnitude (see Fig. 6-14).
is higher. RNA:DNA hybrids increase Tm by 1015C. The spread of the curve results from the mixture of
DNA:DNA hybrids increase Tm by 2025C. slowly renaturing unique sequences and rapidly
The Tm for short probes (1420 bases) can be calcu- renaturing repeated sequences (satellite DNA).
lated by a simpler formula:
Tm 4C number of GC pairs 2C number
of AT pairs
double-stranded sequence to anneal under a given set of
The hybridization temperature of oligonucleotide
conditions.
probes is about 5C below the melting temperature.
Tm and Cot values can provide a starting point for opti-
The effect of sequence complexity on hybridization effi-
mizing stringency conditions for Southern blot analysis.
ciency can be illustrated by the Cot value. Sequence
Hybridization at a temperature 25C below the Tm for 13
complexity is the length of unique (nonrepetitive)
Cot1/2 is considered optimal for a double-stranded DNA
nucleotide sequences. After denaturation, complex
probe. Final conditions must be established empirically,
sequences require more time to reassociate than simple
especially for short probes. Stringency conditions for rou-
sequences, such as polyA:polyU. Cot is an expression of
tine analyses, once established, will be used for all subse-
the sequence complexity (Fig. 6-14). Cot is equal to
quent assays. In the event a component of the procedure
the initial DNA concentration (Co) times the time required
is altered, new conditions may have to be established.
to reanneal (t). Cot1/ is the time required for half of a
2 Hybridizations are generally performed in hybridiza-
tion bags or in glass cylinders. Within limits, the sensi-
tivity of the analysis increases with increased probe
Size
1bp 10,000 bp concentration. Because the probe is the limiting reagent,
Complexity
it is practical to keep the volume of the hybridization
DS
solution low. The recommended volume of hybridization
buffer is approximately 10 mL/100 cm2 of membrane
DS=SS
surface area.
Formamide in the hybridization buffer effectively low-
ers the optimal hybridization temperature. This is espe-
SS cially useful for RNA probes and targets that, because of
6 5 4 3 2 1 0 1 secondary structure, are more difficult to denature and
Log Cot tend to have a higher renaturation (hybridization) tem-
Figure 6-14 Reannealing of single-stranded (SS) DNA perature. Incubation of the hybridization system in sealed
to double-stranded (DS) DNA vs. time at a constant con-
bags in a water bath or in capped glass cylinders in rotary
centration yields a sigmoid curve. The complexity of the
DNA sequence will widen the sigmoid curve. Increasing
ovens maintains the blot at the proper temperature.
the length of the double-stranded DNA will shift the curve Short probes (20 bases) can hybridize in 12 hours.
to the right. In contrast, longer probes require much longer hybridiza-

Radioactive isotope probe

Advanced Concepts
The nature of the probe label will affect hybridiza-
tion conditions. Unlike 32P labeling, the bulky non-
Nitrocellulose
radioactive labels (see Fig. 6-12) disturb the membrane
hybridization of the DNA chain. The temperature of
hybridization with these types of probes will be
lower than that used for radioactively labeled probes.
tion times. For Southern and Northern blots with probes

1000 bases in length, incubation is carried out for 16 Autoradiograph
hours or more. Raising the probe concentration can in-
crease the hybridization rates. Also, inert polymers, such
as dextran sulfate, polyethylene glycol, or polyacrylic X-ray film
acid, accelerate the hybridization rates for probes longer
than 250 bases.
Detection Systems
This chapter has so far addressed the transfer of elec-
trophoresed DNA, RNA, or protein to a solid membrane
Figure 6-15 A DNA or RNA probe labeled with radioactive
support and hybridization or binding of a specic probe phosphorous atoms (32P or 33P) hybridized to target (homolo-
to the target sequence of interest. The next step in these gous) sequences on a nitrocellulose membrane. The frag-
procedures is to detect whether the probe has bound to ments to which the probe is bound can be detected by
the target molecule and, if it has bound, the relative loca- exposing autoradiography lm to the membrane.
tion of the binding. The original 32P-labeled probes
offered the advantages of simple and sensitive detection.
After hybridization, unbound probe is washed off, and
the blot is exposed to light-sensitive lm to detect the
fragments that are hybridized to the radioactive probe
(Fig. 6-15). Wash conditions must be formulated so that
Advanced Concepts only completely hybridized probe remains on the blot.
Optimization may not completely eliminate all non- Typically wash conditions are more stringent than those
specic binding of the probe. This will result in used for hybridization.
extra bands in control lanes or cross-hybridizations. Nonradioactive detection systems require a more
At a given level of stringency, any increase to elim- involved detection procedure. For most nonradioactive
inate cross-hybridization will lower the binding to systems, the probe is labeled with a nucleotide covalently
the intended sequences. It becomes a matter of bal- attached to either digoxygenin or biotin. The labeled
ancing the optimal probe signal with the least nucleotide is incorporated into the nucleotide chain of the
amount of non-target binding. Cross-hybridizations probe by in vitro transcription, nick translation, primer ex-
are usually recognizable as bands of the same size in tension, or addition by terminal transferase. Digoxygenin-
multiple runs. It is important to take cross- or biotin-labeled probe is incubated together with the blot
hybridization bands into account in the nal inter- with sample(s) containing the target sequence of interest
pretation of the assay results. to allow for hybridization to occur. After hybridization,
unbound probe is washed away. Then, antidigoxygenin

Anti digoxygenin or streptavidin

Advanced Concepts conjugated to alkaline phosphatase
Digoxygenin or biotin
In addition to CSPD and CDP-star (Roche
Diagnostics Corp.), there are several substrates for Probe
chemiluminescent detection that are 12 dioxetane
derivatives such as 3-(2-spiroadamantane)-4-
methoxy-4-(3-phosphoryloxy) phenyl-1,2-dioxe-
tane (AMPPD; Tropix, Inc.). Dephosphorylation of Nitrocellulose
membrane
these compounds by the alkaline phosphatase con-
jugate bound to the probe on the membrane results
in a light-emitting product (see Fig. 6-17).25 Other
luminescent molecules include acridinium ester and
acridinium (N-sulfonyl) carboxamide labels, isolu-
minol, and electrochemiluminescent ruthenium tris-
bipyridyl labels.
The substrate used most often for chromogenic Autoradiography
detection is a mixture of Nitroblue tetrazolium
(NBT) and 5-bromo-4-chloro-3-indolyl phosphate
(BCIP). Upon dephosphorylation of BCIP by alka- X-ray film
line phosphatase, it is oxidized by NBT to give a
dark blue indigo dye as an oxidation product. BCIP
is reduced in the process, and also yields a blue
product (see Fig. 6-18).
Figure 6-16 Indirect non-radioactive detection. The

antibody or streptavidin, respectively, conjugated to alka-
probe is covalently attached to digoxygenin or biotin. After
line phosphatase (AP conjugate, Fig. 6-16) is added to hybridization, the probe is bound by antibodies to digoxy-
reaction mix to bind to the digoxigenin- or biotin-labeled genin or streptavidin conjugated to alkaline phosphatase
probe:target complex. Horseradish peroxidase (HRP) (AP). This complex is exposed to color or light producing
conjugates can also be used in this procedure. After the substrates of AP producing color on the membrane or light
detected with autoradiography lm.
binding of the conjugate, the membrane is bathed in a
solution of substrate that, when oxidized by HRP or
dephosphorylated by AP, produces a signal. Substrates designed to minimize these drawbacks. Unlike radioac-
frequently used are dioxetane or tetrazolium dye derivative detection, in which testing the membrane with a
tives, which generate chemiluminescent (Fig. 6-17) or Geiger counter can give an indication of how hot the
chromogenic (Fig. 6-18) signals, respectively (Table 6.2). bands are and consequently how long to expose the mem-
As with radioactive detection, the chemiluminescent brane to the lm, chemiluminescent detection may
signal produced by the action of the enzyme on dioxetane require developing lms at different intervals to deter-
develops in the dark by autoradiography. Light released mine the optimum exposure time.
by phosphorylation of dioxetane takes place at the loca- For chromogenic detection, a colored signal is pro-
tion on the membrane where the probe is bound and duced when the enzyme interacts with a derivative of a
darkens the light-sensitive film. Chemiluminescent tetrazolium dye and is detected directly on the membrane
detection is often stronger and develops faster than lter. The advantage of this type of detection is that the
radioactive detection. A disadvantage of chemilumines- color can be observed as it develops and the reaction
cent detection is that it is harder to control and sometimes stopped at a time when there is an optimum signal-to-
produces high backgrounds. New substrates have been background ratio. In general, chromogenic detection is

O O O O *
OCH3 PO3 OCH3 O OCH3
O Alkaline O O
O
phosphatase + Light
(chemiluminescence)
PO3=
Figure 6-17 Light is emitted from 1-2 dioxetane substrates after dephosphorylation by alkaline
phosphatase to an unstable structure. This structure releases an excited anion that emits light.
not as sensitive as chemiluminescent detection and can ization of a band on the membrane or lm. A band is
also result in a higher background, especially with probes simply seen as a line running across the width of the lane.
labeled by random priming. Analysis of bands, i.e., presence or absence or location in
The key to a successful blotting method is a high the lane, produced by Southern blot can be straightfor-
signal-to-noise ratio. Ideally, the probe and detection ward or complex, depending on the sample and the
systems should yield a specic and robust signal. High design of the procedure. Figure 6-19 is a depiction of a
specic signal, however, may be accompanied by high Southern blot result. The bands shown can be visualized
background (noise). Therefore, sensitivity of detection is either on a membrane or on an autoradiographic lm. If
sometimes sacriced to generate a more specic signal. a gene locus has a known restriction pattern, for instance
in lane 1, then samples can be tested to compare their
restriction patterns. In the gure, the sample in lane 3 has
Interpretation of Results the identical pattern, i.e., both lanes have the same num-
When a specic probe binds to its target immobilized ber of bands, and the bands are all in the same location
on a membrane, the binding is detected as described in on the gel and are likely to be very similar if not identi-
the previous section, with the end result being the visual- cal in sequence to the sample in lane 1. Southern blot
O
O
O P O
Cl O P O Cl OH Cl
O O
Br Br Br HN
O
N Phosphatase NH NH Br
O Cl
BCIP
(colorless, soluble) Oxidation Blue precipitate
Reduction
OCH3 OCH3
N H2CO OCH2
N
N N N N
N
N N N N N N N
NH HN
NO2 NO2
O2N
NO2
NBT Blue precipitate
(yellowish, soluble)
Figure 6-18 Generation of color with BCIP and NBT. Alkaline phosphatase dephosphorylates BCIP which then reduces NBT
making an insoluble blue precipitate.

Table 6.2 Nonradioactive Detection Systems

Type of Detection Enzyme Reagent Reaction Product
Chromogenic HRP 4-chloro-1-naphthol (4CN) Purple precipitate
HRP 3,3-diaminobenzidine Dark brown precipitate
HRP 3,3,5,5,-tetramethylbenzidine Dark purple stain
Alkaline phosphatase 5-bromo-4-chloro-3-indolyl phosphate/nitro- Dark blue stain
blue tetrazolium
Chemiluminescent HRP Luminol/H2O2/p-iodophenol Blue light
Alkaline phosphatase 12 dioxetane derivatives Light
Alkaline phosphatase Disodium 3-(4-methoxyspiro {1,2-dioxetane- Light
3,2-(5-chloro) tricyclo[3.3.1.13,7]decan}
4-yl)-1-phenyl phosphate and derivatives
(CSPD, CDP-Star)
cannot detect tiny deletions or insertions of nucleotides product and that the low signal is not due to technical dif-
or single nucleotide differences unless they affect a spe- culties.
cic restriction site. For some assays, cross-hybridization
may confuse results. These artifacts can be identied by
their presence in every lane at a constant size. Array-Based Hybridization
Northern (or Western) blots are usually used for analy- Dot/Slot Blots
sis of gene expression, although they can also be used to
analyze transcript size, transcript processing, and protein There are many variations on Southern hybridization
modication. For these analyses, especially when esti- methods. In cases where the determination of the size of
mating expression, it is important to include an internal the target is not required, DNA and RNA can be more
control to correct for errors in isolation, gel loading, or quickly analyzed using dot blots or slot blots. These pro-
transfer of samples. The amount of expression is then cedures are usually applied to expression, mutation, and
determined relative to the internal control (Fig. 6-20). In amplication/deletion analyses.
the example shown, the target transcript or protein prod- For dot or slot blots, the target DNA or RNA is depos-
uct is expressed in increasing amounts, left to right. The ited directly on the membrane. Various devices, some
internal standardized control (lower band) assures that a
1 2 3 4
sample has low expression of target transcript of protein
M 1 2 3 4
Figure 6-20 Example of a Northern or Western blot result.

Lane 1 contains a positive control transcript or protein (arrow)
to verify the probe specicity and target size. Molecular
weight markers can also be used to estimate size as in
Figure 6-19 Example of a Southern blot result. The rst lane Southern analysis. The amount of gene product (expression
(M) contains molecular weight markers. Restriction digests of level) is determined by the intensity of the signal from the test
a genetic region can be compared to determine differences samples relative to a control gene product (lower band in
in structure. Two samples with the same pattern (for example, lanes 24). The control transcript is used to correct for any
lanes 1 and 3) can be considered genetically similar. differences in isolation or loading from sample to sample.

with vacuum systems, have been designed to deposit Genomic Array Technology
the target on the membrane. A pipet can be used for
procedures testing only a few samples. For dot blots, the Array technology can be applied to gene (DNA) analysis
target is deposited in a circle or dot. For slot blots, by performing comparative genome hybridization and to
the target is deposited in an oblong bar (Fig. 6-21). Slot gene expression (RNA or protein) analysis on expression
blots are more accurate for quantitation by densitometry arrays. There are several types of array technologies,
scanning because they eliminate the error that may arise including macroarrays, microarrays, high density oligo-
from scanning through a circular target. If the diameter nucleotide arrays, and microelectronic arrays.
of the scanned area is not exactly the same from one sam-
ple to another, comparative results may be inaccurate. Macroarrays
Dot blots are useful for multiple qualitative analyses In contrast to Northern and Southern blots, dot (and slot)
where many targets are being compared, such as muta- blots offer the ability to test and analyze larger numbers of
tional analyses. samples at the same time. These methodologies are lim-
Dot and slot blots are performed most efficiently on ited, however, by the area of the substrate material, nitro-
less complex samples, such as PCR products or selected cellulose membranes, and the volume of hybridization
mRNA preparations. Without gel resolution of the target solution required to provide enough probe to produce an
fragments, it is important that the probe hybridization adequate signal for interpretation. In addition, although
conditions are optimized for these types of blots because up to several hundred test samples can be analyzed simul-
cross-hybridizations cannot be denitively distinguished taneously, those samples can be tested for only one gene
from true target identication. A negative control (DNA or gene product. A variation of this technique is the
of equal complexity but without the targeted sequence) reverse dot blot, in which several different probes are
serves the baseline for interpretation of these assays. immobilized on the substrate, and the test sample is
When performing expression analysis by slot or dot labeled for hybridization with the immobilized probes. In
blots, it is also important to include an amplication or this conguration, the terminology can be confusing.
normalization control, as shown on the right in Figure 6- Immobilized probe is sometimes referred to as the target,
21. This allows correction for loading or sample differ- and the labeled specimen DNA, RNA, or protein is called
ences. This control can also be analyzed on a separate the probe. Regardless of the designation, the general idea
duplicate membrane to avoid cross-reactions between the is that a known sequence is immobilized at a known loca-
test and control probes. tion on the blot, and the amount of sample that hybridizes
to it is determined by the signal from the labeled sample.
Reverse dot blots on nitrocellulose membranes of sev-
eral to several thousand targets are macroarrays. Radi-
oactive or chemiluminescent signals are typically used to
detect the hybridized targets in the sample. Macroarrays
are created by spotting multiple probes onto nitrocellu-
lose membranes. The hybridization of labeled sample
material is read by eye or with a phosphorimager (a
quantitative imaging device that uses storage phosphor
Figure 6-21 Example conguration of a dot blot (left) and technology instead of x-ray lm). Analysis involves com-
a slot blot (right). The target is spotted in duplicate, side by
side, on the dot blot. The last two rows of spots contain posi-
parison of signal intensity from test and control samples
tive, sensitivity and negative control followed by a blank with spotted on duplicate membranes.
no target. The top two rows of the slot blot gel on the left rep- Although macroarrays greatly increase the capacity
resent four samples spotted in duplicate, with positive, sensitiv- to assess numerous targets, this analysis system is still
ity and negative control followed by a blank with no target in
limited by the area of the membrane and the specimen
the last four samples on the right. The bottom two rows repre-
sent a loading or normalization control that is often useful in
requirements. As the target number increases, the volume
expression studies to conrm that equal amounts of DNA or of sample material required increases. This limits the util-
RNA were spotted for each test sample. ity of this method for use on small amounts of test mate-

Solid Split Pin and Thermal Solenoid Piezoelectric Figure 6-22 Pen-type (left) and ink-jet
pin pin ring (right) technologies used to spot arrays.
rial, especially as might be encountered with clinical in triplicate, simultaneous screening of the entire human
specimens. genome on a single chip is within the scope of array tech-
nology.
Microarrays The larger nitrocellulose membrane, then, is replaced
In 1987, the use of treated glass instead of nitrocellulose by a glass microscope slide. The slide carrying the array
or nylon membranes for the production of arrays was of targets is referred to as a chip (Fig. 6-23). Targets are
developed, increasing the versatility of array applica- usually DNA, either cDNAs, PCR products, or oligomers;
tions. With improved spotting technology and the ability however, targets can be DNA, RNA, or protein. Targets
to deposit very small target spots on glass substrates, the are spotted in triplicate and spaced across the chip to
macroarray evolved into the microarray. Tens of thou- avoid any geographic artifacts that may occur from
sands of targets can be screened simultaneously in a very uneven hybridization or other technical problems. Probes
small area by miniaturizing the deposition of droplets are usually cDNA-generated from sample RNA but can,
(Fig. 6-22). Automated depositing systems (arrayers) can as well, be genomic DNA, RNA, or protein.
place more than 80,000 spots on a glass substrate the size
of a microscope slide. The completion of the rough draft
of the human genome sequence revealed that the human
genome may consist of fewer than 30,000 genes. Thus, Advanced Concepts
even with spotting representative sequences of each gene
The analysis of the entire genome or sets of related
genes is the relatively new eld of genomics.
Knowing the combinatorial and interrelated func-
tions of gene products, observation of the behavior
Advanced Concepts of sets of genes or genomes, is a more accurate
The rst automated arrayer was described in 1995 method for analyzing biological states or responses.
by Patrick Brown at Stanford University.26 This and Stanley Fields27 predicted that the entire collection
later versions of automated arrayers use pen-type of proteins coded by the genome, known as the pro-
contact to place a dot of probe material onto the sub- teome, is likely to be ten times more complex than
strate. Modications of this technology include the the genome. The study of entire sets of proteins, or
incorporation of ink jet printing systems to deposit proteomics, will also be facilitated by array tech-
specic targets at designated positions using ther- nology using antigen/antibody or receptor/ligand
mal, solenoid, or piezoelectric expulsion of target binding in the array format. Mass spectrometry can
material (see Fig. 6-22). also be applied to the study of proteomics.

Figure 6-23 Microarray, or DNA chip, is a glass slide car-

rying 384 spots. Arrays are sometimes supplied with uores-
cent nucleotides for use in labeling the test samples, and
software for identication of the spots on the array by the
array reader.
Other methods used to deposit targets on chips include

performing DNA synthesis directly on the glass or
silicon support.10 This technique uses sequence informa-
tion to design oligonucleotides and to selectively mask,
activate, and covalently attach nucleotides at designated Figure 6-25 Microelectronic chip with a ten by ten array
positions on the chip. Proprietary photolithography (center diamond). Each of the 100 stations on the array is
techniques (Affymetrix) allow for highly efficient synthe- attached to a separate electrode (Nanogen).
sis of short oligomers (1025 bases long) on high-density

arrays (Fig. 6-24). These oligomers can then be probed that can be programmed to attract and concentrate the
with labeled fragments of the test sequences. Using this labeled sample. By enhancing the hybridization con-
technology, more than 100,000 targets can be applied ditions separately at each spot on the array, single nuc-
to chips. These types of arrays are called high-density leotide resolution is possible even on longer sample
oligonucleotide arrays and are used for mutation fragments.
analysis, single nucleotide polymorphism analysis, and Sample preparation for array analysis requires uores-
sequencing. cent labeling of the test sample as microarrays and other
Another type of array method uses microelectronics to high-density arrays are read by automated uorescent
focus targets to specic positions on the array (Fig. 6-25). detection systems. The most frequent labeling method
Once bound, these targets can be hybridized to labeled used for RNA is synthesis of cDNA or RNA copies with
DNA or RNA samples under controlled conditions. incorporation of labeled nucleotides. For DNA, random
These are microelectronic arrays. In this technol- priming or nick translation is used. Several alternative
ogy, each position on the array is attached to an electrode methods have also been developed.11
Mask Light
Activated
C A T A T
O O O OH OH O O A G C T G
T T T T T T C C T T C C G
DNA
Glass slide 1025 nucleotides

Figure 6-24 Photolithographic target synthesis. A mask (left) allows light activation of on the chip. When a nucleotide is added
only the activated spots will covalently attach it (center). The process is repeated until the desired sequences are generated at
each position on the chip (right).

For gene expression analyses, target probes immobi- Normal reference DNA
lized on the chips are hybridized with labeled mRNA
from treated cells or different cell types to assess the
expression activity of the genes represented on the chip. Test sample DNA
Arrays used for this application are classie as expres-
sion arrays.12 Expression arrays measure transcript or
protein production relative to a reference control isolated
from untreated or normal specimens (Fig. 6-26).
Another application of array technology is compara-
Microarray CGH
tive genome hybridization (array CGH). This method is
used to screen the genome or specic genomic loci for
deletions and amplications.13 For this method, genomic
DNA is isolated, fragmented, and labeled for hybridiza-
Chromosome
tion on the chip (Fig. 6-27). This type of method is anal-
ogous to the cytogenetic technique done on metaphase
chromosomes. Array CGH can provide higher resolution
and more dened genetic information than traditional
Locus
cytogenetic analysis, but it is limited to the analysis of
loci represented on the chip. Genomic arrays can be per- Cytogenetic location
formed on xed tissue and limiting samples. Methods Figure 6-27 Comparative genomic hybridization.
have been developed to globally amplify genomic DNA Reference and test DNA are labeled with different uors, rep-
resented here as black and green respectively. After hybridiza-
to enhance CGH analysis.14,15 Reading microarrays tion, excess green label indicates amplication of test sample
requires a uorescent reader and analysis software. After locus. Excess black label indicates deletion of the test sample
determination of background and normalization with locus. Neutral or gray indicates equal test and reference DNA.
standards included on the array, the software averages the
signal intensity from duplicate or triplicate sample data.
The results are reported as a relative amount of the refer- ances more than 23 standard deviations from 1 (test
ence and test signals. Depending on the program, vari- reference) are considered an indication of signicant
increases (test:reference 1) or decreases (test:reference
1) in the test sample.
Control Treated Control Treated Several limitations to the array technology initially
restrained the use of microarrays in the clinical laboratory.
Lack of established standards and controls for optimal
binding prevents the calibration of arrays from one labo-
Single color Dual color
fluorescent fluorescent
ratory to another. Not enough data have been accumulated
labeling labeling to determine the background nonspecic binding and
cross hybridization that might occur among and within a
given set of sequences on an array. For instance, how
Hybridize Hybridize
much variation would result from comparing two normal
samples together multiple times? Background noise can
also affect the interpretation of array results. Furthermore,
Figure 6-26 Labeling of sample for array analysis. At the passive hybridization of thousands of different sequences
left is single color uorescent labeling where duplicate chips
will result in different binding affinities under the same
are hybridized separately and compared. On the right is dual
color labeling where test (treated) and reference (control)
stringency conditions, unless immobilized sequences are
samples are labeled with different color uors and hybridized carefully designed to have similar melting temperatures.
to the same chip. For mutation analysis, the length of the immobilized

probe is limited due to the use of a single hybridization Labeled probe Single-stranded RNA
condition for all sequences. For gene expression applica-
tions, only relative, rather than absolute, quantitation is
possible.
These and other concerns are being addressed to
improve the reliability and consistency of array analysis.
As more data are accumulated, baseline measurements, Hybridization
universal standards, and recommended controls will be
established. Advances in microelectronics and microu-
idics have also been applied to array design and manu-
facture.16,17
Although arrays are, to date, in limited use in clinical
laboratories, improvements in price and availability of
instrumentation and premade chips increase their value
Nuclease
for medical applications. Minimal sample requirements
and comprehensive analysis with relatively small invest-
ments in time and labor are attractive features of array
technology.
Solution Hybridization
Nuclease +
Solution hybridization is not yet a routine part of clinical
analysis. With the increasing interest in short inter- Full-length probe
fering RNAs (siRNAs) and microRNAs (miRNAs),
which are conveniently analyzed by this type of hybridi-
zation analysis, solution methods may come into more
frequent use. Target RNA hybrid
Solution hybridization has been used to measure
mRNA expression, especially when there are low Figure 6-28 Solution hybridization. Target RNAs are
amounts of target RNA. One version of the method is hybridized to a labeled RNA or DNA carrying the complemen-
called RNase protection, or S1 analysis, after the S1 sin- tary sequence to the target. After digestion by a single strand-
gle strandspecic nuclease. A labeled probe is hybri- specic nuclease, only the target:probe double-stranded
hybrid remains. The hybrid can be visualized by the label on
dized to the target sample in solution. After digestion of
the probe after electrophoresis.
excess probe by a single strandspecic nuclease, the
resulting labeled, double-stranded fragments are resolved
by polyacrylamide gel electrophoresis (Fig. 6-28). S1 hybridize to the target RNA. One probe, the capture
mapping is useful for determining the start point or ter- probe, is biotinylated and will bind specically to strep-
mination point of transcripts.18,19 This procedure is more tavidin immobilized on a plate or on magnetic beads. The
sensitive than Northern blotting because no target can be other probe, called the detection probe, can be detected
lost during electrophoresis and blotting. It is more appli- by a monoclonal antibody directed against RNA:DNA
cable to expression analysis, the sensitivity being limited hybrids or a covalently attached digoxygenin molecule
with double-stranded DNA targets. that can be used to generate chromogenic or chemilumi-
There are several variations of this type of analysis. nescent signal (see Detection Systems).
Probe:target hybrids can be detected by capture on a solid Solution hybridization can also be applied to the analy-
support or beads rather than by electrophoresis.20,21 For sis of protein-protein interactions and to nucleic
these sandwich-type assays, two probes are used. Both acidbinding proteins, using a gel mobility shift

Increasing probe d. CATCGCGATCTGCAATTACGACGATAA

GTAGCGCTAGACGTTAATGCTGCTATT
Bound Suppose you were to use single strands of these frag-
Free ments as probes for a Southern blot:
2. If the fragments were dissolved in a solution of

Figure 6-29 Gel mobility shift assay showing protein-protein
or protein-DNA interaction. The labeled test substrate is mixed
50% formamide, is the stringency of hybridiza-
with the probe in solution and then analyzed on a polyacry- tion higher or lower than if there were no formamide?
lamide gel. If the test protein binds the probe protein or DNA,
the protein will shift up in the gel assay. 3. If a high concentration of NaCl were added to the
hybridization solution, how would the stringency be
affected?
assay.22,23 After mixing the labeled DNA or protein with
the test material, such as a cell lysate, a change in mobil- 4. Does heating of the solution from 65C to 75C dur-
ity, usually a shift to slower migration, indicates binding ing hybridization raise or lower stringency?
of a component in the test material to the probe protein or
nucleic acid (Fig. 6-29). This assay has been used exten-
5. At the end of the procedure, what would the autoradi-
sively to identify trans factors that bind to cis acting ele-
ogram show if the stringency was too high?
ments that control gene regulation.
Solution hybridization can also be used to detect
6. In an array CGH experiment, three test samples were
sequence changes in DNA or mutational analysis. These
hybridized to three microarray chips. Each chip was
applications will be discussed in Chapter 8.
spotted with eight gene probes (Gene A-H). Below are
Hybridization methods offer the advantage of direct
results of this assay expressed as the ratio of test DNA
analysis of nucleic acids at the sequence level, with-
to reference DNA. Are any of the eight genes consis-
out cloning of target sequences. The signicance of
tently deleted or amplied in the test samples? If so,
hybridization methodology to clinical applications is
which ones?
the direct discovery of molecular genetic information
from routine specimen types. A wide variety of modi- Gene Sample 1 Sample 2 Sample 3
cations of the basic blotting methods have and will
be developed for clinical and research applications. A 1.06 0.99 1.01
Although amplification methods, specifically PCR, B 0.45 0.55 0.43
have replaced many blotting procedures, a number of
C 1.01 1.05 1.06
hybridization methods are still used extensively in rou-
tine clinical analysis. D 0.98 1.00 0.97
E 1.55 1.47 1.62
STUDY QUESTIONS F 0.98 1.06 1.01

G 1.00 0.99 0.99
1. Calculate the melting temperature of the following
DNA fragments using the sequences only: H 1.08 1.09 0.90
a. AGTCTGGGACGGCGCGGCAATCGCA
TCAGACCCTG CCGCG CCGTTAGCGT References
b. TCAAAAATCGAATATTTGCTTATCTA 1. Southern E. Detection of specic sequences
AGTTTTTAGCTTATAAACGAATAGAT among DNA fragments separated by gel electro-
c. AGCTAAGCATCGAATTGGCCATCGTGTG phoresis. Journal of Molecular Biology 1975;
TCGATTCGTAGCTTAACCGGTAGCACAC 98:503-17.

2. Murthy S, Kamine J, Desrosiers RC. Viral-encoded 14. Huang Q, Schantz SP, Pulivarthi HR, et al.
small RNAs in herpes virus saimiriinduced Improving degenerate oligonucleotide primed
tumors. EMBO Journal 1986;5(7):1625-32. PCR comparative genomic hybridization for
3. Bowen B, Steinberg J, Laemmli UK, et al. The analysis of DNA copy number changes in
detection of DNA-binding proteins by protein blot- tumors. Genes, Chromosomes and Cancer
ting. Nucleic Acids Research 1980;8(1):1-20. 2000;28:395-403.
4. Dunn D. Effects of the modication of transfer 15. Wang G, Maher E, Brennan C, et al. DNA ampli-
buffer composition and the renaturation of proteins cation method tolerant to sample degradation.
in gels on the recognition of proteins on western Genome Research 2004;14(11):2357-66.
blots by monoclonal antibodies. Analytical Bio- 16. Edman CF, Raymond DK, Wu E, et al. Electric
chemistry 1986;157(1):144-53. elddirected nucleic acid hybridization on
5. Koshkin AA, Nielson P, Rajwanshi VK, et al. microchips. Nucleic Acids Research 1997;25(24):
Synthesis of the adenine, cytosine, guanine, 5- 4907-14.
methlycysteine, thymine and uracil bicyclonucleo- 17. Sosnowski RG, Tu E, Butler WF, et al. Rapid deter-
side monomers, oligomerisation, and unprecedented mination of single base mismatch mutations in
nucleic acid recognition. Tetrahedron 1998;54: DNA hybrids by direct electric eld control.
3607-30. Proceedings of the National Academy of Sciences
6. Singh SK, Koshkin AA, Wengel J. LNA (locked 1997;94:1119-23.
nucleic acids): Synthesis and high-affinity nucleic 18. Squires C, Krainer A, Barry G, et al. Nucleotide
acid recognition. Chemical Communications sequence at the end of the gene for the RNA
1998;4:455-56. polymerase beta subunit (rpoC). Nucleic Acids
7. Buchardt O, Berg RH, Nielsen PE. Peptide nucleic Research 1981;9(24):6827-40.
acids and their potential applications in biotech- 19. Zahn K, Inui M, Yukawa H. Characterization of a
nology. Trends in Biotechnology 1993;11(9): separate small domain derived from the 5 end of
384-86. 23S rRNA of an alpha-proteobacterium. Nucleic
8. Egholm M, Christensen L, Behrens C, et al. PNA Acids Research 1999;27(21):4241-50.
hybridizes to complementary oligonucleotides 20. Rautio J, Barken KB, Lahdenper J, et al. Sandwich
obeying the Watson-Crick hydrogen-bonding hybridisation assay for quantitative detection of
rules. Nature 1993;365(6446):566-68. yeast RNAs in crude cell lysates. Microbial Cell
9. Kohler G, Milstein C. Continuous cultures of fused Factories 2003;2:4-13.
cells secreting antibody of predened specicity. 21. Casebolt D, Stephenson CB. Monoclonal antibody
Nature 1975;256:495-97. solution hybridization assay for detection of mouse
10. Lipschultz RJ, Fodor TR, Gingeras DJ, et al. High- hepatitis virus infection. Journal of Clinical Micro-
density synthetic oligonucleotide arrays. Nature biology 1992;30(3):608-12.
Genetics 1999;21:20-24. 22. Malloy P. Electrophoretic mobility shift
11. Richter A, Schwager C, Hentz S, et al. Comparison assays. Methods in Molecular Biology 2000;
of uorescent tag DNA labeling methods used for 130:235-46.
expression analysis by DNA microarrays. Bio- 23. Park S, Raines RT. Fluorescence gel retardation
Techniques 2002;33(3):620-30. assay to detect protein-protein interactions.
12. Freeman W, Robertson DJ, Vrana KE. Fundamen- Methods in Molecular Biology 2004;261:
tals of DNA hybridization arrays for gene expres- 155-60.
sion analysis. BioTechniques 2000;29(5):1042-55. 24. Britten RJ. Repeated sequences in DNA. Science
13. Oostlander A, Meijer GA, Ylstra B. Microarray- 1968;161:529-40.
based comparative genomic hybridization and its 25. McCapra F. The chemiluminescence of organic
applications in human genetics. Clinical Genetics compounds. Quarterly Review of the Chemical
2004;66(6):488-95. Society 1966; 20:485510.

26. Schena M, Shalon D, Davis RW, et al. Quantitative 28. Wickstrom E. DNA combination therapy to
monitoring of gene expression patterns with a com- stop tumor growth. Cancer Journal 1998;4
plementary DNA microarray. Science 1995;270: (Suppl 1):S43.
467-70. 29. Smith JB. Preclinical antisense DNA therapy of
27. Fields S. Proteomics: Proteomics in genomeland. cancer in mice. Methods in Enzymology 1999;314:
Science 2001;291(5507):1221-24. 537-80.
Chapter 7 Lela Buckingham and Maribeth L. Flaws
Nucleic Acid
Amplification
OUTLINE OBJECTIVES
TARGET AMPLIFICATION Compare and contrast among the following in vitro assays
Polymerase Chain Reaction for amplifying nucleic acids: polymerase chain reaction
Transcription-Based Amplication (PCR), branched DNA amplication, ligase chain reac-
Systems
tion, transcription-mediated amplication, and Q repli-
PROBE AMPLIFICATION case with regard to type of target nucleic acid, principle,
Ligase Chain Reaction major elements of the procedure, type of amplicon pro-
Strand Displacement Amplication
duced, major enzyme(s) employed, and applications.
Q Replicase
SIGNAL AMPLIFICATION
Describe examples of modications that have been devel-
Branched DNA Amplication oped for PCR.
Hybrid Capture Assays Discuss how amplicons are detected for each of the ampli-
Cleavage-Based Amplication cation methods.
Cycling Probe
Design forward and reverse primers for a PCR, given the
target sequence.
Differentiate between target amplication and signal
amplication.
121

Early analyses of nucleic acids were limited by the avail- What Mullis had envisioned was PCR. Over the next
ability of material to be analyzed. Generating enough months in the laboratory, he synthesized oligos anking a
copies of a single gene sequence required propagation of region of the human nerve growth factor and tried to
millions of cells in culture or isolation of large amounts amplify the region from human DNA, but the experiment
of genomic DNA. If a gene had been cloned, many copies did not work. Not sure of the nucleotide sequence infor-
could be generated on bacterial plasmids, but this prepa- mation he had on the human genes, he tried a more
ration was laborious, and some sequences were resistant dened target. The rst successful amplication was a
to propagation in this manner. short fragment of the Escherichia coli plasmid, pBR322.
The advent of the ability to amplify a specic DNA The rst paper describing a practical application, the
sequence opened the possibility to analyze at the amplication of beta-globin and analysis for diagnosis of
nucleotide level virtually any piece of DNA in nature. patients with sickle cell anemia, was published 2 years
The rst specic amplication method of any type was later.3 He called the method a polymerase-catalyzed
the polymerase chain reaction (PCR). Other amplica- chain reaction because DNA polymerase was the
tion methods have been developed based on making enzyme he used to drive the replication of DNA, and once
modications of PCR. The methods that have been devel- it started the replication continued in a chain reaction.
oped to amplify nucleic acids can be divided into three The name was quickly shortened to PCR. Since PCR was
groups, based on whether the target nucleic acid itself, a conceived and rst performed, it has become increasingly
probe specic for the target sequence, or the signal used user-friendly, more automated, and more amenable to use
to detect the target nucleic acid is amplied. These meth- in a clinical laboratory, with innite applications possible.
ods are discussed in this chapter.
Basic PCR Procedure
When the cell replicates its DNA it requires the existing
Target Amplification double-stranded DNA that serves as the template to give
The amplication of nucleic acids by target amplica- the order of the nucleotide bases, the deoxyribonu-
tion involves making copies of a target sequence to such cleotide bases themselves: adenine, thymine, cytosine,
a level (in the millions of copies) that they can be and guanine; DNA polymerase to catalyze the addition of
detected in vitro. This is analogous to growing cells in nucleotides to the growing strand, and a primer to which
culture and allowing the cells to replicate their nucleic DNA polymerase adds subsequent bases (refer to
acid as well as themselves so that, for example, they can Chapter 1 for a detailed explanation).
be visualized on an agar plate. The difference is that wait- PCR essentially duplicates the in vivo replication of
ing for cells to replicate to detectable levels can take days DNA in vitro, using the same components (Table 7.1) to
to weeks or months, whereas replicating the nucleic acid replicate DNA as the cell does in vivo, with the same end
in vitro only takes hours to days. PCR is the rst and pro- result, one copy of double-stranded DNA becoming two
totypical method for amplifying target nucleic acid. copies (Fig. 7-1). Within one to two hours PCR can pro-
duce millions of copies called amplicons of DNA. In
contrast it would probably take days for a cell to produce
Polymerase Chain Reaction
the same number of copies in vivo. The real advantage of
Kary Mullis conceived the idea of amplifying DNA in the PCR is the ability to amplify specic targets. Just as
vitro in 1983 while driving one night on a California high- the Southern blot rst allowed analysis of specic
way.1,2 In the process of working through a mutation regions in a complex background, PCR presents the
detection method, Mullis came upon a way to double his opportunity to amplify and essentially clone the target
test target, a short region of double-stranded DNA, giving sequences. The amplied target, then, can be subjected to
him 21, or 2, copies. If he repeated the process, the target innumerable analytical procedures.
would double again, giving 22, or 4, copies. After N dou- The components of the PCR, DNR template, primers,
blings, he would have 2N copies of his target. If N 30 nucleotides, polymerase, and buffers, are subjected to an
or 40, there would be millions of copies. amplication program. The amplication program con-

Nucleic Acid Amplification Chapter 7 123
Kary Mullis was working in a laboratory at Cetus contaminating dNTPs. He would then heat the reaction
Corporation, where he synthesized short single- to denature the dNTP-extended oligos and add an
stranded DNA molecules or oligodeoxynucleotides excess of unextended oligos and the ddNTPs. As he
(oligos) used by other laboratories. Mullis also tinkered further considered the modication to his method, he
with the oligos he made. As he drove through the realized that if the extension of an oligo in the prelimi-
mountains of Northern California, Mullis was thinking nary reaction crossed the point where the other oligo
about a method he had designed to detect mutations in bound on the opposite strand, he would make a new
DNA. His scheme was to add radioactive dideoxynu- copy of the region between, similar to how a cell repli-
cleotides, ddATP, ddCTP, ddGTP, ddTTP, to four sepa- cated its DNA during cell division. He considered the
rate DNA synthesis reactions containing oligos, new copy and additional advantage, as it would
template, and DNA polymerase. In each reaction, the improve the sensitivity of this method by doubling the
oligo would bind specically to the template, and the target. Then he thought, what if he did it again? The tar-
polymerase would extend the oligo with the dideoxy- get would double again. If he added dNTPs intention-
nucleotide but only the dideoxynucleotide that was ally he could do it over and over again. In his own
complementary to the next nucleotide in the template. words: I stopped the car at mile marker 46,7 on
He could then determine in which of the four tubes the Highway 128. In the glove compartment I found some
oligo was extended with a radioactive ddNTP by gel paper and a pen. I conrmed that two to the tenth power
electrophoresis. He thought he might improve the was about a thousand and that two to the twentieth
method by using a double-stranded template and prim- power was about a million and that two to the thirtieth
ing synthesis on both strands, instead of one at a time. power was around a billion, close to the number of base
Because the results of the synthesis reaction would be pairs in the human genome. Once I had cycled this
affected by contaminating deoxynucleotides (dNTPs) reaction thirty times I would be able to [copy] the
in the reagent mix, Mullis considered running a pre- sequence of a sample with an immense signal and
liminary reaction without the ddNTPs to use up any almost no background.82
sists of a specied number of cycles that are divided into

steps during which the samples are held at particular tem-
peratures for designated times. The temperature will then
determine the reaction that occurs, and changing the tem-
perature changes the reaction. Table 7.2 shows the steps Mullis original method, using ddNTPs and oligos
of a common three-step PCR cycle. to detect mutations, is still in use today. Fluorescent
PCR starts with one double-stranded DNA target. In polarization-template-directed dye terminator
the rst step (denaturation), the double-stranded DNA is incorporation (described in Chapter 9) uses uo-
denatured into two single strands in order to be replicated rescently labeled ddNTPs to distinguish which
(Fig. 7-2). This is accomplished by heating the sample at ddNTP extends the oligo. Another extension/termi-
9496C for several seconds to several minutes, depend- nation assay, Homogeneous MassExtend, is a sim-
ing on the template. The initial denaturation step is ilar method, using mass spectrometry to analyze the
lengthened for genomic or other large DNA template extension products. Both of these methods are part
fragments. Subsequent denaturations can be shorter. of the Human Haplotype Mapping (HapMap) Proj-
The next and most critical step for the specicity of the ect (see Chapter 11).
PCR is the annealing step. In the second step of the PCR

Table 7.1 Components of a Typical PCR Reaction

Historical Highlights Component Purpose
As Kary Mullis realized early on, the key to the bril- 0.25 mM each primer Directs DNA synthesis to the
liance of PCR is that primers can be designed to tar- (oligodeoxynucleotides) desired region
get specic sequences: I drove on down the road. 0.2 mM each dATP, Building blocks that extend the
In about a mile it occurred to me that the oligonu- dCTP, dGTP, dTTP primers
cleotides could be placed at some arbitrary distance 50 mM KCl Monovalent cation (salt), for opti-
from each other, not just anking a base pair and mal hybridization of primers to
that I could make an arbitrarily large number of template
copies of any sequence I chose and whats more, 10 mM Tris, pH 8.4 Buffer to maintain optimal pH for
most of the copies after a few cycles would be the the enzyme reaction
same size. That size would be up to me. They would 1.5 mM MgCl2 Divalent cation, required by the
look like restriction fragments on a gel. I stopped enzyme
the car again. Dear Thor!, I exclaimed. I had solved 2.5 units polymerase The polymerase enzyme that ex-
the most annoying problems in DNA chemistry in a tends the primers (adds dNTPs)
single lightening bolt. Abundance and distinction. 102105 copies of template Sample DNA that is being tested.
With two oligonucleotides, DNA polymerase, and
the four nucleoside triphosphates I could make as
much of a DNA sequence as I wanted and I could words, the primers determine the specicity of the ampli-
make it on a fragment of a specic size that I could cation. It is important that the annealing temperature be
distinguish easily.82 optimized with the primers and reaction conditions. An-
nealing temperatures will range 5070C and are usually
established empirically. A starting point can be deter-
mined using the Tm of the primer sequences (see Chapter
cycle, the two oligonucleotides that will prime the syn- 6 for a discussion of stringency and hybridization). Reac-
thesis of DNA anneal (hybridize) to complementary se- tion conditions, salt concentration, mismatches, template
quences on the template (Fig. 7-3). The primers dictate condition, and secondary structure will all affect the real
the part of the template that will be amplied; in other Tm of the primers in the reaction.
Region under
investigation
Template DNA
5 3
G A A T CG T CG A GC T GC T A GC T T T G T T CG A
GA A A C A A
Primer Primer
A T CG T C
C T T A GC A GC T CG A CG A T CG A A A C A A GC T
3 5
Template DNA
PCR
5 3
A T CG T CG A GC T GC T A GC T T T G T T
T A GC A GC T CG A CG A T CGA A A C A A Figure 7-1 The components and result of a PCR.
Oligodeoxynucleotides (primers) are designed to
hybridize to sequences anking the DNA region under
A T CG T CG A GC T GC T A GC T T T G T T investigation. The polymerase extends the primers
T A GC A GC T CG A CG A T CG A A A C A A making many copies of the region anked by the
3 5 primer sequences, the PCR product.

Table 7.2 Elements of a PCR Cycle

Step Temperature (oC) Time (sec) DNA Region of interest
Denaturation 9096 2060 5 3
Annealing 5070 2090 Primer
Extension 6875 1060 Primer
3 5
The third and last step of the PCR cycle is the primer
extension step (Fig. 7-4). This is essentially when DNA Figure 7-3 In the second step of the PCR cycle, annealing,
synthesis occurs. In this step, the polymerase synthesizes the primers hybridize to their complementary sequences on
a copy of the template DNA by adding nucleotides to the each strand of the denatured template. The primers are
hybridized primers. DNA polymerase catalyzes the for- designed to hybridize to the sequences anking the region of
interest.
mation of the phosphodiester bond between an incoming
dNTP determined by hydrogen bonding to the template
(A:T or G:C) and the base at the 3 end of the primer. In the PCR program, millions of copies of the original
this way, DNA polymerase replicates the template DNA region dened by the primer sequences will have been
by simultaneously extending the primers on both strands generated (Fig. 7-7). Following is a more detailed discus-
of the template. This step occurs at the optimal tempera- sion of each of the components of PCR.
ture of the enzyme, 6872C. In some cases, the anneal-
ing temperature is close enough to the extension Components of PCR
temperature that the reaction can proceed with only two The PCR is a method of in vitro DNA synthesis. There-
temperature changes. This is two-step PCR, as opposed fore, to perform PCR, all of the components necessary
to three-step PCR that requires a different temperature for the replication of DNA in vivo are combined in opti-
for all three steps. mal concentrations for replication of DNA to occur in
At the end of the three steps, or one cycle (denatura- vitro. This includes the template to be copied, primers to
tion, primer annealing, and primer extension), one copy prime synthesis of the template, nucleotides, polymerase
of double-stranded DNA has been replicated into two enzyme, and buffer components including monovalent
copies. Increasing the temperature back up to the dena- and divalent cations to provide optimal conditions for
turing temperature starts another cycle (Fig. 7-5), with the accurate and efficient replication.
end result being a doubling in the number of double-
stranded DNA molecules again (Fig. 7-6). At the end of
DNA
5 5 3
Primer
DNA 3 5
Region to be
3
amplified
5
Figure 7-4 DNA polymerase catalyzes addition of

3 deoxynucleotide triphosphates (dNTPs) to the primers,
using the sample DNA as the template. This completes
Figure 7-2 Denaturation of the DNA target. The region to one PCR cycle. Note how in the original template there
be amplied is shown in green. The primers are present in vast was one copy of the green region. Now, after one cycle,
excess. there are two copies.

5 3
5 3
3 5
3 5
5 3
5 3
3 5
3 5
Figure 7-5 The rst step (denaturation) of the second cycle, followed by the annealing step in which primers hybridize to the
original template and the newly synthesized product.
Primers get sequence. The placement of the primers will also dic-
The primers are the critical component of the PCR tate the size of the amplied product.
because primers determine the specicity of the PCR. Binding of primers is subject to the same physical lim-
Primers are analogous to the probes in blotting and hybri- itations as probe binding. The primer sequence (% GC)
dization procedures (see Chapter 6). Primers are chemi- and length affect the optimal conditions in which the
cally manufactured on a DNA synthesizer. primer will bind to its target. The approximate melting
Primers are designed to contain sequences homologous temperature, or Tm, of the primers can be calculated using
to sites anking the region to be analyzed. Primer design the equation for short DNA fragments described in
is therefore a critical aspect of the PCR. Primers are sin- Chapter 6. The primer Tm can serve as a starting point for
gle-stranded DNA fragments, usually 2030 bases in
length. The forward primer must bind to the target DNA
sequence just 5 to the sequences intended to be ampli-
ed. The reverse primer must bind just 5 to the sequence Target region
to be amplied on the opposite strand of the DNA. Thus,
the design of primers requires some knowledge of the tar-
Target region
5 3
3 5
5 3
3 5
3 5
5 3
5 3
3 5
Figure 7-7 In an ideal PCR, the PCR product (amplicon) is
Figure 7-6 After the third step (extension) of the second composed of 2N copies of the target region where N num-
cycle, there are four copies of the target region. ber of PCR cycles.

The nature of the primer structure determines the accu-

Advanced Concepts racy of binding to its complementary sequence and not
to other sequences. Just as cross-hybridization can occur
For most laboratories, primers are purchased from a with blot hybridization, aberrant primer binding, or mis-
manufacturer by submitting the required sequences, priming, can occur in PCR. A fragment synthesized from
amount required (scale of synthesis), and level of mispriming will carry the primer sequence and become
purication. Standard primer orders are on the a target for subsequent rounds of amplication (Fig. 7-8).
50200nm scale of synthesis. Higher amounts Eventually, misprimed products will consume com-
(150 m) are more expensive to purchase per base. ponents away from the intended reaction. The resulting
Purication of the synthesized primers may be per- misprimed products may also interfere with proper inter-
formed by cartridge or column binding and washing, pretation of results or subsequent procedures such as
high performance liquid chromatography (HPLC), sequencing (see Chapter 10) or mutation analysis (see
or by polyacrylamide gel electrophoresis (PAGE). Chapter 9).
HPLC and PAGE purication are more expensive Secondary structure (internal folding and hybridiza-
than cartridge purication. Primers may also be tion within DNA strands) can also interfere with PCR.
labeled at the time of synthesis with uorescent Primer sequences that have internal homologies, espe-
dyes, thiolation, biotinylization, or other modiers. cially at the 3 end, or homologies with the other member
of the primer pair may not work as well in the PCR. An
artifact often observed in the PCR is the occurrence of
setting the optimal annealing temperature, the critical step primer dimers. These are PCR products that are just
for the specicity of the amplication reaction. Primers double the size of the primers. They result from the bind-
should be designed such that the forward and reverse ing of primers onto each other through short (23 base)
primers have similar Tm so that both will hybridize opti- homologies at their 3 ends and the copying of each
mally at the same annealing temperature. Tm can be primer sequence (Fig. 7-9). The resulting doublet is then
adjusted by increasing the length of the primers or by a very efficient target for subsequent amplication.
placing the primers in areas with more or fewer Gs and Cs The entire primer sequence does not have to bind to the
in the template. template to prime synthesis; however, the 3 nucleotide
Intended target Unintended

sequence sequence
5 3
3 5
Primer
5 3
3 5
Figure 7-8 Mispriming of one primer

creates an unintended product that could
interfere with subsequent interpretation.
Mispriming can also occur in regions unre-
lated to the intended target sequence.

5 3 5 3
3 5
3 5 Primer
Any sequence
3 5
5 3
3 5
5 3
PCR product with
any sequence attached
3 5 Figure 7-10 Any sequence can be added to the 5 end of
the primer. After PCR, the sequence will be on the end of the
Figure 7-9 Formation of primer dimers occurs when there PCR product. These tailed primers can add useful sequences
are three or more complementary bases at the 3 end of the to one, as shown, or both ends of the PCR product.
primers. With the primers in excess, these will hybridize during
the annealing step (vertical lines), and the primers will be
extended by the polymerase (dotted line) using the opposite
primer as the template. The resulting product, denatured in DNA is usually used. Lesser amounts are required for
the next cycle, will compete for primers with the intended more dened template preparations such as cloned target
template. DNA or product from a previous amplication.
The best templates are in good condition, free of con-
taminating proteins, and without nicks or breaks that can
position is critical for extension of the primer. The poly- stop DNA synthesis or cause misincorporation of
merase will not form a phosphodiester bond if the 3 end nucleotide bases. Templates with high GC content and
of the primer is not hydrogen-bonded to the template. secondary structure may prove more difficult to optimize
This characteristic of primer binding has been exploited for amplication. The DNA region affected in Fragile X
to modify the PCR procedure for mutation analysis of the syndrome, 5 to the FMR-1 gene, is an example of such a
template (see Chapter 9). Noncomplementary extensions GC-rich target.
or tails can be added to the 5 end of the primer sequences
to introduce useful additions to the nal PCR product, Deoxyribonucleotide Bases
such as restriction enzyme sites, promoters, or binding Nucleotide triphosphates are the building blocks of
sites for other primers. These tailed primers can be DNA. An equimolar mixture of the four deoxynucleotide-
designed to add or alter sequences to one or both ends of triphosphates (dNTPs), adenine, thymine, guanine, and
the PCR product (Fig. 7-10).
DNA Template
The template may be single- or double-stranded DNA.
In a clinical sample, depending on the application, the
Advanced Concepts
template may be derived from the patients genomic or Reagent systems that are designed to amplify targets
mitochondrial DNA or from viruses, bacteria, fungi, or optimally with high GC content are available. These
parasites that might be infecting the patient. Genomic systems incorporate an analog of dGTP, deazaGTP,
DNA will have only one or two copies per cell equivalent to destabilize secondary structure. Deaza-GTP
of single-copy genes to serve as amplication targets. interferes with EtBr staining in gels and is best used
With robust PCR reagents and conditions, nanogram in procedures with other types of detection, such as
amounts of genomic DNA are sufficient for consistent autoradiography.
results. For routine clinical analysis, 100 ng to 1 g of

cytosine, is added to the synthesis reaction in concentra- polymerase to generate large products over 30,000 bases
tions sufficient to support the exponential increase of in length.
copies of the template. The four dNTP concentrations Cloning of the genes coding for these polymerases has
should be higher than the estimated Km of each dNTP led to modied versions of the polymerase enzymes,
(1015 mM, the concentration of substrate at half maxi- such as the Stoffel fragment lacking the N-terminal 289
mal enzyme velocity). Standard procedures require amino acids of Taq polymerase and its inherent 3 to 5
0.10.5 mM concentrations of each nucleotide. Substi- exonuclease activity4. The half-life of the Stoffel frag-
tuted or labeled nucleotides, such as deaza GTP, may be ment at high temperatures is about twice that of Taq poly-
included in the reaction for special applications. These merase, and it has a broader range of optimal MgCl2
nucleotides will require empirical optimization for best concentrations (210 mM) than Taq. This enzyme is rec-
results. ommended for allele-specic PCR and for amplication
of regions with high GC content. Further modied ver-
DNA Polymerase sions of the Taq enzymes retaining 3 to 5 exonuclease,
Automation of the PCR procedure was greatly facili- but not 5 to 3 exonuclease activity, are used where high
tated by the discovery of the thermostable enzyme, Taq delity (accurate copying of the template) is important.
polymerase. When Kary Mullis rst performed PCR, he Other variants of Taq polymerase, ThermoSequenase
used the DNA polymerase isolated from E. coli. Every and T7 Sequenase, efficiently incorporate dideoxy NTPs
time the sample was denatured, however, the high tem- for application to chain termination sequencing (see
perature denatured the enzyme. Thus, after each round of Chapter 10).
denaturation, additional E. coli DNA polymerase had to
be added to the tube. This was labor-intensive and pro- PCR Buffer
vided additional opportunities for the introduction of con- PCR buffers provide the optimal conditions for
taminants into the reaction tube. The Taq polymerase was enzyme activity. Potassium chloride (20100 mM),
isolated from the thermophilic bacterium, Thermus ammonium sulfate (1530 mM), or other salts of mono-
aquaticus. valent cations are important buffer components. These
Using an enzyme derived from a thermophilic bac- salts affect the denaturing and annealing temperatures of
terium meant that the DNA polymerase could be added the DNA and the enzyme activity. An increase in salt con-
once at the beginning of the procedure and it would centration makes longer DNA products denature more
maintain its activity throughout the heating and cooling slowly than shorter DNA products during the amplica-
cycles. Other enzymes, such as Tth polymerase from tion process, so shorter molecules will be amplied pref-
Thermus thermophilus, were subsequently exploited erentially. The inuence of buffer/salt conditions varies
for laboratory use. Tth polymerase also has reverse with different primers and templates.
transcriptase activity so that it can be used in reverse Magnesium chloride also affects primer annealing and
transcriptase PCR (RT-PCR, see below) where the start- is very important for enzyme activity. Magnesium
ing material is an RNA template. The addition of proof- requirements will vary with each reaction, because each
reading enzymes, e.g., Vent polymerase allows Taq or Tth NTP will take up one magnesium atom. Furthermore, the
presence of ethylenediaminetetraacetic acid (EDTA) or
other chelators will lower the amount of magnesium
available for the enzyme. Too few Mg2 ions lower
Advanced Concepts enzyme efficiency, resulting in a low yield of PCR prod-
Note the nomenclature for the enzymes is derived uct. Overly high Mg2 concentrations promote misincor-
from the organism from which the enzyme comes, poration and thus increase the yield of nonspecic
similar to the nomenclature for restriction enzymes. products. Lower Mg2 concentrations are desirable when
For example, for the Taq polymerase, the T comes delity of the PCR is critical. The recommended range of
from the genus name, Thermus, and the aqcomes MgCl2 concentration is 14 mM, in standard reaction
from the species name, aquaticus. conditions. If the DNA samples contain EDTA or other
chelators, the MgCl2 concentration in the reaction mix-

ture should be adjusted accordingly. As with other PCR Early versions of thermal cyclers were designed as
components, the optimal conditions are established heater/coolers with programmable memory to accept the
empirically. Tris buffer and accessory buffer components appropriate reaction conditions. Compared with modern
are also important for optimal enzyme activity and accu- models, the available memory for recording the reac-
rate amplication of the intended product; 10 mM Tris- tion conditions was limited, and sample capacity was
HCl maintains the proper pH of the buffer, usually small. Wax or oil (vapor barriers) had to be added to the
between pH 8 and pH 9.5. reactions to prevent condensation of the sample on the
Accessory components are sometimes used to opti- tops of the tubes during the temperature changes. The
mize reactions. Bovine serum albumin (10100 g/mL) layer of wax or oil made subsequent sample handling
binds inhibitors and stabilizes the enzyme. Dithiothreitol more difficult. Later, thermal cycler models were
(0.01 mM) provides reducing conditions that may designed with heated lids that eliminated the requirement
enhance enzyme activity. Formamide (1%10%) added for vapor barriers.
to the reaction mixture will lower the denaturing temper- There are numerous manufacturers of thermal cyclers.
ature of DNA with high secondary structure, thereby These instruments differ in heating and/or refrigeration
increasing the availability for primer binding. Chaotropic systems as well as the programmable software within the
agents such as triton X-100, glycerol, and dimethyl sul- units. Samples may be held in open chambers for air
foxide added at concentrations of 1%10% may also heating and cooling or in sample blocks designed to
reduce secondary structure to allow polymerase exten- accommodate 0.2-mL tubes, usually in a 96 well format.
sion through difficult areas. These agents contribute to Some models have interchangeable blocks to accommo-
the stability of the enzyme as well. date amplication in different sizes and numbers of tubes
Enzymes are usually supplied with buffers optimized or slides. A cycler may run more than one block inde-
by the manufacturer. Commercial PCR buffer enhancers pendently at the same time so that different PCR pro-
of proprietary composition may also be purchased to grams can be performed simultaneously. Rapid PCR
optimize difficult reactions. Often, the buffer and its systems are designed to work with very small sample
ingredients are mixed with the nucleotide bases and volumes in chambers that can be heated and cooled
stored as aliquots of a master mix. The enzyme, target, quickly by changing the air temperature surrounding the
and primers are then added when necessary. Dedicated samples. Real-time PCR systems are equipped with u-
master mixes will also include the primers, so that only orescent detectors to measure PCR product as the reac-
the target sequences must be added. tion proceeds. PCR can also be performed in a microchip
device in which 12 L samples are forced through tiny
Thermal Cyclers channels etched in a glass chip, passing through temper-
The rst PCRs were performed using multiple water ature zones as the chip rests on a specially adapted heat
baths or heat blocks set at the required temperatures for block.5
each of the steps. The tubes were moved from one tem- For routine PCR in the laboratory, an appropriate
perature to another by hand. In addition, before the dis- amount of DNA that has been isolated from a test speci-
covery of thermostable enzymes, new enzyme had to be men is mixed with the other PCR components, either sep-
added after each denaturation step, further slowing the arately or as part of a master mix in 0.20.5mL tubes.
procedure and increasing the chance of error and con- Most thermal cyclers take thin-walled tubes, 0.2-
tamination. mLtube strips or 96 well plates. Preparation of the spec-
Automation of this tedious process was greatly facili- imen for PCR is often referred to as pre-PCR work. To
tated by the availability of the heat stable enzymes. To avoid contamination (see below), it is recommended that
accomplish the PCR, then, an instrument must only man- the pre-PCR work be done in a designated area that is
age temperature according to a scheduled amplication clean and free of amplied products. The sample tubes
program. Thermal cyclers or thermocyclers were thus are then loaded into the thermal cycler. The computer is
designed to rapidly and automatically ramp (change) programmed with the temperatures and times for each
through the required incubation temperatures, holding at step of the PCR cycle, the number of cycles to complete
each one for designated periods. (usually 3050), the conditions for ramping from step to

step, and the temperature at which to hold the tubes once Controls for PCR
all of the cycles are complete. The technologist starts the As with any diagnostic assay, running the correct con-
run and walks away until it is complete. trols in PCR is essential for maintaining and ensuring the
After the PCR, a variety of methods are used to analyze accuracy of the assay. With every PCR run, the appropri-
the PCR product. Most commonly, the PCR product is ate controls must be included. Positive controls ensure
analyzed by gel or capillary electrophoresis. Depending that the enzyme is active, the buffer is optimal, the
on the application, the size, presence, or intensity of PCR primers are priming the right sequences, and the thermal
products is observed on the gel. An example of the results cycler is cycling appropriately. A negative control without
from a PCR run is shown in Figure 7-11. DNA (also called a contamination control or reagent
Molecular Reagent
weight blank
markers
(misprime)
PCR
product
(primer
dimers)
Figure 7-11 Example of PCR products after resolution on an agarose gel and staining with
ethidium bromide. Molecular weight markers in lane 1 are used to estimate the size of the PCR
product. The intended product is 100 bp. Artifactual primer dimers in every lane and a misprimed
product in lane 7 can also be observed. Absence of products in lane 8 conrms that there is no
contamination in the master mix.

blank) ensures that the reaction mix is not contaminated Contamination is controlled both physically and chem-
with template DNA or amplied products from a previous ically. Physically, the best way to avoid PCR carryover is
run. A negative control with DNA that lacks the target to separate the pre-PCR areas from the post-PCR analy-
sequence (negative template control) ensures that the sis areas. Positive airow, air locks, and more extensive
primers are not annealing to unintended sequences of measures are taken by high throughput laboratories that
DNA. In some applications of PCR, an internal control is process large numbers of samples and test for a limited
included. In this type of control (amplication control), number of amplication targets. Most laboratories can
a second set of primers and an unrelated target are added separate these areas by assigning separate rooms or using
to the reaction mix to demonstrate that the reaction is isolation cabinets. Equipment, including laboratory
working even if the test sample is not amplified. gowns and gloves, and reagents should be dedicated to
Amplication controls are performed, preferably in the either pre- or post-PCR. Items can ow from the pre- to
same tube with the test reaction, although it is acceptable the post-PCR area but not in the opposite direction with-
to perform the amplication control on a duplicate sam- out decontamination.
ple. This type of control is most important when PCR Ultraviolet (UV) light has been used to decontaminate
results are reported as positive or negative, by which and maintain pre-PCR areas. UV light catalyzes single-
negative means that the target sequences are not pres- and double-strand breaks in the DNA that will then inter-
ent. The amplication control is critical to distinguish fere with replication. Isolation cabinets are equipped with
between a true negative for the sample and an amplica- UV light sources that are turned on for about 20 minutes
tion failure (false-negative). after the box has been used. The effectiveness of UV light
may be increased by the addition of psoralens to ampli-
Control of PCR Contamination cation products after analysis. Psoralens intercalate
Contamination is a signicant concern for methods that between the bases of double-stranded DNA, and in the
involve target amplication by PCR. The nature of the presence of long-wave UV light they covalently attach to
amplication procedure is such that, theoretically, a sin- the thymidines, uracils, and cytidines in the DNA chain.
gle molecule will give rise to product. This is critical in The bulky adducts of the psoralens prevent denaturation
the clinical laboratory where results may be interpreted and amplication of the treated DNA.
based on the presence, absence, size, or amount of a PCR The efficiency of UV light treatment for decontamina-
product. With modern reagent systems designed for tion depends on the wavelength, energy, and distance of
robust amplication of challenging specimens, such as the light source. Care must be taken to avoid skin or eye
paraffin embedded tissues or samples with low cell num- exposure to UV light. UV light will also damage some
bers, the balance between aggressive amplication of the plastics, so that laboratory equipment may be affected by
intended target and avoidance of a contaminating tem- extended exposure. Although convenient, the efficiency
plate is delicate. For this reason, contamination control is of UV treatment may not be the most effective deconta-
of utmost importance in designing a PCR procedure and minant for every procedure.68
laboratory setup. A widely used method for decontamination and prepa-
Although genomic DNA is a source of spurious PCR ration of the workspace is 10% bleach (7 mM sodium
targets, the major cause of contamination is PCR prod- hypochlorite). Frequently wiping bench tops, hoods, or
ucts from previous amplications. Unlike the relatively any surface that comes in contact with specimen material
large and scarce genomic DNA, the small, highly con- with dilute bleach or alcohol removes most DNA con-
centrated PCR product DNA can aerosol when tubes are tamination. As a common practice in forensic work,
uncapped and when the DNA is pipetted. This PCR prod- before handling evidence or items that come in contact
uct is a perfect template for primer binding and ampli- with evidence, gloves are wiped with bleach and allowed
cation in a subsequent PCR using the same primers. to air-dry.
Contamination control procedures, therefore, are mainly Another widely used chemical method of contamina-
directed toward eliminating PCR product from the setup tion control is the dUTP-UNG system. This requires sub-
reaction. stitution of dTTP with dUTP in the PCR reagent master

get, the amplicon should be 140 bp in size. Much larger

Advanced Concepts or smaller amplicons are due to mispriming or primer
dimers or other artifacts of the reaction. For some proce-
In addition to breaking the sugar phosphate back- dures, these artifacts do not affect interpretation of results
bone of DNA, UV light also stimulates covalent and, as long as they do not compromise the efficiency of
attachment of adjacent pyrimidines in the DNA the reaction, can be ignored. For other purposes, however,
chain, forming pyrimidine dimers. These boxy extraneous PCR products must be avoided or removed.
structures are the source of mutations in DNA in Misprimes are initially averted by good primer design
some diseases of sun exposure. DNA repair systems and optimal amplication conditions. Even with the best
remove these structures in vivo. Loss of these repair conditions, however, misprimes can occur during prepa-
systems is manifested in diseases such as xeroderma ration of the reaction mix. This is because Taq polymerase
pigmentosum, Cockayne syndrome, and trichoth- has some activity at room temperature. While mixes are
iodystrophy.83 Psoralen in combination with UV prepared and transported to the thermal cycler, the
light is an established treatment for psoriasis and primers and template are in contact at 2225C, a condi-
other skin diseases.84,85 tion of very low stringency (see Chapter 6 for a discussion
of stringency). In these conditions, the primers can bind
sequences other than their exact complements in the tar-
get. These misprimed products, then, are already present
mix, which will result in incorporation of dUTP instead before the amplication program begins. Even using
of dTTP into the PCR product. Although some poly- well-designed primers and optimizing amplication con-
merase enzymes may be more or less efficient in incor- ditions, however, does not prevent all mispriming. To fur-
poration of the nucleotide, the dUTP does not affect the ther prevent mispriming, hot-start PCR can be used.
PCR product for most applications. At the beginning of Hot-start setup is done in three ways. In one approach,
each PCR, the enzyme uracil-N-glycosylase (UNG) is the reaction mixes are prepared on ice and placed in the
added to the reaction mix. This enzyme will degrade any thermal cycler after it has been prewarmed to the denatu-
nucleic acid containing uracil, such as contaminating ration temperature. A second way to perform hot-start
PCR product from previous reactions. A short incubation PCR is to use a wax barrier. A bead of wax is placed in
period is added to the beginning of the PCR amplication the reaction tubes with all components of the reaction
program, usually at 50C for 210 minutes to allow the mix except enzyme and template. The tube is heated to
UNG enzyme to function. The initial denaturation step in 100C to melt the wax and then cooled to room tempera-
the PCR cycle will degrade the UNG before synthesis of ture. The melted wax will oat to the top of the reaction
the new products. Note that this system will not work mix in the tube and congeal into a physical barrier as it
with some types of PCR, such as nested PCR (discussed cools. The template and enzyme are then added on top of
below), because a second round of amplication requires the wax barrier. When the tubes are placed in the thermal
the presence of the rst round product. The dUTP-UNG cycler, the wax will melt at the denaturation temperature,
system is used routinely in real-time PCR procedures in and the primers and template will rst come in contact at
which contamination control is more important because the proper annealing temperature. The wax also serves as
the contaminant will not be distinguishable from the an evaporation barrier as the reaction proceeds. After
desired amplicon by gel electrophoresis. amplication, however, the wax barrier must be punc-
tured to gain access to the PCR products.
Prevention of Mispriming The third and most frequently used hot-start method is
As shown in Figure 7-11, PCR products are analyzed for the use of sequestered enzymes, such as AmpliTaq Gold
size and purity by electrophoresis. The amplicon size (Applied Biosystems), Platinum Taq (Invitrogen), Jump-
should agree with the size determined by the primer Start Taq (Sigma), and numerous others. These enzymes
placement. For instance, if two 20 b primers were are either supplied in inactive form or the enzyme is inac-
designed to hybridize to sequences anking a 100 bp tar- tivated by monoclonal antibodies or by other proprietary

methods. Regardless of the inactivation mechanism, the columns or beads provide better recovery than gel elu-
enzyme is inactive until it is activated by heat in the rst tion, they may not completely remove residual primers.
denaturation step of the PCR program, preventing any Addition of shrimp alkaline phosphatase (SAP) in
primer extension during reagent mix preparation. combination with exonuclease I (ExoI) is an enzymatic
method for removing nucleotides and primers from PCR
PCR Product Cleanup products prior to sequencing or mutational analyses.
Even the best procedures sometimes result in extraneous During a 15-minute incubation at 37C, SAP dephospho-
products. Sequence limitations to primer design or reac- rylates nucleotides, and ExoI degrades primers. The
tion conditions may not completely prevent primer enzymes must then be removed by extraction or inacti-
dimers or misprimes. These unintended products are vated by heating at 80C for 15 minutes. This method is
unacceptable for analytical procedures that demand pure convenient as it is performed in the same tube as the PCR.
product, such as sequencing or some mutation analyses It does not, however, remove other buffer components.
(see Chapters 9 and 10). A direct way of obtaining clean In some post-PCR methods, such a small amount of
PCR product is to resolve the amplication products by PCR product is added to the next reaction that residual
gel electrophoresis and then cut the desired bands from components of the amplication are of no consequence,
the gel and elute the PCR product. The gel slice can be so that no further clean up of the PCR product is required.
digested with enzymes such as -agarase (New England The choice of clean-up procedure or whether clean up is
BioLabs) or iodine (Fig. 7-12). The agarase enzyme necessary at all will depend on the application.
digests the agarose polymer and releases the DNA into
solution for further purication.
Residual components of the reaction mix, such as left- PCR Modifications
over primers and unused nucleotides, also interfere with PCR today has been adapted for various applications.
some post-PCR applications. Moreover, the buffers used Several modications are used in the clinical laboratory.
for the PCR may not be compatible with post-PCR pro- Of the large (and increasing numbers) of PCR modica-
cedures. Amplicons free of PCR components are most tions, following is a description of those in standard use
frequently and conveniently prepared using spin columns in the clinical molecular laboratory. These methods are
(Fig. 7-13) or silica beads. The DNA binds to the column, capable of detecting multiple targets in a single run (mul-
and the rest of the reaction components are rinsed away tiplex PCR), using RNA templates (reverse transcriptase
by centrifugation. The DNA can then be eluted. Although PCR), or such amplied products as templates (nested
PCR) and quantitating starting template (quantitative
PCR, or real-time PCR).
Gel containing DNA
Multiplex PCR
More than one primer pair can be added to a PCR so
that multiple amplications are primed simultaneously,
resulting in the formation of multiple products. Multiplex
Sieve
Supernatant PCR is especially useful in typing or identication analy-
+ alcohol ses. Individual organisms, from viruses to humans, can be
Centrifuge identied or typed by observing a set of several PCR
products at once. Pathogen typing and forensic identica-
DNA
tion kits contain multiple sets of primers that amplify
precipitate
polymorphic DNA regions. The pattern of product sizes
Figure 7-12 After gel electrophoresis, the gel band of PCR will be specic for a given type or individual.
product is excised with a clean scalpel or spatula. The gel is
Multiple organisms have been the target of multiplex
disintegrated by centrifugation through a sieve, releasing the
DNA. The DNA in solution can then be separated from the gel PCR in clinical microbiology laboratories.911 One respi-
fragments, precipitated with alcohol and pelleted by a sec- ratory sample, for example, can be used to test for the
ond centrifugation. presence of more than one respiratory virus.12 Organisms

Primer
PCR product
Salt
dNTP
Flip column
Figure 7-13 PCR product cleanup and
in spin columns (left) removes residual centrifuge
components in the PCR mix. Amplicon
DNA binds to a silica matrix in the col-
umn while the buffer components ow
Centrifuge
through during centrifugation. The col-
umn is then inverted, and the DNA is
eluted by another centrifugation in low
salt (Tris-EDTA) buffer.
that cause sexually transmitted diseases can be targeted rst copies the RNA single strand into a RNA:DNA
in multiplex PCR using one genital swab.13 In a slightly hybrid strand and then uses a hairpin formation on the end
different approach to testing for multiple targets, one set of the newly synthesized DNA strand to prime synthesis
of primers can detect an infectious organism, and a sec- of the homologous DNA strand, replacing the original
ond set can detect the presence of a gene that makes that RNA in the hybrid. The resulting double-stranded DNA is
organism resistant to a particular antimicrobial agent. called cDNA for copy or complementary DNA. This
This has been performed and published for methicillin- product is adequate for PCR.
resistant Staphylococcus aureus.14 Like other DNA polymerases, reverse transcriptase
Multiplex PCR reagents and conditions require more requires priming. Specic primers, oligo dT primers or
complex optimization. Often, target sequences will not random hexamers, are most often used to prime the syn-
amplify with the same efficiency, and primers may inter- thesis of the initial DNA strand. Specic primers will
fere with other primers for binding to the target se- prime cDNA synthesis only from transcripts complemen-
quences. The conditions for the PCR must be adjusted for tary to the primer sequences. The yield of cDNA will be
the optimal amplication of all products in the reaction. relatively low using this approach but highly specic for
This may not be possible in all cases. the target of interest. Oligo dT primers are 18-blong
Multiplexing primers is useful, not only to detect mul- single-stranded polyT sequences that will prime cDNA
tiple targets but also to conrm accurate detection of a synthesis only from messenger RNA with polyA tails.
single target. Internal amplication controls are often Yield of cDNA will be higher with oligo dT primers and
multiplexed with test reactions that are interpreted by the should include all mRNA in the specimen. The highest
presence or absence of product. The control primers and yield of cDNA is achieved with random hexamers or
targets must be chosen so that they do not interfere or decamers. These are 610blong single-stranded oligo-
compete with the amplication of the test region. Internal mers of random sequences. The 610b sequences will
amplication controls are the ideal for positive/negative match sequences in the target RNA with some frequency.
qualitative PCR tests. Random priming will generate cDNA from all RNA (and
DNA) in the specimen. For all strategies of cDNA prepa-
Reverse Transcriptase PCR ration, the specicity of the nal product is still deter-
Amplication by PCR requires a double-stranded DNA mined by the PCR primers.
template. If the starting material for a procedure is RNA, RT PCR is used to measure RNA expression proles,
it must rst be converted to double-stranded DNA. This is to detect rRNA, to analyze gene regions interrupted by
accomplished through the action of reverse transcriptase long introns, and to detect microorganisms with RNA
(RT), an enzyme isolated from RNA viruses. This enzyme genomes. For gene expression analysis, the amount of

cDNA reects the amount of transcript in the preparation. paraffin embedded tissues; however, xed specimens are
In other applications, genes that are interrupted by long difficult to analyze consistently.17
introns can be made more available for consistent ampli-
cation using cDNA versions lacking the interrupting Nested PCR
sequences. cDNA is often used for sequencing because Increased sensitivity offered by the PCR is very useful
the sequence of the coding region can be determined in clinical applications as clinical specimens are often
without long stretches of introns complicating the analy- limited in quantity and quality. The low level of target
sis. The detection of RNA viruses such as Coronavirus, and the presence of interfering sequences can prevent a
which is responsible for severe acute respiratory syn- regular PCR from working with the reliability required
drome, can be accomplished using RT PCR.15 for clinical applications. Nested PCR is a modica-
RT PCR was originally performed in two steps: cDNA tion that increases the sensitivity and specicity of the
synthesis and PCR. Tth DNA polymerase, which has RT reaction.1821
activity and proprietary mixtures of RT and sequestered In nested PCR, two pairs of primers are used to
(hot-start) DNA polymerase, are components of one-step amplify a single target in two separate PCR runs. The
RT PCR procedures.16 These methods are more conven- second pair of primers, designed to bind slightly inside of
ient than the two-step procedure, as RNA is added the binding sites of the rst pair, will amplify the product
directly to the PCR. The amplication program is modi- of the rst PCR in a second round of amplication. The
ed to include an initial incubation of 4550C for second amplification will specifically increase the
3060 minutes, during which RT makes cDNA from amount of the intended product. In seminested PCR, one
RNA in the sample. The RT activity will then be inacti- of the second-round primers is the same as the rst-round
vated in the rst denaturation step of the PCR procedure. primer. Nested and seminested procedures increase
Although RT PCR is a widely used and important specicity and sensitivity of the PCR (Fig. 7-14).
adjunct to molecular analysis, it is subject to the vulner- Several variations of nested and seminested PCR have
abilities of RNA degradation. As with other procedures been devised. For example, as shown in Figure 7-14, the
that target RNA, specimen handling is important for rst-round primers can have 5 sequences added (5 tails)
accurate results. Methods have been described for the RT complementary to sequences used for second-round
PCR amplication of challenging specimens, such as primers. This tailed primer method is valuable for multi-
5 3 5 3
3 5 3 5
First round product
Second round product
Figure 7-14 Variations of

nested PCR using nested primers
and seminested second-round
primers (left) and tailed rst-
round primers (right).

plex procedures in which multiple rst-round primers The rationale of qPCR is illustrated in Figure 7-15. If
may differ in their binding efficiencies. Due to the tailed the target copy number in a PCR were graphed versus the
primers, sequences complementary to a single set of number of cycles, the results would be an exponential
second-round primers are added to all of the rst-round curve where the number of target copies 2N, N being
products. In the second round, then, all products will be the number of cycles. If the copy number is measured by
amplied with the same primers and equal efficiency. detectable uorescence as shown in the gure, the curve
Although this tailed primer procedure increases sensitiv- looks similar to a bacterial growth curve, with a lag
ity in multiplex reactions, it does not increase specicity. phase, an exponential (log) phase, a linear phase, and a
stationary phase.
Real-Time (Quantitative) PCR In contrast to real-time PCR, analysis of PCR product
Standard PCR procedures will indicate if a particular by the standard method occurs at the end of the PCR sta-
target sequence is present in a clinical sample. For some tionary phase (endpoint analysis). Exhaustion of reac-
situations, though, the clinician is also interested in how tion components and competition between PCR product
much of the target sequence is present. Several ap- and primers during the annealing step slow the PCR prod-
proaches have been taken to estimate the amount of start- uct accumulation after the exponential phase of growth
ing template by PCR. By the nature of amplication, until it nally plateaus. In the endpoint analysis, products
however, calculating direct quantities of starting material of widely different starting template amounts are tested at
becomes complex. Strategies to quantitate starting mate- the plateau where they are all the same (observe the ends
rial by quantitating the end products of PCRs have uti- of the amplication curves shown in Figure 7-15A.).
lized internal controls, i.e., known quantities of starting Using the uorescent signal to detect the growing target
material, that are co-amplied with the test template. copy number during the amplication process, analysis in
These types of assays, however, suffer from primer in- real-time PCR is performed in the exponential phase of
compatibilities and inconsistent results. Another approach growth where the accumulation of fluorescence is
is to add competitor templates at several known levels to inversely proportional to the amount of starting template.
assess the amount of test material by preferential ampli- With 10-fold dilutions of known positive standards, a
cation over a known amount of competitor.22 These assays relationship between the starting target copy number and
are also at times unreliable and inconsistent when test and the cycle number at which uorescence crosses a thresh-
internal control templates differ by more than 10-fold. old amount of uorescence can be established.
They are most accurate with a 1:1 ratio of test and inter- The PCR cycle at which sample uorescence crosses
nal control, requiring analysis of multiple dilutions of the threshold is the threshold cycle, or CT. Plotting the
controls for optimal results. target copy number of the diluted standards against CT
A very useful modication of the PCR process is real- for each standard generates the graph shown in Figure
time or quantitative PCR (qPCR).23,24 This method was 7-15B. Once this relationship is established, the starting
initially performed by adding ethidium bromide (EtBr) to amount of an unknown specimen can be determined by
a regular PCR. Because EtBr intercalates into double- the cycle number at which the unknown crosses the uo-
stranded DNA and uoresces, it can be used to monitor rescence threshold.
the accumulation of PCR products during the PCR in real
time, i.e., as it is made. The advantage of this method
over standard PCR is the ability to determine the amount
of starting template accurately. These quantitative meas-
urements are performed with the ease and rapidity of
Advanced Concepts
standard PCR without tedious addition of competitor The optimal threshold level is based on the back-
templates or multiple internal controls. A growing num- ground or baseline uorescence and the peak uo-
ber of clinically signicant parameters, such as copy rescence in the reaction. Instrument software is
numbers of diseased human genes, viral load, tumor load, designed to set this level automatically. Alternatively,
and the effects of treatment, are measured easily with this the threshold may be determined and set manually.
method.2527

107 copies
106 copies
105 copies
100
104 copies
103 copies
102 copies
101 copies
10
Rn
0.1
1 3 5 7 9 21 23 25 27 29 33 35 37 39 41 43 45 47 49
Cycle
40.00
35.00
30.00
Threshold cycle (C)
25.00
20.00 Y = 3.345(x) + 38.808
15.00 R2 = 0.9983 Figure 7-15 A plot of the accumulation of PCR
product over 50 cycles of PCR (A) is a sigmoid
10.00 curve. The generation of uorescence occurs ear-
lier with more starting template (solid lines) than
5.00
with less (dotted lines). The cycle number at which
0.00 uorescence increases over a set amount, or uo-
1.00E+00 1.00E+01 1.00E+02 1.00E+03 1.00E+04 1.00E+05 1.00E+06 1.00E+07 rescence threshold, is inversely proportional to the
Starting Quantity (copies/rxn) amount of starting material.
The rst approach to real-time PCR utilized the double-

stranded DNA-specic dye EtBr. This method is still used
Advanced Concepts for routine qPCR, except that EtBr has been replaced by
Fluorescence vs. CT is an inverse relationship. The SYBR green, another double-stranded DNA-specic dye.
more starting material, the fewer cycles are neces- SYBR green is preferred for routine procedures because it
sary to reach the uorescence threshold. Samples has the specicity and robust uorescence of EtBr but is
that differ by a factor of 2 in the original concentra- less toxic than EtBr. These dyes bind and uoresce
tion of target are expected to be 1 cycle apart, with specically in the double-stranded DNA product of the
the more dilute sample having a CT 1 cycle higher PCR (Fig. 7-16).
than the more concentrated sample. Samples that The use of nonspecic dyes to measure product accu-
differ by a factor of 10 (as in a 10-fold dilution mulation requires a clean PCR free of misprimed prod-
series) would be ~3.3 cycles apart. The slope of a ucts or primer dimers, because these artifactual products
standard curve made with 10-fold dilutions, there- will also generate uorescence. More specic systems,
fore, should be 3.3. examples of which are described below, have been
devised that utilize probes designed to generate uores-


EtBR is a planar molecule that intercalates between The 5 end of a Taqman probe is labeled with one of
the planar nucleotides in the DNA molecule. In a number of dyes with different colors, or peak
doing so, it interferes with DNA metabolism and wavelengths of uorescence, e.g., FAM (6-carboxy-
replication in vivo and is a mutagen. In contrast, uorescein), TET (6-tetrachlorouorescein), HEX
SYBR green binds to the minor groove of the dou- (6-hexachlorouorescein), JOE (4,5-dichloro-2,7-
ble helix without disturbing the nucleotide bases dimethoxy-uorescein), Cy3, Cy5 (indodicarbocya-
and thus does not upset DNA metabolism to the nine), and so forth. The probe is covalently bound at
extent that EtBr does. the 3 end with a quencher, such as DABCYL (4-
dimethylaminophenylazobenzoic acid) or TAMRA
(5(6)-carboxytetramethylrhodamine), or nonuores-
cent quenchers, such as BHQ1, BHQ2 (Black Hole
cence. The probes increase specicity by only yielding Quenchers), and Eclipse. In the TaqMan system, the
uorescence when they hybridize to the target sequences. quencher prevents uorescence from the 5 dye until
TaqMan was developed from one of the rst probe- they are separated during the synthesis reaction.
based systems for real-time PCR.28 This method exploits
the natural 5 to 3 exonuclease activity of Taq polymerase
to generate signal. The original method reported by
Holland et al. used radioactively labeled probe and meas- end so that it cannot be extended by the polymerase. The
ured activity by the release of radioactive cleavage frag- single-stranded DNA TaqMan probe is covalently
ments. The TaqMan procedure measures uorescent attached to a uorescent dye on one end and another dye
signal generated by separation of dye and quencher, a or nonuorescent molecule that pulls uorescent energy
system developed by Lee et al.29 Here, a probe composed from the 5 dye (quencher) on the other (Fig. 7-17).
of a single-stranded DNA oligomer homologous to a spe- As the polymerase proceeds to synthesize DNA from
cic sequence in the targeted region of the PCR template the template to which the probe is hybridized, the natural
is used. Note that this probe is present in the PCR in addi- exonuclease activity of Taq polymerase will degrade the
tion to the specic primers used to prime the DNA syn- probe into single and oligonucleotides, thereby removing
thesis reaction. The probe is chemically modied at its 3 the labeled nucleotide from the vicinity of the quencher
and allowing it to uoresce (Fig. 7-18). Excess probe is
present so that with every doubling of the target se-
quences more probe binds and is digested, and more u-
5 3
orescence is generated. The TaqMan procedure has been
applied to quantitative determinations in oncology30 and
3 5
Primer
R Probe Q
5 3 5
3 5
5 3
3 5
Figure 7-16 Non-sequencespecic dyes such as EtBr and Figure 7-17 A TaqMan probe hybridizes to the target
SYBR green bind to double-stranded DNA products of the sequences between the primer binding sites. The probe is
PCR. As more copies of the target sequence accumulate, the covalently attached to a uorescent reporter dye (R) at
uorescence increases. the 5 end and a quencher (Q) at the 3 end.

R
Q
5
3 5
Molecular beacon
5 3
R Q
3 5
R
Q
R Q
5 3
3 5 3 5
5 3
Figure 7-19 A molecular beacon probe contains
3 5
target specic sequences and a short inverted repeat
Figure 7-18 Taqman signal uorescence is generated when that hybridizes into a hairpin structure. The 5 end of the
Taq polymerase extends the primers and digests the probe probe has a reporter dye (R), and the 3 end has a
and releases the reported from the vicinity of the quencher. quencher dye (Q).
microbiology.31 Probe design, like primer design, is im- Scorpion-type primers are a variation of Molecular
portant for a successful qPCR amplication.32,33 Beacons.34,35 In contrast to free-labeled probes, the PCR
Another probe-based detection system, Molecular product will be covalently bound to the dye. In this sys-
Beacons, measures the accumulation of product at the tem, target-specic primers are tailed at the 5 end with a
annealing step in the PCR cycle. The signal from sequence homologous to part of the internal primer
Molecular Beacons is detectable only when the probes are sequence, a quencher, a stem-loop structure, and a 5 u-
bound to the template before displacement by the poly- orophore (Fig. 7-21). The uor and the quencher are
merase. Here the probe is chemically modied so that it is positioned so that they are juxtaposed when the hairpin in
not degraded during the extension step. Molecular bea- the primer is intact. After polymerization, the secondary
cons are designed with a ~25-bspecic binding sequence structure of the primer is overcome by hybridization of
anked by a short (~5 b) inverted repeat that will form a the primer sequence with the target sequence, removing
stem and loop structure when the probe is not bound to the the uor from the quencher. This intramolecular system
template. There is a reporter uorophor (dye) at the 5 end generates signal faster than the intermolecular Molecular
of the oligomer and quencher at the 3 end. Until specic Beacon strategy and may be preferred for methods
product is present, the probe will form a hairpin structure requiring fast cycling conditions.36
that brings the uorophore in proximity with the quencher Another frequently used system, uorescent reso-
(Fig. 7-19). Fluorescence will occur on binding of the nance energy transfer (FRET), utilizes two specic
probe to denatured template during the annealing step probes, one with a 3 uorophore (acceptor), the other
(Fig. 7-20). When the primers are extended in the PCR, with a 5 catalyst for the uorescence (donor) that binds
displacement of the probe by Taq will restore the hairpin to adjacent targets.37 Examples of frequently used donor-
(nonuorescent) structure. Excess probe in the reaction acceptor pairs are uorescein-rhodamine, uorescein-(2
mix will assure binding to the increasing amount of target. aminopurine), and uorescein-Cy5. When the donor and
The amount of uorescence, therefore, will be directly acceptor are brought within 110 nm (15 bases) through
proportional to the amount of template available for bind- specic DNA binding, excitation energy is transferred
ing and inversely proportional to the CT. from the donor to the acceptor (Fig. 7-22). The acceptor

Primer
R Q
R Q
R Q
R Q
R Q
Q
R
Figure 7-21 Scorpion primer/probes are primers tailed

with molecular beacon-type sequences. After extension
of the primer/probe, the target-specic sequences fold
over to hybridize with the newly synthesized target
sequences, separating the reporter (R) from the
R Q quencher (P).
sequences to distinguish types of organisms or to detect

mutations. Refer to Chapter 9 for a description of meth-
ods using uorescent probes and melt curves to detect
gene mutations. Methods can be combined, e.g., using an
Figure 7-20 Molecular beacons bound to target sequences
uoresce. Fluorescence doubles with every doubling of target
intercalating dye (acridine orange) as the donor and a
sequences. probe with a single receptor dye (rhodamine).42 As with
standard PCR, large and growing numbers of such meth-
ods have been devised for a variety of applications.
then loses the energy in the form of heat or uorescence
emission called sensitized emission. The sequences of Arbitrarily Primed PCR
FRET probes are designed such that they bind 15 bases In arbitrarily primed PCR, also known as randomly
from each other on the target sequences. When they are amplied polymorphic DNA or random amplication of
bound to the target, the uorescence is catalyzed. As with polymorphic DNA (RAPD), short (1015 bases) primers
the molecular beacons, the more template available for with random sequences are used to amplify arbitrary
binding, the more uorescence will be generated. FRET regions in genomic DNA under low stringency condi-
probes are used frequently in the clinical laboratory for tions.43,44 With this method, PCR products are generated
viral detection and quantitation and for amplication and without knowing the sequence of the target or targeting a
detection of genetic diseases.3841 specic gene. It is possible with this method to obtain
Real-time PCR lends itself to several variations of multiple products, depending how many times a short
technique as exemplied above. These techniques can be sequence appears in the genome; in traditional PCR, only
further modied, e.g., using FRET probes with different one product is generally obtained (Fig. 7-23). Arbitrarily

D R M 1 2 3 4 M
Primer
D R
Figure 7-23 Illustration of results from a RAPD PCR. The rst

lane on the left contains molecular weight markers. Strain dif-
ferences are evident from the different band patterns. Lanes
1 and 3 are the same strain, and lanes 2 and 4 are the same
D R strain, but different from that in lanes 1 and 3. Lanes M,
molecular weight markers
Transcription-Based
Amplication Systems
In transcription-based amplication systems (TAS), RNA
D R is the usual target instead of DNA. A DNA copy is
synthesized from the target RNA, and then transcription
of the DNA produces millions of copies of RNA. There
are a number of commercial variations of this process:
transcription-mediated amplication (TMA) (Gen-
Probe), nucleic acid sequencebased amplication
Figure 7-22 FRET probes are separate oligomers, one
(NASBA) (Organon-Teknika), and self-sustaining se-
covalently attached to a donor uor (D) and one to an quence replication (3SR) (Baxter Diagnostics).
acceptor or reporter uor (R). The acceptor/reporter Kwoh and colleagues developed the rst TAS in
will uoresce only when both probes are bound next to 1989.46 TAS differs from other nucleic acid amplication
one another on the target sequences. As more target procedures in that RNA is the target as well as the pri-
accumulates, more probes bind, and more uorescence
is emitted.
mary product. In the original method of TAS, a primer
complementary to sequences in the target RNA that also
has the binding site for RNA polymerase at one end is
primed PCR has been used primarily in the epidemiolog- added to a sample of target RNA. The primer anneals,
ical typing of microorganisms.45 Similar band patterns and reverse transcriptase makes a DNA copy of the target
obtained from performing PCR with the same arbitrary RNA. Heat is used to denature the DNA/RNA hybrid,
primers indicate that two organisms are the same or sim- and a second primer binds to the cDNA and is extended
ilar. The disadvantage of this method, though, is that the by reverse transcriptase producing double-stranded
stringency is low enough that the reproducibility between DNA. RNA polymerase derived from the bacteriophage
runs is not very good, such that two organisms that had T7 then transcribes the cDNA, producing hundreds to
the same PCR product pattern on one day could have two thousands of copies of RNA. The transcribed RNA can
different patterns and look like two different organisms then serve as target RNA to which the primers bind and
when amplied on another day. synthesize more cDNA.

(A) (A) RNA polymerase

Promoter
Tailed primer cDNA
RNA target
(B)
Reverse transcriptase
(B) cDNA
RNA
RNase II (C)
(C)
ssDNA
(D)
(D)
Primer
(E) Reverse transcriptase
cDNA (E) Reverse transcriptase
Primer
Figure 7-24 The rst step in transcription-based ampli-
(F)
cation is the production of a complementary double-
stranded DNA copy of the RNA target (A). Synthesis is
performed by reverse transcriptase, which extends a
primer that is tailed with an RNA polymerase binding site
(promoter) sequence (green). The RNA/DNA hybrid (B) is
digested with RNase H, leaving the single-stranded DNA
(C), which is converted to a double strand with a comple-
mentary primer (D). The DNA product will have a promoter
sequence at one end.
Figure 7-25 The cDNA produced by reverse transcriptase
serves as a template for RNA polymerase (A). Many copies of
The original TAS procedure as described above had the RNA are synthesized (B), (C) which are primed by a comple-
mentary primer (D) for synthesis of another RNA/DNA hybrid
disadvantage that heat denaturation was required to dena-
(E). After RNase H degrades the RNA strand, the primer tailed
ture the intermediate RNA/DNA hybrid product. The heat with the promoter sequences synthesizes another template
also denatured the enzymes so that fresh enzyme had to (F), cycling back into the system as (A).
be added after each denaturation step. The process was
simplied with the addition of RNase H derived from E.
coli (Fig. 7-24). RNase H degrades the RNA from the scriptase derived from avian myeloblastosis virus (AMV)
intermediate hybrid, eliminating the heating step. Thus, has inherent RNase H activity. Thus, TAS can be run with
after synthesis of the DNA copy by reverse transcriptase, only two enzymes, AMV reverse transcriptase and T7
the RNA strand is degraded by RNase H. Binding of the RNA polymerase.
second primer and extension of the primer producing TAS has some advantages over PCR and other ampli-
double-stranded DNA by reverse transcriptase is fol- cation procedures. First, in contrast to PCR and the ligase
lowed by transcription of the cDNA with T7 RNA poly- chain reaction (LCR, discussed below), TAS is an isother-
merase (Fig. 7-25). mal process, negating the requirement for thermal cycling
This modied procedure has been marketed as 3SR, to drive the reactions. Second, targeting RNA allows for
NASBA, or TMA, depending on the manufacturer. An the direct detection of RNA viruses, e.g., Hepatitis C
additional modication and simplication of the proce- Virus47,48 and Human Immunodeciency Virus.49,50 Even
dure came about with the discovery that the reverse tran- targeting the RNA of other organisms, such as Mycobac-

terium tuberculosis, is more sensitive than targeting the primers. Because the product of LCR is ligated primer,
DNA, because each bacterium, for example, has multiple LCR is better classied as a method of probe amplica-
copies of RNA, whereas it has only one copy of DNA.51 tion rather than target amplication as the copy number
The NASBA procedure with slight modications can of target molecules does not change.
also be performed on a DNA target.52 For DNA, the sam- LCR is similar to PCR in that it requires a thermal
ple is heated to denature the DNA, and the rst primer cycler to change the temperature to drive the different
anneals and is extended by reverse transcriptase (which reactions. In LCR the tube is heated to denature the tem-
in addition to having RNA-dependent DNA polymerase plate. When the temperature is cooled, the primers anneal
activity also has DNA-dependent DNA polymerase activ- if the complementary sequence is present, and a ther-
ity). The sample is heated again to denature the double mostable ligase joins the two primers (Fig. 7-26). Even a
strands, and the second primer binds and is extended. The 1base pair mismatch at the ligation point will prevent
DNA product has also incorporated the T7 RNA poly- ligation of the primers. Thus, LCR can be used to detect
merase binding site as occurs when RNA is the target. point mutations in a target sequence. The point mutation
Thus, T7 RNA polymerase transcribes the newly repli- that occurs in the beta globulin of patients with sickle cell
cated DNA into hundreds to thousands of RNA copies.53 disease, as compared with normal beta globulin, was one
Detection of M. tuberculosis in smear-positive respira- of the rst applications of LCR.54
tory samples, Chlamydia trachomatis in genital speci-
mens, and HIV and cytomegalovirus (CMV) quantitation
Strand Displacement Amplification
in blood are a few of the current applications for TAS.
SDA differs from most of the previously described ampli-
fication methods in that SDA is an isothermal amplica-
Probe Amplification tion process, i.e., after an initial denaturation step, the
In probe amplication procedures, the number of target reaction proceeds at one temperature.55,56 SDA is more
nucleic acid sequences in a sample is not changed as it is
in target amplication procedures like PCR. Rather, syn-
thetic probes that are specic to the target sequences bind GTACTCTAGCT GTACTCTAGCT
A
to the target where the probes themselves are amplied. T
There are three major procedures that are commercially A

C
available that involve the amplication of probe se- CATGAGATCGA CATGAGATCGA
quences: LCR (Abbott), strand displacement amplica-
tion (SDA) (Becton Dickinson), and Q replicase (Vysis). Ligase Ligase
A
C A
T
Ligase Chain Reaction A
C
LCR is a method for amplifying synthetic primers/probes A
A
complementary to target nucleic acid. LCR is similar to C
PCR, but there are a few differences. The entire target T
A
sequence must be known in order to prepare the oligonu- C
cleotide primers for LCR. In PCR, there can be a distance
Figure 7-26 Ligase chain reaction generates a signal
between the primers of up to hundreds of bases that is by repeated ligation of probes complementary to specic
part of the amplied sequence. In LCR, by contrast, the sequences in the test DNA. One complementary oligomer
primers bind adjacent to each other, separated by only is covalently attached to biotin for immobilization (square),
one base. Instead of DNA polymerase synthesizing com- and one has a signal-producing molecule (circle). The two
oligomers will be ligated together only if the sequence of
plementary DNA by extending the primers as occurs in
the target is complementary (left). The oligomers captured
PCR, DNA ligase is used in LCR to ligate the adjacent on a solid substrate by streptavidin will generate signal. If the
primers together. The ligated primers can then serve as a sequence of the target is not complementary (right), the
template for the annealing and ligation of additional captured probe will not yield a signal.

(A) Probe with

restriction site
Primer
(B)
Modified
nucleotides
Displaced
strand
(extended
Figure 7-27 The rst stage of SDA is the denatura- probe)
tion of the double-stranded target and annealing of
primers and probes tailed with sequences including
a restriction enzyme site (A; only one strand of the (C)
initial target is shown.) A second reaction (B) copies Displaced
the probe, incorporating dATPaS and thereby inacti- probe targets
vating the restriction site on the copied strand (C). Inactive restriction site
This species is the target for amplication in the sec- (due to incorporation
ond stage of the reaction. of modified nucleotides)
similar to LCR than PCR in that the major amplication ing/extension reaction can repeat without denaturation.
products are the probes/primers and not the product of in Thus, the iterative process takes place at about 52C
vitro synthesis of target DNA. There are two stages to the without temperature cycling. The product of this ampli-
SDA process. In the rst stage (target generation), the tar- cation is millions of copies of the initial probe.
get DNA is denatured by heating to 95C. At each end of This method was rst widely applied to detection of M.
the target sequence, a primer and a probe bind close to tuberculosis.57 Methods using uorescence polarization
each other (Fig. 7-27). The probes have a recognition to detect the amplied target have been designed to test
sequence for a restriction enzyme. Exonuclease-decient for M. tuberculosis58 and C. trachomatis.59 Addition of a
DNA polymerase derived from E. coli extends the prim- uorogenic probe to the reaction produces a uorescent
ers, incorporating a modied nucleotide, 2-deoxyadeno- signal that corresponds to the amount of amplied target.
sine 5-O-(1-thiotriphosphate) (dATPaS). As the outer This is the basis for the BDProbeTecET test for M. tuber-
primers are extended, they displace the probes, which are culosis,60 C. trachomatis, and Neisseria gonorrhoeae.61
also extended. A second set of complementary primers
then bind to the displaced probes, and DNA polymerase
Q Replicase
extends the complementary primers, producing a double-
stranded version of the probes. The probes are the target Q replicase is another method for amplifying probes
DNA for the next stage of the process. that have specicity for a target sequence. The method is
The second stage of the reaction is the exponential named for the major enzyme that is used to amplify probe
probe/target amplication phase (Fig. 7-28). When the sequences. Q replicase is a RNA-dependent RNA poly-
restriction enzyme is added to the double-stranded probe merase from the bacteriophage Q.62 The target nucleic
DNA, only one strand of the probe will be cut due to the acid in this assay can be either DNA (which must rst be
dATPS introduced in the extension reaction. This forms denatured) or RNA.
a nick in the DNA that is extended by DNA polymerase, The target nucleic acid is added to a well containing
simultaneously displacing the opposite strand. The dis- reporter probes. The reporter probes are RNA molecules
placed strand is also copied by primers that will restore that have specicity for the target sequence and also con-
the restriction site. As dATPS is also used in the second- tain a promoter sequence (midivariant-1) that is recog-
stage extension reactions, one strand of each new product nized by the Q replicase. The reporter probes are
will be resistant to the restriction enzyme, and the nick- allowed to hybridize to the template. The template with

Nick Capture probe A Reporter probe

(A) G
G
G
G
1st
G hybridization
Magnetic
bead Target RNA
G
C G
Magnet C G Capture, wash
C G
(B) C
C
G
G
C G
C G
(C) C G Release
C G
C
Nick
Capture probe B
(D) A 2nd
A
A
A
hybridization
A
Nick
(E) A
T A
T A
T A
T A
T
Reversible
target capture
Nick
and washes
Figure 7-28 In the second phase of SDA, the target T
T A
T A
sequence is nicked by the restriction enzyme, generating a T A
T A
substrate for the polymerase, which extends the nick, displac- A
ing the opposite strand (B, D). The displaced strand is

hybridized by a primer, producing another endonucleolytic Q replicase
target (C, E). The product of both reactions is a copy of the
target with a hemisensitive restriction site (C, top). The reac-
Amplification
tion cycles of the strands are cut and extended.
bound probes is captured onto the side of the well using

Figure 7-29 The Q replicase method proceeds through a
polyC capture probes and paramagnetic beads so that
series of binding and washing steps.63,64 Probe bound to the
unbound reporter molecules can be washed away (Fig. puried template is then amplied by Q replicase. The result-
7-29). The template-probe complex is released from the ing RNA can be detected by uorometry using propidium
polyC magnetic bead and bound to a different capture iodide as a uorescent label of the synthesized probe or by
probe on a polyT paramagnetic bead. After a series of chromogenic methods.
washes to remove unbound reporter probe, the template-
probe complex is again released from the magnetic bead. eration of 106109 RNA molecules/probe in less than 15
For the amplication step, the probe-bound template is minutes. Because so many RNA molecules are produced,
mixed with the Q replicase, which replicates the probe product detection can be achieved by colorimetric as well
molecules. This replication is very efficient with the gen- as real time uorogenic methods. This assay can also be

quantitative by running a standard curve to determine the

number of target molecules in the sample. Amplifiers
Q replicase has been used primarily to amplify the
nucleic acid associated with infectious organisms, par-
ticularly mycobacteria,63, 64 Chlamydia,65 HIV,66 and
CMV,67 but the assays are not commercially available in
the United States at this time. Extender probes
Signal Amplification
Target RNA or DNA
Capture
Signal amplification procedures differ from target ampli-
probes
cation procedures in that the number of target sequences
does not change; instead, large amounts of signal are Solid support
bound to the target sequences that are present in the sam-
ple. Because the number of target sequences does not Figure 7-30 Branched DNA signal amplication of a single
change, signal amplication procedures are inherently target. The target is captured or immobilized to a solid support
better at quantitating the amount of target sequences by capture probes, after which extender probes and blocking
present in the clinical sample. Several signal amplica- probes create a stable cruciform structure with the ampliers.
tion methods are available commercially. Each amplier has hybridization sites for 814 branches, which
in turn bind substrate molecules for alkaline phosphatase.
Branched DNA Amplication

Chiron Corp. developed and markets the branched DNA Amplifiers
(bDNA) amplication system. The target nucleic acid for
this assay can be either DNA or RNA. A series of short
oligomer probes are used to capture the target nucleic
acid, and additional extender probes bind to the target
nucleic acid and then to multiple reporter molecules,68
loading the target nucleic acid with signal.
The bDNA signal amplification procedure is as fol-
lows. The target nucleic acid is released from the cells,
the DNA is denatured if DNA is the target, and the target
nucleic acid binds to capture probes that are xed to a
solid support (Fig. 7-30). Extender or preamplifier probes
then bind to the captured target. The extender probes
have sequences that are complementary to sequences in Preamplifier
the target molecules as well as to sequences that are in Extender probes
the amplifier molecules. In the first-generation assay, the
extender probes bind to a bDNA amplier, which in turn
bind multiple alkaline phosphatase-labeled nucleotides. Target RNA or DNA
Capture
Eight multimers or amplifiers, each with 15 branches, probes
bind to each extender probe bound to the target. In the
second- and third-generation assays, the extender probes Solid support
bind preamplifiers, which in turn bind 1415 ampliers
that can each bind to multiple alkaline phosphatase Figure 7-31 Second-generation bDNA assays use extender
labeled oligonucleotides (Fig. 7-31). Dioxetane is added probes that bind multiple ampliers, increasing the signal
as the substrate for the alkaline phosphatase, and chemi- intensity and improving limits of detection.

luminescence is measured in a luminometer. This system unique structure that is recognized by antibodies.
has a detection limit of about 50 target mol/mL.69 Antibodies bound to the surface of a microtiter well cap-
There are several advantages to this method. First, there ture the DNA/RNA hybrids. Double-stranded DNA or
is less risk of carryover contamination resulting in a pos- single-stranded RNA will not bind to these antibodies.
itive test in the bDNA assay than in PCR.70 Second, mul- Captured hybrids are detected by the binding of alkaline
tiple capture and extender probes can be incorporated that phosphataseconjugated antiDNA/RNA hybrid antibod-
detect slightly different target sequences as occurs with ies in a typical sandwich assay. The substrate for the alka-
different isolates of hepatitis C virus and HIV. By incor- line phosphatase is added, and chemiluminescence is
porating different probes that recognize slightly different measured. The sensitivity of this assay for Human Papil-
sequences, multiple genotypes of the same virus can still loma Virus has been reported to be about 1000 copies of
be detected by the same basic system. Finally, requiring viral DNA.81 The hybrid capture assay is considered a
that multiple probes bind to the same target increases the signal amplification assay because the amount of target
specificity of the system. It is highly unlikely that all of DNA is not amplified; rather, the DNA is isolated, bound
the required probes would bind nonspecically to an to a probe, and then label is bound to the target/probe
unrelated target and produce a signal. The bDNA signal hybrid molecule.
amplification assay is currently available for the qualita-
tive and quantitative detection of Hepatitis B Virus, Hepa-
titis C Virus, and HIV-1.6974 Cleavage-Based Amplification
Cleavage-based amplication detects target nucleic acids
Hybrid Capture Assays by using a series of probes that bind to the target and over-
lap. Cleavase is an enzyme that has been isolated from
Digene Diagnostics has marketed the hybrid capture bacteria that recognizes overlapping sequences of DNA
assays primarily for the detection and molecular charac- and makes a cut (cleaves) in the overlapping piece. In
terization of Human Papilloma Virus in genitourinary vivo, this activity is most likely important in repairing
specimens.75,76 It is also available for the detection of DNA. Third Wave Technologies has promoted this
Hepatitis B Virus77,78 and CMV.79,80 In these assays, target method as the basis of its Invader system. Targets for this
DNA is released from cells and binds to single-stranded form of amplification have been DNA polymorphisms,
RNA probes (Fig. 7-32). The DNA/RNA hybrid has a primarily for factor V Leiden mutation detection.86, 87
To start the amplication, the target nucleic acid is
mixed with invader and signal probes (see Chapter 9, Fig.
9-26.). The invader probe and the signal probes bind at
the target, with the 5 end of the signal probe overlapping
with the invader probe. Cleavase recognizes this overlap
and cleaves the signal probe, which can act as an invader
probe in the next step of the reaction. In the second step,
a FRET probe is added that has sequences complemen-
tary to the cleaved signal probe. The 5 end of the FRET
probe has a reporter molecule that is located in proximity
DNA RNA Antibodies Secondary to a quencher molecule. As a result, the intact FRET
probe antibodies probe does not produce a signal. The signal probe (now
Figure 7-32 Hybrid capture starts with hybridization of the an invader probe) binds to the FRET probe, producing an
RNA probe to the denatured DNA target. The RNA/DNA
overlapping region that is recognized by Cleavase. When
hybrid is then bound by hybrid-specic immobilized antibod-
ies. A secondary antibody bound to alkaline phosphatase
Cleavase cuts the FRET probe in the overlapping region,
generates signal in the presence of a chemiluminescent it releases the reporter molecule from the quencher,
substrate (right). resulting in the production of signal. The amount of sig-

RNA probe
STUDY QUESTIONS
R
Q
1. The nal concentration of Taq polymerase is to be
DNA target 0.01 units/l in a 50 l PCR. If the enzyme is sup-
plied as 5 units/l, how much enzyme would you add
R Q to the reaction?
a. 1 L
RNase b. 1 L of a 1:10 dilution of Taq
c. 5 L of a 1:10 dilution of Taq
R Q d. 2 L
2. Primer dimers result from:

R a. High primer concentrations
Q
b. Low primer concentrations
c. High GC content in the primer sequences
Figure 7-33 Cycling probe produces uorescence only
d. 3 complementarity in the primer sequences
when the RNA probe binds to the DNA template. The
RNA/DNA hybrid formed by the probe bound to the tem-
plate is a substrate for RNase H, which digests the RNA 3. Which control is run to detect contamination?
probe and releases the reporter dye (R) from the vicinity a. Negative control
of the quencher (Q). b. Positive control
c. Molecular weight marker
nal can be quantitated and related directly to the amount d. Reagent blank
of target molecules in the sample.
4. Nonspecic extra PCR products can result from:
a. Mispriming
Cycling Probe b. High annealing temperatures
In the cycling probe method of amplification, target c. High agarose gel concentrations
sequences are detected using a synthetic probe consisting d. Omission of MgCl2 from the PCR
of sequences of DNA-RNA-DNA. The probe binds to the
target nucleic acid (Fig. 7-33). RNase H cleaves the RNA 5. Using which of the following is an appropriate way to
from the middle of the probe. This releases the DNA por- avoid PCR contamination?
tions from the probes, freeing the template to bind to a. High delity polymerase
additional probe molecules. When the probe is digested, b. Hot-start PCR
the reporter and quencher dye are separated, allowing u- c. A separate area for PCR set up
orescence to escape from the reporter. The amount of u- d. Fewer PCR cycles
orescence from the reporter dye (produced when the
target is present) is measured as an indication of the pres- 6. How many copies of a target are made after 30 cycles
ence of target molecules. Alternatively, the presence of of PCR?
chimeric probes that remain when target sequences are a. 2 30
not present can also be measured. This method has been b. 230
used to detect genes associated with antimicrobial resist- c. 302
ance in bacteria such as methicillin resistance (mecA) in d. 30/2
Staphylococcus aureus and vancomycin resistance (vanA
and vanB) in Enterococcus.88,89 7. What are the three steps of a standard PCR cycle?

8. Which of the following is a method for purifying a a. Write the primer sequences 5 3 as you would
PCR product? if you were to order them from the DNA synthe-
a. Treat with uracil N glycosylase sis facility.
b. Add divalent cations b. Write the Tm for each primer that you have
c. Put the reaction mix through a spin column designed.
d. Add DEPC
References
9. In contrast to standard PCR, real-time PCR is: 1. Mullis K. The unusual origin of the polymerase
a. Quantitative chain reaction. Scientic American 1990;262:
b. Qualitative 5661, 6465.
c. Labor-intensive 2. Mullis K, Faloona FA. Specic synthesis of DNA in
d. Sensitive vitro via a polymerase-catalyzed chain reaction.
Methods in Enzymology 1987;155:33550.
10. In real-time PCR, uorescence is not generated by
3. Saiki R, Scharf S, Faloona F, et al. Enzymatic ampli-
which of the following?
cation of beta-globin genomic sequences and
a. FRET probes
restriction site analysis for diagnosis of sickle cell
b. TaqMan probes
anemia. Science 1985;230:135054.
c. SYBR green
4. Lawyer F, Stoffel S, Saiki RK, et al. Isolation, char-
d. Tth polymerase
acterization, and expression in Escherichia coli of
11. Prepare a table that compares PCR, LCR, bDNA, the DNA polymerase gene from Thermus aquaticus.
TMA, Q Replicase, and Hybrid Capture with Journal of Biological Chemistry 1989;264(11):
regards to the type of amplication, target nucleic 642737.
acid, type of amplicon, and major enzyme(s) for each. 5. Obeid P, Christopoulos TK, Crabtree HJ, et al.
Microfabricated device for DNA and RNA amplifi-
12. Examine the following sequence. You are devising a cation by continuous-ow polymerase chain reaction
test to detect a mutation at the underlined position. and reverse transcription-polymerase chain reaction
5 TATTTAGTTA TGGCCTATAC ACTATTTGTG with cycle number selection. Analytical Chemistry
AGCAAAGGTG ATCGTTTTCT GTTTGAGATT 2003;75(2):28895.
TTTATCTCTT GATTCTTCAA AAGCATTCTG 6. Klaschik S, Lehmann LE , Raadts A , et al. Com-
AGAAGGTGAG ATAAGCCCTG AGTCTCAGCT parison of different decontamination methods for
ACCTAAGAAA AACCTGGATG TCACTGGCCA reagents to detect low concentrations of bacterial
CTGAGGAGC TTTGTTTCAAC CAAGTCATGT 16S DNA by real-time-PCR. Molecular Biotechno-
GCATTTCCAC GTCAACAGAA TTGTTTATTG logy 2002;22(3):23142.
TGACAGTTAT ATCTGTTGTC CCTTTGACCT 7. Meier A, Persing DH , Finken M , et al. Elimina-
TGTTTCTTGA AGGTTTCCTC GTCCCTGGGC tion of contaminating DNA within polymerase
AATTCCGCAT TTAATTCATG GTATTCAGGA chain reaction reagents: Implications for a general
TTACATGCAT GTTTGGTTA AACCCATGAGA approach to detection of uncultured pathogens.
TTCATTCAGT TAAAAATCCA GATGGCGAAT 3 Journal of Clinical Microbiology 1993;31(3):
Design one set of primers (forward and reverse) to gener- 64652.
ate an amplicon containing the underlined base. 8. Fox J, Ait-Khaled M, Webster A, et al. Eliminating
The primers should be 20 bases long. PCR contamination: Is UV irradiation the answer?
The amplicon must be 100150 bp in size. Journal of Virological Methods 1991;33(3):37582.
The primers must have similar melting temperatures (Tm), 9. Waltenbury D, Leduc LG, Ferroni GD. The use of
/ 2C. RAPD genomic ngerprinting to study relatedness
The primers should have no homology in the last three 3 in strains of Acidithiobacillus ferrooxidans. Journal
bases. of Microbiological Methods 2005;62(1):10312.

10. Tzanakaki G, Tsopanomichalou M, Kesanopoulos cycler technology. Cancer Research 2000;60(12):

K, et al. Simultaneous single-tube PCR assay for the 328189.
detection of Neisseria meningitidis, Haemophilus 20. Gibbons C, Awad-El-Kariem FM. Nested PCR for
inuenzae type b and Streptococcus pneumoniae. the detection of Cryptosporidium parvum. Parasito-
Clinical Microbiology and Infection;11(5):38690. logy Today 1999;15(8):345.
11. Nguyen T, Le Van P, Le Huy C, et al. Detection and 21. Knox C, Timms P. Comparison of PCR, nested
characterization of diarrheagenic Escherichia coli PCR, and random amplied polymorphic DNA PCR
from young children in Hanoi, Vietnam. Journal of for detection and typing of Ureaplasma urealyticum
Clinical Microbiology 2005;43(2):75560. in specimens from pregnant women. Journal of
12. Bellau-Pujol S, Vabret A, Legrand L, et al. Clinical Microbiology 1998;36(10):303239.
Development of three multiplex RT-PCR assays for 22. Pinti M, Nasi M, Moretti L, et al. Quantitation of
the detection of 12 respiratory RNA viruses. Journal CD95 and CD95L mRNA expression in chronic
of Virological Methods 2005;126(12):5363. and acute HIV-1 infection by competitive RT-PCR.
13. Gaydos C, Crotchfelt KA, Shah N, et al. Evaluation Annals of the New York Academy of Sciences 2000;
of dry and wet transported intravaginal swabs in 926:4651.
detection of Chlamydia trachomatis and Neisseria 23. Higuchi R, Dollinger G, Walsh PS, et al. Simultane-
gonorrhoeae infections in female soldiers by PCR. ous amplication and detection of specic DNA
Journal of Clinical Microbiology 2002;40(3): sequences. Biotechnology 1992;10:41317.
75861. 24. Higuchi R, Fockler C, Dollinger G, et al. Kinetic
14. Geha D, Uhl JR, Gustaferro CA, et al. Multiplex PCR: Real-time monitoring of DNA amplication
PCR for identication of methicillin-resistant reactions. Biotechnology 1993;11:102630.
staphylococci in the clinical laboratory. Journal of 25. Sherman K, Rouster SD, Horn PS. Comparison of
Clinical Microbiology 1994;32:176872. methodologies for quantication of hepatitis C
15. Hui R, Zeng F, Chan CMF, et al. Reverse transcrip- virus (HCV) RNA in patients coinfected with
tase PCR diagnostic assay for the coronavirus asso- HCV and human immunodeciency virus:
ciated with severe acute respiratory syndrome. Comparison of methodologies for quantication
Journal of Clinical Microbiology 2004;42(5): of hepatitis C virus (HCV) RNA in patients coin-
199499. fected with HCV and human immunodeciency
16. Casabianca A, Orlandi C, Fraternale A, et al. A new virus. Clinical Infectious Diseases 2002;35(4):
one-step RT-PCR method for virus quantitation in 48287.
murine AIDS. Journal of Virological Methods 2003; 26. Raab M, Cremer FW, Breitkreutz IN, et al.
110(1):8190. Molecular monitoring of tumour load kinetics pre-
17. Koopmans M, Monroe SS, Coffield LM, et al. Opti- dicts disease progression after non-myeloablative
mization of extraction and PCR amplication of allogeneic stem cell transplantation in multiple
RNA extracts from paraffin-embedded tissue in myeloma. Annals of Oncology 2005;16(4):
different xatives. Journal of Virological Methods 61117.
1993;43(2):189204. 27. Murthy S, Magliocco AM, Demetrick DJ. Copy
18. Poggio G, Rodriguez C, Cisterna D, et al. Nested number analysis of c-erb-B2 (HER-2/neu) and
PCR for rapid detection of mumps virus in cere- topoisomerase II alpha genes in breast carcinoma
brospinal uid from patients with neurological dis- by quantitative real-time polymerase chain reaction
eases. Journal of Clinical Microbiology 2000;38 using hybridization probes and uorescence in situ
(1):27478. hybridization. Archives of Pathology & Laboratory
19. Nakao M, Janssen JW, Flohr T, et al. Rapid and Medicine 2005;129(1):3946.
reliable quantication of minimal residual disease 28. Holland PM, Abramson RD, Watson R, et al. Detec-
in acute lymphoblastic leukemia using rearranged tion of specic polymerase chain reaction product
immunoglobulin and T-cell receptor loci by light by utilizing the 5 to 3 exonuclease activity of Ther-

mus aquaticus DNA polymerase. Proceedings of the 40. Neoh S, Brisco MJ, Firgaira FA, et al. Rapid detec-
National Academy of Sciences 1991;88:727680. tion of the factor V Leiden (1691 G A) and
29. Lee LG, Connell CR, Bloch W. Allelic discrimina- haemochromatosis (845 G A) mutation by uo-
tion by nick-translation PCR with uorogenic rescence resonance energy transfer (FRET) and
probes. Nucleic Acids Research 1993;21:376166. real-time PCR. Journal of Clinical Pathology 1999;
30. Branford S, Hughes TP, Rudzki Z. Monitoring 52(10):76669.
chronic leukemia therapy by real-time quantitative 41. Gundry CN, Bernard PS, Hermann MG, et al. Rapid
PCR in blood is a reliable alternative to bone mar- F508del and F508C assay using uorescent hybridi-
row cytogenetics. British Journal of Haematology zation probes. Genetic Testing 1999;3:36570.
1999;107:58799. 42. Cardullo RA, Agarwal S, Flores C, et al. Nucleic
31. Kleiber J, Walter T, Haberhausen G, et al. Perform- acid hybridization by nonradioactive uorescence
ance characteristics of a quantitative homogeneous resonance energy transfer. Proceedings of the
TaqMan RT-PCR test for HCV RNA. Journal of National Academy of Sciences 1988;85:879094.
Molecular Diagnostics 2000;2(3):15866. 43. Welsh J, McClelland M. Fingerprinting genomes
32. Rudert WA, Braun ER, Faas SJ, et al. Double- using PCR with arbitrary primers. Nucleic Acids
labeled uorescent probes for 5 nuclease assays: Research 1990;18(24):721318.
Purication and performance evaluation. 44. Perucho M, Welsh J, Peinado MA, et al. Finger-
BioTechniques 1997;22:114045. printing of DNA and RNA by arbitrarily primed
33. Livak KJ, Marmaro J, Flood S. Guidelines for polymerase chain reaction: Applications in cancer
designing Taqman uorescent probes for 5 nucle- research. Methods in Enzymology 1995;254:
ase assays. Applied Biosystems, 1995. 27590.
34. Whitcombe D, Theaker J, Guy SP, et al. Detection 45. Kluytmans J, Berg H, Steegh P, et al. Outbreak of
of PCR products using self-probing amplicons and Staphylococcus schleiferi wound infections: Strain
uorescence. Nature Biotechnology 1999;17: characterization by randomly amplied polymorphic
804807. DNA analysis, PCR ribotyping, conventional ribo-
35. Nazarenko IA, Bhatnagar SK, Hohman RJ. A typing, and pulsed-eld gel electrophoresis. Journal
closed tube format for amplication and detection of Clinical Microbiology 1998;36(8):221419.
of DNA based on energy transfer. Nucleic Acids 46. Kwoh D, Davis GR, Whiteld KM, et al.
Research 1997;25:251621. Transcription-based amplication system and detec-
36. Thelwell NS, Millington S, Solinas A, et al. Mode tion of amplied human immunodeciency virus
of action and application of Scorpion primers to type 1 with a bead-based sandwich hybridization
mutation detection. Nucleic Acids Research 2000; format. Proceedings of the National Academy of
28:375261. Sciences 1989;86(4):117377.
37. Didenko VV. DNA probes using uorescence reso- 47. Gorrin G, Friesenhahn M, Lin P, et al. Performance
nance energy transfer (FRET): Designs and applica- evaluation of the VERSANT HCV RNA qualitative
tions. BioTechniques 2001;31(5):110621. assay by using transcription-mediated amplication.
38. Menard A, Dachet F, Prouzet-Mauleon V, et al. Journal of Clinical Microbiology 2003;41(1):
Development of a real-time uorescence resonance 31017.
energy transfer PCR to identify the main patho- 48. Allain J. Genomic screening for blood-borne viruses
genic Campylobacter spp. Clinical Microbiology in transfusion settings. Clinical and Laboratory
and Infection 2005;11(4):28187. Haematology 2000;22(1):110.
39. Aliyu S, Aliyu MH, Salihu HM, et al. Rapid detec- 49. Kimura T, Rokuhara A,Sakamoto Y, et al. Sensitive
tion and quantitation of hepatitis B virus DNA by enzyme immunoassay for hepatitis B virus core-
real-time PCR using a new uorescent (FRET) related antigens and their correlation to virus load.
detection system. Journal of Clinical Virology Journal of Clinical Microbiology 2002;40(2):
2004;30(2):19195. 43945.

50. Kievits T, van Gemen B, van Strijp D, et al. NASBA culosis complex in respiratory specimens. Journal
isothermal enzymatic in vitro nucleic acid amplifica- of Clinical Microbiology 1999;37(1):13740.
tion optimized for the diagnosis of HIV-1 infection. 61. Little M, Andrews J, Moore R, et al. Strand dis-
Journal of Virological Methods 1991;35(3):27386. placement amplification and homogeneous real-
51. van der Vliet G, Schukkink RA, van Gemen B, et time detection incorporated in a second-generation
al. Nucleic acid sequence-based amplication DNA probe system, BD ProbeTec ET. Clinical
(NASBA) for the identication of mycobacteria. Chemistry 1999;45(6):77784.
Journal of General Microbiology 1993;139(10): 62. Blumenthal T, Carmichael GG. RNA replication:
242329. Function and structure of Qbeta-replicase. Annual
52. Deiman B, van Aarle P, Sillekens P. Characteristics Review of Biochemistry 1979;48:52548.
and applications of nucleic acid sequence-based 63. Shah J, Liu J, Buxton D, et al. Detection of
amplication (NASBA). Molecular Biotechnology Mycobacterium tuberculosis directly from spiked
2002;20(2):16380. human sputum by Q-beta replicaseamplied assay.
53. Romano J, van Gemen B, Kievits T. NASBA: A Journal of Clinical Microbiology 1995;33:32228.
novel, isothermal detection technology for qualita- 64. Shah J, Liu J, Buxton D, et al. Q-beta replicase
tive and quantitative HIV-1 RNA measurements. amplied assay for detection of Mycobacterium
Clinical Laboratory Medicine 1996;16(1):89103. tuberculosis directly from clinical specimens.
54. Barany F. The ligase chain reaction in a PCR world. Journal of Clinical Microbiology 1995;33(6):
PCR Methods and Applications 1991;1(1):516. 143541.
55. Walker G, Fraiser MS, Schram JL, et al. Strand dis- 65. Stefano J, Genovese L, An Q, et al. Rapid and sen-
placement amplication: An isothermal, in vitro sitive detection of Chlamydia trachomatis using a
DNA amplication technique. Nucleic Acids ligatable binary RNA probe and Q beta replicase.
Research 1992;20(7):169196. Molecular and Cellular Probes 1997;11(6):40726.
56. Walker G, Little MC, Nadeau JG, et al. Isothermal 66. Lomeli H, Tyagi S, Pritchard CG, et al. Quantitative
in vitro amplication of DNA by a restriction assays based on the use of replicatable hybridiza-
enzyme/DNA polymerase system. Proceedings of tion probes. Clinical Chemistry 1989;35(9):
the National Academy of Sciences 1992;89(1): 182631.
39296. 67. Fox R, Dotan I, Compton T, et al. Use of DNA
57. Ichiyama S, Ito Y, Sugiura F, et al. Diagnostic value amplication methods for clinical diagnosis in
of the strand displacement amplication method autoimmune diseases. Journal of Clinical Labora-
compared to those of Roche Amplicor PCR and tory Analysis 1989;3(6):37887.
culture for detecting mycobacteria in sputum sam- 68. Horn T, Chang CA, Urdea MS. Chemical synthesis
ples. Journal of Clinical Microbiology 1997;35(12): and characterization of branched oligodeoxyribonu-
38023805. cleotides (bDNA) for use as signal ampliers in
58. Walker G, Linn CP. Detection of Mycobacterium nucleic acid quantication assays. Nucleic Acids
tuberculosis DNA with thermophilic strand dis- Research 1997;25(23):484249.
placement amplication and uorescence polariza- 69. Kern D, Collins M, Fultz T, et al. An enhanced-
tion. Clinical Chemistry 1996;42(10):16041608. sensitivity branched-DNA assay for quantification
59. Spears P, Linn CP, Woodard DL, et al. Simultane- of human immunodeficiency virus type 1 RNA in
ous strand displacement amplication and uores- plasma. Journal of Clinical Microbiology 1996;
cence polarization detection of Chlamydia 34(12):3196202.
trachomatis DNA. Analytical Biochemistry 1997; 70. Lisby G. Application of nucleic acid amplication
247(1):13037. in clinical microbiology. Methods in Molecular
60. Pfyffer G, Funke-Kissling P, Rundler E, et al. Biology 1998;92:129.
Performance characteristics of the BD ProbeTec 71. Konnick E, Williams SM, Ashwood ER, et al.
system for direct detection of Mycobacterium tuber- Evaluation of the COBAS hepatitis C virus (HCV)

TaqMan analyte-specic reagent assay and compar- 80. Hebart H, Gamer D, Loeffler J, et al. Evaluation of
ison to the COBAS Amplicor HCV Monitor V2.0 Murex CMV DNA hybrid capture assay for detec-
and Versant HCV bDNA 3.0 assays. Journal of tion and quantitation of cytomegalovirus infection
Clinical Microbiology 2005;43(5):213340. in patients following allogeneic stem cell transplan-
72. Elbeik T, Markowitz N, Nassos P, et al. Simultane- tation. Journal of Clinical Microbiology 1998;36
ous runs of the Bayer Versant HIV-1 version 3.0 (5):133337.
and HCV bDNA version 3.0 quantitative assays on 81. Schiffman M, Kiviat NB, Burk RD, et al. Accuracy
the System 340 platform provide reliable quantita- and interlaboratory reliability of human papillo-
tion and improved work ow. Journal of Clinical mavirus DNA testing by hybrid capture. Journal of
Microbiology 2004;42(7):312027. Clinical Microbiology 1995;33(3):54550.
73. Gleaves C, Welle J, Campbell M, et al. Multi- 82. Mullis K, The polymerase chain reaction. The
center evaluation of the Bayer Versant HIV-1 Nobel Prize in Chemistry, 1993.
RNA 3.0 assay: Analytical and clinical per- 83. Cleaver J, Crowley E. UV damage, DNA repair and
formance. Journal of Clinical Virology 2002; skin carcinogenesis. Frontiers in Bioscience 2002;
25(2):20516. 7:102443.
74. Yao J, Beld MG, Oon LL, et al. Multicenter evalua- 84. Petering H, Breuer C, Herbst R, et al. Comparison
tion of the Versant hepatitis B virus DNA 3.0 assay. of localized high-dose UVA1 irradiation versus
Journal of Clinical Microbiology 2004;42(2): topical cream psoralen-UVA for treatment of
800806. chronic vesicular dyshidrotic eczema. Journal of
75. Clavel C, Masure M, Levert M, et al. Human papil- the American Academy of Dermatology 2004;50(1):
lomavirus detection by the hybrid capture II assay: 6872.
A reliable test to select women with normal cervi- 85. Naldi L, Griffiths CE. Traditional therapies in the
cal smears at risk for developing cervical lesions. management of moderate to severe chronic plaque
Diagnostic Molecular Pathology 2000;9(3): psoriasis: An assessment of the benets and risks.
14550. British Journal of Dermatology 2005;152(4):
76. Farthing A, Masterson P, Mason WP, et al. Human 597615.
papillomavirus detection by hybrid capture and its 86. Hessner MJ, Budish MA, Friedman KD. Genotyp-
possible clinical use. Journal of Clinical Pathology ing of factor V G1691A (Leiden) without the use of
1994;47(7):64952. PCR by invasive cleavage of oligonucleotide
77. Barlet V, Cohard M, Thelu MA, et al. Quantitative probes. Clinical Chemistry 2000;46:10511056.
detection of hepatitis B virus DNA in serum using 87. Ledford M, Friedman KD, Hessner MJ, et al. A
chemiluminescence: Comparison with radioactive multi-site study for detection of the factor V
solution hybridization assay. Journal of Virological (Leiden) mutation from genomic DNA using a
Methods 1994;49(2):14151. homogeneous invader microtiter plate fluorescence
78. Poljak M, Marin IJ, Seme K, et al. Second- resonance energy transfer (FRET) assay. Journal of
generation hybrid capture test and Amplicor Molecular Diagnostics. 2000;2:97104.
monitor test generate highly correlated hepatitis 88. Cloney L, Marlowe C, Wong A, et al. Rapid detec-
B virus DNA levels. Journal of Virological tion of mecA in methicillin resistant Staphylococcus
Methods 2001;97(12):16569. aureus using cycling probe technology. Molecular
79. Caliendo A, Yen-Lieberman B, Baptista J, et al. and Cellular Probes. 1999;13(3):1917.
Comparison of molecular tests for detection and 89. Modrusan Z, Marlowe C, Wheeler D, et al.
quantication of cell-associated cytomegalovirus Detection of vancomycin-resistant genes vanA and
DNA. Journal of Clinical Microbiology 2003;41(8): vanB by cycling probe technology. Molecular and
350913. Cellular Probes, 1999; 13(3): 223231.
Chromosomal
Structure and
Chromosomal
Mutations
OUTLINE OBJECTIVES
CHROMOSOMAL STRUCTURE Dene mutations and polymorphisms.
AND ANALYSIS
Chromosomal Compaction Distinguish the three types of DNA mutations: genome,
and Histones chromosomal, and gene.
Chromosomal Morphology Describe chromosomal compaction and the proteins
Visualizing Chromosomes involved in chromatin structure.
DETECTION OF GENOME AND Diagram a human chromosome, and label the centromere,
CHROMOSOMAL MUTATIONS
q arm, p arm, and telomere.
Karyotyping
Fluorescence In Situ Hybridization Illustrate the different types of structural mutations that
occur in chromosomes.
State the karyotype of a normal male and female.
Identify the chromosomal abnormality in a given
karyotype.
Compare and contrast interphase and metaphase FISH
analyses.
Distinguish between the effects of balanced and unbal-
anced translocations on an individual and the individuals
offspring.
155

The human genome is all of the genes found in a single be observed microscopically. Mutations at the nucleotide
individual. The human genome consists of 2.9 billion sequence level are detected using biochemical or molec-
nucleotide base pairs of DNA organized into 23 chromo- ular methods. Alterations of the DNA sequence may
somes. As diploid organisms, humans inherit a haploid affect not only the phenotype of an individual but the
set of all their genes (23 chromosomes) from each parent, progeny of that individual as well. The latter, heritable
so that humans have two copies of every gene (except for changes, are the basis for prediction of the phenotype in
some on the X and Y chromosomes). Each chromosome the next generation. The probability of inheritance of a
is a double helix of DNA, ranging from 246 million phenotypic trait can be estimated using logical methods
nucleotide base pairs in length in chromosome 1 (the of mendelian genetics and statistics.
largest) to 47 million nucleotide base pairs in chromo- A transmissible (inheritable) change in the DNA
some 22 (the smallest; Table 8.1). Genetic information is sequence is a mutation or polymorphism. Although these
carried on the chromosomes in the form of the order, or terms are sometimes used interchangeably, they do have
sequence, of nucleotides in the DNA helix. A phenotype slightly different meanings based on population genetics.
is a trait or group of traits resulting from transcription and A DNA sequence change that is present in a relatively
translation of these genes. The genotype is the DNA small proportion of a population is a mutation. The term,
nucleotide sequence responsible for a phenotype. variant, may also be used, particularly to describe inher-
Genotypic analysis is performed to conrm or predict ited sequence alterations, thus reserving the term muta-
phenotype. In the laboratory, some changes in chromo- tion for somatic changes; for example, changes found
some structure and changes in chromosome number can only in tumor tissue. A change in the DNA sequence that
is present in at least 1%2% of a population is a poly-
morphism. Both mutations and polymorphisms may or
Table 8.1 Sizes of Human Chromosomes in Base Pairs may not produce phenotypic differences. Polymorphisms
Chromosome Millions of Base Pairs
are casually considered mutations that do not severely
affect phenotype; this is generally true, as any negative
1 246
effect on survival and reproduction limits the persistence
2 244
of a genotype in a population. Some polymorphisms are
3 199
maintained in a population through a balance of positive
4 192
and negative phenotype. The classic example is sickle
5 181
cell anemia, a condition caused by a single-base substitu-
6 171
tion in the gene that codes for hemoglobin. The alteration
7 158
is regarded as a mutation, but it is really a balanced poly-
8 146
morphism. In addition to causing abnormal red blood
9 136
cells, the genetic alteration results in resistance to infec-
10 135
tion by Plasmodium falciparum; that is, resistance to
11 134
malaria. The benecial trait provides a survival and
12 132
reproductive advantage that maintains the polymorphism
13 113
in a relatively large proportion of the population.
14 100
Examples of benign polymorphisms, that is, those with
15 90
no selective advantage, are the ABO blood groups and
16 82
the major histocompatibility complex (see Chapter 15).
17 76
Polymorphisms used for human identication and pater-
18 64
nity testing are discussed in Chapter 10.
19 64
DNA mutations can affect a single nucleotide or mil-
20 47
lions of nucleotides, even whole chromosomes, and thus
21 47
can be classied into three categories. Gene mutations
22 49
affect single genes and are often, but not always, small
X 154
changes in the DNA sequence. Chromosome mutations
Y 57
affect the structures of entire chromosomes. These

Chromosomal Structure and Chromosomal Mutations Chapter 8 157
changes require movement of large chromosomal regions

either within the same chromosome or to another chro-
mosome. Genome mutations are changes in the number
Advanced Concepts
of chromosomes. A cell or cell population with a normal The structure of metaphase chromosomes is main-
complement of chromosomes is euploid. Genome muta- tained by more than just histones. Metaphase chro-
tions result in cells that are aneuploid. Aneuploidy is matin is one-third DNA, one-third histones, and
usually (but not always) observed as increased numbers one-third nonhistone proteins. Nonhistone protein
of chromosomes, because the loss of whole chromo- complexes, termed condensin I and condensin II, are
somes is not compatible with survival. A single copy of apparently required for maintenance of mitotic
each chromosome (23 in humans) is a haploid comple- chromosome structure.28
ment. Humans are normally diploid, with two copies of
each chromosome. Aneuploidy can result when there are
more than two copies of a single chromosome or when
for accurate segregation in mitosis. There is an 8000-fold
there are multiple copies of one or more chromosomes.
compaction of an extended DNA double helix to make a
Downs syndrome is an example of a disease resulting
metaphase chromosome (Fig. 8-1).3 Winding of DNA
from aneuploidy, where there are three copies, or
onto histones is the rst step. Histones are the most abun-
triploidy, of chromosome 21.
dant proteins in cells. There are ve histones: H1, H2a,
Detection of mutations in the laboratory ranges from
H2b, H3, and H4. Approximately 160180 bp of DNA is
direct visualization of genome and chromosomal muta-
wrapped around a set of 8 histone proteins (2 each of
tions under the microscope to indirect molecular methods
H2a, H2b, H3 and H4) to form a nucleosome. Nucleo-
to detect single-base changes. Methods used for detection
somes can be seen by electron microscopy as 100-
of genome and chromosomal mutations are discussed in
beadlike structures that are separated by short strands of
this chapter. Methods to detect gene mutations are
free double helix (Fig. 8-2). DNA wrapped around his-
described in Chapter 9.
tones forms a bead-on-a-string arrangement that com-
prises the 10-nm or 10-micron ber. The 10-micron
Chromosomal Structure ber is further coiled around histone H1 into a thicker
and shorter 30-nm or 30-micron ber. The 30-nm inter-
And Analysis phase bers represent the resting state of DNA. The
Chromosomal Compaction bers are locally relaxed into 10-nm bers for DNA
and Histones metabolism as required during the cell cycle. These bers
are looped onto protein scaffolds to form 300-nm bers;
An important concept in the understanding of chromo-
before entry into the M phase of the cell cycle (mitosis),
somes is that chromosome behavior is dependent on chro-
the looped bers are wound into 700-nm solenoid coils.4
mosome structure as well as DNA sequence.1 Genes with
The 700-nm coils are compacted into the 1400-nm bers
identical DNA sequences will behave differently, depend-
that can be seen in metaphase nuclei and in karyotypes.
ing on their chromosomal location or the surrounding
nucleotide sequence. For example, certain functional fea-
tures, such as the centromere (where the chromosome
attaches to the spindle apparatus for proper segregation
during cell division), are not dened by specic DNA
sequences.2 It is a well-known phenomenon that a gene Before 1943, histones were thought to contain
inserted or moved into a different chromosomal location genetic information. Their function was later
may be expressed (transcribed and translated) differently thought to be structural. It is now known that modi-
than it was in its original position. This is called position cation of histones, through acetylation, methyla-
effect. tion, phosphorylation, or ubiquitination, plays a role
A eukaryotic chromosome is a double helix of DNA. A in other cellular functions such as recombination,
cell nucleus contains 4 cm of double helix. This DNA replication, and gene expression.32
must be compacted, both to t into the cell nucleus and

DNA double helix When the DNA is relaxed into 10-micron bers for
2 nm transcription or replication, the placement of nucleosomes
along the double helix can be detected using nucleases
(e.g., Mung bean nuclease, or DNase I). These enzymes
Beads-on-a-string
cut the double helix in the linker region, the part of the
11 nm
form of chromatin double helix that is exposed between the histones.
To make 30-nm chromatin bers, the internucleosomal
DNA is associated with histone H1, and the beaded struc-
30-nm chromatin
ture is wound into a solenoid coil. Loss of this level of
fibers of packed 30 nm organization is the rst classic indicator of apoptosis, or
nucleosomes
programmed cell death. The 30-nm bers are uncoiled,
and the exposed linker DNA between the nucleosomes
becomes susceptible to digestion by intracellular nucle-
ases. The DNA wrapped into the nucleosomes remains
intact so that DNA isolated from apoptotic cells contains
Chromosome in
condensed form
300 nm ladders, or multiples of discreet multiples of ~180 bp.
These ladders can be resolved by simple agarose electro-
phoresis (Fig. 8-3). The remainder of the proteins in-
volved in DNA compaction are the nonhistone proteins.
Chromosome topology (state of compaction of the
DNA double helix) affects gene activity; for instance in
Supercoiled 700 nm chromosome X inactivation in females. More highly
chromatin fibers compacted DNA is less available for RNA transcription.
Maintenance of the more highly compacted state of DNA
in closed chromatin, or heterochromatin (in contrast to
open chromatin, or euchromatin), throughout interphase
1400 nm
may require special proteins called condensin proteins or
condensin-like protein complexes.
Chromosome
(10,000-fold shorter than its extended length)
Figure 8-1 DNA compaction into metaphase chromo-
somes. (FromB Alberts, Molecular Biology of the Cell, 4th
edition, Garland Science, New York, 2002.)
Advanced Concepts
Members of a family of proteins called SMC pro-
teins control chromosome condensation in eukary-
110
otes and other aspects of chromosome behavior,
H2A including chromosome segregation in prokaryotes.
H2B
H3
Two of the SMC proteins, XCAP-C and XCAP-E,
H4 rst isolated from frog eggs,29 are integral parts of
Core DNA
55
H3 the condensin complex, a protein scaffold structure
H1 that can be isolated from both mitotic and interphase
H2A H2B
cells. This complex in the presence of topoisomerase
can wrap DNA around itself in an ATP-driven reac-
tion. Although the exact role of this complex in con-
Linker DNA
densation and decondensation is not yet completely
Figure 8-2 DNA wrapped around eight histone proteins
(2 each of histone 2A, 2B, 3, and 4) forms a nucleosome. A
dened, this ability to change chromosome architec-
further association with histone H1 coils the nucleosomal DNA ture is a signicant feature of DNA metabolism.
into a 30-nm ber.

M 1 2 Centromere High order array
2000
1600
1000 Monomers (171 bp)

750 alpha satellite DNA
500
300 Kinetochore
150
50
Chromatin
Figure 8-3 Apoptotic DNA (lane 2) is characterized by Spindle fibers
the ladder seen on gel electrophoresis. This is in contrast to
degraded DNA from necrotic cells (lane 1). Lane M contains
Inner layer Middle layer Outer layer
molecular weight markers.
(40-60 nm) (25-30 nm) (40-60 nm)
Figure 8-4 The centromere (top) consists of tandem
Chromosome Morphology repeats of 171 base pair sequences anking sets of single
repeat units, or monomers repeated in groups in a higher
Mitotic chromosomes have been distinguished histori- order array. The kinetochore (bottom) is a protein structure
cally by their relative size and centromere placement. As that connects the centromeres to the spindle apparatus.
previously stated, the centromere is the site of attach-
ment of the chromosome to the spindle apparatus. The
connection is made between microtubules of the spindle Visualizing Chromosomes
and a protein complex, called the kinetochore, that Conventional cytological stains, such as Feulgens,
assembles at the centromere sequences (Fig. 8-4). At the Wrights, and hematoxylin, have been used to visualize
nucleotide level, the centromere is composed of a set of chromosomes. An advance in the recognition of individ-
highly repetitive alpha satellite sequences.5 Micro- ual chromosomes was the demonstration that uorescent
scopically, the centromere appears as a constriction in stains and chemical dyes can react with specic chromo-
each compacted metaphase chromosome. Chromosomes some regions. This region-specic staining results in the
are metacentric, submetacentric, acrocentric, or telo- formation of band patterns where portions of the chro-
centric, depending on the placement of the centromere
(Fig. 8-5). The placement of the centromere divides the
chromosome into arms.
There are no telocentric human chromosomes. Human
chromosomes are acrocentric or submetacentric and so
have long and short arms (Table 8.2). The long arm of a
chromosome is designated q, and the short arm is desig-
nated p. Acrocentric chromosomes have a long arm
length:short arm length ratio of from 3:1 to 10:1. Chro-
mosomes 13 to 15, 21, and 22 are acrocentric.
Advanced Concepts
Metacentric Acrocentric Telocentric
Some plants and insects have holocentric chromo-
Figure 8-5 The arms of metacentric chromosomes (left)
somes. During cell division, these chromosomes are of equal size. Acrocentric chromosomes (center) divide
form kinetochores along their entire length. the chromosome into long arms and short arms. Telocentric
centromeres (right) are at the ends of the chromosome.

Table 8.2 Classication of Chromosomes by Size

and Centromere Position
Group Chromosomes Description
A 1, 2 Large metacentric
3 Large submetacentric
B 4, 5 Large submetacentric
C 612, X Medium-sized submetacentric
D 1315 Medium-sized acrocentric
with satellites Centromere
E 16 Short metacentric
17, 18 Short submetacentric
F 19, 20 Short metacentric
G 21, 22 Short acrocentric with satellites
Y Short acrocentric
mosome accept or reject the stain. For cytogenetic analy-

sis, this allows unequivocal identication of every chro-
mosome and the direct detection of some chromosomal
abnormalities. Underlying the region-specic staining is
G or Q banding R banding C-banding
the implication that the reproducible staining patterns
Figure 8-6 Reproducible staining patterns on chromosomes
occur as a result of dened regional ultrastructures of the
are used for identication and site location. Heterochromatin
mitotic chromosomes. stains darkly by G or Q banding (left); euchromatin stains
When chromosomes are stained with the uorescent darkly by R banding (center); C banding stains centromeres
dyes quinacrine and quinacrine mustard, the resulting u- (right).
orescence pattern visualized after staining is called Q
banding (Fig. 8-6). This method was rst demonstrated
in 1970 by Caspersson, Zech, and Johansson.6 The results for analyzing chromosomes.8,9 G bands can also be pro-
of this work conrmed that each human chromosome duced by Feulgen staining after treatment with DNase
could be identied by its characteristic banding pattern. I.10 The number of visualized bands can be increased
Q banding gives a particularly intense staining of the from about 300 to about 500 per chromosome by staining
human Y chromosome and thus may also be used to dis- chromosomes before they reach maximal metaphase con-
tinguish the Y chromosome in interphase nuclei. Because densation. This is called high-resolution banding.
Q banding requires a uorescent microscope, it is not as Harsher treatment of chromosomes (87C for 10 min-
widely used as other stains that are detectable by light utes, then cooling to 70C) before Giemsa staining will
microscopy. produce a pattern opposite to the G banding pattern
The chemical dye Giemsa stains in patterns, or G called R banding.11 R bands can also be visualized after
bands, similar to those seen in Q banding. The appear- staining with acridine orange.12
ance of G banding differs, depending on the treatment of Alkali treatment of chromosomes results in cen-
the chromosomes before staining.7 Mild treatment (2 tromere staining, or C banding.13 Centromere staining is
standard saline citrate for 60 minutes at 60C) yields the absent in G band patterns. C bands may be associated
region-specic banding pattern comparable to that seen with heterochromatin, the quiet, or poorly, transcribed
with uorescent dyes. Use of trypsin or other proteolytic sequences along the chromosome that are also present
agents to extract or denature proteins before Giemsa around centromeres. In contrast, euchromatin, which is
staining was found to map structural aberrations more relatively rich in gene activity, may not be stained as
clearly and is the most commonly used staining method much as heterochromatin in C banding.

Chromosome 17
Advanced Concepts Arm Region Band Subband
The correlation between heterochromatin and stain-

3
ing may also hold for noncentromeric G and Q 2
bands. This association is complicated, however, 2 1
2 2
because a variety of procedures and stains produce 1
1
identical banding patterns. The correlation of stain- p 5
ing with heterochromatin is contradicted by obser- 1 4
1 3
vations of the X chromosome. Although one X 2
chromosome is inactive and replicates later than the 1
active X in females, both X chromosomes stain with
1
equal pattern and intensity. Staining differences, 2 17q11.2
therefore, must be due to other factors. Possible 1
1 3
explanations for differential interactions with dye
1
include differences in DNA compaction, sequences, 2 2
q 3
and DNA-associated nonhistone proteins. 1
3 2, 3
4
1
2
2
Nucleolar organizing region staining (NOR staining) 4 3
is another region-specic staining approach. Chromo-
somes treated with silver nitrate will stain specically at
the constricted regions, or stalks, on the acrocentric chro- Figure 8-7 Identication of chromosomal location by G-
mosomes. band patterns. Locations are designated by the chromosome
Staining of chromosomes with 4,6-diamidino-2- number 17 in this example, the arm q, the region 1, the band
phenylindole (DAPI) was rst described in 1976 as a 1 and the sub-band 2.
way to detect mycoplasmal contamination in cell cul-

tures.14 DAPI binds to the surface grooves of double-
stranded DNA and uoresces blue under ultraviolet light For this purpose, the reproducible G-banding pattern has
(353-nm wavelength). DAPI can be used to visualize been ordered into regions, comprising bands and sub-
chromosomes as well as whole nuclei. bands. For example, in Figure 8-7 a site on the long arm
Chromosome banding facilitates detection of small (q) of chromosome 17 is located in region 1, band 1, sub-
deletions, insertions, inversions, and other abnormalities band 2, or 17q11.2.
and the identication of distinct chromosomal locations.
Detection Of Genome And
Chromosomal Mutations
Advanced Concepts Karyotyping
Chromosomes can be prestained with the DNA- Genome mutations, or aneuploidy, can be detected by in-
binding oligopeptide distamycin A to enhance chro- direct methods, such as ow cytometry and more directly
mosomal distinctions.30,31 DAPI/distamycin A by karyotyping. A karyotype is the complete set of chro-
staining is useful in identifying pericentromeric mosomes in a cell. Karyotyping is the direct observation
breakpoints in chromosomal rearrangements and of metaphase chromosome structure by arranging meta-
other rearrangements or chromosomes that are too phase chromosomes according to size. Karyotyping re-
small for standard banding techniques. quires collecting living cells and growing them in culture
in the laboratory for 4872 hours. Cell division is stimu-

Figure 8-8 A normal male karyotype. There are 22 sets of autosomes, one inherited from each
parent, and one pair of sex chromosomes, XY. This karyotype is designated 46, XY.
lated by addition of a mitogen, usually phytohemagglu-

tinin. Dividing cells are then arrested in metaphase with
colcemid, an inhibitor of microtubule (mitotic spindle)
formation. The chromosomes in dividing cells that arrest
in metaphase will yield a chromosome spread when the 1 2 3 4 5
cell nuclei are disrupted with hypotonic saline. The 23
pairs of chromosomes can then be assembled into an
organized display, or karyotype, according to their size
and centromere placement (Fig. 8-8). Aneuploidy can be
6 7 8 9 10 11 12
observed affecting several chromosomes15 (Fig. 8-9) or a
single chromosome (Fig. 8-10).
Karyotyping can also detect chromosomal mutations
such as translocations, which are the exchange of genetic 13 14 15 16 17 18
material between chromosomes. Translocations can be of
several types. In reciprocal translocations, parts of two
chromosomes exchange, i.e., each chromosome breaks,
and the broken chromosomes reassociate or recombine 19 20 21 22 X
with one another. When this type of translocation does not Figure 8-9 Aneuploidy involving multiple chromosomes.
result in gain or loss of chromosomal material, it is bal- Chromosomes 5 and 12 are triploid; chromosomes 6, 9, and
anced (Fig. 8-11, Fig. 8-12). Balanced translocations can 16 are monoploid.

Figure 8-10 Aneuploidy involving

the Y chromosome (XYY syndrome).
This is designated 47,XYY.
occur, therefore, without phenotypic effects. Balanced

translocations in germ cells (cells that give rise to eggs or
sperm) can, however, become unbalanced by not assort-
ing properly during meiosis; as a result, they affect the The rst chromosome mutations were visualized in
phenotype of offspring. A robertsonian translocation the 1960s in leukemia cells. Peter Nowell and col-
involves the movement of most of one entire chromosome league David Hungerford observed an abnormally
to the centromere of another chromosome (Fig. 8-13). small chromosome 22 in leukemia cells, which they
This type of translocation can also become unbalanced labeled the Philadelphia chromosome. A few
during reproduction, resulting in a net gain or loss of years later, Janet Rowley, using chromosome band-
chromosomal material in the offspring. ing, noted that tumor cells not only lost genetic
Other types of chromosome mutations that are some- material, they exchanged it. In 1972 she rst
times visible by karyotyping are shown in Figure 8-14. A described the translocation between chromosomes 8
deletion is a loss of chromosomal material. Large dele- and 21, t(8;21) in patients with acute myeloblastic
tions covering millions of base pairs can be detected leukemia. In that same year, she demonstrated that
using karyotyping; smaller microdeletions are not the Philadelphia chromosome was the result of a
always easily seen using this technique. An insertion is a reciprocal exchange between chromosome 9 and
gain of chromosomal material. The inserted sequences chromosome 22. She went on to identify additional
can arise from duplication of particular regions within the reciprocal translocations in other diseases, the
affected chromosome or from fragments of other chro- t(14;18) translocation in follicular lymphoma and
mosomes. As with deletions, altered banding patterns and the t(15;17) translocation in acute promyelocytic
a change in the size of the chromosomes can indicate the leukemia. This was the rst evidence that cancer had
occurrence of this event. Inversions result from excision, a genetic basis.
ipping, and reconnecting chromosomal material within

Figure 8-13 A robertsonian translocation.

Figure 8-11 A balanced reciprocal translocation.
Figure 8-12 A karyotype showing

a balanced reciprocal translocation
between chromosomes 5 and 13. This
is designated 46, XX,t(5;13).

Translocation Deletion Inversion
Figure 8-14 Chromosome mutations Ring Derivative

involving alterations in chromosome structure. Isochromosome Insertion chromosome chromosome
the same chromosome. Pericentric inversions include and 17 and region 13, band 3, and region 13, respectively.
the centromere in the inverted region, whereas paracen- 47,XX21 is the karyotype of a female with Downs syn-
tric inversions involve sequences within one arm of the drome resulting from an extra chromosome 21. Klinefel-
chromosome. An isochromosome is a metacentric chro- ters syndrome is caused by an extra X chromosome in
mosome that results from transverse splitting of the cen- males; for example, 47,XXY. Table 8.3 shows a list of
tromere during cell division. Transverse splitting causes some of the terms used in expressing karyotypes.
two long arms or two short arms to separate into daugh-
ter cells instead of normal chromosomes with one long
arm and one short arm. The arms of an isochromosome Table 8.3 A List of Descriptive Abbreviations
are, therefore, equal in length and genetically identical. A Abbreviation Indication
ring chromosome results from deletion of genetic
gain
regions from both ends of the chromosome and a joining
loss
of the ends to form a ring. A derivative chromosome is
del deletion
an abnormal chromosome consisting of translocated or
der derivative chromosome
otherwise rearranged parts from two or more unidentied
dup duplication
chromosomes joined to a normal chromosome.
ins insertion
Results of karyotyping analyses are expressed as the
inv inversion
number of chromosomes/nucleus (normal is 46), the sex
I, iso isochromosome
chromosomes (normal is XX or XY), followed by any
mat maternal origin
genetic abnormalities observed. A normal karyotype is
pat paternal origin
46, XX in a female or 46, XY in a male. 46,XX,del(7)
r ring chromosome
(q13) denotes a deletion in the long arm q of chromosome
t translocation
7 at region 13. 46,XY,t(5;17)(p13.3;p13) denotes a
tel telomere (end of chromosome arm)
translocation between the short arms of chromosomes 5

Fluorescence In Situ Hybridization Cell nucleus
Interphase FISH Probes

Fluorescence in situ hybridization (FISH) is a widely
used method to detect protein, RNA as well as DNA
structures in place in the cell or in situ. For cytogenetic
analysis, xed cells are exposed to a probe. The probe is
a 60-200kb fragment of DNA attached covalently to a
uorescent molecule. The probe will hybridize or bind to
its complementary sequences in the cellular DNA. In
interphase FISH, the bound probe can be visualized
under a uorescent microscope in the nucleus of the cell.
Probes are designed to be specic to a particular chro-
mosome or chromosomal regions so that the image under
the microscope will correlate with the state of that chro- Translocated
chromosome
mosome or region. For example, a probe to any unique
region on chromosome 22 should yield an image of two
signals per nucleus, reecting the two copies of chromo-
some 22 in the somatic cell nucleus (Fig. 8-15). A dele-
tion or duplication of the region that is hybridized to the
probe will result in a nucleus with only one signal or
more than two signals, respectively. Multiple probes Reciprocal
translocation
spanning large regions are used to detect regional dele-
Translocated product
tions.16,17 One advantage of interphase FISH is that
chromosome
growth of cells in culture is not required. FISH methods
Figure 8-16 FISH analysis using distinct probes to detect
are, therefore, used commonly to study prenatal samples, a translocation. A normal nucleus has two signals from
tumors, and hematological malignancies, not all of which each probe (top). A translocation involving the two chro-
are conveniently brought into metaphase in culture. mosomes combines the two probe colors (middle). Dual-
Translocations or other rearrangements can be detected fusion probes conrm the presence of the translocation
by also giving a signal from the reciprocal breakpoint
using probes of different colors complementary to regions
(bottom).
on each chromosome taking part in the translocation (Fig.
8-16). A translocated chromosome will combine the two
probe colors with a loss of one of each signal. Analysis of translocation signals is sometimes complicated by false
signals that result from two chromosomes landing close
Probes hybridized to one another in the nucleus, such that the bound probes
Cell nucleus to chromosomes give a signal similar to that exhibited by a translocation.
These false signals can often be distinguished from true
translocations by the size of the uorescent image, but
this distinction requires a trained eye. Accounting for
false-positive signals as background noise limits the sen-
sitivity of this assay.
The sensitivity of interphase FISH analysis can be
Normal cell (diploid) Triploid Deletion increased using dual color probes, or dual fusion probes.
Figure 8-15 FISH analysis for a normal diploid cell (left), These probes, 0.81.5 Mb in size, are designed to bind to
triploidy (center), and deletion (right). regions spanning the breakpoint of both translocation

Breakpoint translocation. This combination of CEP and dual color

probes comprises a tricolor probe. For example, the
IGH/MYC CEP 8 Tri-color Dual Fusion Translocation
Probe (Vysis) is a mixture of a 1.5-Mblabeled probe,
Probes complementary to the immunoglobulin heavy chain
region (IGH) of chromosome 14, an approximately 750-
kb distinctly labeled probe complementary to the myc
gene on chromosome 8 and a CEP to chromosome 8. The
IGH probe contains sequences homologous to the entire
IGH locus as well as sequences extending about 300 kb
beyond the 3 end of the IGH locus. The myc probe
extends approximately 400 kb upstream and about 350
kb 3 beyond the myc gene. CEP 8 targets chromosome 8
Normal Translocation alpha satellite sequences and serves as a control to detect
Figure 8-17 Break-apart probes bind to the chromosome amplication of myc or loss of the chromosome 8 deriv-
anking the translocation breakpoint region. Normal cells will ative resulting from the translocation.
display the combination signal (bottom left), and a transloca-
tion will separate the probe signals (bottom right).
Each chromosome arm has a unique set of repeat
sequences located just before the end of the chromosome,
called the telomere (Fig. 8-18). These sequences have
partners. A translocation will be observed as a signal been studied for the development of a set of DNA probes
from both the translocation junction and the reciprocal of specic to the telomeres of all human chromosomes.
the translocation junction; e.g., t(9;22) and t(22;9); see Telomeric probes are useful for the detection of chro-
Fig. 8-16. Dual color break-apart probes, 0.61.5 Mb, mosome structural abnormalities such as cryptic translo-
are another approach to lower background as well as to cations or small deletions that are not easily visualized by
identify translocation events where one chromosome can standard karyotyping.
recombine with multiple potential partners. These probes Because interphase cells for FISH do not require cul-
are designed to bind to the intact chromosome anking turing of the cells and stimulating division to get
the translocation breakpoint. When a translocation metaphase spreads, as is required for standard karyotyp-
occurs, the two probes separate (Fig. 8-17). Sometimes ing, interphase FISH is faster than methods using
called tri-FISH, break-apart probes are not the same as metaphase cells and is valuable for analysis of cells that
tricolor probes (see below). do not divide well in culture, including xed cells.18,19
Centromeric probes (CEPs) are designed to hybridize Furthermore, as 200500 cells can be analyzed micro-
to highly repetitive alpha satellite sequences surrounding scopically using FISH, the sensitivity of detection is
centromeres. These probes detect aneuploidy of any higher than that of metaphase procedures, which com-
chromosome. Combinations of centromeric probes and monly examine 20 spreads. A limitation of FISH, how-
region-specic probes are often used to conrm deletions ever, is the inability to identify chromosomal changes
or amplications in specic chromosomes. Addition of a other than those at the specic binding region of the
CEP to dual color probes serves as a control for ampli- probe. In contrast, karyotyping is a more generic method
cation or loss of one of the chromosomes involved in the that can detect any chromosomal change that causes
Probe binding site Telomere
Figure 8-18 The binding sites for telomeric probes 100-200 kb 3-20 kb
are unique sequences just next to the telomeric Unique sequences Telomere
associated repeats and telomeric repeat sequences associated repeats
at the ends of chromosomes. (TTAGGG)n

changes in chromosomal size, number, or banding pat- must be visible, crowded cells where the nuclei and sig-
tern within the sensitivity limits of the procedure. nals overlap do not yield accurate results. Furthermore,
Preparation of the sample is critical in interphase FISH different tissue types have different image qualities and
analysis, both to permeabilize the cells for optimal probe- characteristics that must also be taken into account when
target interaction and to maintain cell morphology.20 assessing the FISH image.
Optimal results are obtained if fresh interphase cells are
incubated overnight (aging) after deposition on slides. Metaphase FISH
After aging overnight, cells are treated with protease to Metaphase analysis has been enhanced by the develop-
minimize interference from cytoplasmic proteins and ment of uorescent probes that bind to metaphase chro-
xed with 1% formaldehyde to stabilize the nuclear mosomal regions or to whole chromosomes. Probes that
morphology. Before DNA denaturation, the cells are cover the entire chromosome, or whole chromosome
dehydrated in graded concentrations of ethanol. Paraffin- paints, are valuable for detecting small rearrangements
embedded tissues must be dewaxed in xylene before pro- that are not apparent by regular chromosome banding
tease and formaldehyde treatment. (Fig. 8-19). By mixing combinations of ve uors and
The quality of the probe should also be checked and its using special imaging software, spectral karyotyping
performance validated before use. Fluorescent probes can distinguish all 23 chromosomes by chromosome-
(DNA with covalently attached uorescent dyes) are usu- specic colors.21 This type of analysis can be used to
ally purchased from vendors, which may also supply detect abnormalities that affect multiple chromosomes as
compatible hybridization reagents and controls. Never- is sometimes found in cancer cells or immortalized cell
theless, it is recommended that the probe performance be lines.22-24 Telomeric and centromeric probes are also
observed on control tissue before use on patient samples. applied to metaphase chromosomes (Fig. 8-20) to detect
Under a uorescent microscope with the appropriate aneuploidy and structural abnormalities.
color distinction lters, the signal from the probe should Preparation of chromosomes for metaphase FISH pro-
be bright, specic to the target in the cell nuclei, and free cedures begins with the culture of cells for 72 hours.
of high background. Probes differ in their signal charac- About 45 minutes before harvesting, colcemid is added
teristics and intensities; the technologist should become
familiar with what to expect from a given probe on dif-
ferent types of tissues.
Similar to Southern and Northern blotting procedures,
both probe and target must be denatured prior to hy-
bridization. The amount of time taken to hybridize and
use Cot-1 DNA (to reduce nonspecic binding) or facili-
tators such as dextran sulfate (to increase the effective
probe concentration) depend on the sequence complexity
of the probe (see Chapter 6). A probe 10 ng1 g may be
used in a hybridization volume of 3-10 L. The hybri-
dization of the probe on the target cells should be per-
formed at 37-42C in a humidied chamber. The slides
are cover-slipped and sealed to optimize the hybridization
conditions.
Following hybridization and the removal of unbound
probe by rinsing in Coplin jars, the sample is observed Figure 8-19 Chromosome painting showing a derivative
microscopically. The probe signals should be visible from chromosome formed by movement of a fragment of chromo-
entire intact nuclei. Although adequate numbers of cells some 12 (black) to an unidentied chromosome.

Normal reference DNA
Test sample DNA
Figure 8-21 In CGH, the test sample is compared with a

normal reference sample on a metaphase spread. Normally,
Centromeric probes Telomeric probes
test and reference signals are equal. A higher test signal
Figure 8-20 Centromeric (left) and telomeric (right) probes denotes an amplication, and a higher reference signal
on metaphase chromosomes. denotes a deletion.
to the cultures to arrest cells in metaphase. The cells are wavelength of 550 nm, is often represented as green,
then suspended in a hypotonic medium (0.075 M KCl) and Cy5, which uoresces in the far-red region of the
and xed with methanol/acetic acid (3:1). The xed-cell spectrum (650667 nm), is represented as red. Derivat-
suspension is applied to an inclined slide and allowed to ives of these dyes, such as Cy3.5, which uoresces in the
dry briey. A second treatment with 70% acetic acid may red-orange region, are also available. Because these dyes
improve the chromosome spreading and decrease back- uoresce brightly and are water-soluble, they have been
ground. Condensed chromosome spreads, especially used extensively for CGH using imaging equipment.
those from cultured metaphases, may be affected by tem- Labeling (attachment of Cy3 or Cy5 dye to the test and
perature and humidity. Under a phase contrast micro- reference DNA) is achieved by nick translation or primer
scope, the chromosomes should appear well separated extension in which nucleotides covalently attached to the
with sharp borders. Cytoplasm should not be visible. dye molecules are incorporated into the DNA sequences.
Once the slide is dried, hybridization proceeds as dis- Dye-nucleotides commonly used for this type of labeling
cussed above for interphase FISH. are 5-amino-propargyl-2-deoxycytidine 5-triphosphate
Intrachromosomal amplications or deletions can be coupled to the Cy3 or Cy5 uorescent dye (Cy3-AP3-
detected by comparative genome hybridization dCTP, Cy5-AP3-dCTP) or 5-amino-propargyl-2-
(CGH).25,26 In this method, DNA from test and reference deoxyuridine 5-triphosphate coupled to the Cy3 or Cy5
samples is labeled and used as a probe on a normal uorescent dye (Cy3-AP3-dUTP, Cy5-AP3-dUTP). DNA
metaphase chromosome spread (Fig. 8-21). CGH has the to be tested is partially digested with DNase to produce
advantage of being able to identify the location of dele- fragments that will bind efficiently to the denatured DNA
tions or amplications throughout the genome.27 The resin a metaphase chromosome spread. Separate aliquots of
olution (precise identication of the amplied or deleted test and reference DNA are labeled with different Cy3
region), however, is not as high as can be achieved with and Cy5 dyes, respectively, before application to a normal
array CGH (see Chapter 6). metaphase spread. An example of results from a CGH
For CGH, the test DNA is isolated and labeled along analysis is shown in Figure 8-22. Despite its utility and
with a reference DNA. Cyanine dyes are used as uores- versatility in detecting chromosomal abnormalities, CGH
cent labels for test and reference DNA for CGH. The two does require advanced technical expertise. Array CGH is
colorimetrically distinct dyes, Cy3 and Cy5, are com- less comprehensive, but more specic, for detection of
monly used for this purpose. Cy3, which uoresces at a particular abnormalities.
MPE 600 immortalized female

cancer cell line
Figure 8-22 CGH analysis of four chromosomes from a cancer cell line. Amplied or deleted
areas can be observed where the test and reference signals are not equal. The vertical lines on
the diagram at right represent results from six different chromosomal spreads analyzed for excess
reference signal (left of idiogram) or test signal (right of idiogram).
170

cells when stained with this probe. These results

STUDY QUESTIONS would be interpreted as consistent with:
a. a normal karyotype
1. During interphase FISH analysis of a normal specimen b. Downs syndrome
for the t(9;22) translocation, one nucleus was observed c. Klinefelters syndrome
with two normal signals (one red for chromosome 22 d. technical error
and one green for chromosome 9) and one composite
red/green signal. Five hundred other nuclei were nor- 8. Cells were harvested from a patients blood, cultured
mal. What is one explanation for this observation? to obtain chromosomes in metaphase, xed onto a
slide, treated with trypsin, and then stained with
2. Is 47; XYY a normal karyotype? Giemsa. The resulting banding pattern is called:
a. G banding
3. What are the genetic abnormalities of the following b. Q banding
genotypes? c. R banding
47, XY, 18 d. C banding
46, XY, del(16)p(14)
iso(X)(q10) References
46,XX del(22)q(11.2) 1. Murray A. How to compact DNA. Science 1998;
45, X 282:425-27.
2. Black B, Foltz DR, Chakravarthy S, et al. Structural
4. A chromosome with a centromere not located in the
determinants for generating centromeric chromatin.
middle of the chromosome but not completely at the
Nature 2004;430(6999):578-82.
end, where one arm of the chromosome is longer than
3. Richmond TJ. The structure of DNA in the nucleo-
the other arm, is called:
some core. Nature 2003;423(6936):145-50.
a. metacentric
4. Porter I, Khoudoli GA, Swedlow JR. Chromosome
b. acrocentric
condensation: DNA compaction in real time.
c. paracentric
Current Biology 2004;14(14):R554-R56.
d. telocentric
5. Waye J, Willard HF. Chromosome-specic alpha
5. A small portion of chromosome 2 has been found on satellite DNA: Nucleotide sequence analysis of
the end of chromosome 15, and a small portion of the 2.0 kilobase pair repeat from the human X
chromosome 15 has been found on the end of chro- chromosome. Nucleic Acids Research 1985;13
mosome 2. This mutation is called a: (8):2731-43.
a. reciprocal translocation 6. Caspersson T, Zech L, Johansson C. Differential
b. inversion banding of alkylating uorochromes in human chro-
c. deletion mosomes. Experimental Cell Research 1970;60:
d. robertsonian translocation 315-19.
7. Lewin B. Gene Expression 2, vol. 2. Cambridge,
6. Phytohemagglutinin is added to a cell culture when MA: John Wiley & Sons, 1980.
preparing cells for karyotyping. The function of the 8. Seabright M. A rapid banding technique for human
phytohemagglutinin is to: chromosomes. Lancet 1971;2:971-72.
a. arrest the cell in metaphase 9. Seabright M. The use of proteolytic enzymes for
b. spread out the chromosomes the mapping of structural rearrangements in the
c. x the chromosomes on the slide chromosomes of man. Chromosoma 1972;36:
d. stimulate mitosis in the cells 204-10.
10. Burkholder G, Weaver M. DNA protein interac-
7. A CEP probe is use to visualize chromosome 21. tions and chromosome binding. Experimental Cell
Three uorescent signals are observed in the patients Research 1977;110:251-62.

11. Dutrillaux B, Lejeune, J. Sur une nouvelle technique 22. Kakazu N, Abe T. Cytogenetic analysis of chromo-
danalyse du caryotype human. Comptes Rendus de some abnormalities in human cancer using SKY.
lAcademie des Sciences Paris 1971;272:2638-40. Experimental Medicine 1998;16:1638-41.
12. Bobrow M, Madan, K. The effects of various band- 23. Liang J, Ning Y, Wang R, et al. Spectral karyotypic
ing procedures on human chromosomes studied study of the HL-60 cell line: detection of complex
with acridine orange. Cytogenetics and Cell Gene- rearrangements involving chromosomes 5, 7, and
tics 1973;12:145-56. 16 and delineation of critical region of deletion on
13. Arrighi F, Hsu TC. Localization of heterochromatin 5q31.1. Cancer Genetics and Cytogenetics
in human chromosomes. Cytogenetics 1971;10: 1999;113:105-109.
81-86. 24. Mehra S, Messner H, Minden M, et al. Molecular
14. Jagielski M, Zaleska M, Kaluzewski S, et al. cytogenetic characterization of non-Hodgkin lym-
Applicability of DAPI for the detection of phoma cell lines. Genes Chromosomes and Cancer
mycoplasms in cell cultures. Medycyna dojwiad- 2002;33(3):225-34.
czalna i mikrobiologia 1976;28(2):161-73. 25. Lapierre J, Cacheux V, Da Silva F, et al. Compara-
15. Grimm D. Genetics: Disease backs cancer origin tive genomic hybridization: Technical development
theory. Science 2004;306(5695):389. and cytogenetic aspects for routine use in clinical
16. Juliusson G, Oscier DG, Fitchett M. Prognostic laboratories. Ann Genet 1998;41(1):56-62.
subgroups in B-cell chronic lymphocytic leukemia 26. Wienberg J, Stanyon R. Comparative painting of
dened by specic chromosomal abnormalities. mammalian chromosomes. Current Opinion in
New England Journal of Medicine 1990;323: Genetics and Development 1997;7(6):784-91.
720-24. 27. Kytola S, Rummukainen J, Nordgren A, et al.
17. John S, Erming T, Jeffrey S, et al. High incidence Chromosomal alterations in 15 breast cancer cell
of chromosome 13 deletion in multiple myeloma lines by comparative genomic hybridization and
detected by multiprobe interphase FISH. Blood spectral karyotyping. Genes, Chromosomes and
2000;96(4):1505-11. Cancer 2000;28:308-17.
18. Gellrich S, Ventura R, Jones M, et al. Immunouo- 28. Gassmann R, Vagnarelli P, Hudson D, et al. Mitotic
rescent and FISH analysis of skin biopsies. chromosome formation and the condensin paradox.
American Journal of Dermatopathology 2004;26 Experimental Cell Research 2004;296(1):35-42.
(3):242-47. 29. Hirano T, Mitchison TJ. A heterodimeric coiled-coil
19. Cook J. Paraffin section interphase uorescence in protein required for mitotic chromosome condensa-
situ hybridization in the diagnosis and classication tion in vitro. Cell 1994;79(3):449-58.
of non-Hodgkin lymphomas. Diagnostic Molecular 30. Schweizer D, Ambros P, Anderle M. Modication
Pathology 2004;13(4):197-206. of DAPI banding on human chromosomes by pre-
20. Van Stedum S, King W. Basic FISH techniques and staining with a DNA-binding oligopeptide antibi-
troubleshooting. Methods in Molecular Biology otic, distamycin A. Experimental Cell Research
2002;204:51-63. 1978;111:327-32.
21. Macville M, Veldman T, Padilla-Nash H, et al. 31. Gustashaw K. Chromosome stains. In MJ B, ed.
Spectral karyotyping, a 24-colour FISH technique The ACT Cytogenetics Laboratory Manual, 2nd ed.
for the identication of chromosomal rearrange- New York: Raven Press, Ltd., 1991.
ments. Histochemical Cell Biology 1997;108 32. Berger S. The histone modication circus. Science
(4-5):299-305. 2001;292:64-65.
Gene Mutations
OUTLINE OBJECTIVES
TYPES OF GENE MUTATIONS Compare phenotypic consequences of different types of
DETECTION OF GENE MUTATIONS point mutations.
Hybridization-Based Methods Distinguish detection of known mutations from scanning
Sequencing (Polymerization)-Based
for unknown mutations.
Methods
Cleavage Methods Discuss methods used to detect point mutations.
Other Methods Determine which detection methods are appropriate for
GENE MUTATION NOMENCLATURE screening of new mutations or detection of previously
identied mutations.
Describe mutation nomenclature for expressing sequence
changes at the DNA, RNA, and protein levels.
173

Gene mutations include deletions, insertions, inversions,

Table 9.1 Types of Point Mutations
translocations, and other changes that can affect one base
pair to hundreds or thousands of base pairs. Large differ- DNA Amino Acid Type of
Sequence Sequence Mutation
ences in DNA sequence will likely have a signicant
effect on protein sequence. Alterations of a single or a ATG CAG GTG
few base pairs, or point mutations, will have a range of ACC TCA GTG M Q V T S V None
effects on protein sequence. Refer to the genetic code in ATG CAG GTT
Chapter 3, Figure 3-7, to see how a difference of one or ACC TCA GTG M Q V T S V Silent
a few base pairs may or may not change the amino acid ATG CAA GTG
designation. ACC TCA GTG M Q L T S V Conservative
ATG CCG GTG
Types of Gene Mutations ACC TCA GTG M P V T S V Nonconservative
ATG CAG GTG
Because there is more than one codon for most of the ACC TGA GTG M Q V T ter Nonsense
amino acids, DNA sequence changes do not necessarily ATG CAG GTG
change amino acid sequence. This is an important concept AAC CTC AGT G M Q V N L S Frameshift
for interpreting results of mutation analyses. Substitution
of one nucleotide with a different nucleotide may be
silent; that is, without changing the amino acid sequence codon appears sooner in the out-of-frame coding se-
(Table 9.1). Conservative substitutions may change the quence than it would in a nonmutated reading frame.
amino acid sequence, but the replacement and the original Nonconservative, nonsense, and frameshift mutations
amino acid have similar biochemical properties, e.g., generate a range of phenotypes, depending on where they
leucine for valine, and the change will not affect protein occur along the protein sequence. Point mutations in the
function signicantly. In contrast, a nonconservative end of a coding region may have minimal consequences,
mutation is the substitution of a biochemically different whereas mutations at the beginning of a coding sequence
amino acid, e.g., proline for glutamine, which changes the are more likely to result in drastic alterations or even
biochemical nature of the protein. A nonsense mutation effective deletion of the protein coding region.
terminates proteins prematurely when a nucleotide substi- These factors are important when interpreting results
tution produces a stop codon instead of an amino acid of mutation analyses. Merely finding a difference
codon. Insertion or deletion of more or fewer than three between a test DNA sequence and a reference sequence
nucleotides results in a frameshift mutation, throwing the does not guarantee an altered phenotype. Some screening
triplet code out of frame. The amino acids in the chain methods designed to detect point mutations over large
after the frameshift mutation are affected, as the triplet sequence regions do not determine the specic sequence
code will include new combinations of three nucleotides. alterations and, therefore, cannot distinguish among
The genetic code is structured such that frameshifts often silent, conservative, and nonconservative changes. The
terminate protein synthesis prematurely because a stop specic type of mutation may be ascertained from a fam-
ily history or determination of the specic sequence
change with a second conrmatory test.
Advanced Concepts
The nature of the genetic code is such that
Detection of Gene Mutations
frameshift mutations lead to a termination codon Some, mostly inherited, disease-associated sequence
within a small number of codons. This characteris- changes in DNA occur frequently, e.g., for the factor V
tic might have evolved to protect cells from making Leiden mutation and the hemochromatosis C282Y,
long nonsense proteins. H63D, and S65C mutations. Also, increasing numbers of
specic single nucleotide polymorphisms (SNPs, see

Gene Mutations Chapter 9 175
Chapter 10) are being mapped close to disease genes. gle base pair changes to large chromosomal rearrange-
These changes, although outside of the disease gene, are ments without having to determine the primary DNA
detected as specic sequence changes frequently inher- sequence. Some of these methods are described below.
ited along with the disease phenotype. Sequence detection methods can be generally classied
Some diseases are associated with many mutations according to three broad approaches: hybridization-
in a single gene. For instance, there are more than 600 based methods, sequence (polymerization)-based meth-
disease-associated mutations in the cystic brosis trans- ods, and enzymatic or chemical cleavage methods. Brief
membrane regulator (CFTR) gene, and more than 2000 descriptions of representative methods are presented in
cancer susceptibility mutations have been reported in the the following sections. The methods selected are currently
BRCA1 and BRCA2 genes. Furthermore, unknown num- used or proposed for use in clinical applications. A sum-
bers of gene mutations are yet to be discovered. Detec- mary of the methods discussed is shown in Table 9.2.
tion of mutations in large genes requires screening across
thousands of base pairs to detect a single altered nucleo-
Hybridization-Based Methods
tide. To date, other than sequencing, there is no genome-
wide scanning procedure that can identify yet unreported Single-Strand Conformation Polymorphism
mutations.1 Single-strand conformation polymorphism (SSCP)24 is
In molecular diagnostics, mutation detection is per- one of the more frequently used mutation screening pro-
formed on a variety of specimen types. Inherited muta- cedures in the clinical laboratory. The method is based on
tions are detected from the most convenient and the preference of DNA (as well as RNA) to exist in a
noninvasive specimen material, such as blood or buccal double-stranded, rather than single-stranded, state. In the
cells. Somatic mutations are often more challenging to absence of a complementary strand, nucleic acids form
nd because cells harboring mutations may be only a intrastrand duplexes to attain as much of a double-
small fraction of the total specimen that consists of stranded condition as possible. Each folded strand forms
mostly normal cells. Under these circumstances, detec- a three-dimensional structure, or conformer, the shape of
tion procedures must identify a single mutated gene from which is determined by the primary sequence of the
among thousands of normal genes. Polymerase chain folded strand.
reaction (PCR) amplication, which is part of many pro- SSCP is determined by the migration of the single-
cedures, has simplied mutation detection, especially stranded conformers in polyacrylamide gels under pre-
from limiting specimens. The use of PCR or other ampli- cisely controlled denaturing and temperature conditions.
cation methods to facilitate mutation detection must be For SSCP, dilute concentrations of short, double-stranded
performed under conditions that minimize the introduc- PCR products, optimally 100400 base pairs (bp) long,
tion of mutations in the course of amplication. are denatured (e.g., in 1020 mM NaOH, 80% formamide
Interpretation of the results of mutation analyses is for 5 minutes at 95C; or 1020 mM NaOH, 0.004 mM
also challenging. Mutation scanning by methods that do EDTA, 10% formamide for 5 minutes at 5560C) fol-
not indicate the primary sequence change do not differ- lowed by rapid cooling. Because the diluted single
entiate between silent, conservative, and nonconservative strands cannot easily nd their homologous partners
mutations. The actual effect on phenotype is left to post- under the concentration, buffer conditions, and tempera-
test interpretation of supporting clinical data and patient tures used, they fold by intrastrand hybridization, forming
family history. Mutations discovered through this type of three-dimensional conformers. The shape of the con-
scanning can be subjected to sequence analysis to conformer depends on the complementary nucleotides avail-
rm and further characterize the mutated region. able for hydrogen bonding and folding. A single bp
Although DNA sequencing is the most denitive difference in the DNA sequence can cause the conformer
method for detecting mutations (see Chapter 10), to fold differently. These conformers are resolved in a
sequencing may not be appropriate, especially for high polyacrylamide gel or by capillary electrophoresis with
throughput procedures. A number of techniques have temperature control.5 The speed of migration depends on
been designed for detection of DNA mutations from sin- the shape as well as the size of the conformer. Differences

Table 9.2 Summary of Mutation Detection Methodologies

Laboratory
Method* Target (bp) Accuracy (%) Specicity (%) Sensitivity|| (%) Application Reference#
Sequencing 1000 100 100 1020 C, R Chapter 9
SSCP 50400 70100 80100 520 C, R 125, 126
DGGE 200500 95100 90100 115 R 127, 128
TTGE 2001000 95100 90100 110 R 129, 130
ASO Dened 100 90100 520 C, R 33, 131
HR-MCA Dened 95100 95100 15 C, R 39, 41, 132
MIP Dened, 100 95100 R 46
multiplex
HA, 501000 95100 85100 520 C, R 50, 54, 55, 57,
DHPLC 133138
Array Dened, 95100 80100 15 C, R 57, 59, 138
Technology multiplex
SSP Dened 98100 95100 0.0005 C, R 74, 139
ddF 40600 85100 70100 115 R 7677
Allelic Dened 95100 90100 0.0001 C,R 40, 68, 69
discrimination
Dye Dened 98100 95100 510 R 81, 83, 140
terminator
PTT 5002500 95100 85100 1020 R 93, 141
PCR-RFLP Dened 100 100 0.011 C, R 97
BESS 200600 R 102, 142
NIRCA 5001000 8590 8090 510 R 103, 143, 144
Invader Dened, 100 95100 C, R 112, 145
multiplex
CCM 4030,000 85100 0.011 R 1
*See text. Data are from methods done under optimal conditions.
Optimal length of sequence that can be screened accurately; dened methods target a single nucleotide or site; multiplex methods target multiple dened
types in the same reaction.
Concordance with direct sequencing or other assays reported in the references.
True positive detection of mutations without concurrent false-positive.
Detection of one mutant target in a background of normal targets.
C: Presently used in clinical applications; R: Research applications.

#Also see references in text.
in the shape of the conformers (kinks, loops, bubbles, and SSCP is reported to detect 35%100% of putative
tails) are caused by sequence differences in the DNA sin- mutations.6 The assay can be sensitive enough to detect
gle strand (Fig. 9-1). The band or peak patterns are mutations in samples containing as low as 5% potentially
detected by silver stain, radioactivity, or uorescence. To mutant cells,7 although specimens that are at least 30%
avoid renaturation of homologous partners, a low con- potentially mutant cells produce more reliable results.
centration of products after denaturation must be main- This requirement is satised in inherited mutations, as at
tained. As a consequence, less sensitive stains such as least 50% of cells of a specimen will potentially carry a
ethidium bromide are not often used for this assay. Band mutation. For somatic mutations, however, such as the
or peak patterns different from those of normal sequence analysis of tumor cells, the potentially mutant cells may
control conformers prepared simultaneously with the test be mixed with or surrounded by a vast majority of normal
conformers indicate the presence of mutations. cells or tissue. Consequently, a cell suspension that is at

(A) Normal DNA Mutated DNA SSCP).10 These latter methods, although more sensitive,
are more difficult to interpret and not in general use.
Denaturation
and dilution Denaturing Gradient Gel Electrophoresis
(B) Denaturing gradient gel electrophoresis (DGGE) ex-
ploits differences in denaturation between a normal and
mutated DNA molecule caused by even one nucleotide
difference in a sequence. The contribution of the attrac-
Electrophoresis
tion between successive bases on the same DNA strand
(stacking) can affect denaturation of double-stranded
(C) DNA.1113 For DGGE, double-stranded DNA fragments
Normal/ 200700 bp in length are prepared by PCR amplication
Normal Mutant mutant of test sequences or by restriction digestion. The frag-
ments are separated on polyacrylamide gels containing a
Normal gradient of concentrations of urea and formamide. A
100% denaturant solution is 7 M urea and 40% for-
Mutant mamide. Gradients range 15%90% denaturant, usually
with a 10%20% difference between the high denaturant
Gel electrophoresis Normal/ concentration at the bottom of the gel and the low denat-
mutant
urant concentration at the top of the gel for a given analy-
Capillary electrophoresis sis. Gradient gels can be prepared manually or with
Figure 9-1 Single-strand conformation polymorphism special equipment (gradient makers).
analysis. Double-stranded PCR products (A) of normal or As the double-stranded DNA fragment moves through
mutant sequences are denatured and form conformers the gel, the denaturing conditions increase, sequences
(B) through intrastrand hydrogen bonding. These confor-
mers can be resolved (C) by gel (left) or capillary (right)
reach their denaturing point, and the complementary
electrophoresis. strands begin to denature. Domains of the sequences with
different melt characteristics denature at different points
in the gradient. The formation of single-stranded areas of
least 30% tumor cells or a microdissection of solid tumor the denaturing duplex slows migration of the fragment
tissue from xed or frozen sections is recommended. through the gel matrix from the point of the initial denat-
For microdissection of tissue sections, deparaffinized uration. Even a one-nucleotide difference between two
slides are stained with a mixture of 0.125% toluidine blue DNA molecules results in the two molecules denaturing
and 0.008% methylene blue and are examined by micro- at different positions in the gel. The band of the mutated
scope. Areas containing tumor cells are identied based DNA shifts to a different position in the gel as compared
on morphology and selectively scraped from the slide or with the normal DNA band. Complete strand separation
removed by extraction systems such as Pinpoint (Zymo is prevented by naturally occurring or articially placed
Research). Laser capture microdissection instruments, GC-rich sequences (GC clamps). These can be conve-
capable of selecting and removing single cells, may also niently placed at the ends of PCR products by using
be used; however, most clinical laboratories do not have primers tailed on the 5 end with a 40 bp 5 GC tail.
access to these instruments. The material removed from Two gradient orientations are used in DGGE. The gra-
the sections is extracted at 50-55C in a lysis buffer of 10 dient can increase horizontally across the gel; that is,
mM Tris, 1.0 mM EDTA, 1 g/L proteinase K, or any perpendicularly to the direction of sample migration
of a number of lysis conditions that have been reported to (perpendicular DGGE), or the gradient can increase
produce lysates suitable for PCR. Because SSCP works vertically, parallel to the direction of sample migration
more accurately in some genes than others, modications (parallel DGGE; Fig. 9-2). In the former conguration,
of the SSCP procedure have been developed; for instance, a mixture of samples is loaded across the entire gel in a
using RNA instead of DNA (RNA-SSCP or rSSCP)8,9 or single well, and a sigmoid curve of migration is
using restriction endonuclease ngerprinting (REF- observed, corresponding to the denaturing characteristics

(A) (B)
Advanced Concepts
DGGE requires a signicant amount of preparatory 45%
Double
work to optimize conditions for detection of a par- strands
ticular gene mutation. Originally performed on
restriction fragments, PCR products are now used Single
for DGGE. Primers are chosen so that the region to strands
be screened for mutations has one or two discrete 15% 90% 60%
melting domains (excluding the GC clamp) because Figure 9-2 Schematic of perpendicular (A) DGGE and par-
more than two domains may give a complex pattern allel (B) DGGE.
that is hard to interpret. The GC clamp should be
positioned adjacent to the highest melting domain.
Design of the primers and the melt characteristics of as a Southern blot, any area of the genome can be probed
the resulting product require inspection of the for mutations.
sequence to be screened for mutations. The optimal Two methods that are similar in design to DGGE are
gradient and gel running conditions must also be constant gradient gel electrophoresis (CDGE18,19) and
established. Initially, sample sequences are sepa- temporal temperature gradient gel electrophoresis
rated on a wide gradient (2080% formamide) to (TTGE20,21).
nd the area where the sequence migrations are CDGE requires the initial determination of optimal
most distinct. This area will dene a narrower gra- denaturant concentrations for a particular target mutation.
dient (e.g. 3055% gradient) for use in the actual This can be ascertained by perpendicular DGGE or by
test. The gel running conditions must be strictly using computer programs designed to predict the melting
controlled for reproducible results. If either run time characteristics of a nucleotide sequence for a range of
or temperature, for instance, is not optimal, resolu- temperature and denaturing conditions. The sample is
tion of differing sequences may be lost. then run at the one optimal combination of denaturant
concentration and temperature. As parameters must be set
in this manner, CDGE is used for detecting known muta-
tions rather than for screening for unknown mutations.
CDGE has been extended to capillary electrophoresis
of the sequences. This type of gradient is used to estab- (constant denaturant capillary electrophoresis), which
lish the more dened gradient conditions used in parallel increases the speed and resolution of the separation.22
DGGE. For parallel DGGE, a smaller gradient is used; CDGE has been used to detect mutations in cancer
samples are loaded in single lanes and analyzed by lane genes.23
comparison. Because higher concentrations of DNA are TTGE is similar to CDGE in that specic concentra-
used for this assay, detection with ethidium bromide is tions of formamide and urea are used to denature DNA
sufficient to visualize the results of the electrophoresis. duplexes. In TTGE, unlike CDGE, differences in denatu-
Specic regions within large sequence areas may be visu- ration are resolved by slowly raising the temperature of
alized by blotting the bands in the DGGE gel to a nitro- the gel during migration, e.g., 6368C at 1.7C/h. This
cellulose membrane and probing for the specific
sequence (Southern blot). As with SSCP, DGGE gels are
analyzed for banding patterns in the test specimens that
differ from banding patterns of the control sequences.
DGGE has been used to detect tumor suppressor gene
Advanced Concepts
mutations,14 clonality,15 and population polymor- Compared with SSCP, DGGE has less sensitivity for
phisms.16 In genomic DGGE,17 in which restriction frag- detecting mutations in genes that are rich in GC con-
ments of genomic DNA rather than PCR products are tent.146
separated on a gradient gel and then blotted and probed

provides a wider range of denaturing conditions such that + probe m probe

fragments requiring different denaturant compositions by
CDGE can be resolved on a single gel by TTGE. This
technique has been used in cancer,24,25 genetic,26,27 and
industrial28,29 applications.
m/+ +/+ m/m m/+ +/+ m/m
Figure 9-3 Allele-specic oligomer hybridization. Three
Allele-Specic Oligomer Hybridization samples are spotted on two membranes. One membrane is
Allele-specic hybridization, or allele specic oligomer probed with a labeled oligomer of the normal sequence (
hybridization (ASO), utilizes the differences in melting probe, left) and the other with a labeled oligomer containing
temperatures of short sequences of ~20 bases with one or the mutation (m probe, right). A normal sample (/)
two mismatches and those with no mismatches. At spe- hybridizes with the normal oligomer only. A homozygous
mutant sample (m/m) hybridizes with the mutant oligomer
cic annealing temperatures and conditions (stringency), only. A heterozygous mutant sample (m/) hybridizes with
a single-stranded probe will not bind to a near comple- both oligomers.
mentary target sequence with one or two mismatched
bases, whereas a probe perfectly complementary to the
target sequence will bind. ASO is a dot blot method, sim- probe in order to increase binding specicity.32 Hybri-
ilar to Southern blot using immobilized target and labeled dization can take 212 hours. Following hybridization,
probe in solution. It has been used to test for known, fre- free probe is rinsed from the membrane, and probe signal
quently occurring mutations; for example, in the BRCA1 is detected over the spots containing sequences matching
and BRCA2 gene mutations frequently observed in inher- that of the probe (Fig. 9-4). This method has been used in
ited breast cancer30 and the p16 gene mutations in famil- clinical testing for detection of specic mutations and
ial melanoma.31 The procedure begins with amplication polymorphisms and for typing of organisms. ASO is also
of the gene region of interest by PCR. After the PCR routinely used in the clinical laboratory for tissue typing
product is spotted onto nitrocellulose or nylon mem- (sequence specic oligonucleotide probe hybridization;
branes, the membranes are soaked in a high salt NaOH see Chapter 15).
denaturation solution. The DNA on the membranes is ASO analysis can also be carried out as a reverse dot
neutralized with dilute acid and permanently affixed to blot in a 96 well plate format similar to capture probe
the membrane by baking or ultraviolet crosslinking. methods developed for infectious disease testing, e.g.,
Labeled probes matching the normal and mutated se- Chlamydia trachomatis (Amplicor CT/NG; Roche) and
quences are then hybridized to the membranes in separate Mycobacterium tuberculosis (Amplicor MTB; Roche).
reactions under specic stringency conditions (Fig. 9-3). For mutation analysis, mutant or normal probes are
Some protocols recommend addition of unlabeled probe immobilized on the membrane. The sequence to be tested
directed at the nontarget sequence to the labeled targeted is amplied by PCR with one regular and one biotinylated
1 2 m/+ +/+ N 1 2 m/+ +/+ N
+ probe m probe
Figure 9-4 Autoradiography results of an allele-specic oligomer hybridization using chemiluminescent
detection. One normal (1) sample and one heterozygous mutant (2) sample are shown with a heterozy-
gous mutant control (m/), a normal control (), and a negative control (N).

primer. The biotinylated products are then exposed to the

%S Homozygous
immobilized probes under conditions set so that only the normal
exact complementary sequences hybridize. Unbound
Heterozygous
products are washed away, and those that remain bound
are detected with a conjugated horseradish peroxidase- DS=SS
anti-biotin Fab fragment and exposure to chromogenic Homozygous
substrate. Generation of a color reaction indicates the mutant
binding of the test DNA to the normal or mutant probe. %DS
This method has been proposed for detection of fre- 50 60 70 80
quently occurring mutations such as factor V Leiden.33 Temperature (C)
HLA typing of multiple alleles on a single specimen is Figure 9-5 Melt curve analysis of homozygous mutant, het-
erozygous, and normal PCR products.
also performed by this method (see Chapter 15).
Melt Curve Analysis MCA of PCR products using nonspecic dyes is a sim-
Like DGGE and related methods, melt curve analysis ple and cost-effective way to screen for sequence differ-
(MCA) exploits the sequence- and stacking-directed ences. These dyes are not sequence-specic, however,
denaturation characteristics of DNA duplexes.34 The and do not distinguish between the target amplicon and
method is very useful as a postamplication step of real extraneous products in the PCR reaction, such as primer
time PCR.35,36 PCR amplicons generated in the presence dimers or misprimed amplicons. Although the target sam-
of a DNA-specic uorescent dye, such as ethidium bro- ple should be identiable by its Tm, such artifactual bands
mide, SYBR Green, or LC Green, are heated at a rate of can complicate the melt curve and confuse interpretation.
about 0.3C/sec. The dyes, specic for double-stranded Specicity can be increased by using high resolution
DNA, initially yield a high signal because the DNA is melt curve analysis (HR-MCA). 3739 This method uses
mostly double-stranded at the low temperature. As the uorescent resonance energy transfer (FRET) probes that
temperature rises, the DNA duplexes begin to separate hybridize next to one another across the sequence posi-
into single strands, losing dye accordingly. The uores- tion being analyzed. The probes uoresce only when
cent signal gives a pattern as shown in Figure 9-5. bound to the target sequence because FRET uorescence
Sequence differences result in different melting character- relies on the transfer of energy from a donor uorescent
istics and Tms (where there are equal amounts of double- molecule (uor) on one probe to an acceptor uor on the
and single-stranded DNA) for each sequence. The Tm is other probe. As the temperature increases, the probes dis-
often illustrated as a peak, plotting the derivative (speed of sociate at a specic Tm. When the probes dissociate from
decrease) of uorescence vs. temperature. Results are
interpreted by the temperature peak placement with
respect to the temperature on the X axis. Specimens with
identical sequences should yield the same peak at the Normal
expected Tm, whereas specimens containing different Heterozygous
sequences will yield two or more peaks (Fig. 9-6). mutation
df/dt
Advanced Concepts
Temperature
PCR products smaller than 300 bp in size are pre-
ferred for melt curve analysis. The ability of the Figure 9-6 A plot of the derivative of the uorescence
data (df/dt) vs. temperature shows the inexion point of the
assay to distinguish sequence differences decreases melt curve as a peak at the Tm of the test sequence. A normal
with increasing size of the PCR product.39 homozygous sample should have a Tm that can be distin-
guished from that of the mutant sequence.

the target, the donor is no longer close to the acceptor, and probe with the template. This raises the melting temper-
the uorescence drops. If the target sequence has a mis- ature of the probe, especially one with high A/T content.
match between the target and the probe, hydrogen bond- The Tm of a 1218 bp MGB conjugated probe is equiva-
ing is perturbed between the two strands of the double lent to that of a 2527 bp non-MGB probe.40
helix. The mismatch decreases the dissociation tempera- Special instrumentation is required for MCA and HR-
ture, compared with matched or complementary MCA. Thermal cyclers with uorescent detection, such
sequences. A Tm lower than that of the probe and its per- as the Roche LightCycler and the ABI 7000 series, have
fect complement, therefore, indicates the presence of a melt curve options that can be added to the thermal
mutation, or sequence difference between the known cycling program. The Roche LightTyper and the Idaho
probe sequence and the test sequence. Technologies HR-1 systems are designed to do MCA
FRET is most frequently performed with two probes; only, but they can handle more samples per unit time than
however, single-probe systems have been developed. The the thermal cycler systems.41 Melt curve methodology
single probe is designed to uoresce much more brightly has been proposed for a variety of clinical laboratory
when hybridized to the target. The uorescence is lost on applications such as detection of DNA polymorphisms42-
dissociation (Fig. 9-7). Another modication that is 44 and typing of microorganisms.45
reported to improve the sensitivity of MCA is the cova-

lent attachment of a minor groove binder (MGB) group Inversion Probe Assay
to the probe. The MGB, dihydrocyclopyrroloindole The molecular inversion probe system was designed as a
tripeptide, folds into the minor groove of the duplex method for detection of SNPs in DNA.46 The molecular
formed by hybridization of the terminal 56 bp of the inversion probe is a linear probe containing two target-
Probes Probe
Tm = 62C
Target sequence DNA
Mutation
Tm = 55C
Normal
Heterozygous
Fluorescence
mutant
Homozygous
mutant
Fluorescence
(d/dT)
Figure 9-7 Melt curve analysis with FRET

probes (left) and SimpleProbe (right). A mis-
Temperature Temperature
match between the target and probe will
lower the Tm of the duplex. A. FRET probes B. SimpleProbe

specic regions, one at each end; primer binding sites; Target- Primer Unique Target-
and a 20 nucleotidelong unique sequence tag (Fig. 9-8). specific binding sequence specific
region sites tag region
The probe hybridizes to the target sequence, the two ends
anking the potential SNP being tested. In four separate
reactions A, C, T, or G is added along with DNA poly- Probe
merase and DNA ligase to the probe-target hybridization
reaction (Fig. 9-9). A one-base extension and ligation of
the probe occur only in the tube containing the nucleotide DNA template
complementary to the SNP site on the template. Once the T
probe is ligated and circularized with a single-stranded

endonuclease, the probe, which is then released from the
target, inverts. The inverted probe is then amplied using
uorescently labeled primers complementary to primer
binding sites at either end of the probe. The resulting
amplicons from each tube are hybridized to one of four
microarrays, probing for the unique sequence tag that A T C G
identifies the genomic location of the mutation.
Fluorescence will emit from the ligated and amplied Extension, ligation
probe bound to one of the arrays, i.e., the one correspon-
ding to the nucleotide added to the probe.
T
The inversion probe assay is capable of screening mul- A
tiple mutations or polymorphisms simultaneously as a
Probe release
multiplex inversion probe assay.47 Because each probe
has a unique sequence tag to identify it on the array step
and common PCR primer sites, thousands of probes can
be added to a single set of four reactions with genomic A
T
DNA (500 ng) in four wells of a 96 well plate. Each of the
probes will be successfully ligated in one of the four
nucleotide-extension reactions. As the PCR primer sites
Inverted probe
are the same for all probes, one set of primers can amplify
A
Target- Primer Unique Target-
specific binding sequence specific Amplification labeling
A
region sites tag region
Hybridization
R
Probe
R A
DNA template T
C
T G
Figure 9-9 Molecular inversion probe procedure (only one
Figure 9-8 The molecular inversion probe is designed to of four reactions shown). Closure of the hybridized circular
recognize specic genomic targets on the template, as probe occurs only in the presence of the nucleotide comple-
shown in the bottom panel. A restriction site R is for release mentary to the template. The circular probe from each tube is
of the probe after template-dependent circularization. A released, amplied, and labeled for hybridization to one or
unique sequence tag identies that target by its location four arrays. Each probe hybridizes to one of the four arrays,
of hybridization on a microarray. depending on the original template sequence.

all ligated probes. The amplicons are then hybridized to T

microarrays by the unique sequence tags, which identify A
their genomic locations. The original multiplex inver-
sion probe assay method used four separate identical C
G
microarrays, one for the amplied products of each exten-
Heterozygous sample
sion reaction. Four-color dye technology now permits or sample + probe
hybridization of all four reactions on the same microar-
ray. The location of the array position identies the loca- Denature
tion of the mutation. The color identies the nucleotide at
that location. This assay is one of the high throughput T
methods used in the Human Haplotype Mapping Project A
(see Chapter 11). Although the results of the project will C
provide targets for clinical laboratory testing, inversion
G
probe assays are not to date directly used for clinical
analysis.
Renature
T
T
Heteroduplex Analysis A G
Solution hybridization and electrophoresis of test am-
plicons mixed with reference amplicons can reveal C
C
mutations. To form heteroduplexes, nonidentical double- G A
stranded DNA duplexes are heated to a temperature that Homoduplexes Heteroduplexes
results in complete denaturation of the double-stranded Figure 9-10 Heteroduplex analysis is performed by mixing
DNA (e.g., 95C) and then slowly cooled (e.g., 1C/ sample amplicons with a reference amplicon, denaturing,
420 sec). Heteroduplexes are formed when single and slowly renaturing. If the sample contains mutant
strands that are not completely complementary hybridize sequences, a fraction of the renatured products will be het-
eroduplexes. These structures can be resolved from homodu-
to one another. (Heteroduplexes are also formed when test
plexes by electrophoresis.
amplicons from genetically heterozygous specimens are
denatured and renatured.) The heteroduplexes migrate
differently than do homoduplexes through polyacryla- mixture to minimize the differences in stability of AT and
mide or agarose gels (Fig. 9-10). The presence of bands GC base pairs, increasing the sensitivity of detection.52
different from a homozygous reference control is indi- HPLC separation is then performed on a 25%65% gra-
cative of mutations. Gel-based heteroduplex methods dient of acetonitrile in triethylammonium acetate at the
have been designed for HIV typing48 and hematological melting temperature of the PCR product. The heterodu-
testing.49 plexes elute ahead of the homoduplexes as the denaturing
Conformation-sensitive gel electrophoresis is a het- conditions intensify. The migrating homoduplexes and
eroduplex analysis method in which the heteroduplexes heteroduplexes are detected by absorbance at 260 nm or
are resolved on a 1,4-bis (acrolyl) piperazine gel with by uorescence. HPLC methods are reported to be more
ethylene glycol and formamide as mildly denaturing sol- sensitive than gel methods, with greater capacity for
vents to optimize conformational differences.50,51 This screening large numbers of samples.5355 Although gel-
method was intended for screening large genes for muta- based heteroduplex analyses are routinely used in the
tions and polymorphisms. The use of uorescent detec- clinical laboratory, HPLC analysis of heteroduplexes is
tion increases sensitivity and throughput of the assay. still being evaluated as a mutation screening method in
Heteroduplexes are also resolved by denaturing high- the clinical laboratory.56
performance liquid chromatography (DHPLC). This ver-
sion of heteroduplex analysis is performed on PCR Array Technology
products, ideally 150450 bp in length. The amino acid Single base-pair resolution by hybridization differences
analog betaine is sometimes added to the heteroduplex is achievable with high density oligonucleotide arrays

and microelectronic arrays (see Chapter 6). These different positions in the probe (at the 5 end, in the mid-
methods are similar to comparative genome hybridiza- dle, or at the 3 end). After hybridization of the sample
tion as described in Chapter 8 but focus on a single gene DNA, uorescent label introduced during PCR amplica-
with higher resolution as in ASO procedures. Mutation tion is read on a scanner with appropriate software to
analysis of the p53 tumor suppressor gene by array analy- correct for background and normalized and the mutations
sis has sensitivity and specicity similar to that of direct are identied as indicated by which probes are bound.
sequencing.57 The advantage of array methods is the Although not performed routinely in clinical laborato-
large number of inquiries (potential sequence mutations ries, a number of applied methods have been developed
or SNPs) that can be tested simultaneously. using high density oligonucleotide and microelectronic
Arrays can also be designed to test multiple genes for arrays.5860
sequence mutations. To do this type of analysis, the test Bead array technology utilizes sets of color-coded
PCR-amplied DNA must be fragmented by treatment polystyrene beads in suspension as the solid matrix. In an
with DNase before binding to the complementary probes extension of the FlowMetrix system,61 100 sets of beads
on the array. If the sample fragments are too large (not are dyed with distinct uorochrome mixes. Each set is
treated with DNase), a single base-pair mismatch has coated with oligonucleotide probes corresponding to a
minimal effect on hybridization so that the fragment genetic locus or gene region. In this technology 105 or
binds to multiple probes, and the specicity of detection more probes are attached to each 36-micron bead. When
is lost. An example of one type of hybridization format, labeled test samples are hybridized to the beads through
standard tiling, is shown in Figure 9-11.57 In this format, complementary probe sequences, the combination of
the base substitution in the immobilized probe is always bead color and test label reveals the presence or absence
in the twelfth position from its 3 end. Commonly occur- of a mutation or polymorphism. The advantage of this
ring mutations can be targeted in another type of format, arrangement is that multiple loci can be tested simultane-
redundant tiling, in which the same mutation is placed at ously from small samples. Up to 100 analytes can be
C A T C G/A T
Sense
A C G T Del A C G T Del A C G T Del A C G T Del A C G T Del A C G T Del
Antisense
A C G T Del A C G T Del A C G T Del A C G T Del A C G T Del A C G T Del
Normal Heterozygous mutation

Figure 9-11 Mutation analysis of the p53 gene by high-density oligonucleotide array analysis. Each sequence position is repre-
sented by 10 spots on the array, 5 sense and 5 antisense probes. The sequence binds only to its exactly complementary probe.
The illustration shows three adjacent sequence positions, CAT. Binding of the sample fragment is detected by increased uores-
cence. A fragment with the normal sequence is on the right; a heterozygous mutation is on the left.

tested in a single well of a microtiter plate. This method Primer

requires a ow cytometry instrument, Luminex, that
excites and reads the emitted uorescence as the beads 3 C 5
ow past a detector. This technology has been applied to 5 T 3
3 A 5
antibody detection and infectious diseases and is used in
Primer specific for mutation (T)
tissue typing and in other clinical applications.6264 C
Primer specific for
normal sequence (C)
Sequencing (Polymerization)-
Based Methods M Normal Heterozygous Homozygous
mutant mutant
Sequence-Specic PCR
Sequence-specic PCR (SSP-PCR) is commonly used to
detect point mutations and other single nucleotide poly-
morphisms. There are numerous modications to the
method, which involves careful design of primers such Mutant amplicon
that the primer 3 end falls on the nucleotide to be ana- Normal amplicon
lyzed. Unlike the 5 end, the 3 end of a primer must
match the template perfectly to be extended by Taq poly-
Figure 9-13 Allele-specic primer amplication of a CT
merase (Fig. 9-12). By designing primers to end on a
mutation. A longer primer is designed with the mutated
mutation, the presence or absence of product can be inter- nucleotide (A) at the 3end. This primer is longer and gives
preted as the presence or absence of the mutation. a larger amplicon than the primer binding to the normal
Normal and mutant sequences can be analyzed simul- sequence (top). The resulting products can be distinguished
taneously by making one primer longer than the other, by their size on an agarose gel (bottom). First lane: molecular
weight marker; second lane: a normal sample; third lane: a
resulting in differently sized products, depending on the
heterozygous mutant sample; fourth lane: a homozygous
sequence of the template (Fig. 9-13). Alternatively, pri- mutant.
mers can be multiplexed30 (Fig. 9-14). Multiplexed SSP-
PCR was originally called amplication refractory
mutation system PCR or tetra primer PCR.65,66 amplify the test DNA. The resulting PCR products will
Sequence-specic PCR is routinely used for high resolu- have an allele-specic sequence at one end and a locus-
tion HLA typing (Chapter 15) and for detection of com- specic sequence at the other end. This PCR product is
monly occurring mutations. subsequently amplied in a second round using Cy3 or
A high throughput application of bead array technol- Cy5 (uorescently) labeled 5 primers, corresponding to
ogy (Illumina bead array67) uses sequence-specic PCR the normal or mutant allele and a common 3 primer.
(Fig. 9-15). In this assay, tailed primers are used to These amplicons can then be hybridized to the beads. The
bead color (locus) combined with Cy3 or Cy5 uores-
cence (allele) types the allele at each locus. Although this
Primer Amplification system is one of the technologies used in the Human
5 G 3 Haplotype Mapping Project, it is not routinely used in the
3 C 5 clinical laboratory.
Normal template
Allelic Discrimination
3 No amplification With Fluorogenic Probes
5 G
Thermal cyclers with uorescent detection support allelic
3 T 5
Mutant template discrimination with uorogenic probes. This method is
Figure 9-12 Sequence-specic primer amplication.
an extension of the 5 nuclease PCR assay using two
Successful amplication will occur only if the 3 end of the probes labeled with different uors (Fig. 9-16). Each
primer matches the template. probe matches either the normal or mutant sequence. If

Primer 2 (specific for Locus-specific sequences

Primer 1 normal sequence)
G
3 C 5
Template Primer 3 (specific for mutations) Primer binding site

A Beads
3 G 5
Primer 4 A
+ m m + G
Cy3 A
Or
Cy5 G
Cy3
Or
1-4
specific for
1-3 Cy5
mutation G allele
2-4
Figure 9-15 Bead array technology. Beads colored with
distinct uorescent dyes (upper left) are covalently attached
to the probe sequences, each color of bead attached to a
probe representing a specic locus. In a sequence-specic
Figure 9-14 Multiplex allele-specic PCR. The mutation PCR, test DNA is amplied with tailed primers. The tailed PCR
(CA) is detected by an allele-specic primer (3) that ends products are amplied in a second reaction to generate
at the mutation. Primers 3 and 4 would then produce a mid- labeled amplicons that will bind to specic beads, accord-
sized fragment (13). If there is no mutation, a normal primer ing to the gene locus. The combination of bead label and the
(2) binds and produces a smaller fragment (24). Primers 1 hybridized amplicon label reveals whether there is a mutant
and 4 always amplify the entire region (14). or normal allele at that locus.
either probe matches the test sequence, it is digested by and FAM will be high. Negative controls show no VIC or
the enzyme, releasing the reporter dye. The presence of no FAM. This assay has the advantage of interrogating
the corresponding uorescent signals indicates whether multiple samples simultaneously and has been proposed
the test sequence is normal or mutant; that is, whether the as a practical high throughput laboratory method.68,69 It
probe matched and hybridized to the test sequence. In the has been used in research applications in genetics and
example shown in Figure 9-16, the probe complementary infectious disease.70-74
to the normal sequence is labeled with FAM dye. The
probe complementary to the mutant sequence is labeled Dideoxy DNA Fingerprinting
with VIC dye. If the test sequence is normal, FAM uo- Dideoxy DNA ngerprinting (ddF) is a modied chain
rescence will be high, and VIC uorescence will be low. termination sequencing procedure (see Chapter 10 for a
If the test sequence is mutant, VIC will be high, and FAM description of dideoxy chain termination sequencing).
will be low. If the sequence is heterozygous, both VIC For this analysis, a single dideoxynucleotide is used to

Normal probe (FAM) Mutant probe (VIC)
Taq Taq
Normal
allele
(FAM)
Mutant
allele
(VIC)
Mutant allele (VIC)

Figure 9-16 Allelic discrimination. Probes, com-
plementary to either the normal sequence (left) or
the mutant sequence (right), are labeled with dif-
ferent uors, e.g., FAM and VIC, respectively. The
Taq exonuclease functions only if the probe is
matched to the sequence being tested. High FAM
indicates normal sequence, and high VIC indicates
mutant sequence. If both uors are detected, the
test sample is heterozygous. Mutant allele (VIC)
generate a series of terminated fragments that are Normal Mutant

resolved in one lane of a nondenaturing polyacrylamide ACTGGTTATCGG ACTGGTTCTCGG
gel. A combination of dideoxy sequencing, SSCP, and
ddF resolves normal and mutant sequences by nucleotide
base differences that result in the absence of a normal
band or presence of an additional band (informative
dideoxy component) and altered mobility of terminated
fragments (informative SSCP component). Normal Mutant
Dideoxynucleotide triphosphates (ddNTP) terminate
DNA synthesis (see Chapter 10). For example, dideoxy
guanosine triphosphate added to a DNA synthesis reac- SSCP component
tion terminates copying of the template at each C residue
Dideoxy component
on the template. If the template sequence has a mutation
that replaces another nucleotide with C (or substitutes a C
residue with another nucleotide), an additional fragment
terminated by ddG will be present on the gel, as com-
Figure 9-17 Dideoxy ngerprinting detection of an
pared with the normal pattern (Fig. 9-17). Furthermore, AC mutation. ddG added to the synthesis reaction
fragments terminated at C residues beyond the mutation terminates copies of the template at each opportunity
migrate with altered mobility due to the base change. to add G (opposite C in the template). An additional
Whereas the additional fragment is absolute, the altered termination product will be generated from the mutant
template (dotted line). This fragment will be detected as
mobility is subject to gel conditions and temperature, just
an extra band on the gel (dideoxy component). The subse-
as with SSCP. Each of the four dideoxynucleotides can be quent larger terminated fragments will have a 1 bp dif-
used in this assay, depending on the nature of the ference from the normal ones, which may affect migration
sequence changes under study. This assay was introduced (SSCP component).

as an improvement in sensitivity over SSCP and other A G

screening methods.75 ddT ddC
The basic ddF procedure screens only one strand of the
template duplex. By adding two primers instead of one,
simultaneous termination reactions on both strands are (ROX) (BFL)
generated in bidirectional dideoxy ngerprinting.76 Figure 9-18 FP-TDI detection of an A or G allele of a gene
Although the band patterns produced by this method are sequence. The color of the polarized uorescence detected
more complex, mutations that might be missed on one indicates which dideoxynucleotide is incorporated and, there-
strand will be detected in the complementary strand. Both fore, the nucleotide on the test template.
ddF and bi-ddF can be performed using capillary elec-
trophoresis as well as gel electrophoresis.77,78 Although primer will either incorporate ddTTP and terminate at the
the methods are widely used in research applications, the A or continue to the next A in the sequence, producing a
extensive optimization required for consistent results has larger extension product. The products are then analyzed
precluded their general use in the clinical laboratory. by mass spectrometry to distinguish their sizes. Like FP-
TDI, this method can detect large numbers of mutations
Dye Terminator Incorporation or polymorphisms simultaneously. The system does,
Multiplex assays have been designed using limited incor- however, require expensive instrumentation. Because of
poration of fluorescently labeled dideoxynucleotide their high throughput detection capabilities, both FP-TDI
triphosphates. In one method, uorescent polarization- and MassExtend were used in the Human Haplotype
templatedirected dye terminator incorporation (FP- Mapping Project. Mutation detection by mass spectrom-
TDI)79 primers are designed to hybridize on the test etry may become more practical in the clinical laboratory
sequence up to the nucleotide being tested (Fig. 9-18). as new methods are developed.8487
Two uorescence-labeled terminator dideoxynucleotides
corresponding to the alleles to be typed serve as primers Protein Truncation Test
for a single base extension reaction. For example, one Nonsense or frameshift mutations cause premature trun-
nucleotide is labeled with the dye ROX, and the other is cation of proteins. The protein truncation test (also
labeled with the dye BFL, as in the gure, ROX-ddTTP called in vitro synthesized protein or in vitro tran-
and BFL-ddCTP. The remaining two terminators, ddATP scription/translation) is designed to detect truncated
and ddGTP, are also present, although in unlabeled form,
to prevent misincorporations. No deoxy nucleotides
(dNTPs) are present. If a labeled ddNTP is incorporated AGCTGGA
onto the primer, the uorescence polarization of that dye ddT
increases as it becomes part of the larger oligonu-
cleotide.80 The samples are read twice on a uorometer, CGCTGGA
with lters corresponding to each of the dyes used. ddG ddT
Instrument software calculates the polarization from the
raw data and produces a numerical report. Although this MALDI-TOF analysis
procedure is compatible with mutation detection, its pres-
ent use is in single nucleotide polymorphism analysis.81
Unextended A allele C allele
Another extension/termination assay is Homogeneous
intensity
Relative
primer
MassExtend or MassArray (SEQUENOM).82,83 In this
method, mass spectrometry is used to detect extension
products terminated by specic dye-labeled dideoxynu-
cleotides. An example is shown in Figure 9-19. All four m/z
deoxynucleotides and one dideoxynucleotide, e.g., ddT, Figure 9-19 Sequenom MassExtend uses matrix assisted
are added to the extension reaction. Depending on the desorption/ionization-time of ight mass spectrometry to
allele in the test sequence, A or C in the example, the detect extension products of different sizes (mass).

proteins as an indication of the presence of DNA muta- 6. To perform PCR-RFLP, the region surrounding the
tions.88 This procedure uses a PCR product containing mutation is amplied, and the mutation is detected by
the area of the gene likely to have a truncating DNA cutting the amplicon with the appropriate restriction
mutation. The PCR product is transcribed and translated enzyme (Fig. 9-21). Mutations can inactivate a naturally
in vitro using commercially available coupled transcrip- occurring restriction site or generate a new restriction site
tion/translation systems. When the peptide products of so that digestion of the PCR product results in cutting of
the reaction are resolved by polyacrylamide gel elec- the mutant amplicon but not the normal control amplicon
trophoresis, bands below the normal control bands, rep- or vice versa. Although straightforward, PCR-RFLP re-
resenting truncated translation products, are indicative of quires careful design, as rare polymorphisms have been
the presence of DNA mutations (Fig. 9-20). This proce- reported to confound RFLP results.94 Several PCR-RFLP
dure has been used to detect mutations associated with methods are widely used for detection of commonly
breast cancer,89,90 cystic brosis,91 familial adenosis poly- occurring mutations, such as factor V Leiden95 and HFE
posis,92 retinoblastoma,93 and many other disease condi- mutations. PCR-RFLP has also been used for HLA typ-
tions. It has had limited use, however, as a clinical test. ing (see Chapter 15).
PCR-RFLP can be multiplexed to detect more than one
gene mutation simultaneously. This has been practical for
Cleavage Methods
detection of separate gene mutations that affect the same
Restriction Fragment Length phenotype, e.g., factor V Leiden and prothrombin.96 Alter-
Polymorphisms natively, a combination of SSP-PCR and PCR-RFLP is
If a mutation changes the structure of a restriction also applied to simultaneous detection of mutations in
enzyme target site or changes the size of a fragment gen- more than one locus. An example is shown in Figure 9-22,
erated by a restriction enzyme, restriction fragment in which a primer designed to produce a restriction site in
length polymorphism (RFLP) analysis can be used to the amplicon is used for each gene in a multiplex PCR. In
detect the sequence alteration. Analysis of RFLPs in the example, the primers are designed to generate a
genomic DNA by Southern blot is described in Chapter HindIII site in the amplicons. The PCR reaction and the
Normal Frameshift mutation
F L N C W F L Stop
T T A C T G A A T T G T T GG T TA CTG TAA T TG T TG G
Transcription Transcription
U U A C UG A A U UGU UGG T T A C T G UA A T T G T T G G
Translation Translation
F L N C W F L
Protein Protein
MW NL MUT
Figure 9-20 A frameshift mutation (top

right) results in a truncated protein synthe-
sized in vitro from a PCR product. The
truncated peptide is resolved by polyacry-
lamide gel electrophoresis (bottom). Results
from analysis of a homozygous mutant
sample (MUT) and a normal sample (NL)
are shown.

Normal GTCAGGGTCCCTGC + + + m
+ m + m
Mutation GTCAGGATCCCTGC
Normal Mutant Het Prothrombin

U B U B U B
Factor V
+ + m +
+ m m +
Prothrombin
Figure 9-21 PCR-RFLP. The normal sequence (top line)
is converted to a BamH1 restriction site (GGATCC) by
a GA mutation. The presence of the mutation is
detected by testing the PCR product with BamH1. The
bottom panel shows the predicted gel patterns for the 1 bp mismatch
Factor V
homozygous normal, homozygous mutant, and heterozygous
samples uncut (U) or cut with BamH1 (B).
3 bp mismatch
HindIII digestion are performed in the same tube, and the
Figure 9-22 Multiplex PCR with mutagenic primers to
products are separated on one lane of the gel.97-99 This detect mutations in factor V and prothrombin. The primer
procedure is used in clinical analysis of factor V Leiden sequences are designed to generate a HindIII site in the
and prothrombin mutations. PCR product if the mutations are present. The prothrombin
and factor V PCR products are different sizes that can be
resolved on the gel in a single lane.
Heteroduplex Analysis With
Single-Strand Specic Nucleases
The detection sensitivity of heteroduplex analysis can be
increased by using single-strandspecic nucleases, e.g., T
T
S1 nuclease, that cleave heteroduplexes at the mispaired A
G
Renatured
bases.100 PCR amplications and heteroduplex formation C C
were described in the earlier section on heteroduplex G
A
analysis. After cooling, the heteroduplexes are digested Homoduplexes not
with a single-strandspecic nuclease. Digested het- cleaved by enzyme
Heteroduplexes cleaved
eroduplexes (but not homoduplexes) yield smaller bands by enzyme
that can be resolved on an agarose gel (Fig. 9-23). In
addition to detecting mutations, the fragment sizes can be MW WT M1 M2 M3 M4
used to estimate the placement of the mutation within the
amplied sequence. 955
585
341 Full-length fragment
Base Excision Sequence Scanning 258
Cleaved fragments
Base excision sequence scanning (BESS) is a PCR ampli-
cation in the presence of small amounts of deoxyuridine Figure 9-23 Single-stranded endonucleases cleave mis-
triphosphate (dUTP) added to the reaction mix, followed paired regions of heteroduplexes (top). The cleaved fragments
by treatment with excision enzymes that cleave the frag- can be resolved by agarose gel electrophoresis (bottom).

ment at the dU sites.101 For example, the sequence to be Even so, the complex optimization and interpretation
scanned is amplied in a standard PCR reaction contain- required for BESS preclude its wide use as a clinical test
ing a mixture of 0.2 mM dNTPs and 0.015 mM dUTP. method.
One of the primers in the PCR reaction has a uorescent
or radioactive label. With the above ratios of dNTP:dUTP,
Nonisotopic RNase Cleavage Assay
an average of 1 dU is incorporated into each amplicon.
Nonisotopic RNase cleavage assay (NIRCA) is a het-
After the PCR reaction, the amplicons are digested with
eroduplex analysis using duplex RNA.103 The sequences
uracil-N-glycosylase and Escherichia coli endonuclease
to be scanned are amplied using primers tailed with pro-
IV to remove the uracils and then cut the sugar phosphate
moter sequences of 2025 bp. T7 or SP6 phage RNA
backbone of the DNA. Mutations affecting AT base pairs
polymerase promoters are most often used for this pur-
in the test sequence will be revealed by the incorporation
pose. Following amplication, the PCR products with the
of dU and subsequent fragmentation of the amplicon at
promoter sequences are used as templates for in vitro syn-
the site of dU incorporation. The fragments can then be
thesis of RNA with the T7 or SP6 RNA polymerase
resolved by gel or capillary electrophoresis (Fig. 9-24).
enzymes. This reaction yields a large amount of double-
Premixed reagents for this assay are available (BESS T-
stranded RNA (Fig. 9-25). The transcripts are denatured at
Scan, Epicentre Technologies).
95C and then renatured by cooling to room temperature.
An extension of this method, the BESS G-Tracker, is
If a mutation is present, heteroduplexes form between
designed to interrogate G residues in the test sequence.102
normal and mutant transcripts. These mismatches in the
The amplicons, dissolved in a G modication reagent,
RNA are targets for cleavage by RNase enzymes. A mix-
are subjected to a photoreaction with visible light. A pro-
ture of single-strandspecic E. coli RNase I and
prietary enzyme mix will then fragment the amplicons
Aspergillus RNase T1 cleaves different types of mis-
at the positions of the modied G residues. Interpreta-
matches. The remaining double-stranded RNA fragments
tion of the electrophoresis fragment patterns is the same
can then be separated by agarose gel electrophoresis. As
as described above for the T-Scan. BESS is reported to
in DNA heteroduplex analysis, the size of the RNA frag-
have less optimization requirements than SSCP and ddF.
ments implies the placement of the mutation. Although
NIRCA has been applied to screening of several clinical
targets, including factor IX,103 p53,104 and BRCA1,105,106
Normal Mutant
ACTGGTTATCGG ACTGGTCATCGG
it is not widely used in routine patient testing.
U U
U U
U-containing Invader Assay
U
amplicons Invader is a method developed by Third Wave Technolo-
U U
gies that does not require PCR amplication of sam-
ples.107109 Premixed reagents are added to a standard 96
Normal Mutant well plate along with the test specimens and controls.
Included in the reaction mix is the proprietary enzyme
Cleavase, which recognizes the structure formed by
Normal hybridization of the normal or mutant probes in the mix
to the test sequences. During an isothermal incubation, if
Mutant
the probe and test sequence are complementary, two
enzymatic cleavage reactions occur, ultimately resulting
Gel electrophoresis in a uorescent signal (Fig. 9-26). The signal can be read
Capillary electrophoresis
by a standard uorometer. The advantages of this method
Figure 9-24 Base excision sequence scanning. Uracil are the short hands-on time and optional PCR amplica-
containing amplicons yield different digestion frag-
ments, depending on the sequence of the template.
tion. This method has been applied to several areas of
Gel (left) or capillary (right) electrophoresis patterns are clinical molecular diagnostics, including genetics,109
depicted. hemostasis,110112 and infectious disease.113

Normal Mutant
Tailed primer
PCR
RNA polymerase
PCR products
Transcription
RNA that
hybridizes to
make double
strands
Denaturation,
reannealing
Single strand-specific RNase
Figure 9-25 NIRCA analysis. Normal (left)

and mutant (right) transcription templates
Normal Mutant covering the area to be screened are pro-
duced by PCR with tailed primers carrying
promoter sequences. RNA polymerase then
transcribes the PCR products. The transcripts
Normal
are denatured and reannealed, forming het-
transcript Cleaved eroduplexes between normal and mutant
mutant transcripts. RNase cleavage products can be
transcript resolved on native agarose gels.
Chemical Cleavage of the modied bases. The fragments are resolved by

Chemical cleavage of mismatches (CCM) exploits the polyacrylamide gel electrophoresis. CCM detects only
susceptibility of specic base mismatches to modica- A:A, C:C, G:G, T:T, A:C, A:G, C:T, and G:T mis-
tion by different chemicals.114 Mismatched cytosines and matches. The ability to detect mutations is extended by
thymines are modied by hydroxylamine and osmium using both the sense and antisense strands of the probe.
tetroxide, respectively. For CCM, a labeled normal probe CCM, although highly sensitive, is not attractive for rou-
is hybridized to the test sequence; the resulting duplex is tine analysis due to the hazardous chemicals required and
treated chemically to modify the bases. Subsequent ex- laborious procedure. Still, it is used in some research
posure to a strong reducing agent, piperidine, separates applications,115,116 and there have been efforts to auto-
the sugar phosphate backbone of the DNA at the site mate the process.117

Flap Cleavage Flap No cleavage

Mutant Mutant
Invader A Invader G
probe probe
probe probe
T T
Cleavage
F
A Q
Detection F
Figure 9-26 Invader single-color assay. Hybridization of supplied probe and anchor sequences to the
input template (upper left) forms a structure that is the substrate for the cleavage enzyme. The enzyme
removes the ap sequences, which form another hybridization structure with the labeled probe. The
second cleavage releases the uorescent dye from the vicinity of the quencher on the probe, a uo-
rescent signal. If the template does not match the probe in the rst hybridization (upper right), no
cleavage occurs.
DNA endonucleases, T4E7 and T7E1 from bacterio- procedure may not be ideal for all genes. Hence the devel-
phages T4 and T7, also cleave mismatches in DNA.118 opment of DGGE, TTGE, and DHPLC. Combinations of
The plant endonuclease CEL 1, with properties similar to methods have also been proposed to increase sensitivity
the single-stranded nuclease S1, has also been described.1 and detection, such as RFLP and SSCP. The method used
Although this method has a higher background than in a given laboratory will depend on available instrumen-
chemical cleavage, it has greater potential for automation tation, the genetic target, and the nature of the mutation.
and routine use. Commercial kits for this procedure are A summary of methods is shown in Table 9.2.
available (Amersham-Pharmacia). Another commercial Performance of each method varies, depending on the
enzyme, Surveyor (Transgenomics), is a member of the specimen, template sequence, and type of mutation to be
CEL nuclease family. It cuts both strands of DNA at a detected. For instance, T-BESS or some chemical cleav-
mismatch site without regard to the bases involved in the age methods that detect only mutations involving specic
mismatch. This system has been proposed as a screening nucleotides can have 100% accuracy and specicity for
method for single-base alterations.119 these mutations but 0% for mutations affecting other
nucleotides. Procedures that are developed by targeting a
specic mutation will perform for that target but may not
Other Methods
work as well for other targets. For instance, hybridiza-
The challenges of clinical laboratory requirements for tion methods generally detect mutations in GC-rich
robust, accurate, and sensitive assays have driven the dis- sequence environments more accurately than in AT-rich
covery of new techniques and modication of existing sequences. Methods designed to detect dened targets
techniques.74,120122 As a consequence, many methods have the best accuracy and specicity; however, they
have been devised, especially for high throughput screen- detect only the targeted mutation. Screening methods are
ing. SSCP is probably the most commonly used mutation required for discovery of new mutations, but these muta-
screening method in clinical laboratories, but what has tions have to be conrmed by other methods or direct
been learned from the use of this method is that a single sequencing.

tive numbers, starting with the G of the GT splice donor

Gene Mutation Nomenclature site as 1, or negative numbers, starting with the G of the
Accurate testing and reporting of gene mutations require AG splice acceptor site as 1. Thus, a GT mutation 5
a descriptive and consistent system of expressing muta- nucleotides from the splice donor site of intron 2 is des-
tions and polymorphisms. Recommendations have been ignated IVS25GT.
reported and generally accepted.123,124 Following are gen- At the protein level, numbering begins with the initial
eral descriptive terms for basic alterations and structures. amino acid, methionine, in the protein sequence desig-
For DNA and cDNA, the rst nucleotide of the rst nated 1. The single-letter code has been used to convey
amino acid in the sequence, usually A of ATG for methio- protein sequence, but because of concerns about confu-
nine, is designated as position 1. The preceding sion with the single-letter designations, three-letter deno-
nucleotide is position 1. There is no nucleotide position tations are also acceptable (see Chapter 3, Table 3.1).
0. Nucleotide changes are expressed as the position or Stop codons are designated by X in either case. Amino
nucleotide interval, the type of nucleotide change, the acid changes are described by the amino acid changed,
changed nucleotide, the symbol , and nally the new the position, and the new amino acid. Consider the pro-
nucleotide. For example, consider a nucleotide reference tein sequence: MRHL. If the second amino acid, arginine
sequence: ATGCGTCACTTA. A substitution of a T for a (R), was substituted by tyrosine (Y), the mutation of the
C at position 7 in the DNA sequence (mutant sequence new amino acid sequence, MYHL, would be R2Y. A non-
ATGCGTTACTTA) is expressed as 7CT. A deletion of sense mutation in codon 3, mutant sequence MRX, would
nucleotides 6 and 7, ATGCG ACTTA, is expressed as be written H3X. Deletion of the arginine and histidine,
6_7del or 6_7delTC. An insertion of a TA between ML, would be R2_H3del or R2_H3del2. Insertions are
nucleotides 5 and 6, ATGCGTATCACTTA, is denoted denoted by the amino acid interval, ins, and the inserted
5_6insTA. amino acids. For instance, insertion of amino acids
Duplications are a special type of insertion. A duplica- glycine (G), alanine (A), and threonine (T), making the
tion of nucleotides 5 and 6, ATGCGCGTCACTTA, is altered amino acid sequence MRGATHL, is indicated by
expressed as 5_6dupCG. An insertion with a concomitant R2_H3insGAT or, alternatively, R2_H3ins3. A short
deletion, indel, has three alternate descriptive terms. For notation for frameshift mutations is the amino acid, its
example, if TC at positions 6 and 7 is deleted from the ref- position, and fs. A frameshift mutation affecting the
erence sequence and GACA is inserted, the altered se- histidine residue changing the amino acid sequence to
quence, ATGCGGACAACTTA, is denoted 6_7delTCins MRCPLRGWX is simply H3fs. The length of the shifted
GACA, 6_7delinsGACA, or 6_7GACA. Inversion of open reading frame is indicated by adding X and the posi-
nucleotides is designated by the nucleotides affected, inv, tion of the termination codon. H3CfsX7 is a frameshift in
and the number of nucleotides inverted. For example, codon 3 that changes a histidine to a cysteine and new
inversion of GCGTCAC starting at position 3 to position reading frame ending in a stop at the seventh codon.
9 in the reference sequence (ATCACTGCGTTA) is To distinguish between mutation nomenclature refer-
3_9inv7. ring to genomic DNA, coding (complementary or copy)
Gene mutations in recessive diseases, where both alle- DNA, mitochondrial DNA, RNA, or protein sequences, a
les are affected, are indicated by the designation of each prex of g., c., m., r., and p. are recommended, respec-
mutation separated by . Thus, a 2357CT mutation in tively. Furthermore, RNA sequences are written in lower
one allele of a gene and a 2378delA mutation in the other case letters. For example, c.89TC in the coding DNA
allele on the homologous chromosome is written would be r.89uc in RNA.
[2357CT] [2378CdelA]. This is distinct from two Complex changes and multiple concurrent mutations
mutations in the same allele, which is written [2357CT; are reported as they occur. Some mutations, even with
2378CdelA]. sequence information, cannot be positively determined
Mutations in introns of genomic DNA are indicated by and must be inferred; for example, additions or deletions
IVS, the intron number, the position of the mutation, and of repeat units in repeated sequences. For these changes,
the change. The numbered positions in introns are posi- it is assumed that the 3 most repeat is the one affected,

and the alteration is noted for that position. Updates and MPSGX
further clarications of mutation nomenclature are still MPSGCWLVTGX
being addressed. Current information and descriptors for MPSGR
more complex changes are available at genomic.unimelb. MPSGCWGCWR
edu.au/mdi/mutnomen/ Express these mutations using the accepted nomen-
clature.
STUDY QUESTIONS References

1. Yeung A, Hattangadi D, Blakesley L, et al.
1. Name three assays by which the factor V Leiden Enzymatic mutation detection technologies.
R506Q mutation can be detected. BioTechniques 2005;38(5):74958.
2. Orita M, Iwahana H, Kanazawa H, et al. Detection
2. Exon 4 of the HFE gene from a patient suspected to of polymorphisms of human DNA by gel elec-
have hereditary hemachromatosis was amplied by trophoresis as single-strand conformation polymor-
PCR. The G to A mutation, frequently found in phisms. Proceedings of the National Academy of
hemachromatosis, creates an Rsa1 site in exon 4. Sciences 1989;86:276670.
When the PCR products are digested with Rsa1, what 3. Orita M, Suzuki Y, Sekiya T, et al. Rapid and sensi-
results (how many bands) would you expect to see if tive detection of point mutations and DNA poly-
the patient has the mutation? morphisms using the polymerase chain reaction.
Genomics 1989;5:87479.
3. Which of the following methods would be practical to 4. Hayashi K. A simple and sensitive method for
use to screen a large gene for mutations? detection of mutations in the genomic DNA. PCR
a. SSP-PCR Methods and Applications 1991;1:3438.
b. SSCP 5. Atha D, Wenz H-M, Morehead H, et al. Detection
c. PCR-RFLP of p53 point mutations by single strand conforma-
d. DGGE tion polymorphism: Analysis by capillary elec-
e. FP-TDI trophoresis Electrophoresis 1998;19:17279.
6. Ellison J, Dean M, Goldman D. Efficacy of
4. What is the phenotypic consequence of changing a uorescence-based PCR-SSCP for detection of
codon sequence from TCT to TCC? point mutations. BioTechniques 1993;15:68491.
7. Soong R, Iacopetta BJ. A rapid nonisotopic method
5. A reference sequence, ATGCCCTCTGGC, is mutated for the screening and sequencing of p53 gene muta-
in malignant cells. The following mutations in this tions in formalin-xed, paraffin-embedded tumors.
sequence have been described: Modern Pathology 1997;10:25258.
ATGCGCTCTGGC 8. Sarkar G, Sommer SS. Screening for mutations by
ATGCCCTCGC RNA single-strand conformation polymorphism
ATAGCCCTCTGGC (rSSCP): Comparison with DNA-SSCP. Nucleic
ATGTCTCCCGGC Acids Research 1992;20(4):87178.
ATGCCCTCTGGC 9. Bisceglia L, Grifa A, Zelante L, et al. Development
Express these mutations using the accepted nomen- of RNA-SSCP protocols for the identication and
clature. screening of CFTR mutations: Identication of two
new mutations. Human Mutation 1994;4(2):13640.
6. A reference peptide, MPSGCWR, is subject to inher- 10. Liu Q, Sommer SS. Restriction endonuclease n-
ited alterations. The following peptide sequences have gerprinting (REF): A sensitive method for screening
been reported: mutations in long contiguous segments of DNA.
MPSTGCWR BioTechniques 1995;18(3):47077.

11. Fodde RLM. Mutation detection by denaturing gra- frame by temporal temperature gradient gel elec-
dient gel electrophoresis (DGGE). Human Mutation trophoresis. Electrophoresis 1995;16:185160.
1994;3(2):8394. 22. Khrapko K, Hanekamp JS, Thilly WG, et al.
12. Fisher S, Lerman LS. Length-independent separation Constant denaturant capillary electrophoresis
of DNA restriction fragments in two-dimensional (CDCE): A high resolution approach to mutational
gel electrophoresis. Cell 1979;16:191200. analysis. Nucleic Acids Research 1994;22:36469.
13. Fischer S, Lerman LS. DNA fragments differing by 23. Borresen A-L, Hovig E, Smith-Sorensen B, et al.
single base-pair substitutions are separated in dena- Mutation analysis in human cancers using PCR and
turing gradient gels: Correspondence with melting constant denaturant gel electrophoresis (CDGE).
theory. Proceedings of the National Academy of Advances in Molecular Genetics 1991;4:6371.
Sciences 1983;80(6):157983. 24. Taniere P, Martel-Planche G, Maurici D, et al.
14. Hayes V, Bleeker W, Verind E, et al. Molecular and clinical differences between adeno-
Comprehensive TP53-denaturing gradient gel elec- carcinomas of the esophagus and of the gastric car-
trophoresis mutation detection assay also applicable dia. American Journal of Pathology 2001;158(1):
to archival paraffin embedded tissue. Diagnostic 3340.
Molecular Pathology 1999;8(1):210. 25. Lindforss U, Zetterquist H, Papadogiannakis N, et
15. Brady S, Magro CM, Diaz-Cano SJ, et al. Analysis al. Persistence of K-ras mutations in plasma after
of clonality of atypical cutaneous lymphoid inl- colorectal tumor resection. Anticancer Research
trates associated with drug therapy by PCR/DGGE. 2005;25:65761.
Human Pathology 1999;30(2):13036. 26. Balogh KPA, Patocs A, Majnik J, et al. Genetic
16. Miller K, Ming TJ, Schulze AD, et al. Denaturing screening methods for the detection of mutations
gradient gel electrophoresis (DGGE): A rapid and responsible for multiple endocrine neoplasia type
sensitive technique to screen nucleotide sequence 1. Molecular Genetics and Metabolism 2004;83
variation in populations. BioTechniques 1999;27: (12):7481.
101630. 27. Bor M, Balogh K, Pusztai A, et al. Genetic screen-
17. Burmeister M, diSibio G, Cox DR, et al. ing of exon 12 of the hydroxymethylbilane synthase
Identication of polymorphisms by genomic dena- enzyme of patients with acute intermittent por-
turing gradient gel electrophoresis: Application to phyria. Journal of Physiology 2000;526:111P.
the proximal region of human chromosome 21. 28. Hernan-Gomez SEJ, Espinosa JC, Ubeda JF.
Nucleic Acids Research 1991;19(7):147581. Characterization of wine yeasts by temperature gra-
18. Borresen A, Hovig E, Smith-Sorensen B, et al. dient gel electrophoresis (TGGE). FEMS
Constant denaturant gel electrophoresis as a rapid Microbiology Letters 2000;193(1):4550.
screening technique for p53 mutations. Proceedings 29. Tominaga T. Rapid identication of pickle yeasts by
of the National Academy of Sciences 1991;88: uorescent PCR and microtemperature-gradient gel
84058409. electrophoresi. FEMS Microbiol Letters 2004;238
19. Smith-Sorensen B, Hovig E, Andersson B, et al. (1):4348.
Screening for mutations in human HPRT cDNA 30. Struewing J, Hartge P, Wacholder S, et al. The risk
using the polymerase chain reaction (PCR) in com- of cancer associated with the 185delAG and
bination with constant denaturant gel electrophore- 5382insC mutations of BRCA1 and the 6174delT
sis (CDGE). Mutation Research 1992;269(1): mutation of BRCA2 among Ashkenazi Jews. New
4153. England Journal of Medicine 1997;336(20):
20. Yoshino K, Nishigaki K, Husimi Y. Temperature 14011408.
sweep gel electrophoresis: A simple method to 31. Hussussian C, Struewing JP, Goldstein AM, et al.
detect point mutations. Nucleic Acids Research Germline p16 mutations in familial melanoma.
1991;19:3153. Nature Genetics 1994;8:1521.
21. Wiese U, Wulfert M, Prusiner S, et al. Scanning for 32. Roa B, Boyd AA, Volcik K, et al. Ashkenazi Jewish
mutations in the human prion protein open reading population frequencies for common mutations in

BRCA1 and BRCA2. Nature Genetics 1996;14: the mannose-binding lectin gene using minor
18587. groove binder-DNA probes. Journal of Immuno-
33. rum H, Jakobsen MH, Koch T, et al. Detection logical Methods 2004;287(12):22730.
of the factor V Leiden mutation by direct allele- 44. Belousov Y, Welch RA, Sanders S, et al. Single
specic hybridization of PCR amplicons to nucleotide polymorphism genotyping by two-
photoimmobilized locked nucleic acids. Clinical colour melting curve analysis using the MGB
Chemistry 1999;45:18981905. Eclipse Probe System in challenging sequence
34. Wittwer C, Gudrun HR, Gundry CN, et al. High- environment. Human Genomics 2004;1(3):
resolution genotyping by amplicon melting analysis 20917.
using LC Green. Clinical Chemistry 2003;49(6): 45. Fujigaki H, Takemura M, Takahashi K, et al.
85360. Genotyping of hepatitis C virus by melting curve
35. Ririe K, Rasmussen RP, Wittwer CT. Product dif- analysis with SYBR Green I. Annals of Clinical
ferentiation by analysis of DNA melting curves dur- Biochemistry 2004;41(2):13032.
ing the polymerase chain reaction. Analytical 46. Hardenbol P, Baner J, Jain M, et al. Multiplexed
Biochemistry 1997;245:15460. genotyping with sequence-tagged molecular inver-
36. Lay M, Wittwer CT. Real-time uorescence geno- sion probes. Nature Biotechnology 2003;21(6):
typing of factor V Leiden during rapid cycle PCR. 67378.
Clinical Chemistry 1997;43:226267. 47. Hardenbol P, Yu F, Belmont J, et al. Highly multi-
37. Lyon E. Mutation detection using uorescent plexed molecular inversion probe genotyping:
hybridization probes and melting curve analysis. Over 10,000 targeted SNPs genotyped in a single
Expert Reviews in Molecular Diagnostics tube assay. Genome Research 2005;15(2):26975.
2001;1(1):92101. 48. Belda F, Barlow KL, Clewley JP. Subtyping HIV-1
38. Pals G. Detection of a single base substitution in by improved resolution of heteroduplexes on
single cells by melting peak analysis using dual agarose gels. Journal of Acquired Immune
color hybridization probes. In Dietmaier W, Deciency Syndromes & Human Retrovirology
Wittwer C, Sivasubramanian N, eds. Rapid Cycle 1997;16(3):21819.
Real-Time PCR Methods and Applications. 49. Gonzalez M, Gonzalez D, Lopez-Perez R, et al.
Springer, 2002, pp. 7784. Heteroduplex analysis of VDJ amplied segments
39. Reed G, Wittwer CT. Sensitivity and specicity of from rearranged IgH genes for clonality assess-
single-nucleotide polymorphism scanning by high- ments in B-cell non-Hodgkins lymphoma: A com-
resolution melting analysis. Clinical Chemistry parison between different strategies. Haematologica
2004;50(10):174854. 1999;84(9):77984.
40. Kutyavin I, Afonina IA, Mills A, et al. 3-minor 50. Ganguly A, Rock MJ, Prockop DJ. Conformation-
groove binder-DNA probes increase sequence sensitive gel electrophoresis for rapid detection of
specicity at PCR extension temperatures. Nucleic single-base differences in double-stranded PCR
Acids Research 2000;28(2):65561. products and DNA fragments: Evidence for solvent-
41. Bennett C, Campbell MN, Cook CJ, et al. The induced bends in DNA heteroduplexes. Proceedings
LightTyper: High-throughput genotyping using u- of the National Academy of Sciences
orescent melting curve analysis. BioTechniques 1993;90:1032529.
2003;34(6):128892. 51. Ganguly A. An update on conformation sensitive
42. de Kok J, Wiegerinck ET, Giesendorf BA, et al. gel electrophoresis. Human Mutation 2002;19(4):
Rapid genotyping of single nucleotide polymor- 33442.
phisms using novel minor groove binding DNA 52. Rees W, Yager TD, Korte J, et al. Betaine can elimi-
oligonucleotides (MGB probes). Human Mutation nate the base pair composition dependence of DNA
2002;19(5):55459. melting. Biochemistry 1993;32(1):13744.
43. Van Hoeyveld EHF, Massonet C, Moens L, et al. 53. ODonovan M, Oefner PJ, Robers SC, et al. Blind
Detection of single nucleotide polymorphisms in analysis of denaturing high-performance liquid

chromatography as a tool for mutation detection. 64. Biagini R, Sammons DL, Smith JP, et al. Com-
Genomics 1998;15(1):4449. parison of a multiplexed uorescent covalent
54. Keller G, Hartmann A, Mueller J, et al. Denaturing microsphere immunoassay and an enzyme-linked
high-pressure liquid chromatography (DHPLC) for immunosorbent assay for measurement of human
the analysis of somatic p53 mutations. Laboratory immunoglobulin G antibodies to anthrax toxins.
Investigation 2001;81(12):173537. Clinical and Diagnostic Laboratory Immunology
55. Narayanswami G, Taylor PD. Improved effi- 2004;11(11):5055.
ciency of mutation detection by denaturing high- 65. Ye S, Humphries S, Green F. Allele-specic ampli-
performance liquid chromatography using modied cation by tetra-primer PCR. Nucleic Acids
primers and hybridization procedure. Genetic Research 1992;20(5):1152.
Testing 2001;5(1):916. 66. Ye S, Dhillon S, Ke X, et al. An efficient procedure
56. Schollen E, Dequeker E, McQuaid S, et al. for genotyping single nucleotide polymorphisms.
Diagnostic DHPLC quality assurance (DDQA): A Nucleic Acids Research 2001;29(17).
collaborative approach to the generation of vali- 67. Oliphant A, Barker DL, Stuelpnagel JR, et al. Bead
dated and standardized methods for DHPLC-based Array technology: Enabling an accurate, cost-
mutation screening in clinical genetics laboratories. effective approach to high-throughput genotyping.
Human Mutation 2005;25(6):58392. BioTechniques 2002;32:s56s61.
57. Wen W, Bernstein L, Lescallett J, et al. Comparison 68. Louis M, Dekairelle AF, Gala JL. Rapid combined
of TP53 mutations identied by oligonucleotide genotyping of factor V, prothrombin and methyl-
microarray and conventional DNA sequence analy- enetetrahydrofolate reductase single nucleotide
sis. Cancer Research 2000;60(10):271622. polymorphisms using minor groove binding
58. Moutereau S, Narwa R, Matheron C, et al. An DNA oligonucleotides (MGB probes) and real-
improved electronic microarray-based diagnostic time polymerase chain reaction. Clinical Chem-
assay for identication of MEFV mutations. Human istry and Laboratory Medicine 42 2004;12
Mutation 2004;23(6):62128. (13641369).
59. Lopez-Crapez E, Livache T, Marchand J, et al. 69. Behrens M, Lange R. A highly reproducible and
K-ras mutation detection by hybridization to a economically competitive SNP analysis of several
polypyrrole DNA chip. Clinical Chemistry 2001; well characterized human mutations. Clinical
47:18694. Laboratory 2004;50(56):30516.
60. Fedrigo O, Naylor G. A gene-specic DNA 70. Osgood-McWeeneya D, Galluzzi JR, Ordovas JM.
sequencing chip for exploring molecular evolution- Allelic discrimination for single nucleotide poly-
ary change. Nucleic Acids Research 2004;32(3): morphisms in the human scavenger receptor class B
120813. type 1 gene locus using uorescent probes. Clinical
61. Fulton R, McDade RL, Smith PL, et al. Advanced Chemistry 2000;46:11819.
multiplexed analysis with the FlowMetrix system. 71. Gopalraj R, Zhu H, Kelly JF, et al. Genetic associa-
Clinical Chemistry 1997;43(9):174956. tion of low density lipoprotein receptor and
62. Martins T. Development of internal controls for the Alzheimers disease. Neurobiology and Aging
Luminex instrument as part of a multiplex seven- 2005;26(1):17.
analyte viral respiratory antibody prole. Clinical 72. Hughes D, Ginolhac SM, Coupier I, et al. Common
and Diagnostic Laboratory Immunology 2002;9(1): BRCA2 variants and modication of breast and
4145. ovarian cancer risk in BRCA1 mutation carriers.
63. Bortolin S, Black M, Modi H, et al. Analytical vali- Cancer Epidemiology Biomarkers and Prevention
dation of the tag-it high-throughput microsphere- 2005;14(1):26567.
based universal array genotyping platform: 73. Campsall P, Au NH, Prendiville JS, et al. Detection
Application to the multiplex detection of a panel of and genotyping of varicella-zoster virus by TaqMan
thrombophilia-associated single-nucleotide polymor- allelic discrimination real-time PCR. Journal of
phisms. Clinical Chemistry 2004;50(11):202836. Clinical Microbiology 2004;42(4):140913.

74. Easterday W, Van Ert MN, Zanecki S, et al. Specic cal applications. Clinical Biochemistry 2005;38(4):
detection of Bacillus anthracis using TaqMan mis- 33550.
match amplication mutation assay. BioTechniques 87. Buyse I, McCarthy SE, Lurix P, et al. Use of
2005;38(5):73135. MALDI-TOF mass spectrometry in a 51-mutation
75. Lancaster J, Berchuck A, Futreal PA, et al. Dideoxy test for cystic brosis: Evidence that 3199del6 is a
ngerprinting assay for BRCA1 mutation analysis. disease-causing mutation. Genetics in Medicine
Molecular Carcinogenesis 1997;19(3):17679. 2005;6(5):42630.
76. Liu Q, Feng J, Sommer SS. Bidirectional dideoxy 88. Roest P, Roberts RG, Sugino S, et al. Protein trun-
ngerpringing (Bi-ddF): A rapid method for quantication test (PTT) for rapid detection of translation-
tative detection of mutations in genomic regions of terminating mutations. Human Molecular Genetics
300600 bp. Human Molecular Genetics 1993;5(1): 1993;2:171921.
10714. 89. Zikan M, Pohlreich P , Stribrna J. Mutational
77. Larsen L, Johnson M, Brown C, et al. Automated analysis of the BRCA1 gene in 30 Czech ovarian
mutation screening using dideoxy ngerprinting and cancer patients. Journal of Genetics 2005;84(1):
capillary array electrophoresis. Human Mutation 6367.
2001;18(5):45157. 90. Hogervorst F, Cornelis R, Bout M, et al. Rapid
78. Larsen L, Christiansen M, Vuust J, et al. High detection of BRCA1 mutations by the protein trun-
throughput mutation screening by automated capil- cation test. Nature Genetics 1995;10:20812.
lary electrophoresis. Combinatorial Chemistry and 91. Romey M, Tuffery S, Desgeorges M, et al.
High Throughput Screening 2000;3:393409. Transcript analysis of CFTR frameshift mutations in
79. Hsu T, Chen X, Duan S, et al. Universal SNP geno- lymphocytes using the reverse transcription-poly-
typing assay with uorescence polarization detec- merase chain reaction technique and the protein
tion. BioTechniques 2001;31(3):56070. truncation test. Human Genetics 1996;98(3):32832.
80. Chen X, Levine L, Kwok P-Y. Fluorescence polar- 92. van der Luijt R, Khan PM, Vasen H, et al. Rapid
ization in homogeneous nucleic acid analysis. detection of translation-terminating mutations at the
Genome Research 1999;9(5):49298. adenomatous polyposis coli (APC) gene by direct
81. Xiao M, Latif SM, Kwok P-Y. Kinetic FP-TDI protein truncation test. Genomics 1994;20(1):14.
assay for SNP allele frequency determination. 93. Tsai T, Fulton L, Smith BJ, et al. Rapid identica-
BioTechniques 2003;34(1):19097. tion of germline mutations in retinoblastoma by
82. Leushner J, Chiu NH. Automated mass spectrome- protein truncation testing. Archives of
try: A revolutionary technology for clinical diagnos- Ophthalmology 2004;122:23948.
tics. Molecular Diagnostics 2000;5(4):34148. 94. Gold B, Hanson M, Dean M. Two rare confounding
83. Jurinke C, Oeth P, van den Boom D. MALDI- polymorphisms proximal to the factor V Leiden
TOF mass spectrometry: A versatile tool for mutation. Molecular Diagnostics 2001;6(2):13740.
high-performance DNA analysis. Molecular 95. DiSiena M, Intres R, Carter DJ. Factor V Leiden
Biotechnology 2004;26(2):14764. and pulmonary embolism in a young woman taking
84. Hung K, Sun X, Ding H, et al. A matrix-assisted an oral contraceptive. American Journal of Forensic
laser desorption/ionization time-of-ightbased Medical Pathology 1998;19(4):36267.
method for screening the 1691G: A mutation in the 96. Baris I, Koksal V, Etlik O. Multiplex PCR-RFLP
factor V gene. Blood Coagulation and Fibrinolysis assay for detection of factor V Leiden and pro-
2002;13(2):11722. thrombin G20210A. Genetic Testing 2004;8(4):381.
85. Stanssens P, Zabeau M, Meersseman G, et al. High- 97. Huber S, McMaster KJ, Voelkerding KV. Analytical
throughput MALDI-TOF discovery of genomic evaluation of primer engineered multiplex poly-
sequence polymorphisms. Genome Research 2004; merase chain reactionrestriction fragment length
14(1):12633. polymorphism for detection of factor V Leiden and
86. Tost J, Gut IG. Genotyping single nucleotide poly- prothrombin G20210A. Journal of Molecular
morphisms by MALDI mass spectrometry in clini- Diagnostics 2000;2:15357.

98. Lucotte G, Champenois T. Duplex PCR-RFLP for Invader assay. Molecular Diagnostics 1999;4(4):
simultaneous detection of factor V Leiden and pro- 35364.
thrombin G20210A. Molecular and Cellular 110. Hessner M, Budish MA, Friedman KD. Genotyp-
Probes 2003;17(5):26769. ing of factor V G1691A (Leiden) without the use
99. Welbourn J, Maiti S, Paley J. Factor V Leiden of PCR by invasive cleavage of oligonucleotide
detection by polymerase chain reactionrestriction probes. Clinical Chemistry 2000;46(8):10511056.
fragment length polymorphism with mutagenic 111. Patnaik M, Dlott JS, Fontaine RN, et al. Detection
primers in a multiplex reaction with Pro G20210A: of genomic polymorphisms associated with
A novel technique. Hematology 2003;8(2):7375. venous thrombosis using the invader biplex assay.
100. Howard J, Ward J, Watson JN, et al. Heteroduplex Journal of Molecular Diagnostics
cleavage analysis using S1 nuclease. BioTechni- 2004;6(2):13744.
ques 1999;27(1):1819. 112. Ryan D, Nuccie B, Arvan D. Non-PCR-dependent
101. Hawkins G, Hoffman LM. Base excision sequence detection of the factor V Leiden mutation from
scanning. Nature Biotechnology 1997;15(8): genomic DNA using a homogeneous invader
803804. microtiter plate assay. Molecular Diagnostics
102. Hawkins G, Hoffman LM. Rapid DNA mutation 1999;4(2):13544.
identication and ngerprinting using base exci- 113. Hjertner B, Meehan B, McKillen J, et al. Adapta-
sion sequence scanning. Electrophoresis 1999;20 tion of an invader assay for the detection of
(6):117176. African swine fever virus DNA. Journal
103. Goldrick M, Kimball GR, Liu Q, et al. NIRCA: A of Virological Methods 2005;124(12):110.
rapid robust method for screening for unknown 114. Cotton R, Rodrigues NR, Campbell RD.
point mutations. BioTechniques 1996;21(1): Reactivity of cytosine and thymine in single
10612. base-pair mismatches with hydroxylamine
104. Macera M, Godec CJ, Sharma N, et al. Loss of and osmium tetroxide and its application to
heterozygosity of the TP53 tumor suppressor gene the study of mutations. Proceedings of the
and detection of point mutations by the non- National Academy of Sciences 1988;85(12):
isotopic RNAse cleavage assay in prostate cancer. 43974401.
Cancer Genetics and Cytogenetics 1999;108(1): 115. Fuhrmann M, Oertel W, Berthold P, et al. Removal
4247. of mismatched bases from synthetic genes by
105. Shen D, Wu Y, Subbarao M, et al. Mutation analy- enzymatic mismatch cleavage. Nucleic Acids
sis of BRCA1 gene in African-American patients Research 2005;33(6):e58.
with breast cancer. Journal of the National 116. Freson K, Peerlinck K, Aguirre T, et al.
Medical Association 2000;92(1):2935. Fluorescent chemical cleavage of mismatches for
106. Shen D, Wu Y, Chillar R, et al. Missense alter- efficient screening of the factor VIII gene. Human
ations of BRCA1 gene detected in diverse cancer Mutation 1999;11(6):47079.
patients. Anticancer Research 2000;20:112932. 117. Rowley G, Saad S, Gianelli F, et al. Ultrarapid
107. Lyamichev V, Mast AL, Hall JG, et al. Polymor- mutation detection by multiplex, solid-phase
phism identication and quantitative detection of chemical cleavage. Genomics 1995;30:57482.
genomic DNA by invasive cleavage of oligonu- 118. Ingans M, Byding S, Eckersten A, et al.
cleotide probes. Nature Biotechnology 1999;17(3): Enzymatic mutation detection in the P53 gene.
29296. Clinical Chemistry 2000;46:156273.
108. Hall J, Eis PS, Law SM, et al. Sensitive detection 119. Qiu P, Shandilya H, DAlessio JM, et al. Mutation
of DNA polymorphisms by the serial invasive sig- detection using Surveyor nuclease. BioTechniques
nal amplication reaction. Proceedings of the 2004;36(4):702707.
National Academy of Sciences 2000;97:827277. 120. Tessitore A, Di Rocco ZC, Cannita K, et al.
109. Kwiatkowski RW, de Arruda M, Neri B. Clinical, High sensitivity of detection of TP53 somatic
genetic, and pharmacogenetic applications of the mutations by uorescence-assisted mismatch

analysis. Genes Chromosomes Cancer 2002; 132. Stamer U, Bayerer B, Wolf S, et al. Rapid and
35(1):8691. reliable method for cytochrome P450 2D6
121. Benoit N, Goldenberg D, Deng SX, et al. Colori- genotyping. Clinical Chemistry 2002;48(9):
metric approach to high-throughput mutation 141217.
analysis. BioTechniques 2005;38(4):63539. 133. Yamanoshita O, Kubota T, Hou J, et al. DHPLC is
122. Espasa M, Gonzalez-Martin J, Alcaide F, Aragon superior to SSCP in screening p53 mutations in
LM, et al. Direct detection in clinical samples of esophageal cancer tissues. International Journal
multiple gene mutations causing resistance of of Cancer 2005;114(1):7479.
Mycobacterium tuberculosis to isoniazid and 134. Premstaller A, Oefner PJ. Denaturing HPLC
rifampicin using uorogenic probes. Journal of of nucleic acids. PharmaGenomics 2003;20:
Antimicrobial Chemotherapy 2005;55:86065. 2137.
123. Antonarakis S, Nomenclature Working Group. 135. Metaxa-Mariatou V, Papadopoulos S, Papado-
Recommendations for a nomenclature system for poulou E, et al. Molecular analysis of GISTs:
human gene mutations. Human Mutation 1998; Evaluation of sequencing and dHPLC. DNA and
11:13. Cell Biology 2004;23(11):77782.
124. den Dunnen J, Antonarakis SE. Mutation nomen- 136. Hecker K, Taylor PD, Gjerde DT. Mutation detec-
clature extensions and suggestions to describe tion by denaturing DNA chromatography using
complex mutations. Human Mutation 2000;15: uorescently labeled polymerase chain reaction
712. products. Analytical Biochemistry 1999;272:
125. Barros F, Lareu MV, Salas A, et al. Rapid and 15664.
enhanced detection of mitochondrial DNA varia- 137. Bahrami A, Dickman MJ, Matin MM, et al. Use
tion using single-strand conformation analysis of of uorescent DNA-intercalating dyes in the
superposed restriction enzyme fragments from analysis of DNA via ion-pair reversed phase dena-
polymerase chain reaction-amplied products. turing high-performance liquid chromatography.
Electrophoresis 1997;18(1):5254. Analytical Biochemistry 2002;309:24852.
126. Hayashi K, Yandell DW. How sensitive is PCR- 138. Heller M, Forster AH, Tu E. Active microeletronic
SSCP? Human Mutation 1993;2(5):33846. chip devices which utilize controlled electrophore-
127. Fodde R, Losekoot M. Mutation detection by tic elds for multiplex DNA hybridization and
denaturing gradient gel electrophoresis (DGGE). other genomic applications. Electrophoresis 2000;
Human Mutation 1994;3(2):8394. 21(1):15764.
128. Hanekamp J, Thilly WG, Chaudhry MA. 139. Juszczynski P, Woszczek G, Borowiec M, et al.
Screening for human mitochondrial DNA poly- Comparison study for genotyping of a single-
morphisms with denaturing gradient gel elec- nucleotide polymorphism in the tumor necrosis
trophoresis. Human Genetics 1996;98:24345. factor promoter gene. Diagnostic Molecular
129. Chen T-J, Boles RG, Wong L-JC. Detection of Pathology 2002;11(4):22833.
mitochondrial DNA mutations by temporal tem- 140. Ellis M. Spot-on SNP genotyping. Genome
perature gradient gel electrophoresis. Clinical Research 2000;10(7):89597.
Chemistry 1999;45:116267. 141. Geisler J, Hatterman-Zogg MA, Rathe JA, et al.
130. Wang Y, Helland A, Holm R, et al. TP53 muta- Ovarian cancer BRCA1 mutation detection:
tions in early-stage ovarian carcinoma: Relation Protein truncation test (PTT) outperforms single-
to long-term survival. British Journal of Cancer strand conformation polymorphism analysis
2004;90:67885. (SSCP). Human Mutation 2001;18(4):33744.
131. Wallace R, Shaffer J, Murphy RF, et al. Hybridi- 142. Brieger A, Trojan J, Raedle J, et al. Identication
zation of synthetic oligodeoxyribonucleotides of germline mutations in hereditary nonpolyposis
to phi chi 174 DNA: The effect of single base- colorectal cancer using base excision sequence
pair mismatch. Nucleic Acids Research 1979;6 scanning analysis. Clinical Chemistry 1999;45:
(11):3543. 156467.

143. Matsuno N, Nanri T, Kawakita T, et al. A novel 145. Hessner M, Friedman KD, Voelkerding K, et al.
FLT3 activation loop mutation N841K in acute Multisite study for genotyping of the factor
myeloblastic leukemia. Leukemia 2005;19:48081. II (prothrombin) G20210A mutation by the
144. Waldron-Lyncha F, Adamsa C, Shanahanb F, et al. Invader assay. Clinical Chemistry 2001;47:
Genetic analysis of the 3 untranslated region of 204850.
the tumour necrosis factor shows a highly con- 146. Sheffield V, Beck JS, Kwitek AE, et al. The sensi-
served region in rheumatoid arthritisaffected tivity of single-strand conformation polymorphism
and unaffected subjects. Journal of Medical analysis for the detection of single base substitu-
Genetics 1999;36:21416. tions. Genomics 1993;16(2):325.
DNA Sequencing
OUTLINE OBJECTIVES
DIRECT SEQUENCING Compare and contrast the chemical (Maxam/Gilbert) and
Manual Sequencing the chain termination (Sanger) sequencing methods.
Automated Fluorescent Sequencing
List the components and the molecular reactions that
PYROSEQUENCING
occur in chain termination sequencing.
BISULFITE DNA SEQUENCING
Discuss the advantages of dye primer and dye terminator
BIOINFORMATICS
sequencing.
THE HUMAN GENOME PROJECT
Derive a text DNA sequence from raw sequencing data.
Describe examples of alternative sequencing methods,
such as bisulte sequencing and pyrosequencing.
Dene bioinformatics and describe electronic systems
for the communication and application of sequence
information.
Recount the events of the Human Genome Project.
203

In the clinical laboratory, DNA sequence information

(the order of nucleotides in the DNA molecule) is used
routinely for a variety of purposes, including detecting
Advanced Concepts
mutations, typing microorganisms, identifying human To make a radioactive sequence template, (-32P)
haplotypes, and designating polymorphisms. Ultimately, ATP can be added to the 5 end of a fragment, using
targeted therapies will be directed at abnormal DNA T4 polynucleotide kinase, or the 3 end, using termi-
sequences detected by these techniques.1 nal transferase plus alkaline hydrolysis to remove
excess adenylic acid residues. Double-stranded frag-
ments labeled only at one end are also produced by
Direct Sequencing using restriction enzymes to cleave a labeled frag-
The importance of knowing the order, or sequence, of ment asymmetrically, and the cleaved products are
nucleotides on the DNA chain was appreciated in the ear- isolated by gel electrophoresis. Alternatively, dena-
liest days of molecular analysis. Elegant genetic experi- tured single strands are labeled separately, or a
ments with microorganisms detected molecular changes sticky end of a restriction site is lled in incorpo-
indirectly at the nucleotide level. rating radioactive nucleotides with DNA poly-
Indirect methods of investigating nucleotide sequence merase.
differences are still in use. Molecular techniques, from
Southern blot to the mutation detection methods de-
scribed in Chapter 9, are aimed at identifying nucleotide piperidine, the single-stranded DNA will break at spe-
changes. Without knowing the nucleotide sequence of the cic nucleotides (Table 10.1).
targeted areas, results from many of these methods would After the reactions, the piperidine is evaporated, and
be difficult to interpret; in fact, some methods would not the contents of each tube are dried and resuspended in
be useful at all. Direct determination of the nucleotide formamide for gel loading. The fragments are then sepa-
sequence, or DNA sequencing, is the most denitive rated by size on a denaturing polyacrylamide gel
molecular method to identify genetic lesions. (Chapter 5). The denaturing conditions (formamide, urea,
and heat) prevent the single strands of DNA from hydro-
gen bonding with one another or folding up so that they
Manual Sequencing
Direct determination of the order, or sequence, of
nucleotides in a DNA polymer is the most specic and
direct method for identifying genetic lesions (mutations)
or polymorphisms, especially when looking for changes DMS FA H H+S
affecting only one or two nucleotides. Two types of
sequencing methods have been used most extensively:
the Maxam-Gilbert method2 and the Sanger method.3
Chemical (Maxam-Gilbert) Sequencing G G C C

The Maxam-Gilbert chemical sequencing method was G A T C
G A T C
developed in the late 1970s by Allan M. Maxam and G G C C
Walter Gilbert. Maxam-Gilbert sequencing requires a A T
double- or single-stranded version of the DNA region to G C
be sequenced, with one end radioactively labeled. G C
A T
For sequencing, the labeled fragment, or template, is
Figure 10-1 Chemical sequencing proceeds in four sepa-
aliquoted into four tubes. Each aliquot is treated with a rate reactions in which the labeled DNA fragment is selec-
different chemical with or without high salt (Fig. 10-1). tively broken at specic nucleotides. (DMS-dimethylsulphate;
Upon addition of a strong reducing agent, such as 10% FA-formic acid; H-hydrazine; H+S=hydrazine+salt)

DNA Sequencing Chapter 10 205
Table 10.1 Specic Base Reactions in Maxam-Gilbert Sequencing

Chain breaks at: Base Modier Reaction Time (min at 25C)
G Dimethylsulphate Methylates G 4
GA Formic acid Protonates purines 5
TC Hydrazine Splits pyrimidine rings 8
C Hydrazine salt Splits only C rings 8
migrate through the gel strictly according to their size. Dideoxy (Sanger) Sequencing
The migration speed is important because single-base The original dideoxy chain termination sequencing
resolution is required to interpret the sequence properly. methods required a single-stranded template. Templates
After electrophoresis, the gel apparatus is disassem- up to a few thousand bases long could be produced using
bled; the gel is removed to a sheet of lter paper, and it is M13 bacteriophage, a bacterial virus with a single-
dried on a gel dryer. The dried gel is exposed to light- stranded DNA genome. This virus replicates by infecting
sensitive lm. Alternatively, wet gels can be exposed Escherichia coli, in which the viral single-stranded cir-
directly. An example of Maxam-Gilbert sequencing cular genome is converted to a double-stranded plasmid,
results is shown in Figure 10-2. The sequence is inferred called the replication factor (RF). The plasmid codes for
from the bands on the lm. The smallest (fastest-migrat-
ing) band represents the base closest to the labeled end of 3
the fragment. The lane in which that band appears identi- T
G
es the nucleotide. Bands in the purine (G A) or pyrim- G G+A C+T C
C
idine (C T) lane are called based on whether they are T
also present in the G- or C-only lanes. Note how the T
T
sequence is read from the bottom (5 end of the DNA mol- A
ecule) to the top (3 end of the molecule) of the gel. G
Although Maxam-Gilbert sequencing is a relatively A
efficient way to determine short runs of sequence data, A
T
the method is not practical for high throughput sequenc- A
ing of long fragments. In addition, the hazardous chemi- T
cals hydrazine and piperidine require more elaborate C
G
precautions for use and storage. This method has there- A
fore been replaced by the dideoxy chain termination G
sequencing method for most sequencing applications. C
A
T
G
C
Advanced Concepts C
A
5
Polyacrylamide gels from 6% to 20% are used for Figure 10-2 Products of a Maxam-Gilbert sequencing
sequencing. Bromophenol blue and xylene cyanol reaction. The gel is read from the bottom to the top. The size
loading dyes are used to monitor the migration of of the fragments gives the order of the nucleotides. The
nucleotides are inferred from the lane in which each band
the fragments. Run times range 12 hours for short
appears. A or T is indicated by bands that appear in the G
fragments (up to 50 bp) to 78 hours for longer frag- A lane or C T lane, respectively, but not in the G lane or the
ments (more than 150 bp). C lane. G is present in the G A lane and the G lane. C is
present in the C T lane and the C lane.

viral gene products that use the bacterial transcription M13 bacteriophage (ssDNA)
and translation machinery to make new single-stranded
genomes and viral proteins. To use M13 for template
preparation, the RF is isolated from infected bacteria, cut
with restriction enzymes, and the fragment to be
sequenced is ligated into the RF (Fig. 10-3). When the E. coli
recombined RF is reintroduced into the host bacteria,
M13 continues its life cycle producing new phages, some
of which carry the inserted fragment. When the phages
are spread on a lawn of host bacteria, plaques (clear
spaces) of lysed bacteria formed by phage replication
contain pure populations of recombinant phage. The sin-
gle-stranded DNA can then be isolated from the phage by
picking plugs of agar from the plaques and boiling them
to isolate the single-stranded phage DNA.
Dideoxy chain termination (Sanger) sequencing is a
modication of the DNA replication process. A short,
synthetic single-stranded DNA fragment (primer) com-
plementary to sequences just 5 to the region of DNA to
be sequenced is used for priming dideoxy sequencing Insert fragment
to be sequenced
reactions (Fig. 10-4). For detection of the products of the RF (dsDNA)
sequencing reaction, the primer may be attached cova-
lently at the 5 end to a 32P-labeled nucleotide or a uo-
rescent dye-labeled nucleotide. An alternative detection
strategy is to incorporate 32P- or 35S-labeled deoxynu-
cleotides in the nucleotide sequencing reaction mix. The
latter is called internal labeling.
Just as in the in vivo DNA replication reaction, an in
vitro DNA synthesis reaction would result in polymer-
ization of deoxynucleotides to make full-length copies of
the DNA template (DNA replication is discussed in
Chapter 1). For sequencing, modied dideoxynucleotide
(ddNTP) derivatives are added to the reaction mixture.
Dideoxynucleotides lack the hydroxyl group found on
the 3 ribose carbon of the deoxynucleotides (dNTPs; Recombinant
M13 bacteriophages
Advanced Concepts Lawn of bacteria

with M13 plaques
Because of extensive use of M13, a primer that containing ssDNA
hybridizes to M13 sequences could be used to
sequence any fragment. This primer, the M13 uni-
versal primer, is still used in some applications, Figure 10-3 Preparation of single-stranded sequencing
template using M13 bacteriophage. The engineered RF is
even though the M13 method of template prepara- replicated as the phage genome. The template is isolated
tion is no longer practical. from plaques made by pure clones of recombinant phage
on a lawn of bacteria.

Primer Nitrogen base Nitrogen base

5 OP 3 OH
3 T C G A C G G G C 5 HOCH2 O HOCH2 O
Template
C C C C
Area to be
sequenced C C C C
Figure 10-4 Manual dideoxy sequencing requires a single- OH H H H
stranded version of the fragment to be sequenced (tem-
plate). Sequencing is primed with a short synthetic piece of dNTP ddNTP
DNA complementary to bases just before the region to be Figure 10-5 A dideoxynucleotide (right) lacks the hydroxyl
sequenced (primer). The sequence of the template will be group on the 3 ribose carbon that is required for formation of
determined by extension of the primer in the presence of a phosphodiester bond with the phosphate group of another
dideoxynucleotides. nucleotide.
Fig. 10-5). DNA synthesis will stop upon incorporation synthesized chain will terminate, therefore, with the
of a ddNTP into the growing DNA chain (chain termina- ddNTP (Fig. 10-6).
tion) because without the hydroxyl group at the 3 sugar To perform a manual dideoxy sequencing reaction, a
carbon, the 5-3 phosphodiester bond cannot be estab- 1:1 mixture of template and primer is placed into four
lished to incorporate a subsequent nucleotide. The newly separate reaction tubes in sequencing buffer (Fig. 10-7).
Growing strand
O P O O P O
Template strand
O O
H2 C O H2 C O
A T A T
CH CH2 CH CH2
HC CH2 HC CH2
O O
O P O O P O
O O
H2C O H2C O
G C G C
CH CH2 CH CH2
HC CH2 HC CH2
OH
O O O O O O

O P O P O P O O P O P O P O
C G C G
O O O O O O
H2 C O H2C O
CH CH CH CH
HC CH2 HC CH2
OH OH
Figure 10-6 DNA replication (left) is terminated by the absence of the 3 hydroxyl group on the
dideoxyguanosine nucleotide (ddG, right). The resulting fragment ends in ddG.

Advanced Concepts ddATP + four dNTPs ddA

A dAdGdCdTdGdCdCdCdG
PCR products are often used as sequencing tem-
plates. It is important that the amplicons to be used
as sequencing templates are free of residual compo-
nents of the PCR reaction, especially primers and ddCTP + four dNTPs dAdGddC
nucleotides. These reactants can interfere with the C dAdGdCdTdGddC
sequencing reaction and lower the quality of the dAdGdCdTdGdCddC
dAdGdCdTdGdCdCddC
sequencing ladder. PCR amplicons can be cleaned
by adherence and washing on solid phase (column dAddG
ddGTP + four dNTPs
or bead) matrices, alcohol precipitation, or enzyma- G dAdGdCdTddG
tic digestion with alkaline phosphatase. Alterna- dAdGdCdTdGdCdCdCddG
tively, amplicons can be run on an agarose gel and
the bands eluted. The latter method provides not
only a clean template but also conrmation of the ddTTP + four dNTPs dAdGdCddT
T dAdGdCdTdGdCdCdCdG
product being sequenced. It is especially useful
when the PCR reactions are not completely free of
misprimed bands or primer dimers (see Chapter 7). Figure 10-7 Components required for DNA synthesis
(template, primer, enzyme, buffers, dNTPs) are mixed with
a different ddNTP in each of four tubes (left). With the proper
ratio of ddNTPs:dNTPs, the newly synthesized strands
of DNA will terminate at each opportunity to incorporate
Sequencing buffer is usually provided with the sequenc- a ddNTP. The resulting synthesis products are a series of
fragments ending in either A (ddATP), C (ddCTP), G (ddGTP)
ing enzyme and contains ingredients necessary for the
or T (ddTTP). This collection of fragments is the sequencing
polymerase activity. Mixtures of all four dNTPs and one ladder.
of the four ddNTPs are then added to each tube, with a
different ddNTP in each of the four tubes.
The ratio of ddNTPs:dNTPs is critical for generation
of a readable sequence. If the concentration of ddNTPs is
too high, polymerization will terminate too frequently
Advanced Concepts
early along the template. If the ddNTP concentration is Manganese (Mn) may be added to the sequencing
too low, infrequent or no termination will occur. In the reaction to promote equal incorporation of all dNTPs
beginning days of sequencing, optimal ddNTP:dNTP by the polymerase enzyme.31,32 Equal incorporation
ratios were determined empirically (by experimenting of the dNTPs makes for uniform band intensities
with various ratios). Modern sequencing reagent mixes on the sequencing gel, which eases interpretation of
have preoptimized nucleotide mixes. the sequence. Manganese increases the relative
With the addition of DNA polymerase enzyme to the incorporation of ddNTPs as well, which will
four tubes, the reaction begins. After about 20 minutes, enhance the reading of the rst part of the sequence
the reactions are terminated by addition of a stop buffer. by increasing intensity of the smaller bands on the
The stop buffer consists of 20 mM EDTA to chelate gel. Modied nucleotides, deaza-dGTP and deoxy-
cations and stop enzyme activity, formamide to denature inosine triphosphate (dITP), are also added to
the products of the synthesis reaction, and gel loading sequencing reaction mixes to deter secondary struc-
dyes (bromophenol blue and/or xylene cyanol). It is ture in the synthesized fragments. Additives such as
important that all four reactions be carried out for equal Mn, deaza-dGTP, and dITP are supplied in preop-
time. Maintaining equal reaction times will provide con- timized concentrations in commercial sequencing
sistent band intensities in all four lanes of the gel buffers.
sequence, which facilitates nal reading of the sequence.

The sets of synthesized fragments are then loaded onto the next nucleotide in the sequence. In the gure, the next
a denaturing polyacrylamide gel (see Chapter 5 for more largest band is found in the ddGTP lane, so the next base
details about polyacrylamide gel electrophoresis). The is a G. The sequence is thus read from the bottom (small-
products of each of the sequencing reactions are loaded est, 5-most) to the top (largest, 3-most) fragments across
into four adjacent lanes, labeled A, C, G, or T, correspon- or within lanes to determine the identity and order of
ding to the ddNTP in the four reaction tubes. Once the gel nucleotides in the sequence.
is dried and exposed to x-ray lm, the fragment patterns Depending on the reagents and gel used, the number of
can be visualized from the signal on the 32P-labeled bases per sequence read averages 300400. Advances in
primer or nucleotide. All fragments from a given tube will enzyme and gel technology have increased this capability
end in the same ddNTP; for example, all the fragments to over 500 bases per read. Sequencing reads can also be
synthesized in the ddCTP tube end in C. The four-lane gel lengthened by loading the same ladders in intervals of
electrophoresis pattern of the products of the four 26 hours so that the larger bands are resolved with
sequencing reactions is called a sequencing ladder (Fig. longer (e.g., 8-hour) migrations, whereas smaller bands
10-8). The ladder is read to deduce the DNA sequence. will be resolved simultaneously in a 12hour migration
From the bottom of the gel, the smallest (fastest- that was loaded 67 hours later.
migrating) fragment is the one in which synthesis termi- Sequencing technology has been improved sig-
nated closest to the primer. The identity of the ddNTP at nicantly from the rst routine manual sequencing
a particular position is determined by the lane in which procedures. Recombinant polymerase enzymes, such as
the band appears. If the smallest band is in the ddATP Sequenase,4 and the heat stable enzymes Thermoseque-
lane, then the rst base is an A. The next larger fragment nase5 and Therminator are now available; in vitro removal
is the one that was terminated at the next position on the of the exonuclease activity of these enzymes makes them
template. The lane that has the next larger band identies faster and more processive (i.e., they stay with the tem-
A C T G A C T G
3
G
T 3
C
A
A
C Gel area more
T difficult to read
G
A
A
T
C
C
C
T
Figure 10-8 A sequencing ladder is read G
C
from the bottom of the gel to the top. The small-
G
est (fastest migrating) fragment represents the A 5
rst nucleotide attached to the primer by the 5
polymerase. Since that fragment is in lane A,
from the reaction that contained ddATP (left),
the sequence read begins with A. The next 5 AGCGTCCCTAAGTCAACTG 3
largest fragment is in lane G. The sequence,
then, reads AG. The next largest fragment is in
lane C, making the sequence AGC, and so
forth up the gel. Larger bands on a sequencing
gel can sometimes be compressed, limiting the
length of sequence that can be read on a sin-
gle gel run (right).

plate longer, producing longer sequencing ladders). In

addition, these engineered enzymes more efficiently
incorporate ddNTPs and nucleotide analogs such as dITP
Advanced Concepts
(deoxyinosine triphosphate) or 7-deaza-dGTP, which are Fluorescent dyes used for automated sequencing
used to deter secondary structure (internal folding and include uorescein and rhodamine dyes and Bodipy
hybridization) in the template and sequencing products. (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene) dye
Furthermore, most sequencing methods in current use are derivatives that are recognized by commercial
performed with double-stranded templates, eliminating detection systems.16,33 Automated sequence readers
the tedious preparation of single-stranded versions of the excite the dyes with a laser and detect the emitted
DNA to be sequenced. uorescence at predetermined wavelengths. More
Using the heat-stable enzymes such as Therminator and advanced methods have been proposed to enhance
Thermosequenase, the sequencing reaction can be per- the distinction between the dyes for more accurate
formed in a thermal cycler (cycle sequencing). With cycle determination of the sequence.34
sequencing, timed manual starting and stopping of the
sequencing reactions are not necessary. The labor savings
in this regard increase the number of reactions that can be
performed simultaneously; for example, a single operator the reaction mixes can be read in the same lane of a gel
can set up 96 sequencing reactions (i.e., sequence 24 frag- or on a capillary. Fluorescent dye color rather than lane
ments) in a 96-well plate. Finally, improvements in uo- placement will assign the fragments as ending in A, T, G,
rescent dye technology have led to the automation of the or C in the sequencing ladder (Fig. 10-9).
sequencing process and, more importantly, sequence
determination. Approaches to Automated Sequencing
There are two approaches to automated uorescent
sequencing: dye primer and dye terminator sequencing
Automated Fluorescent Sequencing (Fig. 10-10). The goal of both approaches is the same: to
The chemistry for automated sequencing is the same as label the fragments synthesized during the sequencing
described for manual sequencing, using double-stranded reaction according to their terminal ddNTP. Thus, frag-
templates and cycle sequencing. Because cycle sequenc- ments ending in ddATP, read as A in the sequence, will be
ing (unlike manual sequencing) does not require sequen- labeled with a green dye; fragments ending in ddCTP,
tial addition of reagents to start and stop the reaction, read as C in the sequence, will be labeled with a blue
cycle sequencing is more easily adaptable to high-
throughput applications and automation.6 Universal sys-
G A T C
tems combine automation of DNA isolation of the
template and setup of the sequencing reactions. For exam-
ple, the Qiagen BioRobot 9600 can isolate template DNA G
T
and set up the sequencing reactions for cycle sequencing
C
of 48 samples in 35 minutes.
T
Electrophoresis and reading of the sequencing ladder G
can also be automated. A requirement for automated A
reading of the DNA sequence ladder is the use of uo-
rescent dyes instead of radioactive nucleotides to label Gel electrophoresis
the primers or sequencing fragments.
Capillary electrophoresis
Fluorescent dyes used for sequencing have distinct
Figure 10-9 Instead of four gel lanes (left) uorescent
colors, or peak wavelengths of uorescence emission, fragments can be run in a single gel lane or in a capillary
that can be distinguished by automated sequencers. The (right). Note that the sequence of nucleotides, AGTCTG,
advantage of having four distinct colors is that all four of read by lane in the slab gel is read by color in the capillary.

(A) Automated dye primer sequencing (B) Automated dye terminator sequencing
Dye primer Primer
A
A Dye terminators
ACCGTA
ddATP ACCGTA AC
ddATP Dye
terminator ACCGTAT
ddCTP ACC
removal
ddGTP ACCG Completed
ACCGT sequencing
ddTTP reaction
ACCGTAT
AC
ddCTP ACC
Ethanol
ACCGTAT
precipitation
Completed
sequencing
reaction
ddGTP ACCG
ACCGT
ddTTP ACCGTAT
Figure 10-10 Fluorescent sequencing chemistries. Dye primer sequencing uses labeled primers (A). The products of all four
reactions are resolved together in one lane of a gel or in a capillary. Using dye terminators (B) only one reaction tube is neces-
sary, since the fragments can be distinguished directly by the dideoxynucleotides on their 3 ends.
dye; fragments ending in ddGTP, read as G in the labels. The primer labeled with each color is added to
sequence, will be labeled with a black or yellow dye; four separate reaction tubes, one each with ddATP,
and fragments ending in ddTTP, read as T in the sequence, ddCTP, ddGTP, or ddTTP, as shown in Figure 10-10.
will be labeled with a red dye. This facilitates reading After addition of the rest of the components of the
of the sequence by the automated sequence. sequencing reaction (see the section above on manual
In dye primer sequencing, the four different uores- sequencing) and of a heat stable polymerase, the reaction
cent dyes are attached to four separate aliquots of the is subjected to cycle sequencing in a thermal cycler. The
primer. The dye molecules are attached covalently to the products of the sequencing reaction are then labeled at
5 end of the primer during chemical synthesis, resulting the 5 end, the dye color associated with the ddNTP at the
in four versions of the same primer with different dye end of the fragment.

Dye terminator sequencing is performed with one of

the four uorescent dyes attached to each of the ddNTPs
instead of to the primer. The primer is unlabeled. A major
Advanced Concepts
advantage of this approach is that all four sequencing DNA sequences with high G/C content are some-
reactions are performed in the same tube (or well of a times difficult to read due to intrastrand hybridiza-
plate) instead of in four separate tubes. After addition of tion in the template DNA. Reagent preparations that
the rest of the reaction components and cycle sequencing, include 7-deaza-dGTP (2-deoxy-7-deazaguanosine
the product fragments are labeled at the 3 end. As with triphosphate) or deoxyinosine triphosphate instead
dye primer sequencing, the color of the dye corre- of standard dGTP improve the resolution of bands in
sponds to the ddNTP that terminated the strand. regions that exhibit GC band compressions or
bunching of bands close together so that they are not
Preparation of the Sequencing Ladder resolved, followed by several bands running farther
After a sequencing reaction using uorescent dye termi- apart.
nators, excess dye terminators must be removed from the
sequencing ladder. Sequencing ladders can be cleaned
with columns or beads or by ethanol precipitation. Most tor in the automated sequencer. The laser beam excites
spin columns or bead systems bind the sequencing frag- the dye attached to each fragment, causing the dye to
ments to allow removal of residual sequencing compo- emit uorescence that is captured by the detector. The
nents by rinsing with buffers. Another approach is to bind detector converts the uorescence to an electrical signal
the dye terminators onto specially formulated magnetic that is recognized by computer software as a ash or peak
beads and recover the DNA ladder from the supernatant of color.
as the beads are held by a magnet applied to the outside Fluorescent detection equipment yields results as an
of the tube or plate. electropherogram, rather than a gel pattern. Just as the
The fragments of the sequencing ladder should be gel sequence is read from the smallest (fastest-migrating)
completely denatured before running on a gel or capillary. fragments to the largest, the automated sequencer reads,
Denaturing conditions (5060C, formamide, urea dena- or calls, the bases from the smallest (fastest-migrating)
turing gel) should be maintained as the fragments must be fragments that rst pass the detector to the largest. The
resolved strictly according to size. Secondary structure instrument calls the base by the color of the uorescence
can affect migration speed and lower the quality of the of the fragment as it passes the detector. The readout from
sequence. Before loading in a gel or capillary instrument, the instrument is a series of peaks of the four uorescent
sequence ladders are cleaned, as described above, to dyes as the bands of the sequencing ladder migrate by the
remove residual dye terminators, precipitated, and resus- detector. The software assigns one of four arbitrary colors
pended in formamide. The ladders are heated to 9598C (associated with each of the uorescent dyes) and a text
for 25 minutes and placed on ice just before loading. letter to the peaks for ease of interpretation.
As with manual sequencing, the ratio of ddNTPs:
Electrophoresis and dNTPs is key to the length of the sequence read (how
Sequence Interpretation much of the template sequence can be determined). Too
Both dye primer and dye terminator sequencing reactions many ddNTPs will result in a short sequence read. Too
are loaded onto a slab gel or capillary gel in a single lane. low a concentration of ddNTPs will result in loss of
The uorescent dye colors, rather than lane assignment, sequence data close to the primer but give a longer read,
distinguish which nucleotide is at the end of each frag- because the sequencing enzyme will polymerize further
ment. Running all four reactions together not only down the template before it incorporates a ddNTP into the
increases throughput but also eliminates lane-to-lane growing chain. The quality of the sequence (height and
migration variations that affect accurate reading of the separation of the peaks) improves away from the primer
sequence. The fragments migrate through the gel accord- and begins to decline at the end. At least 400500 bases
ing to size and pass in turn by a laser beam and a detec- can be easily read with most sequencing chemistries.

A
C
G
T
C C T T T T T G A A A T A A A G N C C T G C C C N G T A T T G C T T T A A A C A A G A T T T
10 20 30 40
C C T C T A T T G T T G G A T C A T T C G T C A C A A A A T G A T T C T G A A T T A G C G T A T C G T
60 70 80 90 100
Figure 10-11 Electropherogram showing a dye blob at the beginning of a sequence (positions 9-15). The sequence read
around this area is not accurate.
Interpretation of sequencing data from a dye primer or an electropherogram, especially if the alteration is in the
dye terminator reaction is not always straightforward. heterozygous form. Ideally, a heterozygous mutation
The quality of the electropherogram depends on the qual- appears as two peaks of different color directly on top
ity of template, the efficiency of the sequencing reaction, of one another; that is, at the same position in the
and the cleanliness of the sequencing ladder. Failure to electropherogram. The overlapping peaks should be
clean the sequencing ladder properly results in bright about half the height of the rest of the sequence.
ashes of uorescence (dye blobs) that obliterate parts of Heterozygous deletions or insertions (e.g., the BRCA
the sequence read (Fig. 10-11). Poor starting material frameshift mutations) affect all positions of the sequence
results in a poor-quality sequence that cannot be read downstream of the mutation (Fig. 10-14) and, thus,
accurately (Fig. 10-12). Clear, clean sequencing ladders are more easily detected. Somatic mutations in clinical
are read accurately by the automated reader, and a text specimens are sometimes most difficult to detect as they
sequence is generated. Sequencing software indicates the may be diluted by normal sequences that mask the
certainty of each base call in the sequence. Some pro- somatic change.
grams compare two sequences or test with reference Several software applications have been written to
sequences to identify mutations or polymorphisms. Less interpret and apply sequence data from automatic
than optimal sequences are not accurately readable by sequencers. Software that collects the raw data from the
automated detectors but can sometimes be read by an instrument is supplied with automated sequencing instru-
experienced operator. ments. Software that interprets, compares, or otherwise
It is important to sequence both strands of DNA to manipulates sequence data is sometimes supplied with
conrm sequence data. This is critical for conrmation of a purchased instrument or available on the Internet. A
mutations or polymorphisms in a sequence (Fig. 10-13). representative sample of these applications is shown in
Alterations affecting a single base pair can be subtle on Table 10.2.

A
C
G
T
G A T T C T G A A T T A G C T G T A T C G G A T T C T G G A A T T N G C T G T A T C G
80 90 100 110
Figure 10-12 Examples of good sequence quality (left) and poor sequence quality (right). Note the clean baseline on the
good sequence; that is, only one color peak is present at each nucleotide position. Automatic sequence reading software will
not accurately call a poor sequence. Compare the text sequences above the two scans.
generation of light (luminescence) when nucleotides are

Pyrosequencing added to a growing strand of DNA (Fig. 10-15). With this
Chain termination sequencing is the most widely used system, there are no gels, uorescent dyes, or ddNTPs.
method to determine DNA sequence. Other methods have The pyrosequencing reaction mix consists of a single-
been developed that yield the same information but not stranded DNA template, sequencing primer, sulfurylase
with the throughput capacity of the chain termination and luciferase, plus the two substrates adenosine 5 phos-
method. Pyrosequencing is an example of a method phosulfate (APS) and luciferin. Sequentially, one of the
designed to determine a DNA sequence without having to four dNTPs is added to the reaction. If the nucleotide is
make a sequencing ladder.7,8 This procedure relies on the complementary to the base in the template strand next to
A
C
G
T
G C T G G T G G C G T A G C T T G T G G C G T A G C T A C G C C A C A A G C
70 G 120 110 C
Figure 10-13 Sequencing of a heterozygous GT mutation in exon 12 of the ras gene. The nor-
mal codon sequence is GGT (right). The heterozygous mutation, (G/T) (center) is conrmed in the
reverse sequence, (C/A) (right).

A
C
G
T
G T A T G C A G A A A A T C T T A G A G T G T C C C A T C T G G T A A G T C A G C
G T A T G C A G A A A A T C T T A G A G T G T C C C A T C T G G T A A G T C A G C
W S M Y M S K K R W W S S M R
Figure 10-14 187 delAG mutation in the BRCA1 gene. This heterozygous dinucleotide deletion is evident in the lower
panel where, at the site of the mutation, two sequences are overlaid: the normal sequence and the normal sequence
minus two bases.
Table 10.2 Software Programs Commonly Used to Analyze and Apply Sequence Data
Software Name Application
BLAST Basic Local Alignment Search Tool Compares an input sequence with all sequences in a selected
database
GRAIL Gene Recognition and Assembly Internet Finds gene-coding regions in DNA sequences
Link
FASTA FAST-All derived from FAST-P (protein) Rapid alignment of pairs of sequences by sequence patterns
and FAST-N (nucleotide) search algo- rather than individual nucleotides
rithms
Phred Phred Reads bases from original trace data and recalls the bases,
assigning quality values to each base
Continued on following page

Table 10.2 Software Programs Commonly Used to Analyze and Apply Sequence Data (continued)
Software Name Application
Polyphred Polyphred Identies single nucleotide polymorphisms (SNPs) among the
traces and assigns a rank indicating how well the trace at a site
matches the expected pattern for an SNP
Phrap Phragment Assembly Program Uses user-supplied and internally computed data quality informa-
tion to improve accuracy of assembly in the presence of repeats
TIGR Assembler The Institute for Genomic Research Assembly tool developed by TIGR to build a consensus sequence
from smaller-sequence fragments
Factura Factura Identies sequence features such as anking vector sequences,
restriction sites, and ambiguities.
SeqScape SeqScape Mutation and SNP detection and analysis, pathogen subtyping,
allele identication, and sequence conrmation
Assign Assign Allele identication software for haplotyping
Matchmaker Matchmaker Allele identication software for haplotyping
the 3 end of the primer, DNA polymerase extends the

primer. Pyrophosphate (PPi) is released with the forma- Advanced Concepts
tion of the phosphodiester bond between the dNTP and
the primer. The PPi is converted to ATP by sulfurylase in Pyrosequencing requires a single-stranded sequenc-
the presence of APS. The ATP is used to generate a lumi- ing template. Methods using streptavidin-conjugated
nescent signal by luciferase-catalyzed conversion of beads have been devised to easily prepare the tem-
luciferin to oxyluciferin. The process is repeated with plate. First the region of DNA to be sequenced is
each of the four nucleotides again added sequentially to PCR-amplied with one of the PCR primers cova-
the reaction. The generation of a signal indicates which lently attached to biotin. The amplicons are then
nucleotide is the next correct base in the sequence. Results immobilized onto the beads and the nonbiotinylated
from a pyrosequencing reaction consist of single peaks strand denatured with NaOH. After several washings
of luminescence associated with the addition of the com- to remove all other reaction components, the
plementary nucleotide. If a sequence contains a repeated sequencing primer is added and annealed to the pure
nucleotide, for instance, GTTAC, the results would be: single-stranded DNA template.
dG peak, dT peak (double the height of the dG peak), dA
peak, dC peak.
Pyrosequencing is most useful for short- to moderate-
quencing designed to detect methylated nucleotides.12,13
sequence analysis. It is therefore used mostly for muta-
Methylation of cytosine residues in DNA is an important
tion or single nucleotide polymorphism (SNP) detection
part of regulation of gene expression and chromatin
and typing rather than for generating new sequences. It
structure (see Chapter 2). Methylated DNA is also
has been used for applications in infectious disease typ-
involved in cell differentiation and is implicated in a
ing 9,10 and HLA typing.11
number of diseases, including several types of cancer.
For bisulte sequencing, 24 g of genomic DNA is
cut with restriction enzymes to facilitate denaturation.
Bisulte DNA Sequencing The enzymes should not cut within the region to be
Bisulfite DNA sequencing, or methylation-specific sequenced. The restriction digestion products are resolved
sequencing, is a modication of chain termination se- on an agarose gel, and the fragments of the size of inter-

Step 1
Polymerase
(DNA)n + dNTP (DNA)n+1 + PPi
Step 2
Luciferin Oxiluciferin
Sulfurylase
Luciferase
APS + PPi
Light
ATP Light
Time
Step 3
Apyrase
nNTP dNDP + dNMP + phosphate
Apyrase
ATP ADP + AMP + phosphate
Nucleotide sequence
Figure 10-15 Pyrosequencing is analysis of
pyrophosphate (PPi) released when a nucleotide G C A GG CC T
base (dNTP) is incorporated into DNA (top left). The
released PPi is a cofactor for ATP generation from
adenosine 5 phosphosulfate (APS). Luciferase plus
ATP converts luciferin to oxyluciferin with the pro-
duction of light which is detected by a luminome-
ter. The system is regenerated with apyrase, that
degrades residual free dNTP and dATP (Step 3).
As nucleotides are added to the system
one at a time, the sequence is determined by
G C T A G C T
which of the four nucleotides generates a light
signal. Nucleotide added
est are puried from the gel. The puried fragments are quence C/G base pairs are not changed to U/G; that is,
denatured with heat (97C for 5 minutes) and exposed to the sequence will be altered relative to controls at the
bisulte solution (sodium bisulte, NaOH and hy- unmethylated C residues (Fig. 10-16).
droquinone) for 1620 hours. During this incubation, the Nonsequencing detection methods have also been
cytosines in the reaction are deaminated, converting them devised to detect DNA methylation, such as using restric-
to uracils, whereas the 5-methyl cytosines are unchanged. tion enzymes to detect restriction sites generated or
After the reaction, the treated template is cleaned, pre- destroyed by the CU changes. Other methods use PCR
cipitated, and resuspended for use as a template for PCR primers that will bind only to the converted or noncon-
amplication. The PCR amplicons are then sequenced verted sequences so that the presence or absence of
in a standard chain termination method. Methylation is PCR product indicates the methylation status. These
detected by comparing the treated sequence with an un- methods, however, are not always applicable to detec-
treated sequence and noting where in the treated se- tion of methylation in unexplored sequences. As the role

Methylated sequence: GTCMeAGCMeTATCTATCMeGTGCA

Treated sequence: GTCMeAGCMeTATUTATCMeGTGUA
Bioinformatics
Information technology has had to encompass the vast
Untreated reference: GTCAGCTATCTATCGTGCA amount of data arising from the growing numbers of
Treated reference: GTUAGUTATUTATUGTGUA
sequence discovery methods, especially direct sequenc-
Figure 10-16 Exposure of a sequence (top) to bisulte ing and array technology. This deluge of information
will result in conversion of unmethylated cytosines to uracils
(treated sequence). By comparing the sequence treated with
requires careful storage, organization, and indexing of
bisulte to mock treated reference sequence, the methylated large amounts of data. Bioinformatics is the merger of
cytosines will become apparent as they are not changed to biology with information technology. Part of the practice
uracil (U) by the bisulte. in this eld is biological analysis in silico; that is, by
computer rather than in the laboratory. Bioinformatics
dedicated specically to handling sequence information
of methylation and epigenetics in human disease is is sometimes termed computational biology. A list of
increasingly recognized, bisulte sequencing has become some of the terms used in bioinformatics is shown in
a popular method in the research laboratory. To date, Table 10.3. The handling of the mountains of data being
however, this method has had limited use in clinical generated requires continual renewal of stored data and a
analysis. number of databases are available for this purpose.14
Table 10.3 Bioinformatics Terminology

Term Denition
Identity The extent to which two sequences are the same
Alignment Lining up two or more sequences to search for the maximal regions of identity in order to assess the
extent of biological relatedness or homology
Local alignment Alignment of some portion of two sequences
Multiple sequence Alignment of three or more sequences arranged with gaps so that common residues are aligned together
alignment
Optimal alignment The alignment of two sequences with the best degree of identity
Conservation Specic sequence changes (usually protein sequence) that maintain the properties of the original sequence
Similarity The relatedness of sequences, the percent identity or conservation
Algorithm A xed set of commands in a computer program
Domain A discreet portion of a protein or DNA sequence
Motif A highly conserved short region in protein domains
Gap A space introduced in alignment to compensate for insertions or deletions in one of the sequences being
compared
Homology Similarity attributed to descent from a common ancestor
Orthology Homology in different species due to a common ancestral gene
Paralogy Homology within the same species resulting from gene duplication
Query The sequence presented for comparison with all other sequences in a selected database
Annotation Description of functional structures, such as introns or exons in DNA or secondary structure or functional
regions to protein sequences
Interface The point of meeting between a computer and an external entity, such as an operator, a peripheral device,
or a communications medium
GenBank The genetic sequence database sponsored by the National Institutes of Health
PubMed Search service sponsored by the National Library of Medicine that provides access to literature citations
in Medline and related databases
SwissProt Protein database sponsored by the Medical Research Council (United Kingdom)

Standard expression of sequence data is important for in lower and higher eukaryotes. The deciphering of the
the clear communication and organized storage of human genome is a hallmark of molecular biology. It
sequence data. In some cases, such as in heterozygous is a benchmark in the ongoing discovery of the molecu-
mutations, there may be more than one base or mixed lar basis for disease and the groundwork of molecu-
bases at the same position in the sequence. Polymorphic lar diagnostics. In the process of solving the human
or heterozygous sequences are written as consensus DNA sequence, genomes of a variety of clinically signif-
sequences, or a family of sequences with proportional icant organisms have also been deciphered, advancing
representation of the polymorphic bases. The Internatio- typing and predicting infectious disease treatment out-
nal Union of Pure and Applied Chemistry and the Inter- comes.
national Union of Biochemistry and Molecular Biology The rst complete genome sequence of a clinically
(IUB) have assigned a universal nomenclature for mixed, important organism was that of Epstein-Barr virus pub-
degenerate, or wobble bases (Table 10.4). The base desig- lished in 1984.15 The 170,000base pair sequence was
nations in the IUB code are used to communicate consen- determined using the M13 template preparation/chain
sus sequences and for computer input of polymorphic termination manual sequencing method. In 1985 and
sequence data. 1986 the possibility of mapping or sequencing the human
genome was discussed at meetings at the University of
California, Santa Cruz; Cold Spring Harbor, New York;
The Human Genome Project and at the Department of Energy in Santa Fe, New
From the rst description of its double helical structure in Mexico. The idea was controversial because the two to
1953 to the creation of the rst recombinant molecule ve billion dollar cost of the project might not justify the
in the laboratory in 1972, DNA and the chemical nature information gained, most of which would be sequences
of the arrangement of its nucleotides have attracted of junk, or nongene-coding DNA. Furthermore, there
interest. Gradually, this information began to accumulate, was no available technology up to the massive task. The
rst regarding simple microorganisms and then partially sequencing automation and the computer power neces-
sary to assemble the three billion bases of the human
genome into an organized sequence of 23 chromosomes
Table 10.4 IUB Universal Nomenclature was not yet developed.
for Mixed Bases Nevertheless, several researchers, including Walter
Symbol Bases Mnemonic
Gilbert (of Maxam-Gilbert sequencing), Robert Sinshei-
mer, Leroy Hood, David Baltimore, David Botstein,
A Adenine Adenine
Renato Dulbecco, and Charles DeLici, saw that the proj-
C Cytosine Cytosine
ect was feasible because technology was rapidly advanc-
G Guanine Guanine
ing toward full automation of the process. In 1982
T Thymine Thymine
Akiyoshi Wada had proposed automated sequencing
U Uracil Uracil
machinery and had gotten support from Hitachi Instru-
R A, G puRine
ments. In 1987 Smith and Hood announced the rst
Y C, T pYrimidine
automated DNA sequencing machine.16 Advances in the
M A, C aMino
chemistry of the sequencing procedure, described in the
K G, T Keto
rst sections of this chapter, were accompanied by
S C, G Strong (3 H bonds)
advances in the biology of DNA mapping, with methods
W A, T Weak (2 H bonds)
such as pulsed eld gel electrophoresis,17,18 restriction
H A, C, T Not G
fragment length polymorphism analysis,19 and transcript
B C, G, T Not A
identication.20 Methods were developed to clone large
V A, C, G Not T
(500 kbp) DNA fragments in articial chromosomes, pro-
D A, G, T Not C
viding long contiguous sequencing templates.21 Finally,
N A, C, G, T aNy
application of capillary electrophoresis to DNA resolu-
X, ? Unknown A or C or G or T
tion2224 made the sequencing procedure even more rapid
O, - Deletion
and cost-efficient.

For the human sequence, the decision was made to use

Table 10.5 Model Organisms Sequenced During
the Human Genome Project a composite template from multiple individuals rather
than a single genome from one donor. Human DNA was
Genome Estimated Number
Organism Size (Mb) of Genes
donated by 100 anonymous volunteers; only 10 of these
genomes were sequenced. Not even the volunteers knew
Epstein-Barr virus 0.17 80 if their DNA was used for the project. To ensure accurate
Mycoplasma genitalium 0.58 470 and high-quality sequencing, all regions were sequenced
Haemophilus inuenzae 1.8 1740 510 times over.
Escherichia coli K-12 4.6 4377 Another project started with the same goal. In 1992
E. coli O157 5.4 5416 Craig Venter left the NIH to start The Institute for
Saccharomyces cerevisiae 12.5 5770 Genomic Research (TIGR). Venters group completed the
Drosophila melanogaster 180 13,000 rst sequence of a free-living organism (Haemophilus
Caenorhabditis elegans 97 19,000 inuenzae)27 and the sequence of the smallest free-living
Arabidopsis thaliana 100 25,000 organism (Mycoplasma genitalium).28 Venter established
a new company named Celera and proposed to complete
the human genome sequence in 3 years for $300 million,
With these advances in technology, the Human faster and cheaper than the NIH project. Meanwhile,
Genome Project was endorsed by the National Research Watson had resigned as head of the NIH project and was
Council. The National Institutes of Health (NIH) estab- replaced by Francis Collins. In response, the Wellcome
lished the Office of Human Genome Research with James Trust doubled its support of the NIH project. The NIH
Watson as its head. Over the next 5 years, meetings on moved its completion date from 2005 to 2003, with a
policy, ethics, and cost of the project resulted in a plan to working draft to be completed by 2001. Thus began a
complete 20 Mb of sequence of model organisms by 2005 competitive effort to sequence the human genome on two
(Table 10.5). To organize and compare the growing fronts.
amount of sequence data, the Basic Local Alignment The two projects approached the sequencing differ-
Search Tool and Gene Recognition and Assembly ently (Fig. 10-17). The NIH method (hierarchal shotgun
Internet Link algorithms were introduced in 1990.25,26 sequencing) was to start with sequences of known
Hierarchical Shotgun Sequencing Whole-genome Shotgun Sequencing
Whole genome
Known regions
of individual
chromosomes
Figure 10-17 Comparison of

Random reads two approaches for sequencing of
the human genome. The hierar-
chal shotgun approach taken by
the NIH (left) was to sequence
from known regions so that new
sequences could easily be located
in the genome. The Celera whole-
genome shotgun approach (right)
was to sequence random frag-
Assembly
ments from the entire genome and
Anchoring then to assemble the complete
Genome assembly sequence with computers.

regions in the genome and walk further away into the

Table 10.6 Completed Chromosomes
chromosomes, always aware of where the newly gener-
ated sequences belonged in the human genome map. The Chromosome Completion Date
researchers at Celera had a different idea. Their approach 21 December 1999
(whole genome shotgun sequencing) was to start with 22 May 2000
10 equivalents of the human genome cut into small frag- 20 December 2001
ments and randomly sequence the lot. Then, powerful 14 January 2003
computers would nd overlapping sequences and use Y June 2003
those to assemble the billions of bases of sequence into 7 July 2003
their proper chromosomal locations. 6 October 2003
Initially, the Celera approach was met with skepticism. 13 March 2004
The human genome contains large amounts of repeated 19 March 2004
sequences (see Chapter 11), some of which are very dif- 10 May 2004
cult to sequence and even more difficult to map prop- 9 May 2004
erly. A random sequencing method would repeatedly 5 September 2004
cover areas of the genome that are more easily sequenced 16 December 2004
and miss more difficult regions. Moreover, assembly of X March 2005
the whole sequence from scratch with no chromosomal 2 April 2005
landmarks would take a prohibitive amount of computer 4 April 2005
power. Nonetheless, Celera began to make headway 8 January 2006
(some alleged with the help of the publicly published 11 March 2006
sequences from the NIH), and eventually the NIH project 12 March 2006
modied its approach to include both methods. 17 April 2006
Over the next months, some efforts were made toward 3 April 2006
combining the two projects, but these efforts broke down 1 May 2006
over disagreements over database policy and release of
completed sequences. The result of the competition was
that the rough draft of the sequence was completed by from 20,000 to 30,000, was much lower than expected.
both projects earlier than either group had proposed, in The average size of a human gene is 27 kbp. Chromosome
June 2000. A joint announcement was made, and both 19 is the most gene-rich per unit length (23 genes/Mbp).
groups published their versions of the genome, the NIH Chromosomes 13 and Y have the fewest genes per base
version in the journal Nature29 and the Celera version in pair (5 genes/Mbp). Only about 2% of the sequences code
the journal Science.30 for genes; 30%40% of the genome consists of repeat
The sequence completed in 2000 was a rough draft of sequences. There is one SNP between two random indi-
the genome; that is, there were still areas of missing viduals found approximately every 1000 bases along the
sequence and sequences yet to be placed. Only chromo- human DNA sequence. More detailed information, data-
somes 21 and 22, the smallest of the chromosomes, had bases, references, and updated information are available
been fully completed. In the ensuing years, the nished at ncbi.nlm.nih.gov
sequences of each chromosome are being released (Table The signicance of the Human Genome Project to
10.6). diagnostics can be appreciated with the example of the
Even with the rough draft, interesting characteristics of discovery of the gene involved in cystic brosis. Seven
the human genome were revealed. The size of the entire years of work were required for discovery of this gene.
genome is 2.91Gbp (2.91 billion base pairs). The genome With proper mapping information, a gene for any condi-
was initially calculated as 54% AT, 38% GC with 8% of tion can now be found by computer, already sequenced,
the bases still to be determined. Chromosome 2 is the in a matter of minutes. Of course, all genetic diseases are
most GC-rich chromosome (66%), and chromosome X not due to malfunction of a single gene. In fact, most dis-
has the fewest GC base pairs (25%). A most surprising eases and normal states are driven by a combination of
discovery was that the number of genes, estimated to be genes as well as by environmental inuences. Without

the rich information afforded by the sequence of the 4. In a manual sequencing reaction, the DNA ladder on
human genome, identication of these multicomponent the polyacrylamide gel is very bright and readable at
diseases would be almost impossible. the bottom of the gel, but the larger (slower-migrat-
Another project has been launched to further dene the ing) fragments higher up are very faint. What is the
relationship between gene sequence and disease. This is most likely cause of this observation? How might it be
the Human Haplotype Mapping, or HapMap, Project. corrected?
The goal of this project is to nd blocks of sequences that
are inherited together, marking particular traits and pos- 5. In an analysis of the p53 gene for mutations, the fol-
sibly disease-associated genetic lesions. A description of lowing sequences were produced. For each sequence,
this project is presented in Chapter 11. write the expected sequence of the opposite strand
The technology developed as part of the Human that would conrm the presence of the mutations
Genome Project has made sequencing a routine method detected.
used in the clinical laboratory. Small, cost-effective se- Normal:
quencers are available for rapid sequencing, methods that 5TATCTGTTCACTTGTGCCCT3
were not practical only a few years ago. In the clinical (Homozygous substitution)
laboratory, sequencing is actually resequencing, or re- 5TATCTGTTCATTTGTGCCCT3
peated analysis of the same sequence region, to detect (Heterozygous substitution)
mutations or to type microorganisms, making the task 5TATCTGT(T/G)CACTTGTGCCCT3
even more routine. The technology continues to develop, (Heterozygous Deletion)
to reduce the cost and labor of sequencing larger and 5TATCTGTT(C/A)(A/C)(C/T)T(T/G)(G/T)(T/G)
larger areas, so that several regions can be sequenced to (G/C)CC(C/T)(T/3
detect multicomponent diseases or to predict predisposi-
tion to disease. Accurate and comprehensive sequence 6. A sequence, TTGCTGCGCTAAA, may be methylated
analysis is one of the most promising areas of molecular at one or more of the cytosine residues: After bisulte
diagnostics. sequencing, the following results are obtained:
Bisulte treated: TTGCTGTGCTAAA
Untreated: TTGCTGCGCTAAA
Write the sequences showing the methylated
STUDY QUESTIONS cytosines as CMe.
1. Read 5 to 3 the rst 20 bases of the sequence in the
7. In a pyrosequencing read out, the graph shows peaks
gel on the right in Figure 10-8.
of lumninescence corresponding to the addition of the
2. After an automated dye primer sequencing run, the following nucleotides:
electropherogram displays consecutive peaks of the dT peak, dC peak (double height), dT peak,
following colors: dA peak
red, red, black, green, green, blue, black, red, green, What is the sequence?
black, blue, blue, blue
If the computer software displays the uors from References
ddATP as green, ddCTP as blue, ddGTP as black, 1. Amos J, Grody W. Development and integration of
and ddTTP as red, what is the sequence of the region molecular genetic tests into clinical practice: The US
given? experience. Expert Review of Molecular Diagnostics
2004;4(4):46577.
3. After an automated dye terminator sequencing run, 2. Maxam A, Gilbert W. Sequencing end-labeled DNA
the electropherogram displays bright (high, wide) with base-specic chemical cleavage. Methods in
peaks of fluorescence, obliterating some of the Enzymology 1980;65:499560.
sequencing peaks. What is the most likely cause of 3. Sanger F, Nicklen S, Coulson AR. DNA sequenc-
this observation? How might it be corrected? ing with chain terminating inhibitors. Proceedings

of the National Academy of Sciences 1977;74: 16. Smith L, Sanders JZ, Kaiser RJ, et al. Fluorescence
546367. detection in automated DNA sequence analysis.
4. Tabor S, Richardson CC. Selective inactivation of Nature 1986;32(6071):67479.
the exonuclease activity of bacteriophage T7 DNA 17. Schwartz D, Cantor CR. Separation of yeast chro-
polymerase by in vitro mutagenesis. Journal of mosomesized DNAs by pulsed eld gradient gel
Biological Chemistry 1989;264(11):644758. electrophoresis. Cell 1984;37(1):6775.
5. Elie C, Salhi S, Rossignol JM, et al. A DNA poly- 18. Van der Ploeg L, Schwartz DC, Cantor CR, et al.
merase from a thermoacidophilic archaebacterium: Antigenic variation in Trypanosoma brucei ana-
Evolutionary and technological interests. Biochim- lyzed by electrophoretic separation of chromosome-
ica Biophysica Acta 1988;951(2-3):26167. sized DNA molecules. Cell 1984;37(1):7784.
6. Hilbert H, Schafer A, Collasius M, et al. High- 19. Donis-Keller H, Green P, Helms C, et al. A genetic
throughput robotic system for sequencing of linkage map of the human genome. Cell 1987;51
microbial genomes. Electrophoresis 1998;19(4): (2):31937.
500503. 20. Green E, Mohr RM, Idol JR, et al. Systematic gen-
7. Ronaghi M, Uhlen M, Nyren P. A sequencing eration of sequence-tagged sites for physical map-
method based on real-time pyrophosphate. ping of human chromosomes: Application to the
Science 1998;281(5375):36365. mapping of human chromosome 7 using yeast
8. Nyren M, Pettersson B, Uhlen M. Solid phase DNA articial chromosomes. Genomics 1991;11(3):
minisequencing by an enzymatic luminometric 54864.
inorganic pyrophosphate detection assay. Analytical 21. Riethman H, Moyzis RK, Meyne J, et al. Cloning
Biochemistry 1993;208:17175. human telomeric DNA fragments into Saccha-
9. Unemo M, Olcen P, Jonasson J, et al. Molecular romyces cerevisiae using a yeast-articial-
typing of Neisseria gonorrhoeae isolates by pyrose- chromosome vector. Proceedings of the National
quencing of highly polymorphic segments of the Academy of Sciences 1989;86(16):624044.
porB gene. Journal of Clinical Microbiology 2004; 22. Luckey J, Drossman H, Kostichka AJ, et al. High-
42:292634. speed DNA sequencing by capillary electrophoresis.
10. Cebula T, Brown EW, Jackson SA, et al. Molecular Nucleic Acids Research 1990;18(15):441721.
applications for identifying microbial pathogens in 23. Karger A. Separation of DNA sequencing frag-
the post-9/11 era. Expert Review of Molecular Dia- ments using an automated capillary electrophoresis
gnostics 2005;5(3):43145. instrument. Electrophoresis 1996;17(1):14451.
11. Ramon D, Braden M, Adams S, et al. Pyrosequenc- 24. Chen D, Swerdlow HP, Harke HR, et al. Low-
ing: A one-step method for high resolution HLA cost, high-sensitivity laser-induced uorescence
typing. Journal of Translational Medicine 2003;1:9. detection for DNA sequencing by capillary gel
12. Fraga M, Esteller M. DNA methylation: A prole electrophoresis. Journal of Chromatography 1991;
of methods and applications. BioTechniques 2002; 559(12):23746.
33(3):63249. 25. Altschul S, Gish W, Miller W, et al. Basic local
13. Shiraishi M, Hayatsu H. High-speed conversion of alignment search tool. Journal of Molecular Biology
cytosine to uracil in bisulte genomic sequencing 1990;215(3):40310.
analysis of DNA methylation. DNA Research 2004; 26. Xu Y, Mural RJ, Uberbacher EC. Constructing
11(6):40915. gene models from accurately predicted exons:
14. Wheeler D, Barrett T, Benson DA, et al. Database An application of dynamic programming. Com-
resources of the National Center for Biotechnology puter Applications in the Biosciences 1994;10(6):
Information. Nucleic Acids Research (database 61323.
issue) 2005;33(D39D45). 27. Fleischmann R, Adams MD, White O, et al.
15. Baer R, Bankier AT, Biggin MD, et al. DNA se- Whole-genome random sequencing and assembly
quence and expression of the B95-8 Epstein-Barr of Haemophilus inuenzae. Science 1995;269:
virus genome. Nature 1984;310(5974):20711. 496512.

28. Fraser C, Gocayne JD, White O, et al. The minimal the National Academy of Sciences 1989;86:
gene complement of Mycoplasma genitalium. 407680.
Science 1995;270(5235):397403. 32. Tabor S, Richardson CC. Sequence analysis with
29. Lander E, Linton LM, et al. Initial sequencing and a modied bacteriophage T7 DNA polymerase:
analysis of the human genome. Nature 2001;409 Effect of pyrophorolysis and metal ions. Journal
(6822):860921. of Biological Chemistry 1990;265:832228.
30. Venter J, Adams MD, et al. The sequence of 33. Metzker ML, Lu J, Gibbs RA. Electrophoretically
the human genome. Science 2001;291(5507): uniform uorescent dyes for automated DNA
130451. sequencing. Science 1996;271:142022.
31. Tabor S, Richardson CC. Effect of manganese 34. Lewis E, Haaland WC, Nguyen F, et al. Color-
ions on the incorporation of dideoxynucleotides blind uorescence detection for four-color DNA
by bacteriophage T7 DNA polymerase and sequencing. Proceedings of the National Academy
E. coli DNA polymerase I. Proceedings of of Sciences 2005;102(15):534651.
SECTION 3
Techniques in the Clinical Lab
DNA Polymorphisms
and Human
Identication
OUTLINE OBJECTIVES
TYPES OF POLYMORPHISMS Compare and contrast different types of polymorphisms.
RFLP TYPING Dene restriction fragment length polymorphisms and
Genetic Mapping With RFLPs
discuss how they are used in genetic mapping, parentage
RFLP and Parentage Testing
Human Identication Using RFLP testing, and human identication.
STR TYPING BY PCR Describe short tandem repeat structure and nomenclature.
STR Nomenclature Describe gender identication using the amelogenin locus.
Gender Identication
Analysis of Test Results Explain matching probabilities and the contribution of
Y-STR allele frequencies to the certainty of matching.
Matching with Y-STRs Describe the use of Y-STR in forensic and lineage studies.
ENGRAFTMENT TESTING USING
Give examples of the use of STR for bone marrow
DNA POLYMORPHISMS
engraftment monitoring.
LINKAGE ANALYSIS
QUALITY ASSURANCE OF TISSUE Show how STR may be used for quality assurance of
SECTIONS USING STR histological sections.
SINGLE NUCLEOTIDE POLYMORPHISMS Dene single nucleotide polymorphisms and their
The Human Haplotype (Hap Map) potential use in disease gene mapping.
Mapping Project
MITOCHONDRIAL DNA POLYMORPHISMS
Discuss mitochondrial DNA typing.
225

226 Section 3 Techniques in the Clinical Lab
As discussed in Chapter 8, polymorphisms are DNA se- pseudogenes (intronless, nonfunctional copies of active
quences that differ from the sequences of a majority of a genes) throughout the human genome. Shorter blocks of
population but are still shared by a certain percentage. repeated sequences also undergo expansion or shrinkage
These sequences can be as small as a single base pair or through generations. Examples of the latter are short
involve thousands of base pairs. tandem repeats (STRs) and variable number tandem
repeats (VNTRs).
Single nucleotide polymorphisms, larger sequence
Types of Polymorphisms variants, and tandem repeats can be detected by observ-
The probability of polymorphic DNA in humans is great ing changes in the restriction map of a DNA region.
due to the relatively large size of our genome, 98% of Analysis of restriction fragments by Southern blot reveals
which does not code for genes. At the nucleotide- restriction fragment length polymorphisms (RFLPs).
sequence level, it is estimated that genome sequences Particular types of polymorphisms, specically SNPs,
differ by one nucleotide every 10001500 bases. These VNTRs, STRs, and RFLPs, are routinely used in the lab-
single nucleotide differences, or single nucleotide poly- oratory (Table 11.1).
morphisms (SNPs), may occur in gene-coding regions
as well as intergenic sequences (see Chapter 4 for the RFLP Typing
nature of the genetic code and Chapter 8 for a discussion
of silent and conservative mutations in coding regions). The rst polymorphic RFLP was described in 1980.
The human leukocyte antigen (HLA) locus is a famil- RFLPs were the original molecular targets used for gene
iar example of a highly polymorphic region of human mapping, human identication, and parentage testing.
DNA where single nucleotide changes occur more fre- RFLPs are observed as differences in the sizes and num-
quently. The variable nucleotide sequences in this locus ber of fragments generated by restriction enzyme diges-
code for peptides that establish self-identity of the tion of DNA (Fig. 11-1). Fragment sizes may vary as a
immune system. The extent of similarity or compatibility result of changes in the nucleotide sequence in or be-
between immune systems of transplant recipients and tween the recognition sites of a restriction enzyme.
potential donors can thus be determined by comparing Nucleotide changes can destroy, change, or create restric-
DNA sequences (see Chapter 15). HLA typing may also tion enzyme sites, altering the number of fragments.
be used for exclusion in human identication tests. The rst step in using RFLPs is to construct a restric-
Some human sequence polymorphisms affect many tion enzyme map of the DNA region under investigation.
base pairs. Large blocks of repeated sequences may be (Construction of restriction maps is described in Chapter
inverted, deleted, or duplicated from one individual to
another. Long interspersed nucleotide sequences
(LINES) are highly repeated sequences, 68 kbp in Table 11.1 Types of Useful Polymorphisms
length, that contain RNA polymerase promoters and and Laboratory Methods
open reading frames related to the reverse transcriptase Polymorphism Structure Detection Method
of retroviruses. There are more than 500,000 of these
RFLP One or more nucleotide Southern blot
LINE-1 (L1) elements, making up more than 15% of the
changes that affect
human genome. There are even more short interspersed
the size of restriction
nucleotide sequences (SINES) scattered over the
enzyme products
genome. SINES, 0.3 kbp in size, are present in over
VNTR Repeats of 1050 base Southern blot,
1,000,000 copies per genome. SINES include Alu ele-
sequences in tandem PCR
ments, named for harboring recognition sites for the AluI
STR Repeats of 110 base PCR
restriction enzyme. LINES and SINES are also known as
sequences in tandem
mobile elements or transposable elements. They are
SNP Alterations of a single Sequencing, other
copied and spread by recombination and reverse tran-
nucleotide
scription and may be responsible for formation of

DNA Polymorphisms and Human Identication Chapter 11 227
Normal DNA Eco RI site
GTCCAGTCTAGCGAATTCGTGGCAAAGGCT
CAGGTCAGATCGCTTAAGCACCGTTTCCGA
Bal I site
Point mutations
GTCCAGTCTAGCGAAA T C G T G G CC AAGGCT
CAGGTCAGATCGCTTTAGCACCG GTTCCGA
Insertions
Figure 11-1 Types of DNA sequence alter- GTCCAGTCTAGCGAAGCGA A T T C G T G G CTC A A A G G C T

CAGGTCAGATCGCTTCGCTTAAGCACCGAGTTTCCGA
ations that change restriction fragment
lengths. The normal sequence (top) has an
Eco R1 site (GAATTC). Single base changes Duplications
(point mutations, second line) can destroy the GTCCAGTCTAGCGAATTCGTGTAGCGAATTCGTGG C A A A
EcoR1 site or create a new restriction site, as CAGGTCAGATCGCTTAAGCAC ATCGCTTAAGCAC C G T T T
can insertions, duplications, or deletions of any
number of bases (third through fifth lines ).
Fragment insertion (or deletion)
Insertions, duplications, and deletions between
two restriction sites change fragment size with- GTCCAGTCTAGCGAATTCGTGGCAAAAAA CAAGGCTGAATTC
out affecting the restriction sites themselves. CAGGTCAGATCGCTTAAGCACCGTTTTTTGTTCCGACTTAAG
6.) Once the restriction map is known, the number and Bgl II Bgl II
sizes of the restriction fragments of a test DNA region cut 1 2
with restriction enzymes are compared with the number
and sizes of fragments expected based on the restriction
map. Polymorphisms are detected by observing fragment A B C
numbers and sizes different from those expected from
the reference restriction map. An example of a polymor- +
phism in a restriction site is shown in Figure 11-2. In a AGATCT AT A T C T
theoretical linear piece of DNA, loss of the recognition TCTAGA TATAGA
site for the enzyme (BglII in the gure) results in alter-
ation of the size and number of bands detected after gel
electrophoresis. 1 2 Size Number +/+ +/ /+ /
Initially, RFLP typing in humans required the use of + + A, B, C 3
the Southern blot technique (see Chapter 5). DNA was + A, B+C 2
cut with restriction enzymes, resolved by gel electro- + A+B, C 2
phoresis, and blotted to a membrane. Probes to specic A+B+C 1
regions of DNA containing potential RFLPs were then
hybridized to the DNA on the membrane to determine the Figure 11-2 A linear piece of DNA with two polymorphic
size of the resulting bands. In Figure 11-3, the pattern of Bgl II restriction enzyme sites, designated here as 1 and 2, will
bands resulting from a Southern blot analysis of RFLP is yield different fragment sizes, depending on the presence of
shown. Note that not all of the restriction fragments are neither, either, or both of the restriction sites. For instance a
GT mutation will change the sequence of the normal site
detected by the probe; yet the three polymorphisms can
() to one not recognized by the enzyme (). The presence
still be identied. or absence of the polymorphic sites is evident from the num-
DNA is inherited as one chromosome complement ber and size of the fragments after cutting the DNA with
from each parent. Each chromosome carries its polymor- Bgl II (bottom right).

Bgl II Bgl II examples shown in Figure 11-3, ( ), ( ), ( ),

1 2 and ( ) describe the presence () or absence () of
BglII sites making up four alleles of the locus detectable
A B C
by Southern blot. In the illustration, genotypes I and II
both have the ( ) allele on one chromosome, but geno-
Probe type I has ( ), and genotype II has ( ) on the other
chromosome. This appears in the Southern blot results as
one band of equal size between the two genotypes and
1 2 Fragments visualized one band that is a different size. Two individuals can share
+/+ +/ /+ /
+ + B both alleles at a single locus, but the chances of two indi-
+ B+C viduals, except for identical twins, sharing the same al-
+ A+B leles decrease 10-fold with each additional locus tested.1
A+B+C More than 2000 RFLP loci have been described in
human DNA. The uniqueness of the collection of poly-
Genotype Fragments visualized morphisms in each individual is the basis for human iden-
I II III
I ++/+ B, B+C tication at the molecular level. Detection of RFLPs by
II +/+ A+B, B+C Southern blot made positive paternity testing and human
III ++/ B, A+B+C identication possible for the rst time. RFLP protocols
for human identication in most North American labora-
Figure 11-3 Using a Southern blot to probe for RFLP. With tories used the restriction enzyme HaeIII for fragmenta-
the same region shown in Figure 11-2, only the fragments with tion of genomic DNA. Many European laboratories used
complementary sequences to a probe to the B region (top) the HinfI enzyme. These enzymes cut DNA frequently
can be visualized.
enough to reveal polymorphisms in multiple locations
throughout the genome. To regulate results from inde-
phisms so that the offspring inherits a combination of the pendent laboratories, the Standard Reference Material
parental polymorphisms. When visualized as fragments (SRM) DNA Proling Standard for RFLP analysis was
that hybridize to a probe of a polymorphic region, the released in 1992. The SRM supplies cell pellets, genomic
band patterns represent the combination of RFLPs DNA, gel standards, precut DNA, electrophoresis materi-
inherited from each parent. Due to recombination and ran- als, molecular weight markers, and certied values for
dom assortment, each person has a unique set of RFLPs, nal analysis. These materials were designed to maintain
half inherited maternally and half paternally. Every geno- reproducibility of the RFLP process across laboratories.
type will yield a descriptive band pattern as shown in
Figure 11-3.
Over many generations, mutations, intra- and inter-
Genetic Mapping With RFLPs
chromosomal recombination, gene conversion, and other Polymorphisms are inherited in a mendelian fashion, and
genetic events have increased the diversity of DNA locations of many polymorphisms in the genome are
sequences. One consequence of this genetic diversity is known. Therefore, polymorphisms can be used as land-
that a single locus, that is, a gene or region of DNA, will marks, or markers, in the genome to determine the loca-
have several versions, or alleles. Human beings are tion of other genes. In addition to showing clear family
diploid; that is, people have two copies of every locus. In history or direct identication of a genetic factor, one can
other words, each person has two alleles of each locus. If conrm that a disease has a genetic component by demon-
these alleles are the same, the locus is homozygous; if strating a close genetic association or linkage to a known
the two alleles are different, the locus is heterozygous. marker. Formal statistical methods are used to determine
Depending on the extent of diversity or polymorphism the probability that an unknown gene is located close to a
of a locus, any two people can share the same alleles or known marker in the genome. The more frequently a par-
have different alleles. More closely related individuals are ticular polymorphism is present in persons with a disease
likely to share more alleles than unrelated persons. In the phenotype, the more likely the affected gene is located

Father Mother
Historical Highlights 1
Locus
2 1
Locus
2
Mary Claire King used RFLP to map one of the
genes mutated in inherited breast cancer.61,62
Following extended families with high incidence of Parents
breast and ovarian cancer, she found particular
RFLP always present in affected family members.
Because the location in the genome of the RFLP
Locus
was known (17q21), the BRCA1 gene was thereby 1 2
mapped to this position on the long arm of chro-
mosome 17.
Child
close to the polymorphism. This is the basis for linkage

mapping and one of the ways genetic components of dis-
Figure 11-4 RFLP inheritance. Two different genetic regions,
ease are identied. or loci, are shown, locus 1 and locus 2. There are several ver-
sions or alleles of each locus. Note that the father is heterozy-
gous at locus 1 and homozygous at locus 2. The alleles in the
RFLP and Parentage Testing
child will be a combination of one allele from each parent.
In diploid organisms, chromosomal content is inherited
half from each parent. This includes the DNA polymor-
analysis could be performed in a few minutes, the dis-
phisms located throughout the genome. Taking advantage
crimination power was low. With only four possible
of the unique combination of RFLP in each individual,
groups, this method was only good for exclusion (elimi-
one can infer a parents contribution of alleles to a son or
nation) of a person as a source of biological material and
daughter from the combination of alleles in the child and
those of the other parent. The fragment sizes of an indi-
vidual as a combination of those from each parent is illus- AF 1 AF 2 Mother
trated in Figure 11-4. In a paternity test, the alleles or Locus Locus Locus
1 2 1 2 1 2
fragment sizes of the offspring and the mother are ana-
lyzed. The remaining fragments (the ones that do not
match the mother) have to come from the father. Alleged
fathers are identied, or included, based on the ability to
provide the remaining alleles. Aside from possible muta-
tions, a difference in just one allele may exclude paternity.
A simplied RFLP paternity test is shown in Figure
Child
11-5. Of the two alleged fathers shown, only one could Locus
supply the fragments not supplied by the mother. In this 1 2
example, only two loci are shown. A parentage test
requires analysis of at least eight loci. The more loci
tested, the higher the probability of positive identication
of the father.
Human Identication Using RFLP Figure 11-5 Two alleged fathers (AF) are being tested for
paternity of the child whose partial RFLP prole is shown in the
The rst genetic tool used for human identication was bottom gel. The mothers alleles are shown in green. One
the ABO blood group antigens. Although this type of AF (AF1) is excluded from paternity.

was informative only in 15% to 20% of cases. Analysis

of the polymorphic HLA loci could add a higher level of
discrimination, with exclusion in 90% of cases. Testing
both ABO and HLA could exclude a person in 97% of Professor Sir Alec John Jeffreys, a British geneticist,
cases but still did not provide positive identication. rst developed techniques for genetic proling, or
The initial use of DNA as an identication tool relied DNA fingerprinting, using RFLP to identify
on RFLP detectable by Southern blot. As shown in Figure humans. The technique has been applied to foren-
11-1, RFLP can arise from a number of genetic events. sics and law enforcement to resolve paternity and
One of these is the insertion or deletion of nucleotides immigration disputes and can be applied to nonhu-
between the restriction sites. This occurs frequently in man species, for example in wildlife population
repeated sequences in DNA. Tandem repeats of sequences genetics. The initial application of this DNA tech-
of all sizes are present in genomic DNA (Fig. 11-6). nique was in a regional screen of human DNA to
Repeats of eight or more nucleotides are called variable identify the rapist and killer of two girls in
number tandem repeats (VNTRs), or minisatellites. Leicestershire, England, in 1983 and 1986. Colin
These repeats are large enough so that loss or gain of one Pitchfork was identied and convicted of murder
repeat can be resolved by gel electrophoresis of a restric- after samples taken from him matched semen sam-
tion enzyme digest. The frequent cutters, HaeIII (recogni- ples taken from the two dead girls.
tion site GGCC) or HinfI (recognition site GANTC),
generate fragments that are small enough to resolve those
that contain different numbers of repeats and thereby give
an informative pattern by Southern blot. Furthermore, large, fragile 0.7% gels were required to
The rst human DNA proling system was introduced achieve adequate band resolution, and the 32P-based
by the United Kingdom Forensic Science Service in 1985 probe system could take 57 days to yield clear results.
using Alec Jeffreys Southern blot multiple locus probe After visually inspecting the band patterns, proles were
(MLP)-RFLP system.2 This method utilized three to ve subjected to computer analysis to accurately size the
probes to analyze three to ve loci on the same blot. restriction fragments and apply the results to an estab-
Results of probing multiple loci at once produced pat- lished matching criterion. RFLP is an example of a con-
terns that were highly variable between individuals but tinuous allele system in which the sizes of the fragments
that required some expertise to optimize and interpret. In dene alleles. Therefore, precise band sizing was critical
1990, single locus probe (SLP) systems were established to the accuracy of the results. A match implied inclusion,
in Europe and North America.3,4 Analysis of one locus at which was rened by determination of the genotype fre-
a time yielded simpler patterns, which were much easier quency of each allele in the general or local population.
to interpret, especially in cases where specimens might This process established likelihood of the same genotype
contain DNA from more than one individual (Fig 11-7). occurring by chance. The probability of two people hav-
The RFLP Southern blot technique required 100 ng1 ing the same set of RFLP, or prole, becomes lower and
g of relatively high quality DNA, 120 kbp in size. lower as more loci are analyzed.
One repeat unit

GTTCTAGCGGCCGTGGCAGCTAGCTAGCTAGCTGCTGGGCCGTGG
CAAGATCGCCGGCACCGTCGATCGATCGATCGACGACCCGGCACC
Tandem repeat (4 units) Figure 11-6 A tandem repeat is a direct repeat 1

to 100 nucleotides in length. The one shown has a
4-bp repeat unit. A gain or loss of repeat units forms
GTTCTAGCGGCCGTGGCAGCTAGCTAGCTGCTGGGCCGTGG a new allele. New alleles can be detected as varia-
CAAGATCGCCGGCACCGTCGATCGATCGACGACCCGGCACC tions in fragment size on digestion with Hae III (green
recognition sites).
Tandem repeat (3 units)

M 1 P C 2 M E M 1 P C 2 M E
Advanced Concepts
At least three to seven RFLP probes were initially
required to determine genetic identity. Available
probes included G3, MS1, MS8, MS31, and MS43,
which were subclones of Jeffreys multilocus probes
33.6 and 33.15 and pYNH24m, MS205, and
MS621.55 Single locus probes MS1, MS31, MS43,
G3, and YNH24 were used by Cellmark in the O.J.
Simpson trial in 1996.
the HLA DQA forensic DNA amplication and typing kit

was discontinued in 2002.
The tandem repeat shown in Figure 11-6 is an STR
with a 4 bp repeat unit, AGCT. Occasionally, STRs con-
tain repeat units with altered sequences, or microvari-
ants, repeat units missing one or more bases of the
repeat. These differences have arisen through mutation or
Figure 11-7 Example of RFLP crime evidence using two other genetic events.
single-locus probes. M are molecular weight markers, 1 and In contrast to VNTRs, the smaller STRs are efficiently
2 are suspects. C is the child victim, and P is the parent of amplied by PCR, easing specimen demands signi-
the child victim. E is evidence from the crime scene. For cantly. Long intact DNA fragments are not required to
both loci probed, suspect 2 matches the evidence found
detect the STR products; therefore degraded or otherwise
at the crime scene. Positive identication of suspect 2 requires
further determination of the frequencies of these specic less than optimal specimens are potentially informative.
alleles in the population and the probability of matching The amount of specimen required for STR analysis by
them by chance. PCR is reduced from 1 g to 10 ng, a key factor for foren-
sic analysis.6 Furthermore, PCR procedures shorten the
analysis time from several weeks to 2448 hours. Careful
design of primers and amplications facilitated multi-
STR Typing by PCR plexing and automation.7
The rst commercial and validated PCR-based typing test STR alleles are identied by PCR product size.
specically for forensic use was the HLA DQ alpha sys- Primers are designed to produce amplicons 100400 bp
tem, now called DQA1, developed by Cetus Corporation in which the STRs are embedded (Fig. 11-8). The sizes
in 1986.5 This system could distinguish 28 DQA1 types. of the PCR products are inuenced by the number of
With the addition of another commercial system, the embedded repeats. If one of each primer pair is labeled
Polymarker (PM) system, the analyst could type ve addi- with a uorescent marker, the PCR product can be ana-
tional genetic markers. The PM system is a set of primers lyzed in uorescent detection systems. Silver-stained
complementary to sequences anking short tandem re- gels may also be used; however, capillary electrophoresis
peats (STRs), or microsatellites. STRs are similar to with uorescent dyes is the preferable method, especially
VNTRs but have smaller repeat units of 17 base pairs. for high throughput requirements.
(The exact repeat unit size limit of STR varies 710 bp, To perform genotyping, test DNA is mixed with the
depending on different texts and reports.) Because of the primer pairs, buffer, and polymerase to amplify the test
increased power of discrimination and ease of use of STR, loci. A control DNA standard is also amplied. Following

amplication, each sample PCR product is combined with

Advanced Concepts allelic ladders (sets of fragments representing all possible
alleles of a repeat locus) and internal size standards
Theoretically, the minimal sample requirement for (molecular weight markers) in formamide for elec-
polymerase chain reaction analysis is a single cell. A trophoresis. After electrophoresis, detection and analysis
single cell has approximately 6 pg of DNA. This software will size and identify the alleles. In contrast to
number is derived from the molecular weight of A/T RFLPs and VNTRs, STRs are discrete allele systems in
and G/C base pairs (617 and 618 g/mol, respec- which a nite number of alleles are dened by the num-
tively). There are about three billion base pairs in ber of repeat units in the tandem repeat (see Fig. 11-8).
one copy of the human genome; therefore for one Several commercial systems are available consisting of
genome copy: labeled primers for one locus to more than 16 loci. The
3 109 bp x 618 g/mol/bp 1.85 1012 allelic ladders in these reagent kits allow accurate identi-
g/mol cation of the sample alleles (Fig. 11-9).
1.85 1012 g/mol 1 mol/6.023 1023 mol- Advances in uorescence technology have increased
ecules 3.07 1012 g 3pg the ease and sensitivity of STR allele identication (Fig.
A diploid cell has two genome copies, or 6 pg of 11-10). Although capillary electrophoresis is faster and
DNA. One ng (1000 pg) of DNA should, therefore, more automated than gel electrophoresis, a single run
contain 333 copies (1000 pg/3pg/genome copy) of through a capillary can resolve only loci whose allele
each locus. ranges do not overlap. The number of loci that can be
resolved on a single run was increased by the use of mul-
ticolor dye labels. Primer sets labeled with dyes that can
be distinguished by their emission wavelength generate
Allele 1 products that are resolved according to uorescence color
TH01
as well as size (Fig. 11-11). Test DNA amplicons, allelic
TCATTCATTCATTCATTCATTCATTCATTCAT ladders, and size standards for multiple loci are thus run
AGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTA
simultaneously through each capillary. Genotyping soft-
Allele 2 ware such as GeneMapper (Applied Biosystems), STaR
Call, and FMBIO Analysis Software (Hitachi Software
TCATTCATTCATTCATTCATTCATTCATTCATTCAT Engineering) provide automated resolution of uorescent
AGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTA dye colors and genotyping by comparison with the size
standards and the allelic ladder.
PCR products: 7/8 7/10 As in RFLP testing, an STR match is made by com-
Allele 1 = 187 bp (7 repeats) 11 paring proles followed by probability calculations. The
Allele 2 = 191 bp (8 repeats)
AmpliType HLA DQa Forensic DNA Amplication and
Typing Kit (Promega) has been used in conjunction with
5
the PM system to generate highly discriminatory allele
frequencies. For example, the chance of a set of alleles
Figure 11-8 Short tandem repeat TH01 (repeat unit TCAT) occurring in two unrelated individuals at random is 1 in
linked to the human tyrosine hydroxylase gene on chromo-
1067 108 Caucasians or 1 in 3 1063 108
some11p15.5. Primers are designed to amplify short regions
containing the tandem repeats. Allelic ladders African Americans.
consisting of all alleles in the human population (anking
lanes in the gel shown at bottom right) are used to deter-
mine the number of repeats in the locus by the size of STR Nomenclature
the amplicon. The two alleles shown contain 7 and 8
repeats. If these alleles were found in a single individual,
The International Society for Forensic Genetics recom-
that person would be heterozygous for TH01 with a mended nomenclature for STR loci in 1997.8 STRs
genotype of 7/8. within genes are designated according to the gene name;

FGA PentaE
TPOX D18S51
D8S1179 D2S11
TH01
Figure 11-9 Multiple short tandem repeats

can be resolved on a single gel. Here, four and
ve different loci are shown on the left and
right gels, respectively. The allelic ladders show
that the ranges of potential amplicon sizes do vWA D3S1358
not overlap, allowing resolution of multiple loci
in the same lane. Two individual genotypes
are shown on the two gels.
11 for example, TH01 is in intron 1 of the human tyrosine

hydroxylase gene on chromosome 11, and TPOX is in
intron 10 of the human thyroid peroxidase gene on chro-
mosome 2. These STRs do not have any phenotypic
5 effect with respect to these genes. Nongene associated
STRs are designated by the D#S# system. D stands for
STR by capillary electrophoresis DNA, the following number designates the chromosome
130 140 150 160 170 180 190 200
13
100 bp 200 bp 300 bp 400 bp
D3S1358 vWA FGA Penta E

D5S818 D13S317
D8S1179 D21S11 D18S1179 Penta D
14
D5S818 D13S317 D7S820
vWA TH01
Figure 11-10 STR analysis by capillary gel electrophoresis. Figure 11-11 An illustration of the ranges of allele peak
Instead of bands on a gel (top), peaks of uorescence on an locations for selected STRs. By labeling primers with different
electropherogram reveal the PCR product sizes (bottom). uorescent dye colors (FAM, JOE, and NED), STRs with over-
Alleles are determined by comparison with molecular weight lapping size ranges can be resolved by color. The molecular
markers and allelic ladders run through the capillary simulta- weight markers (bottom) are labeled with the uorescent
neously with the sample amplicons. dye ROX.

Table 11.2 STR Locus Information*50

Repeat Alleles
STR Locus Chromosome Sequence
CD4 Locus between CD4 and 12p AAAAG 4, 6, 7, 8, 8, 9, 10, 11, 12, 13, 14, 15
triosephosphate isomerase
CSF1PO c-fms protooncogene for CSF- 5q TAGA 6, 7, 8, 9, 10, 11, 12, 13, 14, 15
1 receptor
D3S1358 3p TCTA 8, 9, 10, 11, 12, 13, 14, 15, 15, 15.2, 16, 16,
16.2, 17, 17, 17.1, 18, 18.3, 19, 20
D5S818 5q AGAT 7, 8, 9, 10, 11, 12, 13, 14
D7S829 7q GATA 7, 8, 9, 10, 11, 12, 13, 14, 15
D8S1179 Sequence tagged site 8q TCTA 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
D13S317 13q TATC 7, 8, 9, 10, 11, 12, 13, 14, 15
D16S539 16q GATA 5, 8, 9, 10, 11, 12, 13, 14, 15
D18S51 Sequenced tagged site 18q GAAA 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27
D21S11 21q TCTG 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38
F13A01 Coagulation factor IX 6p GAAA 3.2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16
F13B Factor XIII b 1q TTTA 6, 7, 8, 9, 10, 11, 12
FESFPS c-fes/fps protooncogene 15q ATTT 7, 8, 9, 10, 11, 12, 13, 14
HPRTB Hypoxanthine phosphoribosyl- Xq TCTA 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
transferase
LPL Lipoprotein lipase 8p TTTA 7, 8, 9, 10, 11, 12, 13, 14
TH01 Tyrosine hydroxylase 11p TCAT 5, 6, 7, 8, 9, 9.3, 10, 11
TPOX Thyroid peroxidase 2p TGAA 6, 7, 8, 9, 10, 11, 12, 13
vWA Von Willebrands factor 12p TCTA 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
PentaD 21q AAAGA 2.2, 3.2, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
PentaE 15q AAAGA 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 20.3, 21, 22, 23, 24
*http://www.cstl.nist.gov/div831/strbase/index.htm
Some alleles have units with 1, 2, or 3 missing bases
In an alternate 8-repeat allele, one repeat sequence is AAAGG
In alternate 15, 16, or 17 repeat alleles, one repeat sequence is TCTG
||D21S11 has multiple alternate alleles
where the STR is located (1-22, X or Y). S refers to a Gender Identication

unique segment, followed by a number registered in the
International Genome Database (GDB). See Table 11.2 The amelogenin locus is a very useful marker often ana-
for some examples. lyzed along with STR. The amelogenin gene, which is
STRs are present all over the genome. Some of the not an STR, is located on the X and Y chromosomes and
STR loci commonly used for laboratory investigation is required for embryonic development and tooth matura-
are shown in Table 11.2. A comprehensive collection of tion. The polymorphism is located in the second intron of
STR information is available at cstl.nist.gov/biotech/ the amelogenin gene. The Y allele of the gene is six base
strbase pairs larger in this region than the X allele. Amplication

140 150 160 170 180 190 200 210 220 230 240 250
Advanced Concepts
The GDB is overseen by the Human Genome
Nomenclature Committee, a part of the Human
Genome Organization (HUGO) located at Univer-
sity College, London. HUGO was established in
1989 as an international association of scientists
involved in human genetics. The goal of HUGO is to
promote and sustain international collaboration in Figure 11-12 Males are heterozygous for the amelogenin
the eld of human genetics. The GDB was origi- locus (XY), and females are homozygous for this locus (XX).
nally used to organize mapping data during the ear- Amplication of amelogenin will produce a male-specic 218
bp product (Y allele) in addition to the 212 bp product found
liest days of the Human Genome Project (see
on the X chromosome (X allele).
Chapter 10). With the release of the human genome
sequences and the development of polymerase chain
reaction (PCR), the number of laboratories doing and electrophoretic resolution reveals two bands or peaks
genetic testing has grown a thousand-fold. The GDB for males (XY) and one band or peak for females (XX,
is still widely used as a source of information about Fig. 11-12). Some commercially available sets will con-
PCR primers, PCR products, polymorphisms, and tain primers to amplify the amelogenin polymorphism in
genetic testing. The use of information from GDB is addition to containing the STR primer sets.
unrestricted and available at http:www.gdb.org
Analysis of Test Results
Analysis of polymorphisms at multiple loci results in very
high levels of discrimination (Table 11.3). Discovery of
the same set of alleles from different sources or shared
Advanced Concepts alleles between allegedly related individuals can be very
In 1997 the Federal Bureau of Investigation adopted strong evidence of identity, paternity, or relatedness.
13 core loci as the Combined DNA Indexing Results from such studies, however, must be expressed in
System (CODIS). The loci are TPOX on chromo- terms of the background probability of chance matches.
some 2, D3S1358 on chromosome 3, FGA on chro- DNA testing results in peak or band patterns that must
mosome 4, D5S818 and CSF1PO on chromosome 5, be converted to genotype (allele identication) for com-
D7S820 on chromosome 7, D8S1179 on chromo-
some 8, TH01 on chromosome 11, vWA on chromo-
some 12, D13S317 on chromosome 13, D16S539 on Table 11.3 Matching Probability of STR Genotypes
chromosome 16, D18S51 on chromosome 18, in Different Subpopulations
D21S11 on chromosome 2, and the amelogenin African White Hispanic
locus on the X and Y chromosome. The National American American American
Institute of Standards and Technology supplies 8 loci 1/274,000,000 1/114,000,000 1/145,000,000
Standard Reference Material for quality assurance 9 loci 1/5.18 109 1/1.03 109 1/1.84 109
of testing laboratories. The SRM certies values for *10 loci 1/6.76 1010 1/9.61 1010
22 STR loci, including CODIS and markers used by 12 loci 1/4.61 1012 1/1.78 1011 1/4.75 1011
European forensic laboratories. Proler Plus (Ap- 14 loci 1/6.11 1017 1/9.96 1017 1/1.31 1017
plied Biosystems) and PowerPlex (Promega) primer 16 loci 1/7.64 1017 1/9.96 1017 1/1.31 1017
mixes include the CODIS loci. *AmpliSTR Identiler Kit (Applied Biosystems)
PowerPlex Systems (Promega)

parison of results between laboratories. As described

above, an STR locus genotype is dened by the number
of repeats in the alleles. For instance, if the locus geno-
Advanced Concepts
type in Figure 11-8 represented homologous chro- Alec Jeffreys DNA proling was the basis for the
mosomes from an individual, the locus would be National DNA Database (NDNAD) launched in
heterozygous, with 7 repeats on one chromosome and 8 Britain in 1995. Under British law, the DNA prole
repeats on the other. This locus would thus be designated of anyone convicted of a serious crime is stored on
7/8 or 7,8. A homozygous locus (where both homologous a database. The database now has DNA information
chromosomes carry the same allele) is designated by the on more than 250,000 people.
single number of repeats of that allele; for instance, 7/7 or Created by the DNA Identication Act of 1994,
7,7. Some reports use a single number, such as 6 or 7 to the National DNA Index System (NDIS) is the fed-
designate a homozygous locus. Microvariant alleles con- eral level of the Combined DNA Indexing System
taining partial repeat units are indicated by the number of (CODIS) used in the United States. There are three
complete repeats followed by a decimal point and then the levels of CODIS: the Local DNA Index System
number of bases in the partial repeat. For example, the 9.3 (LDIS), State DNA Index System (SDIS), and
allele of the TH01 locus has 9 full 4-base pair repeat units NDIS. At the local level, CODIS software main-
and one repeat unit with 3 base pairs. Microvariants are tained by the Federal Bureau of Investigation (FBI)
detected as bands or peaks very close to the full-length is used at the bench in sizing alleles. This informa-
allele (Fig. 11-13). tion may be applied locally and/or submitted to the
The genotype, or prole, of a specimen is the collec- SDIS. At the state level, interlaboratory searching
tion of alleles in all the locus genotypes tested. To deter- occurs. The state data may be sent to the NDIS. The
mine the extent of certainty that one prole matches SDIS and NDIS must adhere to the quality assur-
another, the occurrence of the detected genotype in the ance standards recommended by the FBI. The orig-
general or a dened population must be assessed. inal entries to these databases were RFLP proles;
A matching genotype is not necessarily an absolute all future entries will be STR proles. As of 2005,
determination of identity of an individual. Genetic con- there were 108,976 forensic DNA proles and
cordance is a term used to express the situation where all 2,390,740 convicted offender proles in NDIS.
locus genotypes (alleles) from two sources are the same.
Concordance is interpreted as inclusion of a single indi-
vidual as the donor of both genotypes. Two samples are
considered different if at least one locus genotype differs
(exclusion). An exception is paternity testing, in which
mutational events may generate a new allele in the off-
D3S1358
spring, and this difference may not rule out paternity.
95 100 105 110 115 120 125 130 135 140 145 Matching requires clear and unambiguous laboratory
11B Sample 11 11 Blue CAL DOJ9708057A-B11 results. As alleles are identied by gel resolution, good
intragel precision (comparing bands or peaks on the same
gel or capillary) and intergel precision (comparing bands
or peaks of separate gels or capillaries) are important. In
15 15.2 general, intergel precision is less stringent than intragel
COFILER R Sample 18 18 Blue COfiler LADDER precision. This is not unexpected because the same sam-
ples may run with slightly different migration speeds on
different gels. Some microvariant alleles differ by only a
single base pair (see Fig. 11-13), so precision must be less
12 13 14 15 16 17 18 19 than 0.5 bp. Larger alleles, however, may show larger
Figure 11-13 A microvariant allele (15.2) migrates between variation. The TH01 9.3 allele described above is an
the full-length alleles. It is detected as a peak or band located example. This allele must be distinguished from the 10
very close to the full-length peak in an electropherogram. allele, which is a single base pair larger than the 9.3 allele.


Artifacts such as air bubbles, crystals, and dye Binning can be performed in different ways using
blobs, as well as sample contaminants, temperature replicate peak height and position. To calculate the
variations, and voltage spikes, can interfere with probability that two peaks are representative of the
consistent band migration. In addition, amplication same allele, the proportion of alleles that fall within
artifacts occur during PCR. Some polymerases the uncertainty window (bin) must be determined.
add an additional nontemplate adenine residue to This proportion is represented exactly in xed bins
the 3 end of the PCR product. If this 3 nucleotide and approximated in oating bins. The xed bin
addition does not include all the amplied products, approach is an approximation of the more conserva-
a mixed set of amplicons will result in extra tive oating bin approach.9,56 An alternative assess-
bands or peaks located very close together. Stutter ment of allele certainty is the use of locus-specic
is another anomaly of PCR amplication, in which brackets. In this approach, articial alleles are
the polymerase may miss a repeat during the designed to run at the high and low limit of the
replication process, resulting in two or more differ- expected allele size. Identical alleles are expected to
ent species in the amplied product. These also fall within this dened bracket.10
appear as extra bands or peaks. Generally, the larger
the repeat unit length, the less stutter is observed.
These or other aberrant band patterns confuse the
analysis software and can result in miscalling of mercially available software has been designed to auto-
alleles. matically bin and identify alleles.
All peaks that fall within a bin are interpreted as repre-
sentative of the same allele of a locus. Each band or peak
in a genotype is binned and identied according to its mig-
To establish identity of peaks from capillary elec- ration characteristics. The group of bands or peaks makes
trophoresis (or peaks from densitometry tracings of gel up the characteristic pattern or prole of the specimen.
data), the peak is assigned a position relative to some The number of loci tested must be taken into consider-
landmark within the gel lane or capillary, such as the ation in genotyping analysis. The more loci analyzed, the
loading well or the start of migration. Upon replicate res- higher the probability that the locus genotype positively
olutions of a band or peak, electrophoretic variations identies an individual (match probability; see Table
from capillary to capillary, lane to lane, or gel to gel may 11.3). Degraded, compromised, or mixed samples will
occur. Normalization of migration is achieved by relation affect the match probability, as all loci may not yield
of the migration of the test peaks to the simultaneous clear, informative results. Criteria for interpretation of
migration of size standards. Size standards can be inter- results and determination of a true allele are established
nal (in the same gel lane or capillary) or external (in a by each laboratory. These criteria should be based on
separate gel lane). Even with normalization, however, validation studies and results reported from other labo-
tiny variations in position, height, and area of peaks or ratories. Periodic external prociency testing should be
gel bands may persist. If the same fragments are run performed to conrm the accuracy of test performance.
repeatedly, a distribution of observed sizes can be estab-
lished. An acceptable range of sizes in this distribution is Matching of Proles
a bin. A bin can be thought of as an uncertainty window Results from the analysis of polymorphisms are used to
surrounding the mean position of each peak or band. All determine the probability of identity or inheritance of
bands or peaks, therefore, that fall within this window are genetic markers or to match a particular marker or
considered identical. Collection of all peaks or bands marker pattern. To establish the identity of an individual
within a characteristic distribution of positions and areas by an allele of a locus, the chance that the same allele
is called binning.9,10 Bins for each allele can be estab- could arise in the population randomly must be taken into
lished manually in the laboratory. Alternatively, com- account.

Allele frequencies differ between subpopulations or

Advanced Concepts ethnic groups. Different allele frequencies in subpopula-
tions are determined through study of each ethnic
The certainty of a matching pattern increases with group.11 As can be seen from the data in Table 11.3, there
decreased frequency of alleles in the general popu- are differences in the polymorphic nature of alleles in dif-
lation. Under dened conditions, the relative fre- ferent subpopulations.
quency of two alleles in a population remains When identication using genotype proles requires
constant. This is Hardy Weinberg equilibrium, or comparing the genotype of an unknown specimen with a
the Hardy Weinberg Law.57 The population fre- known reference sample, for example, the genotype of
quency of two alleles, p and q, can be expressed evidence from a crime and the genotype of an individual
mathematically as: from a database, the determination that the two geno-
p2 2pq q2 1.0 types match (are from the same person) is expressed in
This equilibrium assumes a large population with terms of a likelihood ratio. The likelihood ratio is the
random mating and no immigration, emigration, comparison of the probability that the two genotypes
mutation, or natural selection. Under these circum- came from the same person with the probability that the
stances, if enough individuals are assessed, a close two genotypes came from different persons, taking into
approximation of the true allele frequency in the account allele frequencies and linkage equilibrium in the
population can be determined. population. A likelihood ratio greater than 1 is an indica-
tion that the probability is more likely, whereas a likeli-
hood ratio of less than 1 indicates that the probability is
less likely. If a likelihood ratio is 1000, the tested geno-
The frequency of a set of alleles or a genotype in a
types are 1000 times more likely to have come from the
population is the product of the frequency of each allele
same person than from two randomly chosen members of
separately (the product rule). The product rule can be
the population. Or, in a random sampling of 100,000
applied because of linkage equilibrium. Linkage equi-
members of a population, 100 people (100,000/1000)
librium assumes that the loci are not associated with one
with the same genotype might be found. A simplied
another (genetically linked) in the genome. The overall
illustration can be made from the penta D and D7S829
frequency (OF) of a locus genotype consisting of n loci
example above. Suppose the penta D 5 and D7S829 8
can be calculated as:
prole was discovered in a specimen from an independ-
OF F1 F2 F3 . . . Fn ent source. The likelihood that the prole came from the
where F1n represents the frequency of each individual tested individual is 1, having been directly determined.
allele in the population. Individual allele frequencies are The likelihood that the same prole could come from
determined by data collected from testing many individ- someone else in the population is 1/500. The likelihood
uals in general and dened populations. For example, at ratio is 1/(1/500), or 500. The specimen material is 500
locus penta D on chromosome 21, the 5 allele has been times more likely to have come from the tested individ-
previously determined to occur in 1 of 10 people in a the- ual than from some other person in the population.
oretical population. At locus D7S829 on chromosome 7, When comparing genotypes with those in a database
the 8 allele has been previously observed in 1of 50 peo- looking for a match, it is important to consider whether
ple in the same population. The overall frequency of the the database is representative of a population or subpop-
prole containing the loci penta D 5 allele and D7S829 8 ulation. It is also important to consider whether the pop-
allele would be 1/10 1/50 1/500. That is, that geno- ulation is homogeneous (a random mixture) with respect
type or prole would be expected to occur in 1 out of to the alleles tested.
every 500 randomly chosen members of that population.
As should be apparent, the more loci tested, the greater Allelic Frequencies in Paternity Testing
the certainty that the prole is unique to a single individ- A paternity test is designed to choose between two
ual in that population; that is, the overall frequency of the hypotheses: the test subject is not the father of the tested
prole is very low. The overall frequencies in Table 11-3 child (H0), or the test subject is the father of the tested
illustrate this point. child (H1). Paternity is rst assessed by observation of

C
Advanced Concepts
Thomas Bayes proposed a theory to predict the vWA TH01 AMEL TP0X F13A01 CSF
chance of a future event based on the observation of M
the frequency of that event in the past. Bayes theo-
rem was found among his papers in an article pub-
lished by The Royal Society in 1763 entitled An
Essay Towards Solving a Problem in the Doctrine of
Chances by the Reverend Thomas Bayes (Philoso- F
phical Transactions of the Royal Society, volume
53, pp. 370-418, 1763). The article had been pub-
lished posthumously. In it, Bayes developed his the-
Figure 11-14 Electropherogram showing results from ve
orem about conditional probability: STR loci and the amelogenin locus for a child (C), mother (M),
P(A) P(B|A) and father (F). Note how the child has inherited one of each
P(A|B) allele from the mother (black dots) and one from the father
P(B) (green dots).
That is, the probability that A will occur, given
that B has occurred (posterior odds), is equal to the
probability that B has occurred given that A has can be multiplied together to calculate the combined
occurred (prior odds) times the quotient of the sep- paternity index (CPI), which summarizes and evaluates
arate probabilities of A and B (likelihood ratio). the genotype information. The CPI for the data shown in
Bayes theorem is used in paternity testing and Table 11-4 is:
genetic association studies.58 CPI 5.719 8.932 15.41 10.22
8,044.931
This indicates that the child is 8045 times more likely
shared alleles between the alleged father and the child to have inherited the four observed alleles from the
(Fig. 11-14). Identity of shared alleles is a process of alleged father than from another man in the population.
matching, as described above for identity testing. If a paternal allele does not match between the alleged
A paternity index, or likelihood ratio of paternity, is father and the child, H1 for that allele is 0. One might
calculated for each locus in which the alleged father and assume, therefore, that the nonmatching allele paternity
the child share an allele. The paternity index is an expres- index of 0 would make the CPI 0. This is not the case.
sion of how many times more likely the childs allele is Nonmatching alleles between the alleged father and the
inherited from the alleged father than by random occur- child found at one locus (exclusion) is traditionally not
rence of the allele in the general population. An allele regarded as a demonstration of nonpaternity because of
that occurs frequently in the population has a low pater- the possibility of mutation. Although mutations were
nity index. A rare allele has a high paternity index. Table quite rare in the traditional RFLP systems, analysis of 12
11.4 shows the paternity index for each of four loci. The or more STR loci may occasionally reveal one or two
FESFPS 13 allele is rarer than the D16S539 9 allele. In
this example, the child is 5.719 times more likely to have
Table 11.4 Example Data From a Paternity
inherited the 9 allele of locus D16S539 from the alleged Test Showing Inclusion
father than from another random man in the population.
Alleged Shared Paternity
Similarly, the child is 15.41 times more likely to have Allele Child Father Allele Index
inherited the 13 allele of FESFPS from the alleged father
D16S539 8, 9 9, 10 9 5.719
than by random occurrence. When each tested locus is on
D5S818 10, 12 7, 12 12 8.932
a different chromosome (not linked), the inheritance or
FESFPS 9, 13 13, 14 13 15.41
occurrence of each allele can be considered an indepen-
F13A01 4, 5 5, 7 5 10.22
dent event. The paternity index for each locus, therefore,

mutations resulting in nonmatching alleles even if the

man is the father. To account for mutations, the paternity
index for nonmatching alleles is calculated as:
Advanced Concepts
Based on studies showing that the majority of STR
paternity index for a mutant allele
mutations are gains or losses of a single repeat,20
where is the observed mutation rate (mutations/ Brenner proposed that the paternity index for a
meiosis) of the locus. The American Association of mutant allele must take into account the nature of
Blood Banks has collected data on mutation rates in STR the mutation; that is, loss or gain of one or more
loci (Table 11.5). repeats.59 The loss of one repeat is much more likely
Using these data, in the case of a nonmatching allele, in a single mutation event than the loss of two or
H1 is not 0 but . more repeats. According to Brenners formula:
In a paternity report, the combined paternity index is Paternity index for a mutant allele /(4 P(Q))
accompanied by the probability of paternity, a number (for a single repeat difference)
calculated from the paternity index (genetic evidence) Paternity index for a mutant allele /(40 P(Q))
and prior odds (nongenetic evidence). For the prior odds, (for a two-repeat difference) and so forth.
the laboratory as a neutral party assumes a 50/50 chance P(Q) is the frequency or probability of occurrence
that the test subject is the father. The probability of pater- of the normal allele, Q, in the population.
nity is, therefore:
CPI prior odds
(CPI prior odds) (1 prior odds)
CPI 0.50 In the example illustrated previously, the CPI is
(CPI 0.50) (1 0.50) 8,044.931. The probability of paternity is:
8044.931 0.50
0.999987
Table 11.5 Observed Mutation Rates in (8044.931 0.50) 0.50
Paternity Tests Using STR Loci The genetic evidence (CPI) has changed the probabil-
STR Locus Mutation Rate (%) ity of paternity (prior odds) of 50% to 99.9987%.
D1S1338 0.09 There is some disagreement about the assumption of
D3S1358 0.13 50% prior odds. Using different prior odds assumptions
D5S818 0.12 changes the nal probability of paternity (Table 11.6). As
D7S820 0.10 can be observed from the table, however, at CPI over 100
D8S1179 0.13 the differences become less signicant.
D13S317 0.15
D16S539 0.11
Sibling Tests
Polymorphisms are also used to generate a probability of
D18S51 0.25
siblings or other blood relationships.12 A sibling test is a
D19S433 0.11
more complicated statistical analysis than a paternity
D21S11 0.21
CSF1PO 0.16
FGA 0.30
TH01 0.01 Table 11.6 Odds of Paternity Using Different
Prior Odds Assumptions
TPOX 0.01
VWA 0.16 Prior Odds
F13A01 0.05 CPI 10% 25% 50% 75% 90%
FESFPS 0.05 5 0.36 0.63 0.83 0.94 0.98
F13B 0.03 9 0.50 0.75 0.90 0.96 0.98
LPL 0.05 19 0.68 0.86 0.95 0.98 0.994
Penta D 0.13 99 0.92 0.97 0.99 0.997 0.999
Penta E 0.16 999 0.99 0.997 0.999 0.9997 0.9999

test.13,14 A full sibling test is a determination of the like- will have the same Y-chromosome haplotype. Thus Y-
lihood that two people tested share a common mother and chromosome inheritance can be applied to lineage, pop-
father. A half sibling test is a determination of the like- ulation, and human migration studies.
lihood that two people tested share a common parent As all male relatives in a family will share the same
(mother or father). The likelihood ratio generated by a allele combination or prole, the statistical signicance
sibling test is sometimes called a kinship index, sibling of a Y-STR DNA match cannot be assessed by multiply-
index, or combined sibling index. ing likelihood ratios as was described above for autoso-
A test to determine the possibility of an aunt or uncle mal STR. Instead of allele frequency used in the match
relationship, also known as avuncular testing, measures calculations of STR, haplotype frequencies are used.
the probabilities that two alleged relatives are related as Estimation of haplotype frequencies, however, is limited
either an aunt or an uncle of a niece or nephew. The prob- by the number of known Y haplotypes. This smaller data
ability of relatedness is based on the number of shared set accounts for the reduced inclusion probabilities and a
alleles between the tested individuals. As with paternity discrimination rate that is signicantly lower than that for
and identity testing, allele frequency in the population autosomal STR polymorphisms. Traditional STR loci
will affect the signicance of the nal results. The prob- are, therefore, preferred for identity or relationship analy-
abilities can be increased greatly if other known relatives, ses, and the Y-STRs are used to aid in special situations;
such as a parent of the niece or nephew, are available for for instance, in conrming sibship between males who
testing. Determination of rst- and second-degree rela- share commonly occurring alleles, that is, have a low
tionships is important for genetic studies because linkage likelihood ratio based on traditional STRs.
mapping of disease genes in populations can be affected Y-STRs have been utilized in forensic tests where evi-
by undetected familial relationships.15 dence consists of a mixture of male and female DNA,
such as semen, saliva, other body secretions or ngernail
scrapings. For instance in specimens from evidence of
Y-STR rape, the female DNA may be in vast excess (more than
Unlike conventional STRs (autosomal STRs), where 100-fold) compared to the male DNA in the sample.17
each locus is dened by two alleles, one from each parent, Autosomal STR are not consistently informative under
Y-STRs are represented only once per genome and only in these circumstances. Using Y-specic primers, however,
males (Fig. 11-15). A set of Y-STR alleles comprises a Y-STR can be specically amplied from the male-
haplotype, or series of linked alleles always inherited female mixture resulting in an analyzable marker that has
together, because the Y chromosome cannot exchange no female background. This affords a more accurate
information (recombine) with another Y chromosome. identication of the male donor.
Thus, marker alleles on the Y chromosome are inherited Y haplotyping is also used in lineage studies involving
from generation to generation in a single block. This paternally linked relationships and identication. The Y-
means that the frequency of entire Y-STR proles (haplo- STR/paternal lineage test can determine whether two or
types) in a given population can be determined by empir- more males have a common paternal ancestor. In addition
ical studies. For example, if a combination of alleles to family history studies, the results of a paternal lineage
(haplotype) was observed only two times in a test of 200 test serve as supportive evidence for adoptees and their
unrelated males, that haplotype is expected to occur with biological relatives or for individuals making inheritance
a frequency of approximately 1 in 100 males tested in the and Social Security benet claims.
future. The discrimination power of Y-haplotype testing As Y chromosomes are inherited intact, spontaneous
will depend on the number of subjects tested and will mutations in the DNA sequence of the Y chromosome
always be less commanding than with autosomal STR. can be used to follow human migration patterns and his-
Despite being a less powerful system for identication, torical lineages. Y-chromosome genotyping has been
STR polymorphisms on the Y chromosome have unique used in studies designed to locate the geographical origin
characteristics that have been exploited for forensic, lin- of all human beings.18
eage, and population studies as well as kinship testing.16 The Y chromosome has a low mutation rate. The over-
Except for rare mutation events, every male member of all mutation rate for Y chromosome loci is estimated
a family (brothers, uncles, cousins, and grandparents) at 1.724.27 per thousand alleles.19,20 Assuming that Y

100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 400
Y PLEX LADDER
1214 1316 2833

Y PLEX LADDER
2225 912 8, 1019

Molecular weight standards
Y alleles
15 15 29
Y alleles
21 10 17
Molecular weight standards
Figure 11-15 Electropherogram showing allelic ladders for six STR loci in the Y-Plex 6 system
(top panel) and a single haplotype (bottom panel). Molecular weight standards are shown
at the bottom of each.
chromosome mutations generally occur once every 500 for identication of Y-STRs are available commercially;
generations/locus,21 for 25 loci, 1 locus should have a for example, the Powerplex Y System, which contains 12
mutation every 20 generations (500 generations/25 mark- Y loci (Promega); the AmpliSTR Y-ler, which contains
ers 20 generations). This low mutation rate makes it 17 Y loci (Applied Biosystems); and the Y-Plex 6, which
possible to investigate the paternal lineage over several contains 6 Y loci (Reliagene).
generations. It is also useful for missing persons cases in
which reference samples can be obtained from paternally
Matching With Y-STRs
related males.
A list of informative Y-STRs is shown in Table 11.7. Matching probabilities from Y-STR data are determined
Several Y-STRs are located in regions that are duplicated differently than for the autosomal STR. Haplotype
on the Y chromosome. DSY389I and DSY389II are diversity (HD) can be calculated from the frequency
examples of a duplicated locus. A quadruplicated locus, of occurrence of a given haplotype in a tested popula-
DSY464, has also been reported.22 Like autosomal STRs, tion. The probability of two random males sharing the
Y-STRs have microvariant alleles containing incomplete same haplotype is estimated at 1-HD. Another measure
repeats and alleles containing repeat sequence differ- of prole uniqueness, the discriminatory capacity (DC),
ences. Reagent systems consisting of multiplexed primers is determined by the number of different haplotypes

seen in the tested population and the total number of

Advanced Concepts samples in the population. DC expresses the percentage
of males in a population who can be identied by a given
The European Y chromosome typing community haplotype. Just as the number of loci included in an auto-
has established a set of Y-STR loci termed the min- somal STR genotype increases the power of discrimi-
imal haplotype (see http://www.ystr.org). The min- nation, DC is increased by increasing the number of
imal haplotype consists of Y-STR markers DYS19, loci dening a haplotype. For instance, the loci tested in
DYS389I, DYS389II, DYS390I, DYS391, DYS392, the Y-Plex 6 system can distinguish 82% of African-
DYS393, and DYS385.60 An extended haplotype American males. Using 22 loci raises the DC to almost
includes all of the loci from the minimal haplotype 99% (Table 11.8).
plus the highly polymorphic dinucleotide repeat As there is no recombination between loci on the Y
YCAII. chromosome, the product rule cannot be applied. The
Table 11.7 Y-STR Locus Information*5153

Y-STR Repeat Sequence Alleles
DYS19 [TAGA]3TAGG[TAGA]n 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
DYS385 [GAAA] n 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 16.3, 17, 17.2 17.3, 18, 19, 20,
21, 22, 23, 24, 28
DYS388 [CAA] n 10, 11, 12, 13, 14, 15, 16, 17, 18
DYS389 I [TCTG]q [TCTA]r 9, 10, 11, 12, 13, 14, 15, 16, 17
DYS389 II [TCTG]n[TCTA]p[TCTG]q[TCTA]r 26, 27, 28, 28, 29, 29, 29, 29, 30, 30 30, 30. 31, 31 31,
32, 32,, 33, 34
DYS390 [TCTG]n[TCTA]m[TCTG]p[TCTA] 17,18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28
DYS391 [TCTA]n 6, 7, 8, 9, 10, 11, 12, 13, 14
DYS392 [TAT]n 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17
DYS393 [AGAT]n 9, 10, 11, 12, 13, 14
DYS426 [CAA]n 6.2, 9, 10, 11, 12, 13, 14
DYS434 [CTAT]n 8, 9, 10, 11
DYS437 [TCTA]n[TCTG]2[TCTA]4 13, 14, 15, 16, 17
DYS438 [TTTTC]n 6, 7, 8, 9, 10, 11, 12, 13, 14
DYS439 [GATA]n 9, 10, 11, 12, 13, 14
DYS439 [GATA]n 9, 10, 11, 12, 13, 14
(Y-GATA-A4)
DYS441 [CCTT]n 8, 10.1, 11, 11.1, 12, 13, 13.1, 14, 14.3, 15, 16, 17, 18, 19, 20
DYS442 [TATC]n 8, 9, 10, 11, 12, 12.1, 13, 14, 15
DYS444 [TAGA]n 9, 10, 11, 12, 13, 14, 15, 16
DYS445 [TTTA]n 6, 7, 8, 9, 10, 10.1, 11, 12, 13, 14
DYS446 [AGAGA]n 8, 9, 10, 11, 12, 13, 14, 15, 15.1, 16, 17, 18, 19, 19.1, 20, 21, 22,
23
DYS447 [TTATA]n 15, 16, 17, 18, 19, 19.1, 20, 21, 22, 22.2, 22.4, 23, 24, 25, 26, 26.2,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36
DYS448 [AGAGAT]n 17, 19, 19.2, 20, 20.2, 20.4, 21, 21.2, 21.4, 22, 22.2, 23, 23.4, 24,
24.5, 25, 26, 27

Table 11.7 Y-STR Locus Information*5153 (continued)

Y-STR Repeat Sequence Alleles
DYS449 [GAAA]n 23, 23.4, 24, 24.5, 25, 26, 27, 27.2, 28, 28.2, 29, 29.2, 30, 30.2, 31,
32, 32.2, 33, 33.2, 34, 35, 36, 37, 37.3, 38
DYS452 [TATAC]n 24, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35
DYS454 [TTAT]n 6, 7, 8, 9, 10, 11, 12, 13
DYS455 [TTAT]n 7, 8, 9, 10, 11, 12, 13
DYS456 [AGAT]n 11, 12, 13, 14, 15, 16, 17, 18, 19, 20
DYS458 [CTTT]n 12, 12.2, 13, 14, 15, 15.2, 16, 16.1, 16.2, 17, 17.2, 18, 18.2, 19,
19.2, 20, 20.2, 21
DYS460 [ATAG]n 7, 8, 9, 10, 10.1, 11, 12, 13
(Y-GATA-A7.1)
*http://www.cstl.nist.gov/div831/strbase/index.htm
Some alleles contain repeats with 1, 2, or 3 bases missing
DYS389 I and II is a duplicated locus
results of a Y typing can be reported accompanied by the dence, which gives extra support to the hypothesis that an
number of observations or frequency of the analyzed hap- independent source with this haplotype comes from an
lotype in a database of adequate size. Suppose a haplotype individual or a paternal relative. Even with a 99.9% DC,
containing the 17 allele of DYS390 occurs in only 23% of however, the matching probability is orders of magnitude
men in a database of 12,400. However, if that same hap- lower than that for autosomal STR.
lotype contains the 21 allele of DYS446, only 6% of the Y-chromosome haplotypes can be used to exclude
men will have haplotypes containing the DYS390 17 and paternity. Taking into account the mutation rate of each
DYS446 21 alleles. If the 11 allele of DYS455 and the 15 allele, any alleles that differ between the male child and
allele of DYS458 are also present, only 1 out of 12,400 the alleged father are strong evidence for nonpaternity.
men in the population has a haplotype containing all four Conversely, if a Y haplotype is shared between a child
alleles. The uniqueness of this haplotype is strong evi- and alleged father, a paternity index can be calculated in
dence that a match is not the result of a random coinci- a manner similar to that of the autosomal STR analysis.
For example, suppose 6 Y-STR alleles are tested and
match between the alleged father and child. If the haplo-
Table 11.8 Discriminatory Capacity of Y-STR type has not been observed before in the population, the
Genotypes in Different Subpopulations54 occurrence of that haplotype in the population database is
African White Hispanic 0/1200, and the haplotype frequency will be 1/1200, or
American (%) American (%) American (%) 0.0008333. The paternity index (PI) is the probability
*6 loci 82.3 68.9 78.3 that a man with that haplotype could produce one sperm
9 loci 84.6 74.8 85.1 carrying the haplotype (H0), divided by the probability
11 loci 91.3 83.8 90.3 that a random man could produce one sperm carrying the
17 loci 99.1 98.8 98.3 haplotype (H1). The PI is then 1/0.0008333 1200. With
||20 loci 98.5 97.2 98.6 a prior probability of 0.5, the probability of paternity is
#22 loci 98.9 99.6 99.3 (1200 0.5)/[(1200 0.5) 0.5] or 99.9%. This result,
*Y-Plex 6 (DYS19, DYS390, DYS391, DYS393, DYS389II, and however, does not exclude patrilineal relatives of the
DYS385) alleged father.
European minimal haplotype Y-STRs also provide marker loci for Y-chromosome,
Minimal haplotype SWGDAM
or surname, tests to determine ancestry. For example, a
AmpliSTR Y-ler as reported by Applied Biosystems
||Y-STR 20 plex (Minimal haplotype plus DYS388, DYS426, DYS437,
group of males of a strictly male descent line (having the
DYS439, DYS460, H4, DYS438 DYS447 and DYS448) same last name or surname) is expected to be related to a
#Y-STR 22 plex common male ancestor. Therefore, they should all share

the same Y-chromosome alleles (except for mutations, Autologous bone marrow transplant
which should be minimal, given 1 mutation per 20 gen-
erations, as explained above). The Y-chromosome haplo-
type does not provide information about degree of
relatedness, just inclusion or exclusion from the family.
An analysis to nd a most recent common ancestor
(MRCA) is possible, however, using a combination of
researched family histories, Y-STR test results, and sta-
tistical formulas for mutation frequencies.
Bone marrow cells
Engraftment Testing
Using DNA Polymorphisms
Allogeneic bone marrow transplant
Bone marrow transplantation is a method used to treat
malignant and nonmalignant blood disorders, as well as
some solid tumors. The transplant approach can be
autologous (from self), in which cells from the patients
own bone marrow are removed and stored. The patient
then receives high doses of chemotherapy and/or radio-
therapy. The portion of marrow previously removed from
the patient may also be purged of cancer cells before
being returned to the patient. Alternatively, allogeneic
transplants (between two individuals) are used. The
donor supplies healthy cells to the recipient patient (Fig. Figure 11-16 In autologous bone marrow transplant (top),
11-16). Donor cells are supplied as bone marrow, periph- bone marrow cells are taken from the patient, purged, and
eral blood stem cells (also called hematopoetic stem replaced in the patient after conditioning treatment. In allo-
geneic transplant (bottom), bone marrow cells are taken from
cells), or umbilical cord blood. To assure successful
another genetically compatible individual (donor) and given
establishment of the transplanted donor cells, donor and to the patient.
recipient immune compatibility is tested prior to the
transplant by HLA typing (see Chapter 15).
In myeloablative transplant strategies, high doses of cell fraction before infusion of donor cells has resulted
therapy completely remove the recipient bone marrow, in increased incidence of graft failure and relapse.
particularly the stem cells that give rise to all the other The rst phase of allogeneic transplantation is donor
cells in the marrow (conditioning). The allogeneic or matching, in which potential donors are tested for im-
autologous stem cells are then expected to re-establish a munological compatibility. This is performed by examin-
new bone marrow in the recipient (engraftment). The ing the human leukocyte antigen (HLA) locus using
toxicity of this procedure can be avoided by the use of sequence-specic PCR or by sequence-based typing (see
nonmyeloablative transplant procedures or minitrans- Chapter 15). Sequence polymorphisms (alleles) in the
plants. In this approach, pretransplant therapy will not HLA locus are compared with those of the recipient to
completely remove the recipient bone marrow. The donor determine which donor would be most tolerated by the
bone marrow is expected to eradicate the remaining recipient immune system. Donors may be known or
recipient cells through recognition of residual recipient related to the patient or anonymous unrelated contributors
cells as foreign to the new bone marrow. This process also (matched unrelated donor).
imparts a graft-versus-leukemia or graft-versus-tumor Stem cells may also be acquired from donated umbili-
(GVT) effect, which is the same process as graft-versus- cal cord blood. After conditioning and infusion with the
host disease (GVHD). The T-cell fraction of the donor donor cells, the patient enters the engraftment phase, in
marrow is particularly important for engraftment and for which the donor cells reconstitute the recipients bone
GVT effect. Efforts to avoid GVHD by removing the T- marrow. Once a successful engraftment of donor cells is

established, the recipient is a genetic chimera; that is, the and the recipient have the same alleles. In donor-inform-
recipient has body and blood cells of separate genetic ative loci, donor and recipient share one allele, and the
origins. donor has a unique allele. Conversely, in recipient-
The engraftment of donor cells in the recipient must be informative loci, the unique allele is in the recipient (Fig.
monitored, especially in the rst 90 days after the trans- 11-17). The second part of the testing process is the
plant. This requires a method that can distinguish donor engraftment analysis, which is performed at specied
cells from recipient cells. Earlier methods included red intervals after the transplant. In the engraftment analysis,
blood cell phenotyping, immunoglobulin allotyping, HLA the recipient blood and bone marrow are tested to deter-
typing, karyotyping, and uorescence in situ hybridiza- mine the presence of donor cells using the informative
tion analysis. Each of these methods has drawbacks. and/or recipient informative loci.
Some require months before engraftment can be detected. Pretransplant analysis and engraftment were measured
Others are labor-intensive or restricted to sex mismatched in early studies by amplication of small VNTRs and
donor-recipient pairs. resolution of amplied fragments on polyacrylamide gels
DNA typing has become the method of choice for with silver stain detection.27 Before the transplant, the
engraftment monitoring.23,24 Because all individuals, screen for informative loci was based on band patterns of
except identical twins, have unique DNA polymor- the PCR products, as illustrated in Figure 11-17. After the
phisms, donor cells can be monitored by following donor transplant, analysis of the gel band pattern from the blood
polymorphisms in the recipient blood and bone marrow. and bone marrow of the recipient revealed one of three
Although RFLP can effectively distinguish donor and different states: full chimerism, in which only the donor
recipient cells, the detection of RFLP requires use of the alleles were detected in the recipient; mixed chimerism,
Southern blot method, which is too labor-intensive and in which a mixture of donor and recipient alleles was
slow for this application. In comparison, small VNTRs present, or graft failure, in which only recipient alleles
and STRs are easily detected by PCR (see Fig. 11-9). were detectable (Fig. 11-18).
PCR amplication of VNTRs and STRs is preferable Currently, PCR amplication of STRs, resolution by
because of the increased rapidity and the 0.5%1% sen- capillary electrophoresis, and uorescent detection is
sitivity achievable with PCR. Sensitivity can be raised to the preferred method. This procedure provides ease of
0.01% using Y-STR, but this approach is lim-ited to those use, accurate quantitation of the percentage of donor/
transplants from a female donor to a male recipient.25,26 recipient cells, and high sensitivity with minimal sample
In the laboratory, there are two parts to engraftment/ requirements.
chimerism DNA testing. Before the transplant, several Donor and recipient DNA for allele screening prior to
polymorphic loci in the donor and recipient cells must be transplant can be isolated from blood or buccal cells. One
screened to nd at least one informative locus; that is,
one in which donor alleles differ from the recipient al-
leles. Noninformative loci are those in which the donor Locus: 1 2 3 4 5
M D R D R D R D R D R
Advanced Concepts
Chimerism is different from mosaicism. A chimera
is an individual carrying two populations of cells
that arose from different zygotes. In a mosaic, cells
arising from the same zygote have undergone a
Figure 11-17 Band patterns of ve different loci comparing
genetic event, resulting in two clones of phenotypi- donor (D) and recipient (R) alleles. The second and fth loci
cally different cells in the same individual. are informative. The rst and fourth loci are noninformative.
The third locus is donor-informative.

M D R M D R GF MC FC vWA TH01 AMEL TPOX CSFIPO
Figure 11-18 Band patterns after PAGE analysis of VNTR.

First, before the transplant, several VNTR must be screened to
nd informative loci that differ in pattern between the donor
and recipient. One such marker is shown at left (M molecu-
lar weight marker, D donor, R recipient). After the trans-
plant, the band patterns can be used to distinguish between
graft failure (GF), mixed chimerism (MC), or full chimerism (FC).
ng of DNA is reportedly sufficient for screening of mul-

tiple loci; however, 10 ng is a more practical lower limit.
Multiple loci can be screened simultaneously using mul-
tiplex PCR. Although not validated for engraftment test-
ing, several systems designed for human identication,
such as Promegas PowerPlex and Applied Biosystems
AmpliSTR Identiler and Proler, may be used for this
purpose. The AmpliSTR Yler may also be useful for sex
mismatched donor/recipient pairs. Figure 11-19 shows
the ve tetramethylrhodamine (TMR)labeled loci from
the PowerPlex system. A total of nine loci are amplied
simultaneously by this set of multiplexed primers.
Although multiplex primer systems are optimized for
consistent results, all loci may not amplify with equal
efficiency in a multiplex reaction. For example, the amel-
ogenin locus in Figure 11-19 did not amplify as well as
the other four loci in the multiplex. This is apparent from
the lower peak heights in the amelogenin products com-
pared with the products of the other primers.
Figure 11-19 Multiplex PCR showing DNA mixtures from
two unrelated individuals (top and bottom trace) showing
peak patterns for vWA, TH01, Amelogenin, TPOX, and
Advanced Concepts CSF1PO loci. The center traces are stepwise mixtures of
the two genotypes.
A more dened condition can be uncovered by cell
type separation. Some cell fractions, such as granu-
locytes, engraft before others. Isolated granulocytes Although the instrumentation used for this method is
may show full chimerism while the T-cell fraction the same as that used for sequence analysis (see Chapter
still shows mixed chimerism. This is a case of split 10), investigating peak sizes and peak areas is distin-
chimerism. guished from sequence analysis as fragment analysis and
sometimes requires adjustment of the instrument or capil-

lary polymer. Automatic detection will generate an elec-

120 140 160 180 200 220 240 260 280 300 320
tropherogram as shown in Figure 11-20. Informative and
noninformative loci will appear as nonmatching or match-
ing donor and recipient peaks, respectively. Many combi-
nations of donor/recipient peaks are possible. Optimal
LPL D5S818 D13S317 D7S820 D16S539
loci for analysis should be clean peaks without stutter,
especially stutter peaks that co-migrate with informative
peaks, nonspecic amplied peaks (misprimes), or other
technical artifacts.28 Ideally, the chosen locus should have
at least one recipient informative allele. This is to assure LPL D5S818 D13S317 D7S820 D16S539
direct detection of minimal amounts of residual recipient

cells. If the recipient is male and the donor is female, the
amelogenin locus supplies a recipient informative locus.
vWA TH01 TP0X F13A01 CSF1P0
Good separation (ideally, but not necessarily, by two
repeat units) of the recipient and donor alleles is desirable
for ease of discrimination in the post-transplant testing.
The choices of informative alleles are more limited in
vWA TH01 TP0X F13A01 CSF1P0
related donor-recipient pairs, as they are likely to share
alleles. Unrelated donor-recipient pairs, on the other hand, Figure 11-20 Screening of 10 loci for informative
will yield more options. alleles. Recipient peak patterns (rst and third scans) are
After the transplant, the recipient is tested on a sched- compared with donor patterns (second and fourth scans).
ule determined by the clinician or according to consensus LPL, D5S818, D13S317, vWA, TH01, TP0X, and CSF1P0 are
informative.
recommendations.29 With modern nonmyeloablative or
reduced-intensity pretransplant protocols, testing is rec-

ommended at 1, 3, 6, and 12 months. Because early pat-
Advanced Concepts terns of engraftment may predict GVHD or graft failure
Occasionally, specimens may be received in the lab- after nonmyeloblative treatments, even more frequent
oratory after engraftment without pre-engraftment blood testing may be necessary, such as 1, 2, and 3 months
information. In this case, the blood or bone marrow after transplant. Bone marrow specimens can most conve-
of the recipient is not acceptable for determination of niently be taken at the time of bone marrow biopsy fol-
recipient-specic alleles because the alleles present lowing the transplant, with blood specimens taken in
are likely to represent both donor and recipient. The intervening periods. Usually, 35 mL of bone marrow or
specimen can be processed using the amelogenin 5 mL of blood is more than sufficient for analysis; how-
locus or Y-STR markers if the donor and recipient ever, specimens collected soon after the transplant may be
are of different sexes, preferably female donor and hypocellular so that larger volumes (57 mL bone mar-
male recipient. Another option is to use an alternate row, 10 mL blood) may be required.
source of recipient DNA such as buccal cells, skin Quantication of percent recipient and donor post-
biopsy sample, or stored specimens or DNA from transplant is performed using the informative locus or loci
previous testing. Because of the nature of lympho- selected during the pretransplant informative analysis.
cyte migration, however, skin and buccal cells may The raw data for these calculations are the areas under the
also have donor alleles due to the presence of donor peaks generated by the PCR products after amplication.
lymphocytes in these tissues. The best approach is to The emission from the uorescent dyes attached to the
ensure informative analysis of the donor and recipi- primers and thus to the ends of the PCR products is col-
ent as part of the pretransplant schedule. lected as each product migrates past the detector. The u-
orescent signal is converted into uorescence units by the

There are several formulas for percent calculations,

Advanced Concepts depending on the conguration of the donor and recipi-
ent peaks. For homozygous or heterozygous donor and
Positive or negative selection techniques may be recipient peaks with no shared alleles, the percent recipi-
used to test specic cell lineages. For example, ent cells is equal to R/(R D), where R is the area under
analysis of the T-cell fraction separately is used to the recipient-specic peak(s) and D is the area under the
monitor graft-versus-tumor activity. T cells may donor-specic peak(s). Shared alleles, where one allele is
comprise 10% of peripheral blood leukocytes and the same for donor and recipient (Fig. 11-20) can be
3% of bone marrow cells following allogeneic trans- dropped from the calculation, and the percent recipient
plantation. Analysis of unfractionated blood and cells is calculated as
especially bone marrow where all other lineages are R(unshared)
100% may miss split chimerism in the T-cell frac-
(R(unshared) D(unshared))
tion. T-lineagespecic chimerism will therefore
increase the sensitivity of the engraftment analysis, Chimerism/engraftment results are reported as percent
particularly after nonmyeloablative and immunoab- recipient cells and/or percent donor cells in the bone mar-
lative pretransplant treatments. row, blood, or cell fraction. These results do not reect
T cells are conveniently separated from whole the absolute cell number, which could change indepen-
blood using magnetized polymer particles (beads), dently of the donor/recipient ratio. Inability to detect
such as MicroBeads (MicroBeads AS), DynaBeads donor or recipient cells does not mean that that cell pop-
(Dynal), or EasySep (StemCell Technologies), ulation is completely absent, as capillary electrophoresis
attached to pan-T antibodies (anti-CD3). To isolate T and uorescent detection methods offer a sensitivity of
cells, white blood cells isolated by density gradient 0.1%1% for autosomal STR markers. Time trends may
centrifugation are mixed with the beads in saline or be more important than single-point results following
phosphate-buffered saline and incubated to allow the transplantation.
antibodies on the beads to bind to the CD3 antigens Because cell lineages engraft with different kinetics,
on the T-cell surface. With the beadsT cells immo- testing of blood and bone marrow may yield different
bilized by an external magnet, the supernatant con- levels of chimerism. Bone marrow will contain more
taining non-T cells is decanted. After another saline myeloid cells, and blood will contain more lymphoid
wash, the T cells are collected and lysed for DNA cells. The rst determination to be made from engraft-
isolation. It is not necessary to detach the T cells ment testing is whether donor engraftment has occurred
from the beads. and secondly whether there is mixed chimerism. In
Automated cell sorter systems, such as the mixed chimerism, cell separation techniques may be used
autoMACS separator (Miltenyi Biotec), may also be to determine which lineages are mixed and which are
used for this purpose. With a positive selection pro- in fully donor. Nonmyeloablative conditioning of the
gram, the instrument is capable of isolating up to transplant recipients requires monitoring of both myeloid
2 108 pure T cells per separation. Unwanted cells and lymphoid cell engraftment. This information may
can be removed with the depletion programs. be determined by positive or negative lineage separa-
tion of whole blood (see the Advanced Concepts box
that discusses cell lineage) or by testing blood and bone
marrow.
computer software. The software displays the PCR prod-
ucts as peaks of uorescence units (y-axis) vs. migration
speed (x-axis). The amount of uorescence in each prod-
Linkage Analysis
uct or peak is represented as the area under the peak. This Because the locations of many STRs in the genome are
number is provided by the software and is used to calcu- known, these structures can be used to map genes, espe-
late the percent recipient and donor (Fig. 11-21). cially those genes associated with disease. Three basic

approaches are used to map genes, family histories, pop-

230 240 250 260 270 280 290 300 310 320
Recipient
ulation studies, and sibling analyses.
D16S539
Family history and analysis of generations of a single
family for the presence of a particular STR allele in
affected individuals is one way to show association.
Family members are tested for several STRs, and the
Donor
alleles are compared between affected and unaffected
members of the family. Assuming normal mendelian
inheritance, if a particular allele of a particular locus is
always present in affected family members, that locus
Recipient Whole Blood must be closely linked to the gene responsible for the phe-
notype in those individuals (Fig. 11-22). If the linkage is
close enough to the gene (no recombination between the
16413 4616 STR and the disease gene), the STR may serve as a con-
Recipient T-Cell Fraction
venient target for disease testing. Instead of testing for
mutations in the disease gene, the marker allele is deter-
mined. It is easier, for example, to look for a linked STR
15608 516
allele than to screen a large gene for point mutations. The
Figure 11-21 Postengraftment analysis of an informative
presence of the indicator STR allele serves as a genetic
locus D16S539. The area (uorescence units) under the peaks marker for the disease (Fig. 11-23).
is calculated automatically. The recipient and donor patterns Another approach to linkage studies is association
are shown in the rst and second trace, respectively. Results analysis in large numbers of unrelated individuals in pop-
from the whole blood and T-cell fraction are shown in the ulation studies. Just as with family history studies, close
third and fourth traces. For D16S539 the formula, R(unshared)/
(R(unshared) D(unshared), yields 4616/(4616 16413) 100 22%
linkage to specic STR alleles supports the genetic prox-
recipient cells in the unfractionated blood (arrow) and 516/ imity of the disease gene with the STR. In this case, how-
(516 15608) 100 3.3% recipient cells in the T-cell fraction. ever, large numbers of unrelated people are tested for
CACACACA AB BC
Allele A
CACACACACACA AC AB BC BB
Allele B
CACACA
Allele C
Figure 11-22 Linkage analysis with STRs. Three alleles, A, B, and C, of an STR
locus are shown (left). At right is a family pedigree showing assortment of the
alleles along with gel analysis of PCR amplication products. Allele C is present
in all affected family members. This supports the linkage of this STR with the gene
responsible for the disease affecting the family. Analysis for the presence of
allele C may also provide a simple indicator to predict inheritance of the
affected gene.

AB BC
CON BC AC BB AB BC AB BB AC BB AB
Figure 11-23 Inheritance of alleles in an

A
affected family. Using the banding pattern
shown, the B allele of this STR is always present in B
affected individuals. This locus must be closely
C
linked to the mutated gene.
linkage rather than a limited number of related individu- data, one nonmatching locus excludes the tissue in ques-
als in a family. The results are expressed in probability tion as coming from the patient.
terms that an individual with the linked STR allele is An example of such a case is shown in Figure 11-24.
likely to have the disease gene. A uterine polyp was removed for microscopic examina-
Sibling studies are the third approach to linkage studies.
Monozygotic (identical) and dizygotic (fraternal) twins
provide convenient genetic controls for genetic and
environmental studies. Monozygotic twins will always 120 140 160 180 200 220 240 260 280 300 320
Reference
have the same genetic alleles, including disease genes.
There should be 100% recurrence risk (likelihood) that if
one twin has a genetic disease, the other twin has it, and
both should have the same linked STR alleles. Fraternal
twins have the same likelihood of sharing a gene allele as D5S818 D13S317 D7S820 D16S539
any sibling pair. Investigation of adoptive families may Test

also distinguish genetic from environmental or somatic
effects.
D5S818 D13S317 D7S820 D16S539

Quality Assurance for
Surgical Sections Using STR Reference
Personnel in the molecular diagnostics laboratory can
assist in assuring that surgical tissue sections are properly
identied and uncontaminated. During processing of tis-
sue specimens, microscopic fragments of tissue may per- vWA TH01 Amelo TP0X CSF1P0
sist in paraffin baths (oaters). These fragments can
Test
adhere to subsequent slides, resulting in anomalous
appearance of the tissue under the microscope. If a tissue
sample is questioned, STR identication can be used to
conrm the origin of tissue.
vWA TH01 Amelo TP0X CSF1P0
For this procedure, reference DNA isolated from the
patient and the tissue in question on the slide is subjected
Figure 11-24 Quality assurance testing of a tissue frag-
to multiplex PCR. The results are compared for matching ment.The STR prole of the fragment in question (test) was
alleles. If the tissue in question originated from the compared with that of reference DNA from the patient. The
patient, all alleles should match. Assuming good-quality alleles matched at all loci, supporting genotypic identity.

tion. An area of malignant tissue was present on the slide.

Table 11.9 Types of SNP
The pathologists were suspicious about the malignancy
as there was no other malignant tissue observed in other SNP Region Alteration
sections. The tissue fragment was microdissected from Type I Coding Nonconservative
the thin section and tested at nine STR loci. The allelic Type II Coding Conservative
prole was compared to reference DNA from the patient. Type III Coding Silent
The proles were identical, conrming that the tissue Type IV Noncoding 5 UTR*
fragment was from the patient. Type V Noncoding 3 UTR
Type VI Noncoding, other
*Untranslated region
Single Nucleotide
Polymorphisms
Data from the Human Genome Project revealed that the changes was not as easy as detection of STRs, VNTRs, or
human nucleotide sequence differs every 10001500 even RFLPs. With improving technology (see methods
bases from one individual to another.30 The majority of described in Chapter 9), mapping studies are achieving
these sequence differences are variations of single nucleo- denser coverage of the genome.32
tides or SNPs. The traditional denition of polymorphism In 1999 the SNP Consortium (TSC) was established as
requires that the genetic variation is present at a frequency a public resource of SNP data. The original goal of TSC
of at least 1% of the population. The International SNP was to discover 300,000 SNPs in 2 years, but the nal
Map Working Group observed that two haploid genomes results exceeded 1.4 million SNPs released into the pub-
differ at 1 nucleotide per 1331 bp.31 This rate, along lic domain by the end of 2001. Although STRs have had
with the theory of neutral changes expected in the human the most practical use in clinical applications, SNPs, with
population, predicts 11 million sites in a genome of 3 their denser coverage of the genome, are especially
billion bp that vary in at least 1% of the worlds pop- attractive markers for future genetic variation and disease
ulation. In other words, each individual has 11 million association studies.33,34
SNPs.
Initially, the only way to detect SNPs was by direct
The Human Haplotype
sequencing. A number of additional methods have now
Mapping (HapMap) Project
been designed to detect single nucleotide polymorphisms
(see Chapter 9). Computer analysis is also required to Despite the presence of numerous polymorphisms, any
conrm that the population frequency of the SNPs meets two people are 99.9% identical at the DNA sequence
the requirements of a polymorphism. So far, approxi- level. Understanding the 0.1% difference is important,
mately 5 million SNPs have been identied in the human in part because these differences may be the basis of
genome. Almost all (99%) of these have no biological differences in disease susceptibility and other variations
effect. Over 60,000, however, are within genes, and some among normal human traits. The key to nding the
are associated with disease. A familiar example is the sin- genetic sources of these variations depends on identi-
gle nucleotide polymorphism responsible for the forma- cation of closely linked markers or landmarks through-
tion of hemoglobin S in sickle cell anemia. SNPs have out the genome. Genes, RFLPs, VNTRs, STRs, and other
been classied according to location with relation to cod- genetic structures have been mapped previously; how-
ing sequences and whether they cause a conservative or ever, long stretches of DNA sequence are yet to be cov-
nonconservative sequence alteration (Table 11.9). ered with high density. Closely linked markers allow
Due to the density of SNPs across the human genome, accurate mapping of regions associated with phenotypic
these polymorphisms were of great interest for genetic characteristics.
mapping, disease prediction, and human identication. Blocks of closely linked SNPs on the same chromo-
The problem was that detection of single base pair some tend to be inherited together; that is, recombination

phase was started to generate an even more detailed map.

The new phase will increase the density of SNP identi-
Haplotype cation vefold from 1 SNP per 3000 bases to 1 SNP per
~10,000 bp
600 bases, or a total of 4.6 million SNPs.
Finding a haplotype frequently in people with a dis-
ease, especially genetically complex diseases such as
asthma, heart disease, type II diabetes, or cancer, identi-
es a genomic region that may contain genes contribut-
ing to the condition. Because the second phase (phase II
HapMap) will be so detailed, the results are expected to
advance efforts signicantly to locate specic genes
involved in these complex genetic disorders.
To create the HapMap, DNA was taken from blood
Figure 11-25 Sections of DNA along chromosomes can samples from 270 volunteer donors from Chinese,
be inherited as a unit or block of sequence in which no Japanese, African, and European populations. SNPs were
recombination occurs within the block. All the SNPs on that
detected in DNA from each individual and compared.
block comprise a haplotype.
SNP detection is performed by high throughput detec-
tion systems such as Beadarray, Invader, Multiplex Inver-
sion Probe, Fluorescent Polarization-Template Directed
rarely takes place within these sequences. This is a phe-
Dye Terminator Incorporation, and Homogenous Mass
nomenon known as linkage disequilibrium. The groups
EXTEND (MassArray, Sequenom). See Chapter 9 for
of SNPs comprise haplotypes. In the human genome,
descriptions of these assay methods. Ultimately the hap-
SNP haplotypes tend to be approximately 2060,000 bp
lotypes, identied by tag SNPs, will be used for associa-
of DNA sequence containing up to 60 SNPs (Fig. 11-25).
tion studies assuming the common disease/common
Furthermore, as all of the SNPs in the haplotype are
variant hypothesis. That is, diseases will be identied by
inherited together, the entire haplotype can be identied
a pattern of haplotypes in an individual. This information
by only a subset of the SNPs in the haplotype. This means
will lead to therapeutic strategies or prediction of treat-
that up to 60,000 bp of sequence can be identied through
ment response. In addition, genetic determinants of nor-
detection of four or ve informative SNPs, or tag SNPs.35
mal traits such as longevity or disease resistance may also
SNP haplotypes offer great potential for mapping of
be uncovered. Laboratory testing for these haplotypes
disease genes. A mutation responsible for a genetic dis-
will be relatively simple to perform and interpret, com-
ease originally occurs in a particular haplotype, the ances-
pared with the more complex methods, such as single-
tral haplotype. Over several generations the disease
strand conformational polymorphism, that are required to
allele and the SNPs closest to it (the haplotype) tend to be
screen for gene mutations. Technologies such as Invader
inherited as a group. This haplotype, therefore, should
and PyroSequencing are ideally suited to detect known
always be present in patients with the disease. The genetic
single base changes such as tag SNPs.
location and the identication of any disease gene can
thus be ascertained, by association with an SNP haplo-
type. There is, therefore, much interest in developing a Mitochondrial DNA
haplotype map of the entire human genome.
To this end, the Human Haplotype Mapping project
Polymorphisms
was initiated in October, 2002, with a target completion Mitochondria contain a circular genome of 16,569
date of September 2005.36,37 The goal of the project is to base pairs. The two strands of the circular mitochondrial
map the common patterns of SNPs in the form of a hap- DNA (mtDNA) chromosome have an asymmetric distri-
lotype map, or HapMap. An initial draft of the HapMap bution of Gs and Cs generating a G-rich heavy (H)- and
was completed before the deadline date, and a second a C-rich light (L)-strand. Each strand is transcribed from

a control region starting at one predominant promoter, PL region has been validated for the genetic characterization
on the L strand and PH on the H strand, located in of forensic specimens39 and disease states40,41 and for
sequences of the mitochondrial circle called the displace- geneology studies.42,43
ment (D)-loop (Fig. 11-26). The D-loop forms a triple- In contrast to nuclear DNA, including the Y chromo-
stranded region with a short piece of H-strand DNA, the some, mtDNA follows maternal clonal inheritance pat-
7S DNA, synthesized from the H strand. PL starts bidi- terns. With few exceptions,44 mtDNA types (sequences)
rectional transcription on the L-strand and PH1 and PH2 on are inherited maternally. These characteristics make pos-
the H-strand. RNA synthesis proceeds around the circle sible collection of reference material for forensic analysis,
in both directions. A bidirectional attenuator sequence even in cases in which generations are skipped. For foren-
limits L-strand synthesis and, in doing so, maintains a sic purposes, the quality of an mtDNA match between
high ratio of rRNA to mRNA transcripts from the H- two mtDNA sources is determined by counting the num-
strand (see Fig. 11-26). The mature RNAs, 1 to 17, are ber of times the mtDNA prole occurs in data collections
generated by cleavage of the polycistronic (multiple of unrelated individuals. The estimate of uniqueness of a
gene) transcript at the tRNAs. particular mtDNA type depends on the size of the refer-
Genes encoded on the mtDNA include 22 tRNA genes, ence database.39 As more mitochondrial DNA sequences
2 ribosomal RNA genes, and 12 genes coding for com- are entered into the database, the more powerful the iden-
ponents of the oxidation-phosphorylation system. Muta- tication by mitochondrial DNA will become.
tions in these genes are responsible for neuropathies and Mitochondrial nucleotide sequence data are divided
myopathies (see Chapter 13). into two components, forensic and public. The forensic
In addition to coding sequences, the mitochondrial component consists of anonymous population proles and
genome has two noncoding regions that vary in DNA is used to assess the extent of certainty of mtDNA identi-
sequence and are called hypervariable regions I and II, cations in forensic casework. All forensic proles
HVI and HVII (see Fig. 11-26). The reference mtDNA include, at a minimum, a sequence region in HVI (nuc-
hypervariable region is the sequence published initially by leotide positions 1602416383) and a sequence region in
Anderson, called the Cambridge Reference Sequence, HVII (nucleotide positions 53372). These data are
the Oxford sequence, or the Anderson sequence.38 Poly- searched through the CODIS program in open case les
morphisms are denoted as variations from the reference and missing persons cases. Approximately 610 bp, includ-
sequence. Nucleotide sequencing of the mtDNA control ing the hypervariable regions of mtDNA, are routinely
sequenced for forensic analysis. Deviations from the
Cambridge reference sequence are recorded as the num-
HV 1 HV 2 ber of the position and a base designation. For example, a
(342 bp) (268 bp) transition from A to G at position 263 would be recorded
PH1 as 263 G.
PH2 The public data consist of mtDNA sequence data from
PL
the scientic literature and the GenBank and European
Molecular Biology Laboratory databases. The public data
Mitochondrial genome have not been subjected to the same quality standards as
(16,569 bp) the forensic data. The public database provides informa-
tion on worldwide population groups not contained
within the forensic data and can be used for investigative
purposes.
As all maternal relatives share mitochondrial se-
Figure 11-26 The mitochondrial genome is circular.
The hypervariable (HV) sites in the control region are quences, the mtDNA of sisters and brothers or mothers
shown. Mitochondrial genes are transcribed bidirec- and daughters will exactly match in the hypervariable
tionally starting at promoters (PL and PH ). region in the absence of mutations. The use of mtDNA

subjected to dideoxy sequencing (see Chapter 10). A pos-

Advanced Concepts itive control of a known mitochondrial sequence is
included with every run along with a reagent blank for
Mitochondrial proles in both public and private PCR contamination and a negative control for contami-
data sets are identied in a systematic naming nation during the sequencing reaction. If the negative or
scheme. A standard 14-character nucleotide se- reagent blank controls yield sequences similar to the
quence identier is assigned to each prole. The rst specimen sequence, the results are rejected. Both strands
three characters indicate the country of origin. The of the specimen PCR product must be sequenced.
second three characters describe the group or ethnic The mitochondrial sequence traces are imported into
affiliation to which a particular prole belongs. The a software program for analysis. With the sequence
nal six characters are sequential acquisition num- software, the heavy-strand sequences should be reverse-
bers. For example, prole USA.ASN.000217 desig- complemented so that the bases are aligned in the light-
nates the 217th nucleotide sequence from an strand orientation for strand comparison and base
individual of Asian American ethnicity. The popula- designation. Occasionally, more than one mtDNA popu-
tion/ethnicity codes for indigenous peoples are lation is present in the same individual. This is called het-
numeric and arbitrarily assigned. For example, eroplasmy. In point heteroplasmy, two DNA bases are
USA.008.000217 refers to an individual from the observed at the same nucleotide position. Length het-
Apache tribe sampled from the United States. eroplasmy is typically a variation in the number of bases
in tracts of like bases (homopolymeric tracts, e.g.,
CCCCC). A length variant alone cannot be used to sup-
port an interpretation of exclusion.46
polymorphisms is for exclusion. There is an average of Samples cannot be excluded as originating from the
8.5 nucleotide differences between mtDNA sequences of same source just on the basis of a sequence matching.
unrelated individuals in the hypervariable region. The The conclusion that an individual can or cannot be elim-
Scientic Working Group for DNA Methods (SWG- inated as a possible source of the mtDNA is reached
DAM) has accumulated a database of more than 4100 under conditions dened by the individual laboratory. In
mtDNA sequences. The size of this database dictates the addition, evaluation of cases in which heteroplasmy may
level of certainty of exclusion using mtDNA. have occurred is laboratory-dened.
SWGDAM has recommended guidelines for the use of In general, if two or more nucleotide differences occur
mtDNA for identication purposes.45 The process begins between the reference and test samples, the reference and
with visual inspection of the specimen. Bone or teeth test samples can be excluded as originating from the same
specimens are examined and ascertained to be of human person or a maternally related person. One nucleotide dif-
origin. In the case of hair samples, the hairs are examined ference between the samples is interpreted as an incon-
microscopically and compared with hairs from a known clusive result. If the test and reference samples show
source. Sequencing is performed only if the specimen sequence concordance, then the test specimen cannot be
meets the criteria of origin and visual matching to the ref- excluded as coming from the same individual or maternal
erence source. Before DNA isolation, the specimens are relative as the source of the reference sequence.
cleaned with detergent or, for bone or teeth, by sanding to The mtDNA prole of a reference and test sample that
remove any possible source of extraneous DNA adhering cannot be excluded as possibly originating from the same
to the specimen. The cleaned specimen is then ground in source can be searched in a population database. Popula-
an extraction solution. Hair shafts yield mtDNA as do the tion databases such as the mtDNA population database
eshy pulp of teeth or bone. The dentin layer of old tooth and CODIS are used to assess the weight of forensic evi-
samples will also yield mtDNA. DNA is isolated by dence, based on the number of different mitochondrial
organic extraction (see Chapter 4) and amplied by PCR sequences previously identied. The SWGDAM database
(see Chapter 7). The PCR products are then puried and contains mtDNA sequence information from more than

4100 unrelated individuals. The quality of sequence infor- top panel. One year later, the patient was reevalu-
mation used and submitted for this purpose is extremely ated. The results from the same marker are shown in
important.47,48 Based on the number of known mtDNA the bottom panel.
sequences, the probability of sequence concordance in
two unrelated individuals is estimated at 0.003. The prob- 120 125 130 135 140
ability that two unrelated individuals will differ by a sin-
REC
gle base is 0.014.
Mitochondrial DNA analysis is also used for lineage R
studies and to track population migrations. Like the Y
chromosome, there is no recombination between mito- 41919
chondria, and polymorphisms arise mostly through muta-
DON
tion. The location and divergence of specic sequences in
the HV regions of mitochondria are an historical record D
of the relatedness of populations.
Because mitochondria are naturally amplied (hun- 61188
dreds per cell and tens of circular genomes per mitochon- POST
dria) and because of the nuclease- and damage-resistant
circular nature of the mitochondrial DNA, mtDNA typing
has been a useful complement to other types of DNA 40704 3171
identication. Challenging specimens of insufficient REC
quantity or quality for nuclear DNA analysis may still
yield useful information from mtDNA. To this end, R
mtDNA analysis has been helpful for the identication of
missing persons in mass disasters or for typing ancient 41919
specimens. MtDNA typing can also be applied to quality
DON
assurance issues as described for STR typing of pathol-
ogy specimens.49 D
61188
POST
Case Study 11 1
A 32-year-old woman was treated for mantle cell
lymphoma with a nonmyeloablative bone marrow 53400
transplant. Before the transplant and after a donor
was selected, STR analysis was performed on the Results from engraftment analysis at 100 days (top)
donor and the recipient to nd informative alleles. and 1 year (bottom) showing marker D5S818. R. recipient;
D, donor.
One hundred days after the transplant, engraftment
was evaluated using the selected STR alleles. The
QUESTION: Was the woman successfully engrafted
results from one marker, D5S818, are shown in the
with donor cells? Explain your answer.

Case Study 11 2 Case Study 11 3

A young man of 26 years reported to his doctor with A fixed paraffin-embedded tissue section was
joint pain and fatigue. Complete blood count and dif- received in the pathology department with a diagno-
ferential counts were indicative of chronic myeloge- sis of benign uterine broids. Slides were prepared
nous leukemia. The diagnosis was conrmed by for microscopic study. Only benign broid cells
karyotyping, showing 9/20 metaphases with the were observed on all slides, except one. A small
t(9;22) translocation. Quantitative PCR was per- malignant process was observed located between
formed to establish a baseline for monitoring tumor the broid and normal areas on one slide. As similar
load during and following treatment. Treatment with tissue was not observed on any other section, it was
Gleevec and a bone marrow transplant were recom- possible that the process was a contamination from
mended. The man had a twin brother, who volun- the embedding process. To determine the origin of
teered to donate bone marrow. The two brothers were the malignant cells, DNA was extracted from the
not sure if they were fraternal or identical twins. malignant area and compared with DNA extracted
Donor and recipient buccal cells were sent to the from normal tissue from the patient. The results are
molecular pathology laboratory for STR informative shown below.
analysis. The results are shown below.
120 140 160 180 200 220 240 260 280 300 120 140 160 180 200 220 240 260 280 300 320
P
D5S818 D13S317 D7S820 D16S539
D5S818 D13S317 D7S820 D16S539
vWA TH01 TP0X CSF
vWA TH01 TP0X CSF
STR analysis of suspicious tissue discovered on a paraffin

LPL F13B FESFPS F13A section. Eight loci were tested. P, patient; T, tissue section.
QUESTION: Were the malignant cells seen in one

section derived from the patient, or were they a con-
taminant of the embedding process? Explain your
LPL F13B FESFPS F13A
answer.
STR analysis of two brothers, one who serves as bone
marrow donor (D) to the other (R). Twelve loci are shown.
QUESTION: Were the brothers fraternal or identical

twins? Explain your answer.

Paternity Index
STUDY QUESTIONS Locus Child AF for Shared Allele
D5S818 9,10 9 0.853

1. Consider the following STR analysis.
D8S1179 11 11,12 2.718
Locus Child Mother AF1 AF2
D16S539 13,14 10,14 1.782
D3S1358 15/15 15 15 15/16
vWA 17/18 17 17/18 18 a. What is the combined paternity index from these
three loci?
FGA 23/24 22/23 20 24 b. With 50% prior odds, what is the probability of
TH01 6/10 6/7 6/7 9/10 paternity from these three loci?
TPOX 11/11 9/11 9/11 10/11
4. Consider the following theoretical allele frequencies
CSF1PO 12/12 11/12 11/13 11/12 for the loci indicated.
D5S818 10/12 10 11/12 12 Locus Alleles Allele Frequency
D13S317 9/10 10/11 10/11 9/11 CSF1PO 14 0.332
a. Circle the childs alleles that are inherited from D13S317 9, 10 0.210, 0.595
the father. TPOX 8, 11 0.489, 0.237
b. Which alleged father (AF) is the biological parent?
a. What is the overall allele frequency, using the
2. The following evidence was collected for a criminal
product rule?
investigation.
b. What is the probability that this DNA found
Locus Victim Evidence Suspect at the two sources came from the same
person?
TPOX 11/12 12, 11/12 11
CSF1PO 10 10, 9 9/10 5. STR at several loci were screened by capillary elec-
trophoresis and uorescent detection for informative
D13S317 8/10 10, 8/10 9/12
peaks prior to a bone marrow transplant. The follow-
D5S818 9/11 10/11, 9/11 11 ing results were observed:
TH01 6/10 6/10, 8/10 5/11
Locus Donor Alleles Recipient Alleles
FGA 20 20, 20/22 20
LPL 7, 10 7, 9
vWA 15/17 18, 15/17 15/18
F13B 8, 14 8
D3S1358 14 15/17, 14 11/12
FESFPS 10 7
The suspect is heterozygous at the amelogenin locus. F13A01 5, 11 5, 11
a. Is the suspect male or female?
b. In the evidence column, circle the alleles belong- a. Which loci are informative?
ing to the victim.
c. Should the suspect be held or released? 6. An engraftment analysis was performed by capillary
gel electrophoresis and uorescence detection. The
3. A child and an alleged father (AF) share alleles with uorescence as measured by the instrument under the
the following paternity index: FESFPS donor peak was 28118 units, and that under

the FESFPS recipient peak was 72691. What is the forensic deoxyribonucleic acid (DNA) amplication
percent donor in this specimen? and typing kit. Journal of Forensic Science 1991;
36:155156.
7. The T-cell fraction from the blood sample in Question 6. Chakraborty R, Stivers DN, Su B, et al. The utility
6 was separated and measured for donor cells. of short tandem repeat loci beyond human iden-
Analysis of the FESFPS locus in the T-cell fraction tication: Implications for development of new
yielded 15362 uorescence units under the donor DNA typing systems. Electrophoresis 1999;20:
peak and 97885 under the recipient peak. What does 168296.
this result predict with regard to T-cell mediated 7. Butler J. Forensic DNA Typing: Biology and Tech-
events such as graft-versus-host disease or graft- nology Behind STR Markers London: Academic
versus-tumor? Press, 2001.
8. Olaisen B, Br W, Brinkmann B, et al. DNA
8. If a child had a Y haplotype including DYS393 allele recommendations 1997 of the International
12, DYS439 allele 11, DYS445 allele 8, and DYS447 Society for Forensic Genetics. Vox Sanguinis
allele 22, what are the predicted Y alleles for these 1998;74:6163.
loci of the natural father? 9. Leclair B, Frageau CJ, Bowen KL, et al. Precision
and accuracy in uorescent short tandem repeat
9. Which of these would be used for a surname test: Y- DNA typing: Assessment of benets imparted
STR, mitochondrial typing, or autosomal STR? by the use of allelic ladders with the AmpF/
STR Proler Plus kit. Electrophoresis 2004;25:
10. An ancient bone fragment was found and claimed to 79096.
belong to an ancestor of a famous family. Living 10. Butler J, Appleby JE , Duewer DL. Locus-specic
members of the family donated DNA for conrma- brackets for reliable typing of Y-chromosome short
tion of the relationship. What type of analysis would tandem repeat markers. Electrophoresis 2005;26:
likely be used for this test? Why? 258390.
11. Hartmann J, Houlihan BT, Keister RS, et al. The
11. What are two biological exceptions to positive iden- effect of ethnic and racial population substructuring
tication by autosomal STR? on the estimation of multi-locus xed-bin VNTR
RFLP genotype probabilities. Journal of Forensic
References Science 1997;42(2):23240.
1. Herrin GJ. Probability of matching RFLP patterns 12. Wenk RTMCF. Determination of sibship in any two
from unrelated individuals. American Journal of persons. Transfusion 1996;36: 25962.
Human Genetics 1993;52:49197. 13. Douglas J, Boehnke M, Lange K. A multipoint
2. Gill P, Jeffreys AJ, Werrett DJ. Forensic applica- method for detecting genotyping errors and
tions of DNA ngerprints. Nature 1985;318: mutations in sibling-pair linkage data. American
57779. Journal of Human Genetics 2000;66:128797.
3. Budowle B, Bacchtel FS. Modications to improve 14. Boehnke M, Cox NJ. Accurate inference of
the effectiveness of restriction fragment length poly- relationships in sib-pair linkage studies.
morphism typing. Applied and Theoretical Electro- American Journal of Human Genetics 1997;61:
phoresis 1990;1:18187. 42329.
4. Evett I, Gill P. A discussion of the robustness of 15. Epstein M, Duren WL, Boehnke M. Improved
methods for assessing the evidential value of DNA inference of relationship for pairs of individuals.
single locus proles in crime investigations. Elec- American Journal of Human Genetics 2000;67
trophoresis 1991;12:22630. (5):121931.
5. Walsh P, Fildes N, Louie AS, et al. Report of the 16. Jobling M, Pandya A, Tyler-Smith C. The Y chro-
blind trial of the Cetus Amplitype HLA DQ alpha mosome in forensic analysis and paternity testing.

International Journal of Legal Medicine 1997;110: geneic transplant: A comparative study of current
11824. technologies. Bone Marrow Transplant 1995;16:
17. Gill P, Brenner C, Brinkmann B, et al. DNA 4355.
commission of the international society of 27. Smith A, Martin PJ. Analysis of amplied variable
forensic genetics: Recommendations on foren- number tandem repeat loci for evaluation of
sic analysis using Y-chromosome STRs. Interna- engraftment after hematopoietic stem cell trans-
tional Journal of Legal Medicine 2001;114: plantation. Reviews in Immunogenetics 1999;
30509. 1:25564.
18. Sinha S, Budowle B, Chakraborty R, et al. Utility 28. Thiede C, Bornhauser M, Ehninger G. Evaluation
of the Y-STR typing systems Y-PLEXTM 6 and Y- of STR informativity for chimerism testing: Com-
PLEXTM 5 in forensic casework and 11 Y-STR parative analysis of 27 STR systems in 203
haplotype database for three major population matched related donor recipient pairs. Leukemia
groups in the United States. Journal of Forensic 2004;18:24854.
Science 2004;49:110. 29. Antin J, Childes R, Filipovich AH, et al. Establish-
19. Sajantila A, Lukka M, Syvanen AC. Experimentally ment of complete and mixed donor chimerism
observed germline mutations at human micro- and after allogeneic lymphohematopoietic trans-
mini-satellite loci. European Journal of Human plantation: Recommendations from a work-
Genetics 1999;7:26366. shop at the 2001 tandem meetings. Biology
20. Brinkmann B, Klintschar M, Neuhuber F, et al. of Blood and Marrow Transplantation 2001;7:
Mutation rate in human microsatellites: Inuence 47385.
of the structure and length of the tandem repeat. 30. Kruglyak L, Nickerson DA. Variation is the spice
American Journal of Human Genetics 1998;62: of life. Nature Genetics 2001;27:23436.
140815. 31. Sachidanandam R, Weissman D, Schmidt SC, et al.
21. Heyer E, Puymirat J, Dieltjes P, et al. Estimating International SNP Map Working Group: A map of
Y chromosome specic microsatellite mutation human genome sequence variation containing 1.42
frequencies using deep rooting pedigrees. Human million single nucleotide polymorphisms. Nature
Molecular Genetics 1997;6:799803. 2001;409:92833.
22. Redd A, Agellon AB, Kearney VA, et al. Gene ow 32. Matise T, Sachidanandam R, Clark AG, et al. A 3.
from the Indian subcontinent to Australia: Evidence 9-centimorgan-resolution human single-nucleotide
from the Y chromosome. Forensic Science Interna- polymorphism linkage map and screening set.
tional 2002;130:97111. American Journal of Human Genetics 2003;73:
23. Van Deerlin V, Leonard DGB. Bone marrow 27184.
engraftment analysis after allogeneic bone 33. Shriver M, Mei R, Parra EJ, et al. Large-scale SNP
marrow transplantation. Acute Leukemias 2000; analysis reveals clustered and continuous patterns
20:197225. of human genetic variation. Human Genomics
24. Thiede C, Florek M, Bornhauser M, et al. Rapid 2005;2:8189.
quantication of mixed chimerism using multiplex 34. Tamiya G, Shinya M, Imanishi T, et al. Whole
amplication of short tandem repeat markers and genome association study of rheumatoid arthritis
uorescence detection. Bone Marrow Transplant using 27,039 microsatellites. Human Molecular
1999;23:105560. Genetics 2005.
25. Thiede C. Diagnostic chimerism analysis after allo- 35. Patil N, Berno AJ, Hinds DA, et al. Blocks of lim-
geneic stem cell transplantation: New methods and ited haplotype diversity revealed by high-resolution
markers. American Journal of Pharmacogenomics scanning of human chromosome 21. Science 2001;
2004;4:17787. 294:171923.
26. Leclair B, Frageau CJ, Aye MT, et al. DNA typing 36. Consortium TIH. The International HapMap Project.
for bone marrow engraftment follow-up after allo- Nature 2003;426:78996.

37. Consortium TIH. Integrating ethics and science in biopsy slide. Journal of Clinical Pathology 2005;
the International HapMap Project. Nature Review 58:8386.
Genetics 2004;5:46775. 50. Bar W, Brinkman B, Budowle B, et al. DNA
38. Anderson S, Bankier AT, Barrell BG, et al. Se- recommendations: Further report of the DNA
quence and organization of the human mitochon- Commission of the ISFH regarding the use of
drial genome. Nature 1981;290:45765. short tandem repeat systems. International
39. Budowle B, Wilson MR, DiZinno JA, et al. Mito- Society for Forensic Haemogenetics. Interna-
chondrial DNA regions HVI and HVII population tional Journal of Legal Medicine 1997;110:
data. Forensic Science International 1999;103: 17576.
2335. 51. Sinha S, Budowle B, Arcot SS, et al. Development
40. Tajima A, Hamaguchi K, Terao H, et al. Genetic and validation of a multiplexed Y-Chromosome
background of people in the Dominican Republic STR genotyping system,Y-PLEX6, for forensic
with or without obese type 2 diabetes revealed by casework. Journal of Forensic Science 2003;48:
mitochondrial DNA polymorphism. Journal of 111.
Human Genetics 2004;49:49599. 52. Iida R, Sawazaki K, Ikeda H, et al. A novel
41. van der Walt J, Dementieva YA, Martin ER, et al. multiplex PCR system consisting of Y-STRs
Analysis of European mitochondrial haplogroups DYS441, DYS442, DYS443, DYS444, and
with Alzheimer disease risk. Neuroscience Letters DYS445. Journal of Forensic Science 2003;
2004;365:2832. 48:108890.
42. Nasidze I, Ling EY, Quinque D, et al. Mitochon- 53. Hanson E, Ballantyne J. A highly discriminating
drial DNA and Y-chromosome variation in the 21 locus Y-STR megaplex system designed to
Caucasus. Annals of Human Genetics 2004;68: augment the minimal haplotype loci for forensic
20521. casework. Journal of Forensic Science 2004;49:
43. Shriver M, Kittles RA. Genetic ancestry and the 112.
search for personalized genetic histories. Nature 54. Schoskea R, Vallonea PM, Klinea MC, et al. High-
Review Genetics 2004;5:61118. throughput Y-STR typing of U.S. populations with
44. Schwartz M, Vissing J. Paternal inheritance of 27 regions of the Y chromosome using two multi-
mitochondrial DNA. New England Journal of plex PCR assays. Forensic Science International
Medicine 2002;347:57680. 2004;139:10721.
45. Scientic Working Group on DNA Analysis 55. Gomez J, Carracedo A. The 19981999 collabora-
Methods (SWGDAM). Guidelines for mitochon- tive exercises and prociency testing program on
drial DNA (mtDNA) nucleotide sequence inter- DNA typing of the Spanish and Portuguese working
pretation. Forensic Science Communications group of the international society for forensic gene-
2003;5(2). tics (GEP-ISFG). Forensic Science International
46. Stewart JEB, Fisher, CL, Aagaard, PJ, et al. Length 2000;114:2130.
variation in HV2 of the human mitochondrial DNA 56. Monson K, Budowle B. A comparison of the
control region. Journal of Forensic Science 2001; xed bin method with the oating bin and
46:86270. direct count methods: Effect of VNTR prole
47. Bandelt H-J, Salas A, Bravi C. Problems in FBI frequency estimation and reference popula-
mtDNA database. Science 2004;305:140204. tion. Journal of Forensic Science 1993;38:
48. Budowle B, Polanskey D. FBI mtDNA database: A 103750.
cogent perspective. Science 2005;307:84547. 57. Norton H, Neel JV. Hardy-Weinberg equilibrium
49. Alonso A, Alves C, Surez-Mier MP, et al. and primitive populations. American Journal of
Mitochondrial DNA haplotyping revealed the pres- Human Genetics 1965;17:9192.
ence of mixed up benign and neoplastic tissue sec- 58. Whittemore A. Genetic association studies:
tions from two individuals on the same prostatic Time for a new paradigm? Cancer Epidemi-

ology Biomarkers and Prevention 2005;14: haplotypes. Forensic Science International 2001;
1359. 118:10613.
59. Brenner C. Forensic mathematics http://dna-view. 61. Hall J, Lee MK, Newman B, et al. Linkage of
com/index.html, 2005. early-onset familial breast cancer to chromosome
60. Roewer L, Krawczak M, Willuweit S, et al. 17q21. Science 1990;250:168489.
Online reference database of European Y- 62. King M-C. Localization of the early-onset breast
chromosomal short tandem repeat (STR) cancer gene. Hospital Practice 1991:8994.
Chapter 12 Maribeth L. Flaws and Lela Buckingham
Detection and
Identication of
Microorganisms
OUTLINE OBJECTIVES
SPECIMEN COLLECTION Name the organisms that are common targets for
SAMPLE PREPARATION molecular-based laboratory tests.
QUALITY CONTROL
Identify advantages and disadvantages of using molecular-
BACTERIAL TARGETS OF MOLECULAR- based methods as compared with traditional culture-based
BASED TESTS
Selection of Sequence Targets for methods in the detection and identication of microorgan-
Detection of Microorganisms isms.
Molecular Detection of Bacteria Differentiate between organisms for which commercially
Respiratory Tract Pathogens
Urogenital Tract Pathogens available nucleic acid amplication tests exist and those
ANTIMICROBIAL AGENTS
for which home-brew polymerase chain reaction (PCR)
Resistance to Antimicrobial Agents is used.
Molecular Detection of Resistance List the genes involved in the emergence of antimicrobial
MOLECULAR EPIDEMIOLOGY resistance that can be detected by nucleic acid amplica-
Molecular Strain Typing Methods for tion methods.
Epidemiological Studies
Comparison of Typing Methods Compare and contrast the molecular methods that are used
VIRUSES to type bacterial strains in epidemiological investigations.
Human Immunodeciency Virus Explain the value of controls, in particular amplication
Hepatitis C Virus controls, in ensuring the reliability of PCR results.
Summary
FUNGI
Interpret pulse eld gel electrophoresis patterns to deter-
PARASITES
mine whether two isolates are related to or different from
each other.
263

The use of molecular-based tests in the clinical microbi- ioides6,7; and those for which reliable laboratory tests
ology laboratory has exploded over the last 1015 years. are lacking, such as Hepatitis C Virus (HCV) and Human
A brief review of a recent table of contents of the Journal Immunodeciency Virus (HIV).8
of Clinical Microbiology shows that the majority of Additionally, molecular-based tests have been devel-
research papers that are published in that journal are oped for organisms that are received in clinical laborato-
based on the molecular characterization of microorgan- ries in high volumes, such as Streptococcus pyogenes in
isms and the development and evaluation of molecular- throat swabs and Neisseria gonorrhoeae and Chlamydia
based laboratory tests that are used to detect and identify trachomatis in genital specimens.9 Furthermore, genes
microorganisms in clinical specimens and isolated in cul- that confer resistance to antimicrobial agents are the tar-
tures. Another important application of molecular tech- gets of molecular-based methodologies, such as mecA,
nology in the clinical microbiology laboratory is in the that contributes to the resistance of Staphylococcus aureus
comparison of biochemically similar organisms in out- to oxacillin10; vanA, vanB, and vanC, which give Entero-
break situations, known as molecular epidemiology, to coccus resistance to vancomycin11; and katG and inhA,
ascertain whether the isolates have a common or inde- which mediate M. tuberculosis resistance to isoniazid.12,13
pendent source. Finally, characterization (sequencing) of DNA and
When the potential of molecular-based methods was RNA is being used to nd and identify new organisms,
rst realized and the successful amplication of microor- such as Tropheryma whipplei14 and also to further char-
ganism nucleic acid was rst demonstrated, a common acterize or genotype known organisms, such as species of
fear (or hope, depending on the perspective) of microbiol- Mycobacterium, HCV, and HIV. Nucleic acid sequence
ogists was that the detection and identication of microor- information is also used to reclassify bacterial organisms
ganisms by traditional culture, stains, and biochemical based on 16S rRNA sequence homology, for epidemio-
testing would be relegated to the history books and that logical purposes, and to predict therapeutic efficacy.
molecular-based testing would be the sole methodology in The molecular methods that are used in the clinical
the clinical microbiology laboratory. Although molecular- microbiology laboratory are the same as those that were
based methods have denitely found a niche in clinical described previously for the identication of human poly-
microbiology, traditional culture and biochemical testing morphisms and those that will be discussed in subsequent
are still the major methods used for the detection and chapters for the identication of genes involved in cancer
identication of most microorganisms and will continue and in inherited diseases. The primary molecular methods
to be the major method for a long time. used in clinical microbiology laboratories are polymerase
Clinically important microorganisms include a range chain reaction (PCR): traditional, real-time, and reverse
of life forms from arthropods to prions. In contrast to transcriptase PCR (see Chapter 7), as well as sequencing
classical testing that analyzes phenotypic traits of (see Chapter 10). An additional method that is used in
microorganisms (microscopic and colonial morpholo- molecular epidemiology is pulsed-eld gel electrophore-
gies, enzyme or pigment production, as well as carbohy- sis (PFGE) (see Chapter 5) as well as other methods that
drate fermentation patterns), the analyte for molecular will be discussed in this chapter. All types of microorgan-
testing is the genome of the microorganism. Bacteria, isms serve as targets for molecular-based laboratory tests
fungi, and parasites have DNA genomes, whereas viruses from bacteria to viruses, fungi, and parasites. But the
can have DNA or RNA genomes. Prions, which cause development of molecular-based methods has been more
transmissable encephalopathies such as Creutzfeldt- successful for only some organisms and not yet for all
Jakob disease, consist only of protein. organisms, as will be discussed in this chapter.
Microorganisms targeted for molecular-based lab-
oratory tests have been those that are difficult and/or
time-consuming to isolate, such as Mycobacterium tuber-
Specimen Collection
culosis as well as other species of Mycobacterium1-3; As with any clinical test, collection and transport of spec-
those that are hazardous with which to work in the imens for infectious disease testing can affect analytical
clinical laboratory, such as Histoplasma 4,5 and Coccid- results negatively, unless proper procedure is followed.

Detection and Identication of Microorganisms Chapter 12 265
Microbiological specimens may require special handling

Table 12.1 Specimen Transport Systems
to preserve the viability of the target organism. Special
collection systems have been designed for collection of Type Examples
strict anaerobes, viruses, and other fastidious organisms. Sterile containers Sterile cups, screw-capped tubes, stop-
Although viability is not as critical for molecular testing, pered tubes, Petri dishes
the quality of nucleic acids may be compromised if the Swabs Calcium alginate swabs, Dacron swabs,
specimen is improperly handled. DNA and especially cotton swabs, nasopharyngeal-urogenital
RNA can be damaged in lysed or nonviable cells. Due to swabs, Swab Transport System
the sensitivity of molecular testing, it is also important to Specialty systems N. gonorrhoeae transport systems, SETS.
avoid contamination that could yield false-positive Proprietary Molecular testing, Neisseria gonorrhoeae
results. systems transport systems, STAR buffer42
Collection techniques designed to avoid contamination Anaerobic trans- Starplex Anaerobic Transport system
from the surrounding environment of adjacent tissues port systems (Fisher), BBL Vacutainer Anaerobic
apply to molecular testing, especially by amplication Specimen Collector
methods. Sampling must include material from the orig- Viral transport BD Cellmatics Viral Transport Pack, BBL
inal infection. The time and site of collection must be systems Viral Culturette
optimal for the likely presence of the infectious agent.
For example, Salmonella typhi is initially present in
peripheral blood but not in urine or stool until at least 2 ments addressing the requirements for transport devices
weeks after infection. For classical methods that include and quality control guidelines. The College of American
culturing of the agent, a sufficient number of microor- Pathologists requires documented procedures describing
ganisms (103/mL specimen) must be obtained for agar specimen handling, collection, and transport in each lab-
or liquid culture growth. For molecular testing, however, oratory.
minimum numbers (as few as 50 organisms) can be de-
tected successfully. The quantity of target organisms as
well as the clinical implications should be taken into
account when interpreting the signicance of positive
Advanced Concepts
results, as molecular detection can reveal infective agents Biological safety is an important concern for clini-
at levels below clinical signicance. cal microbiology. Because various collection, trans-
Equipment and reagents used for specimen collection port, and extraction systems inactivate organisms at
are also important for molecular testing (Table 12.1). different times, the technologist should follow rec-
Blood draws should go into the proper anticoagulant, if ommendations of the Centers for Disease Control
one is to be used. (See Chapter 16 for a list of anticoagu- and Prevention (CDC) that call for universal precau-
lants and their effect on molecular testing.) Although tions, treating all specimens as if they were infec-
wooden-shafted swabs may be used for throat cultures, tious throughout the extraction process. Updated
dacron or calcium alginate swabs with plastic shafts are guidelines are available from the CDC for the han-
recommended for collection of bacteria, viruses, and dling of suspected bioterrorism material; for exam-
mycoplasma from mucosal surfaces.15 The plastics are ple, the anthrax spores discovered in the United
less adherent to the microorganisms and will not interfere States Postal System in 2001. Organisms such as
with PCR reagents as do emanations from wooden- smallpox must be handled only in approved (level 4
shafted swabs. The swab extraction tube system (SETS, containment) laboratories. Molecular testing has
Roche Diagnostics) is designed for maximum recovery eased the requirements for preserving the viability
of microorganisms from swabs by centrifugation. of organisms for laboratory culture. This should
Commercial testing kits supply an optimized collec- improve safety levels as methods are devised that
tion system for a particular test organism. The Clinical replace growing cultures.
and Laboratory Standards Institute has published docu-

lysed. Serum or plasma can also be used as a source of

Sample Preparation microorganism nucleic acid.
The isolation of nucleic acids was described in Chapter 4. Sputum is used as a source of nucleic acid from organ-
Isolating nucleic acids from microorganisms is similar to isms that cause respiratory tract infections. Acidic poly-
isolating nucleic acids from human cells with only a few saccharides present in sputum may inhibit DNA
additional considerations. First, depending on the micro- polymerase and thus must be removed. Using a method
organism, more rigorous lysis procedures may be re- that reliably separates DNA from other cellular mole-
quired. Mycobacteria and fungi in particular have thick cules is sufficient in removing the inhibitors. Urine, when
cell walls that are more difficult to lyse than those of sent for nucleic acid isolation and amplication, is
other bacteria and parasites. Gram-positive bacteria hav- treated similarly to cerebrospinal uid; i.e., the specimen
ing a thicker cell wall than gram-negative bacteria may is centrifuged to concentrate the organisms and then sub-
require more rigorous cell lysis conditions. Mycoplasma, jected to nucleic acid isolation procedures. Inhibitors of
on the other hand, lacks a cell wall, and so care must be DNA polymerase, namely nitrate, crystals, hemoglobin,
taken with the sample to avoid spontaneous lysis of the and beta-human chorionic gonadotropin, have been de-
cells and loss of nucleic acids. Chapter 4 has a complete monstrated in urine as well.16
description of cell lysis methods. The type of specimen sent for molecular testing
Second, the concentration of organisms within the may also affect extraction and yield of nucleic acid. For
clinical sample must be considered. Samples should be example, viral nucleic acid from plasma is easier to
centrifuged to concentrate the uid and the organisms isolate than nucleic acid from pathogenic Enterococcus
within the uid from the milliliters of sample that are in stool specimens. Reagents and devices have been
often received, down to microliter volumes that are used developed to combine collection and extraction of
in nucleic acid amplication procedures. Third, inhibi- nucleic acid from difficult specimens; for example, stool
tors of enzymes used in molecular analysis may be pre- transport and recovery (STAR, Roche Diagnostics) buffer
sent in clinical specimens; removal or inactivation of or the FTA paper systems that inactivate infectious agents
inhibitors must be a part of specimen preparation. Fin- and adhere nucleic acids to magnetic beads or paper,
ally, if RNA is to be analyzed, inactivation or removal of respectively.
RNases in the sample and in all reagents and materials
that come into contact with the sample must occur.
Any clinical specimen can be used as a source of
Quality Control
microorganism nucleic acid for analysis. Depending on Quality control for any clinical laboratory procedure is
the specimen, however, special preparation procedures critical for ensuring the accuracy of patient results, and
may be necessary to allow for optimal nucleic acid isola- ensuring the quality of molecular methods in the clinical
tion, amplication, and analysis. In cerebrospinal uid, microbiology laboratory is equally important. The sensi-
inhibitors of DNA polymerase have been demonstrated; tivity of molecular methods is so high that even one mol-
therefore, careful isolation of nucleic acid from other ecule of target can be used as a template. Thus, ensuring
molecules present in the sample will more likely result in that the integrity of specimens is maintained, i.e., that
an ampliable sample. Isolation of nucleic acids from specimens are not contaminated by other specimens or
blood was discussed in Chapter 4. When processing a with the products of previous amplication procedures, is
whole blood specimen, it is critical to remove all of the critical to avoid false positives. On the other hand, it is
hemoglobin and other products of metabolized hemoglo- equally important to ensure that the lack of a product in an
bin because they have been shown to be inhibitors of amplication procedure is due to the absence of the target
DNA polymerase and thus may prevent the amplication organism and not the presence of inhibitors preventing the
of nucleic acid in the sample, resulting in a false negative. amplication of target sequences (false negative).
White blood cells, such as lymphocytes, can be used as a The incorporation of positive controls in a nucleic acid
source of nucleic acid for organisms, primarily viruses amplication assay shows that the assay system is func-
that infect these cells. In this case, the cells are isolated tioning properly. A sensitivity control that is positive at
from the red blood cells using Ficoll-Hypaque and then the lower limit of detection demonstrates sensitivity of

qualitative assays. Two positive controls, one at the lower the amplication of the control does not interfere with the
limit and the other at the upper limit of detection, should amplication of the target.
be run in quantitative assays to test the dynamic range of Heterologous intrinsic controls are eukaryotic genes.
the assay. Reagent blank or contamination controls are Human gene controls serve to ensure that human nucleic
critical for monitoring reagents for carry-over contamina- acid is present in the sample in addition to controlling for
tion. These controls contain all of the reagents except tar- extraction and amplication. The use of this control
get sequences and should always be negative. For typing requires that either two amplication reactions are per-
and other studies that might include nontarget organisms, formed on the sample, one for the control and the other
a negative template control containing nontarget organ- for the target gene, or that the amplication procedure be
ism(s) should also be included. With regard to amplica- multiplexed, which may result in interference of the am-
tion controls (see below), the negative template control plication of the target.
should have a positive amplication control signal, In a procedure that detects a microorganism, a positive
whereas the reagent blank should be negative for target result states that the organism is present in that sample,
and amplication. The presence of an amplicon in the whereas a negative result indicates that the organism is
negative control negates the assay, and the source of the not present (at least not at amounts up to the detection
contamination must be found. limits of the assay). Although most false positives can be
In order to rule out false negatives due to amplication eliminated by preventing carryover contamination,
failure, an amplication control aimed at a target that is another source of false positives that cannot be controlled
always present can be incorporated into an amplication in the laboratory is the presence of dead or dying micro-
assay. If the amplication control is amplied, then the organisms in the sample of a patient taking antimicrobial
fact that the target did not amplify can be more con- agents. In this situation, the nucleic acidbased tests will
dently interpreted as a true negative result. Amplication remain positive longer than culture assays and thus may
controls are usually housekeeping genes or those that are appear as a false positive. Repeating the nucleic acid
always present in a human sample. Housekeeping genes based assay 36 weeks after antimicrobial therapy is
that are used as internal controls include prokaryotic more likely to yield a true negative result.15
genes such as groEL, rpoB, recA, and gyrB19 and eukary- False-negative results may be more problematic and
otic genes such as -actin, glyceraldehyde-3-phosphate, arise when the organism is present, but the test result is
interferon-, extrinsic homologous control, human mito- negative. There are a few reasons for obtaining false-
chondrial DNA and peptidylprolyl isomerase A.15,20 negative results on a sample. First, the organism may be
Internal controls are amplication controls that mon- present, but the nucleic acid was degraded during collec-
itor particular steps of an amplication method. Internal tion, transport, and/or extraction. This can be prevented
controls can be either homologous extrinsic, heterolo- by proper specimen handling, effective transport media,
gous extrinsic, or heterologous intrinsic. A homolo- and inhibiting the activity of DNases and RNases that
gous extrinsic control is a wild-typederived control with may be present in the sample and in the laboratory.
a nontarget-derived sequence insert. This control is added Second, amplication procedures can be inhibited by
to every sample after nucleic acid extraction and before substances present in the specimen. Hemoglobin, lacto-
amplication. The amplication of this control occurs ferrin, heparin and other anticoagulants, sodium poly-
using the same primers as for the target. It is good for anethol sulfonate (anticoagulant used in blood culture
ensuring that amplication occurs in the sample, but media), and polyamines have been shown to inhibit nuc-
it does not control for target nucleic acid degradation leic acid amplication procedures.15 Attention to nucleic
during extraction. Heterologous extrinsic controls are acid isolation procedures and ensuring optimal purica-
nontarget-derived controls that are added to every sample tion of nucleic acid from other components of the speci-
before nucleic acid extraction. This control will ensure men and extraction reagents will help minimize the
that extraction and amplication procedures were accept- presence and inuence of inhibitors on the amplication
able, but a second set of primers must also be added to reaction. Experimenting with different commercial nuc-
the reaction for this control to be amplied. Use of this leic acid extraction systems may result in discovering a
control requires that the procedure be optimized such that system that is optimal for a particular purpose.15

Extensive validation must be performed on new molec- A B C

ular-based tests that are brought into the laboratory (see Genome
Chapter 16). Controls must be tested, and the sensitivity,
specicity, and reproducibility of the assay must be deter- Target organism
mined. Prociency testing of personnel should be per-
formed regularly to ensure that the people performing the
tests are doing so correctly. The Clinical and Laboratory Genome
Standards Institute,19 Association for Molecular Pathol-
ogy,20 and the Food and Drug Administration (FDA) have Target organism
(variant)
guidelines for molecular methods in the laboratory.
Genome
Bacterial Targets of
Molecular-Based Tests Other flora
Figure 12-1 Selection of target sequences for a nucleic
Selection of Sequence Targets acid test. The genomes of three organisms, the test target,
for Detection of Microorganisms a variant or different type of the test target, and another
nontarget organism, are depicted. Sequence region A is
Molecular methods are extremely sensitive and specic, not specic to the target organism and is, therefore, not
but these qualities are limited by the choice of target an acceptable area for probe or primer binding to detect
sequences for primer or probe hybridization. The primary the target. Sequences B and C are specic to the target.
Sequence B is variable and can be used to detect and type
nucleotide sequence of many clinically important the target, although some variants may escape detection.
microorganisms is now known. Sequences are available Sequence C will detect all types of the target organism, but
from GenBank or from published literature. The speci- cannot be used for determining the type.
city of molecular methods targeting these sequences
depends on the primers or probes that must hybridize to
the chosen point in the genome of the microorganism. conditions of the procedure. Sequence differences can be
Choosing a sequence target is critical for the specicity distinguished using sequence-specic probes or primers
of a molecular test (Fig. 12-1). Many microorganisms (see Chapters 6 and 7).
share the same sequences in evolutionarily conserved Probe design includes decisions as to the length of the
genes. These sequences would not be used for detection probe, whether the probe is DNA, RNA, or protein; how
of specic strains as they are likely to cross-react over a the probe is labeled; and, for nucleic acid probes, the
range of organisms. Sequences unique to the target organ- length of sequences included in the probe. The source of
ism are therefore selected. Some organisms, such as HIV, the probe is also important, as probes must be replenished
have variable sequences within the same species. Such and perform consistently over long-term use. Probes are
variations may be informative, for instance, in determin- manufactured synthetically or biologically by cloning
ing drug resistance or for epidemiological information; (see Chapter 6). Synthetic oligonucleotides may be pre-
however, not all types would be detected by a single ferred for known sequences where high specicity is
sequence. The variable sequences may be included in the required. Primer design includes the length and any mod-
probe or primer areas to differentiate between types. ications of the primers and type of signal generation for
These type-specic probes/primers can be used in a con- quantitative PCR. Refer to Chapters 6 and 7 for further
rmatory test after an initial test using probes or primers discussion of hybridization and amplication methods.
directed to a sequence shared by all types. Many tests currently used in molecular microbiology
In addition to their strain- or species-specicity, the are supplied as commercially designed systems, includ-
target sequences must meet technical requirements for ing prevalidated probes and/or primers. Several of these
hybridization conditions. Primers should have similar methods are FDA-approved or FDA-cleared (Table 12.2).
annealing temperatures and yield amplicons of appropri- An updated list of the currently available FDA-approved
ate size. Probes must hybridize specically under the tests is available at ampweb.org

Table 12.2 FDA-Approved/Cleared Test Methods

Target Organism Methods*
Cytomegalovirus NASBA, Hybrid capture
Hepatitis C virus (HCV), qualitative TMA, PCR
HCV, quantitative bDNA
Human immunodeciency virus (HIV), quantitative bDNA, NASBA, RTPCR
HIV resistance testing Sequencing
Hepatitis B virus/HCV/HIV screening for blood donations TMA, PCR, RTPCR
Human papillomavirus Hybrid capture
Chlamydia trachomatis (CT) Hybrid capture, TMA, hybridization protection assay, PCR
Neisseria gonorrhoeae (NG) Hybrid capture, TMA, hybridization protection assay, PCR
CT/NG Hybrid capture, TMA, hybridization protection assay, PCR, SDA
Gardnerella, Trichomonas vaginalis, Candida Hybridization
Group A Streptococci Hybridization protection assay
Group B Streptococci Hybridization protection assay, real-time PCR
Legionella pneumophila SDA
Methicillin Resistant Staphylococcus aureus Real-time PCR
Mycobacterium tuberculosis TMA, PCR
*See Chapters 7 and 9 for detailed description of these methods.
Manufacturers of these commercial reagents provide ing (see Chapter 10), enzyme immunoassay, dot blot
quality assurance requirements including controls and hybridization (see Chapter 6), and restriction enzyme
assay limitations. Each system must be validated on the analysis (see Chapter 6).
type of specimen used for clinical testing, including Real-time PCR, or quantitative PCR (qPCR), is used
serum, plasma, cerebrospinal and other body uids, tis- increasingly for detection of infectious agents as it pro-
sue, cultured cells, and organisms. In addition to the com- vides the sensitivity of PCR with more information than
mercial reagent sets, many professionals working in is available from conventional PCR. The quantitative
clinical laboratories have been developing laboratory capability of qPCR allows distinction of subclinical lev-
protocols (home-brew PCR) for most of the testing that els of infection (qualitatively positive by conventional
they perform. Primers are designed based on sequence PCR) from higher levels with pathological consequences.
information that has been published; the reagents are Furthermore, qPCR programs can be designed to provide
bought separately, and the procedures are developed and closed-tube sequence or typing analysis by adding a melt
optimized within the individual laboratory. curve temperature program following the amplica-
tion of the target (Fig. 12-2). Like conventional PCR,
qPCR can be performed on DNA extracted directly from
Molecular Detection of Bacteria
clinical specimens, including viral, bacterial, and fungal
Molecular-based methods that have been used to detect pathogens.
and identify bacteria include nucleic acid sequencebased Design of a qPCR method requires selection of a tar-
amplication (NASBA), Q-replicase, and PCR, includ- get gene unique to the specimen or specimen type for
ing the following modications: real-time or quantitative, which primers and probes can be designed. The DNA-
reverse transcriptase, nested, and multiplex (see Chapter specic dye, SYBR Green, can be used in place of probes
7 for explanations of these methods). Product detection is if the amplicon is free of artifacts such as misprimes or
accomplished by a variety of methods including Southern primer dimers (see Chapter 7). Probe types used most
blot hybridization (see Chapter 6), agarose gel electro- often include uorescent energy transfer hybridization
phoresis (see Chapter 5), PCR (see Chapter 7), sequenc- probes and hydrolysis (TaqMan) probes. The require-

0.08
Fluorescence (FZ/BackF1)
0.07
BK
0.06
0.05
0.04
JC
0.03
0.02
0.01
0
55 60 65 70 75 80 85
Temperature (C)
Fluorescence, d(FZ/BackF1)dt
0.012
0.01 BK
JC
0.008
Figure 12-2 Melt curve analysis of BK and JC viruses.
0.006 BK and JC are differentiated from one another by dif-
0.004 ferences in the Tm* of mthe probe specic for each viral
sequence. Fluorescence from double-stranded DNA
0.002
decreases with increasing temperature and DNA
0 denaturation to single strands (top panel). Instrument
software will present a derivative of the uorescence
0.002
60 62 64 66 68 70 72 74 76 78 80 (bottom panel) where the Tms (67o68oC for BK and
Temperature (C) 73o74oC for JC) are observed as peaks.
ment for probes in addition to primers increases the com- quences that have a great amount of heterogeneity encode
plexity of the design process. Instrument software and the stems of the rRNA and can be used to detect a specic
several Web sites offer computer programs that automat- genus or species of bacteria.19 rRNA was the original tar-
ically design primers and probes on submitted sequences. get of many bacterial molecular-based assays, but be-
Commercial primer and probe sets are also available for cause of the instability and difficulty in analyzing RNA,
purchase in kit form. A variety of gene targets have been current assays amplify and detect rDNA sequences.
used for qPCR detection of a number of organisms. A list
of examples of targets and probes is available in a com-
Respiratory Tract Pathogens
prehensive review by Espy et al.21
The genes that have been the targets for the design of Bacteria that cause respiratory tract disease account for
primers include ribosomal RNA (rRNA), both 16S and signicant morbidity and mortality levels around the
23S, and housekeeping genes such as groEL, rpoB, recA, world. Many of these organisms are endemic even in
and gyrB.21 16S rRNA is a component of the small sub- higher socioeconomic countries and are ubiquitous in
unit of the prokaryotic ribosome, and the 23S rRNA is a the environment. Bacteria in the respiratory tract are
component of the large subunit of the prokaryotic ribo- easily transmitted by contact with infected respiratory
some. Analysis of 16S rRNA is performed to determine secretions, and laboratory detection and identication
the evolutionary and genetic relatedness of microorgan- by nonmolecular methods often lack sensitivity and/or
isms and is driving changes in microorganism nomencla- are time consuming. Because of these organisms impor-
ture.22 The rDNA that encodes the rRNA consists of tance in causing human disease and the lack of sensitive,
alternating regions of conserved sequences and sequences rapid traditional laboratory testing, the development of
that vary greatly from organism to organism. The con- molecular-based assays that can detect and identify
served sequences encode the loops of the rRNA and can bacterial pathogens directly in respiratory specimens
be used as a target to detect all or most bacteria. The se- (Table 12.3) has been a priority.

Table 12.3 Typical Respiratory Tract Organisms Targeted by Molecular-Based Detection Methods23, 24
Traditional Diagnostic
Organism Specimen Source Gene target Methods
Mycoplasma pneumoniae Bronchoalveolar lavage 16S rRNA Culture
16S rDNA Serology
Species-specic protein gene
P1 adhesion gene
Chlamydophila pneumoniae Respiratory Cloned Pst I fragment Culture
Throat 16S rRNA
Artherosclerotic lesions MOMP
Legionella Deep respiratory secretions 5S rRNA mip gene Culture
Serum 16S rRNA Antigen detection
Buffy coat
Urine
Bordetella pertussis Nasopharyngeal IS 481 Culture
Adenylate cyclase gene DFA
Porin gene
Pertussis toxin promoter region
Streptococcus pneumoniae Blood DNA polymerase gene Culture
CSF plyA (pneumolysin)
Serum lytA (autolysin)
Sputum pbp2a (penicillin-binding protein)
pbp2b
pspA (pneumococcal surface protein)
Mycobacterium tuberculosis Sputum 16S rRNA Culture
Bronchoalveolar lavage
Bronchial washings
Gastric aspirates
Mycobacterium tuberculosis For many years, the diagnosis of tuberculosis consisted

M. tuberculosis is an important cause of respiratory tract of the performance of mycobacterial smears and culture.
infections, is a worldwide problem, and results in infec- Whereas a uorochrome stain has increased sensitivity
tions that have signicant morbidity and mortality levels. compared with the Kinyoun and Ziehl-Neelsen stains for
The diagnosis of tuberculosis can be difficult and can take detecting mycobacteria directly in clinical specimens, the
prolonged periods during which the patient is not ade- sensitivity of smears in general for mycobacteria is
quately treated and may spread the organism to other peo- 22%80%.27 At least 104 organisms/mL are required in
ple. The genome of M. tuberculosis has been sequenced order to see mycobacteria in a smear, and then only 60%
and has 4,411,529 bp with about 4000 genes that encode of those smears were read as positive.28 Cultures for M.
proteins and 50 RNA-encoding genes.25 More than 250 tuberculosis are more sensitive than smears, able to detect
genes encode enzymes involved in the metabolism of 101102 organisms/mL of specimen, but they are still
fatty acids, compared with just 50 genes of the same func- problematic because the organism grows very slowly in
tion that are found in Escherichia coli. The genome of dif- vitro and may not be isolated for 23 weeks after speci-
ferent isolates of M. tuberculosis does not vary to any men collection.29 Liquid-based culture systems have
great extent, and most variation is due to the movement of improved the detection rate of mycobacteria to a few
insertion elements rather than to point mutations.26 days, depending on the organism load.

Once mycobacteria are detected growing in a culture, The MTD test uses transcription-mediated amplication
they must be speciated. The traditional method (and still (see Chapter 7) to amplify 16S rRNA present in a con-
the only method for most mycobacterial species) for spe- centrated clinical sample. The amplied rRNA is detected
ciation is biochemical testing, which can take a few using the same DNA probe as that used in the DNA probe
weeks to perform. Mycolic acid analysis by high per- assays described above and measuring chemilumines-
formance liquid chromatography has been used by some cence of rRNA-DNA hybrids. The sensitivity of the MTD
laboratory professionals to identify mycobacterial species when compared with smear and culture of smear-positive
either in a smear-positive specimen or from the growth in respiratory samples was 100% and 83% for specimens
liquid or on solid media,30 but it is not performed in most that had a negative smear.32 Amplication and detection
laboratories. can be performed in 3.5 hours in a single tube and have
Mycobacterial identication was revolutionized with 100% specicity for M. tuberculosis complex. The MTD
the development of DNA probe assays by GenProbe, Inc. test is subject to false negatives when inhibitors are pre-
and their implementation in clinical mycobacteriology sent in the clinical sample as well as when only a few
laboratories in 1990. The AccuProbe family of tests is organisms are present in the sample. The incorporation of
available for the identication of the following species internal controls and ensuring the amplication of the
of Mycobacterium: tuberculosis complex (tuberculo- control in a valid test help to decrease the likelihood of
sis, bovis, and africanum), avium-intracellulare, kansasii, false-negative samples.32
and gordonae. The AccuProbe tests detect mycobacterial- The AMPLICOR MTB test is a kit-based PCR assay
specic sequences of 16S rRNA when the rRNA forms a for the detection of M. tuberculosis complex directly in a
hybrid complex with reagent probe DNA. The hybrid clinical specimen.33 Cells are lysed in the sample, releas-
rRNA-DNA complexes are detected in a luminometer ing mycobacterial DNA, DNA is denatured, primers
that measures chemiluminescence given off by the acri- complementary to a 584-bp region of 16S rRNA that
dinium ester attached to the DNA probe. The AccuProbe is common to all mycobacteria hybridize to target se-
assay can be performed on colonies growing on solid quences, and DNA polymerase makes a copy of the target
media or from the growth in liquid media. Combining DNA. dUTP and uracil-N-glycosylase are added to pre-
isolation of mycobacteria in a liquid-based medium with vent carryover contamination. Product detection is
identication of species using AccuProbe has decreased accomplished using a DNA probe specic for M. tuber-
the detection and identication of M. tuberculosis in par- culosis complex and avidinhorseradish peroxidase con-
ticular by at least 3 weeks.31 jugatetetramethyl benzidine substrate system. The
Although DNA probes greatly simplied and reduced AMPLICOR MTB test takes 6.58 hours to complete and
the time involved in identifying mycobacterial species as has a sensitivity of 55.3% in smear-negative samples and
compared with traditional biochemical testing, their sen- 94.7% sensitivity in smear-positive samples.33 The differ-
sitivity was not great enough so that they could be used ence in sensitivities reects the importance of organism
to detect mycobacteria directly in a clinical specimen. burden in the sample in yielding a positive, even in a
The advent of nucleic acid amplication methodologies highly sensitive assay such as PCR.
led to the development of laboratory tests in which M. In a direct comparison of MTD and AMPLICOR MTB
tuberculosis could be detected directly in a clinical spec- assays, both assays agreed with culture and clinical diag-
imen with reliable sensitivity and specicity. Two such nosis in 96.8% of the samples.34 The MTD test had a bet-
tests are available: the Amplied M. tuberculosis Direct ter sensitivity of 95.9 when compared with the
Test (MTD; GenProbe, Inc., San Diego, CA) and the AMPLICOR MTB assay (85.4), which was statistically
AMPLICOR M. tuberculosis PCR test (AMPLICOR signicant (p 0.045). The specicity of both assays
MTB; Roche Diagnostics Systems, Branchburg, NJ) was comparable with a specicity of the MTD assay of
GenProbes MTD test is FDA-approved for the 98.9 and 99.6 for the AMPLICOR MTB.
direct detection of M. tuberculosis in smear-positive and
-negative respiratory tract samples. The assay can be Bordetella pertussis
performed on nonrespiratory samples with slight modi- B. pertussis is an upper-respiratory tract pathogen that is
cation, although it is not yet FDA-approved for this use. the causative agent of whooping cough. The organism is

endemic worldwide and is transmitted via direct contact gold standard was considered as 100% sensitive, they
with infected respiratory secretions. Children 15 years found that the PCR assay was 97% specic.36 Fry, et al.
of age are the primary targets of B. pertussis. In 1947 found that using PCR to detect B. pertussis resulted in an
vaccination against B. pertussis was implemented in the almost vefold increase in the ability to diagnose B. per-
United States, and cases of whooping cough in the target tussis in clinical specimens as compared with culture.37
age group decreased signicantly. Infections in infants In a third study comparing detection of B. pertussis in
younger than 1 year of age increased, however, after the culture versus PCR, Chan and colleagues reported a sen-
vaccination program was started because the infants had sitivity of 100%, specicity of 97.4%, positive predictive
not received the full series of three shots.25 Recently, out- value of 87.6%, and a negative predictive value of 100%
breaks of pertussis have been identied in adolescents of PCR; for culture, they reported a sensitivity of 11.6%,
and adults whose immunity owing to the vaccine waned. specicity and positive predictive value of 100%, and a
Infections in these age groups have increased so much, in negative predictive value of 85.7%.38 Another critical dif-
fact, that a booster vaccine has been developed and is ference between culture and PCR that was investigated
now highly recommended for adolescents 1018 years of and reported by the Chan group was the amount of time
age. Thus, despite the availability of a vaccine, B. pertus- needed to perform and report results from a PCR assay as
sis remains a signicant pathogen that is responsible for compared with the amount of time required for B. per-
an estimated 50 million cases of pertussis and 350,000 tussis to be detected in culture. They reported that results
deaths worldwide.35 from PCR assays were available in 2.3 days (where the
One of the problems associated with reducing the inci- assay was only performed 3 to 5 days/week), whereas
dence of B. pertussisrelated disease has been the lack of positive culture results were not available for 5.1 days
reliable culture methods that consistently allow for the (where cultures were performed and read 6 days/week).38
isolation of B. pertussis from clinical samples. B. pertus- While molecular-based assays have clearly been
sis is a highly fastidious organism that requires special shown repeatedly to have signicantly higher sensitivity
isolation conditions. Regan-Lowe or Bordet-Gengou rates, some concerns still exist for the performance and
media are specialized media that have been formulated to interpretation of these assays. First of all, the major
isolate B. pertussis. The media need to be inoculated with genetic target for primer binding in PCR assays detecting
a freshly-collected nasopharyngeal swab and/or aspirate B. pertussis is IS481. This insertion sequence is also
and incubated at 35oC in ambient air with increased found in Bordetella holmesii, and thus the presence of B.
humidity for at least 710 days in order to get the organ- holmesii in a clinical specimen can give false-positive
isms to grow.25 results when B. pertussis is the target.39 The amplication
B. pertussis very early became a target for the devel- and detection of another insertion sequence, IS1001, can
opment of molecular-based assays because of its contin- be used to discriminate between B. pertussis and B.
ued clinical signicance and because of the difficulties holmesii. IS1001 is used as a target to detect Bordetella
encountered with the traditional culture methods used to parapertussis in clinical samples primarily, but IS1001 is
isolate the organism. Once the B. pertussis genome was also found in B. holmesii and not in B. pertussis. IS481
characterized, species-specic target sequences were sequences are not seen in B. parapertussis. By amplify-
identied and used to generate primers for PCR assays. ing both insertion sequence targets, the specicity of the
Target sequences for B. pertussis are located in the IS481 assay for all three species is greatly increased.40 Second,
insertion sequence, the pertussis toxin gene promoter a standardized or FDA-approved, commercially available
region, the adenylate cyclase gene, and species-specic PCR test for B. pertussis is not yet available. A quality
porin protein structural genes.25 assurance program to assess interlaboratory performance
Several studies have been performed comparing the of existing PCR assays for B. pertussis is also lacking at
sensitivity and specicity of culture with PCR assays for this time. Without a standardized assay or external assess-
the direct detection of B. pertussis in nasopharyngeal ment of internally developed assays, technologists in
samples. Dragsted and colleagues found that the sensitiv- clinical laboratories must perform extensive validation
ity of PCR for B. pertussis was 97%, whereas the sensi- studies and develop quality control and quality assurance
tivity of the culture was only 58%. When culture as the programs to ensure the validity of in-house assays.

Nonetheless, PCR assays have completely replaced cul- rate yeast extract media (sensitivity 80%; specicity
ture-based assays for the detection of B. pertussis in 100%), direct uorescent antibody (DFA) stain (sensitiv-
many laboratories, especially public health laboratories, ity 33%70%; specicity 96%99%), enzyme
and probably will eventually do so in all laboratories. immunoassay for urinary antigen (sensitivity
70%80%; specicity 99%), immunochromatographic
Chlamydophila (Chlamydia) assay for urinary antigen (sensitivity 80%; specicity
pneumoniae 97%100%), and serology (sensitivity 40%75%;
Chlamydophila (Chlamydia) pneumoniae is an obligate specicity 96%99%), which is only useful retrospec-
intracellular pathogen that causes 10% of community- tively.46 PCR assays are available for the direct detection
acquired pneumonias and has recently been implicated in of Legionella in respiratory tract specimens that are
atherosclerosis and coronary artery disease. The preva- highly specic (88%100% specicity), but they are not
lence of C. pneumoniae worldwide is high, with 70% of more sensitive than the traditional culture assays, with
people having antibodies against C. pneumoniae by the reported sensitivities ranging 64%100%.46 Thus far,
time they are 50 years of age.41 C. pneumoniae typically primers for Legionella nucleic acid amplication have
causes pharyngitis, bronchitis, and mild pneumonia. targeted the macrophage infectivity potentiator (mip)
Analysis of chlamydial 16S and 23S rRNA sequences gene and 16S and 5S rRNA genes. Use of the 5S rRNA
has led to the suggestion that the genus Chlamydia primers and early primers against 16S rRNA sequences
should be split such that pneumoniae is a species of a has been associated with the low sensitivity and speci-
newly named genus, Chlamydophila.42 city that have been reported mostly because the primers
The traditional laboratory method used for the detec- did not amplify all of the clinically-relevant species of
tion of C. pneumoniae in respiratory samples is culture of Legionella. Recent reports of PCR detection of L. pneu-
the organism on cell lines in a shell vial culture system mophila and Legionella species in BAL using different
that is used for viral detection. Culture, however, is insen- primers targeting 16S rRNA genes, however, did demon-
sitive and dependent on obtaining and inoculating fresh strate amplication of multiple species of Legionella, but
clinical samples containing infected host cells onto the the assays are still in the developmental stages.47, 48
cell lines. Because reliable laboratory methods for the
detection of C. pneumoniae are lacking, many groups Mycoplasma pneumoniae
have tried to develop molecular-based assays targeting Mycoplasma pneumoniae is a Mollicute, a bacterium that
detection of C. pneumoniae in clinical samples. Unfortu- lacks a cell wall and is the smallest in size and genome of
nately, the assays have thus far lacked the sensitivity and the free-living organisms. M. pneumoniae is the most
specicity necessary for utilization in routine clinical common cause of community-acquired pneumonia, caus-
testing.24,43 ing 20% of these infections. Laboratory diagnosis of M.
pneumoniae is accomplished primarily by culture of res-
Legionella pneumophila piratory tract secretions on special media, but serological
L. pneumophila is the cause of Legionnaires disease, a tests are also available. For culture, specimens must be
lower respiratory tract infection that was rst diagnosed inoculated into a mycoplasma transport medium, and M.
in men attending an American Legion convention in pneumoniae grows very slowly, taking up to 4 weeks to
Philadelphia in 1976. Since their rst identication, be detected.
Legionella species have been found in water, both in the M. pneumoniae has been a target for the development
environment as well as in air conditioners and hot water of numerous molecular-based assays over the last 15
tanks in a variety of types of buildings. Legionella species years.24 Genes that have been the targets of amplication
infections range from asymptomatic to fatal and are the procedures include the P1 adhesion gene, 16S rRNA, the
third most common cause of community-acquired pneu- ATPase operon genes, and the gene (tuf) that encodes
monias.44,45 elongation factor 2. Amplication methodologies range
Laboratory diagnosis of Legionella includes culture of from multiplex, nested, and real-time PCR to NASBA
bronchoalveolar lavage (BAL) samples on buffered cit- and Q-replicase. Primer design and amplication pro-

cedures for the nucleic acid of M. pneumoniae seem to be younger than 3 years and adults older than 65 years. S.
adequate and successful18, 49-51; however, problems have pneumoniae has been found in people 0-65 years of age
been encountered in evaluating the results of the ampli- colonizing the upper respiratory tract, although the high-
cation assays because when they are compared with iso- est rates of carriage are seen in children younger than 15
lation of M. pneumoniae in culture, the molecular-based years of age. The virulence of S. pneumoniae in people at
methods detect many more positives than culture meth- the extremes of age is due to the lack of an adequate
ods. When the nucleic acid amplication assays are com- immune response in these age groups since the produc-
pared with serological test results, the nucleic acidbased tion of antibodies that are critical for eradicating the
tests have a sensitivity ranging 77%94% and a speci- organism is less than optimal in these groups because of
city ranging 97%100%, depending on the study.24 The the immaturity of the response in infants and the aging of
real test of the sensitivity and specicity of the nucleic the response in older adults.25
acid amplication assays is to compare the results to the Traditional laboratory detection of S. pneumoniae is
isolation of M. pneumoniae in culture together with by culture of clinical samples. The organism is fastidious
review of patient symptoms. PCR and culture results cor- yet grows well on traditional media such as chocolate
relate better when the samples come from patients who agar and trypticase soy agar with 5% sheep red blood
have current lower respiratory tract infections than when cells. Because the organism can be found colonizing the
the samples come from healthy individuals.18 Respiratory oropharynx, the signicance of its isolation in expecto-
secretions collected from healthy individuals that are rated sputum that is contaminated with oral secretions is
positive in the PCR assay yet negative by culture suggest questionable. This fact makes the sensitivity of the cul-
the persistence of the organism after an infection or ture of sputum for S. pneumoniae difficult to assess.
asymptomatic carriage of the organism. Thus, just as Molecular-based tests targeting S. pneumoniae have
with any other laboratory test, the results of nucleic acid been in development for many years and have attempted
amplication procedures need to be taken into consider- to detect S. pneumoniae in a variety of clinical samples
ation with patient symptoms, history, and other labora- and by targeting a variety of genes (see Table 12.3).
tory test results to ensure their validity in the diagnosis of Unfortunately, the results have been mixed, and PCR is
the patient. still not recommended as a method to diagnose S. pneu-
Despite the problems with the development, imple- moniae infections.
mentation, and interpretation of molecular-based assays In a study comparing the specicity of four different
for M. pneumoniae, L. pneumophila, B. pertussis, and C. PCR assays for identifying S. pneumoniae, the authors
pneumoniae individually, multiplex nucleic acid ampli- found that primers specic for the autolysin (lytA) genes
cation tests that screen for the presence of all four organ- were the only primers that had 100% specicity for S.
isms seem to show some promise in being able to detect pneumoniae.56 In another report, PCR assays targeting
these organisms in a sensitive, specic, and rapid man- the pneumococcal pneumolysin gene were sensitive
ner.53-55 As these organisms in particular have overlap- down to 10 colony forming units/mL, specic for S.
ping symptoms and traditional culture assays are difficult pneumoniae, and determined to be positive on all blood
and/or time-consuming, multiplex assays that detect mul- (9) and cerebrospinal uid (4) specimens that were
tiple respiratory tract pathogens will benet physicians culture-positive for S. pneumoniae.57 The same assay
and patients in savings in time and cost yet provide sen- performed on serum was positive in 38% of patients who
sitive and specic results leading to faster and more had lobar pneumonia and in 44% of patients who had oti-
appropriate treatment and reduced hospital stays.53,54 tis media caused by S. pneumoniae. Unfortunately, the
same PCR assay performed on serum was positive in
Streptococcus pneumoniae 13%30% of healthy children because of organism colo-
S. pneumoniae is the major cause of community-acquired nization of the upper respiratory tract.57 On the other
pneumonia and is also a common cause of bacteremia, hand, PCR for S. pneumoniae on the serum of healthy
sepsis, otitis media, and meningitis.25 Target age groups adults age 1850 years was negative in all of the subjects
for infections causing disease are infants and toddlers tested, suggesting that a positive PCR on an adult would

be a true positive result whereas on a child younger than 12.4 summarizes the molecular-based tests that have
16 years might be a false positive due to upper respiratory been described for the bacteria that cause genital tract
tract colonization. infections.
Another study of PCR targeting the pneumolysin gene
performed on whole blood found that of the adults who Neisseria gonorrhoeae
had pneumonia caused by S. pneumoniae, the sensitivity and Chlamydia trachomatis
of blood culture was 28%, pleural uid culture was 60%, N. gonorrhoeae and C. trachomatis are the two most
sputum culture was 20%, and PCR on blood was 55%.58 common causes of sexually transmitted disease. Disease
Importantly in this study, PCR performed on blood of caused by N. gonorrhoeae, called gonorrhea, is associ-
adults who had nonpneumococcal pneumonia was nega- ated with dysuria and urethral discharge in men and cer-
tive on all the patients, giving a specicity of 100%; 32% vicovaginal discharge in women. N. gonorrhoeae can
of patients in the study, however, who had pneumonia of also cause pharyngitis and anorectal infections. C. tra-
unknown etiology had a positive PCR result for S. pneu- chomatis causes a nongonococcal urethritis and is
moniae, and 4% of their control adults were also PCR- asymptomatic in 50%66% of men and women. N. gon-
positive. Incorporation of these false positives reduced orrhoeae and C. trachomatis are often found in coinfec-
the specicity of the assay to 81%. tions, so it is prudent to rule out both organisms when
Even PCR assays developed to detect S. pneumoniae considering that one is present.61
in respiratory tract samples have not shown the sensitiv- Traditional laboratory diagnosis of N. gonorrhoeae
ity and specicity necessary to supplant existing labora- entails culture of endocervical or urethral swabs onto
tory methods. Murdoch and colleagues published an chocolate agar and selective, enriched media such as
evaluation of a PCR assay for S. pneumoniae and found modied Thayer Martin. For male urethral swabs, Gram
that for sputum specimens in which S. pneumoniae was stain alone with the observation of gram-negative diplo-
isolated in culture, 98% of the specimens were also pos- cocci is diagnostic by itself for N. gonorrhoeae (sensitiv-
itive by PCR.59 They also performed PCR on throat ity 90%95%; specicity 95%100%).62 For female
swabs taken from patients with a clinical diagnosis of endocervical swabs or other specimen types from males
pneumonia, and 55% were positive for S. pneumoniae by and females, Gram stain alone is not diagnostic (sensitiv-
PCR. As a control, they performed PCR on throat swabs ity 50%70% for endocervical). N. gonorrhoeae is
of healthy people and found a similar rate of PCR posi- fastidious, and the specimen needs to be transported in a
tives (58%), further suggesting that although PCR is spe- transport medium or plated directly onto media at the
cic for S. pneumoniae, the clinical signicance of a bedside. Delays in culturing the specimen are associated
positive PCR assay is questionable because a signicant with false-negative cultures. Plates are examined daily
portion of the population (especially children) is colo- for 72 hours for the presence of colonies resembling
nized with the organism and PCR can not discern Neisseria and identied by biochemical testing.
between colonization and infection.59 Laboratory diagnosis of C. trachomatis is more prob-
lematic. C. trachomatis is an obligate intracellular patho-
gen; thus, when collecting specimens for isolation of C.
Urogenital Tract Pathogens
trachomatis, it is critical that the practitioner scrape the
Neisseria gonorrhoeae and Chlamydia trachomatis were endocervix or urethra to ensure the collection of host
among the rst organisms to be targeted for detection columnar epithelial cells that harbor the organisms. C.
in clinical specimens by molecular methods. The molec- trachomatis is extremely labile, and clinical specimens
ular methods are so well characterized for these two sent to the laboratory for culture must be placed in a
organisms that detection of the nucleic acid of N. gonor- chlamydial transport medium to maintain the viability of
rhoeae and C. trachomatis is the laboratory method used the chlamydia. Culture of specimens for C. trachomatis
almost exclusively. Other sexually transmitted bacteria is typically performed on McCoy cells in a shell vial sys-
are considered good targets for the development of tem. The specimen is inoculated onto the cell line, the
molecular-based methods because traditional laboratory vial is incubated for 4872 hours, and the cells are har-
methods of detection and identication for these organ- vested and stained with a uoresceinated antibody that
isms either lack sensitivity or are time-consuming. Table has specicity for C. trachomatis. Cultures for N. gonor-

Table 12.4 Typical Genital Tract Organisms Targeted by Molecular-Based Detection Methods25,60
Organism Specimen Sources Traditional Diagnostic Methods Gene Target
Treponema pallidum Genital ulcers Serological (indirect and direct) TpN44.5a
Blood Direct antigen detection (dark TpN19
Brain tissue eld, DFA) TpN39
Cerebrospinal uid p01A
Amniotic uid TpN47
Placenta 16S rRNA
Umbilical cord polA
Fetal tissue
Serum
Mycoplasma genitalium Urine Culture MgPa (adhesion gene)
Urethral rDNA gene
Vaginal
Cervical
Mycoplasma hominis Genital tract Culture 16S rRNA
Amniotic uid
Ureaplasma urealyticum Genital tract Culture 16S rRNA
Amniotic uid Urease gene
Haemophilus ducreyi Grams stain 1.1 kb target
Culture groEL gene
Serological Intergenic spacer between
16S and 23S rDNA
p27
16S rDNA gene
Neisseria gonorrhoeae Urine Culture omp III gene
Urethral opa gene
Cervical Cytosine DNA methyltrans-
Thin preparation vials ferase gene
cPPB gene
Site-specic recombinase gene
Chlamydia trachomatis Urine Culture MOMP
Urethral EIA 16S RNA
Cervical DFA
Thin preparation vials
Conjunctiva
rhoeae and C. trachomatis have been considered the gold Probe, Inc. The AccuProbe is a nonamplication-based
standard, but when compared with nucleic acid ampli- nucleic acid hybridization method that detects the rRNA
cation assays, the sensitivity of culture for N. gonor- of an organism by using an acridinium-labeled single-
rhoeae is 85%100% and for C. trachomatis 80%.9 stranded DNA probe. The sensitivity of the AccuProbe for
Nucleic acid amplication assays have the additional N. gonorrhoeae as compared with culture is 100%, with a
advantages of being rapid, and testing can be batched and specicity of 99.5%. For C. trachomatis, the sensitivity of
automated, resulting in further savings for the laboratory. AccuProbe is 67%96% (specimen quality is the reason
The rst molecular-based assay available for N. gonor- for the variability), and specicity is 96%100%.9
rhoeae and C. trachomatis was AccuProbe from Gen- Although the DNA probes have comparable sensitivities

and specicities to culture methods, laboratory pro- the organism is dead or alive. Another sample should not
fessionals quickly implemented AccuProbe in their labo- be taken for 34 weeks after treatment if the practitioner
ratories for the detection of N. gonorrhoeae and C. wants to see if the therapy was effective. Collection of
trachomatis because the assay is faster than culture and samples and testing too soon after treatment will result in
the same swab can be used for the detection of both N. positives long after cultures on the same specimen have
gonorrhoeae and C. trachomatis. become negative.
Numerous nucleic acid amplication assays on the
market target N. gonorrhoeae and C. trachomatis. The Treponema pallidum
commercially available assays include target amplica- The spirochete Treponema pallidum subspecies pallidum,
tion assays such as COBAS AMPLICOR CT/NG (Roche is the causative agent of syphilis, a sexually transmitted
Diagnostics, Indianapolis IN; PCR), BD ProbeTecET disease that results in the formation of a chancre at the
(Becton Dickinson Microbiology Systems, Sparks MD; site of inoculation (primary syphilis). If left untreated, the
strand displacement amplification), and APTIMA organism disseminates throughout the body, damaging
COMBO II (Gen-Probe Inc, San Diego CA; transcription tissues, and the patient may progress into the other stages
mediated amplication). One signal amplication assay, of disease, i.e., secondary syphilis (disseminated rash),
called Rapid Capture System II for GC and CT (Digene, latent syphilis (asymptomatic period), and tertiary
Gaithersburg MD; hybrid capture), is also available. The syphilis (central nervous system and cardiovascular man-
nucleic acid amplication assays can be performed on ifestations).
urethral or cervical swabs, urine, and, in some cases, on Laboratory diagnosis of syphilis is limited to serologi-
Thin prep transport vials that are used to collect cervical cal testing, in which patients are typically screened ini-
cells for Papanicolaou smears. The sensitivity of all of tially for the presence of antibodies against cardiolipin
the amplification methods is excellent and ranges (a normal component of host membranes) (rapid plasma
93%100%. Likewise, the specicity of these assays is reagin [RPR] and venereal disease research labora-
excellent, ranging 99%100%.9 The ability to use urine as tory [VDRL] tests) and followed up with testing for the
a specimen to screen for the presence of N. gonorrhoeae presence of antibodies against T. pallidum (TP-PA test;
and C. trachomatis has many advantages. Urine is a non- Fujirebio) to conrm infection. T. pallidum cannot be
invasive specimen that can be collected by the patient. grown in vitro. New enzyme immunoassay (EIA)based
The rst portion of the urine stream should be collected tests are available that are being used to detect antiT. pal-
for these assays from patients who have not voided for at lidum antibodies. The EIA tests have been prepared using
least 2 hours. The acceptability of the Thin prep vials for more immunologically relevant antigens and thus have
N. gonorrhoeae and C. trachomatis testing means that consistently higher sensitivity (97%100%) and speci-
one specimen can be collected from women for city (98%100%) for patients in all stages of syphilis.
Papanicolaou smear, N. gonorrhoeae, C. trachomatis, and Laboratory professionals who have adopted the EIA
Human Papillomavirus. assays use these assays to screen patients for syphilis and
In general, molecular-based assays are the major use the RPR to monitor effectiveness of treatment and
method for detection of N. gonorrhoeae and C. trachoma- diagnose reinfection.63
tis. The assays are sensitive, specic, and rapid and have RPR and VDRL are limited in that, when reactive, they
the potential to be fully automated. The only situation in are not specic for syphilis, and even if the patient has
which molecular-based tests is not acceptable for the syphilis, the sensitivity of the test in very early
detection of N. gonorrhoeae and C. trachomatis is in the (77%100%) and late (73%) syphilis is low.63 The sero-
workup of children in suspected child abuse cases. For logical tests that detect T. pallidum antibodies are limited
these children, cultures should be performed alone or by the fact that they cannot differentiate between current
in conjunction with molecular-based assays. Another and past infections: generally, once someone has syphilis,
consideration for the use of molecular-based tests for N. he or she will always have anti-T. pallidum antibodies.
gonorrhoeae and C. trachomatis is when laboratory The RPR test, though, can be used to diagnose reinfec-
testing has to demonstrate cure of an infection. As with tions because titers of anticardiolipin antibodies will
any infectious organism and molecular-based tests, the decrease to nonreactive following successful treatment of
nucleic acid is detectable in a clinical sample whether the organism and increase again with reinfections.

Several PCR assays have been developed and tested for ther development is needed before these assays are used
the direct detection of T. pallidum DNA in genital ulcers, routinely.
blood, brain tissue, cerebrospinal uid, serum, and other
samples with varying sensitivities (1130 organisms).60 Mycoplasma and Ureaplasma spp.
Amplication of the T. pallidum DNA polymerase I gene Mycoplasma hominis, Mycoplasma genitalium, and Urea-
(polA) resulted in a detection limit of about 1025 organ- plasma urealyticum cause nongonococcal urethritis. The
isms; when tested on genital ulcers, a sensitivity of 95.8% mycoplasmas, as discussed above for M. pneumoniae, are
and a specicity of 95.7% were reported.64 In another test the smallest free-living, self-replicating organisms
of PCR for the detection of T. pallidum in anogenital or known. M. genitalium has the smallest genome and thus
oral ulcers, the authors found that PCR was 94.7% sensi- was one of the rst organisms to have its genome fully
tive and 98.6% specic; the positive predictive value was sequenced.68 M. genitalium was rst identied in 1981,69
94.7%, and the negative predictive value was 98.6% in and culture methods rst described in 199670 are still
patients who had primary syphilis.65 The numbers were labor-intensive and not widely available. U. urealyticum is
similar for patients in secondary syphilis, except that the related to the Mycoplasma spp. and is also a member of
sensitivity (80.0%) and positive predictive value (88.9%) the Mollicutes class.
were lower. Thus, while studies show some promise in PCR assays have been developed that amplify the adhe-
the use of PCR for diagnosing syphilis, additional studies sion gene (MgPa)71,72 or the rDNA gene73,74 of M. geni-
to test the sensitivity of PCR using clinical specimens still talium. Urethral or endocervical swabs or rst-pass urine
need to be performed in order for PCR to be routinely samples are all acceptable and yield positive PCR results.
implemented in clinical laboratories for the detection of Although M. genitalium has been detected by PCR in
T. pallidum.65 all specimen types, its presence and association with dis-
ease are still questioned. Whereas more men who were
Haemophilus ducreyi symptomatic were positive by PCR for M. genitalium
H. ducreyi is a fastidious gram-negative coccobacillus (20%), men who were asymptomatic still had detectable
that is the causative agent of chancroid. H. ducreyi is M. genitalium by PCR (9%).71 Subsequent studies look-
rarely found in the United States; it causes more infec- ing at M. genitalium by PCR in men with nongonococcal,
tions in lower socioeconomic countries, especially in nonchlamydial urethritis have shown that M. genitalium
Africa, Asia, and Latin America. Laboratory diagnosis of was the cause of symptoms in 18%45.5% of cases.75
H. ducreyi is difficult because the organism does not Whereas PCR has been important in establishing M. gen-
grow well in vitro and requires special media for isola- italium as an important genital tract pathogen, the use
tion that is not available in most clinical laboratories in of PCR as a clinical laboratory method for the routine
the United States. Gram stain of exudates is only 50% diagnosis of M. genitalium has yet to be realized. Further
sensitive for H. ducreyi and thus is not recommended.60 studies are still required to validate the sensitivity and
PCR assays have been developed for H. ducreyi that specicity of PCR for M. genitalium in genitourinary
amplify a variety of genes (see Table 12.4). Amplication specimens.60
of 16S rRNA along with the use of two probes for ampli- PCR assays for M. hominis and U. urealyticum have
con detection was shown by Chiu and colleagues to be been developed but have not been used widely in clinical
100% sensitive in detecting multiple strains of H. laboratories for the diagnosis of these organisms. The
ducreyi.66 In addition, the assay had a sensitivity of assays have been found to be specic and sensitive, but
83%98% and a specicity of 51%67% (depending on just like some of the organisms discussed above, without
the number of amplication cycles) in detecting H. a reliable gold standard assay to use for comparison and
ducreyi in clinical specimens. Another group developed especially in the absence of clinical symptoms, the clini-
a PCR assay that amplied an intergenic spacer region cal signicance of PCR-positive specimens is difficult to
between the rrs and rrl ribosomal RNA genes of H. interpret.25
ducreyi that was 96% sensitive for H. ducreyi in genital Just like respiratory tract specimens, genital tract spec-
ulcer swabs compared with a sensitivity of 56% for imens have been the target for the development of multi-
culture.67 Thus, PCR appears promising for the direct plex assays in which the presence of nucleic acid of
detection of H. ducreyi in genital specimens, but fur- multiple organisms can be determined from one specimen

in one tube. The organisms causing genital tract infec-

tions either overlap in their symptoms, making diagnosis
difficult without specic laboratory testing, or infections
Advanced Concepts
can be caused by the presence of multiple organisms at The rst antibiotics isolated were natural secretions
the same time. Several reports of multiplex PCR for gen- from fungi and other organisms. Synthetic modica-
ital tract specimens have been published. In one report, tions of these natural agents were designed to in-
simultaneous detection of T. pallidum, H. ducreyi, and crease the spectrum of activity (ability to kill more
herpes simplex virus (HSV) types 1 and 2 in genital organisms) and to overcome resistance. For example,
ulcers was performed by multiplex PCR.76 The sensitivity cephalosporins include rst-generation agents, ceph-
of the PCR assay for HSV was 100% (culture sensitivity alothin and cefazolin active against Staphylococcus,
was 71.8%), for H. ducreyi was 98.4% (culture was Streptococcus, and some Enterobacteriaceae. A sec-
74.2%), and for T. pallidum was 91% (dark-eld sensi- ond generation of cephalosporins, cefamondole,
tivity was 81%). Since this rst description of the multi- cefoxitin, and cefuroxime, is active against more
plex assay, other groups have used the method to conrm Enterobacteriaceae and organisms resistant to -
the sensitivity of the assay for the targeted organisms and lactam antibiotics. A third generation, cefotaxime,
to use it to examine the prevalence of these organisms in ceftriaxone, and ceftazidime, is active against P.
various geographic areas in different years.60 aeruginosa as well as many Enterobacteriaceae and
organisms resistant to -lactam antibiotics. The
fourth generation, cefepime, is active against an
Antimicrobial Agents extended spectrum of organisms resistant to -
Antimicrobial agents are of two types, those that inhibit lactam antibiotics.
microbial growth (-static, e.g., bacteriostatic, fungistatic)
and those that kill organisms outright (-cidal, e.g., bac-
teriocidal, fungicidal). Antimicrobial agents for use in numbers below the detection levels of routine laboratory
clinical applications should be selective for the target sensitivity testing methods.
organism with minimal effect on mammalian cells. The There are several ways in which microorganisms
agent should also distribute well in the host and remain develop resistance (Table 12.6). First of all, bacteria can
active for as long as possible (long half-life). Ideally the produce enzymes that inactivate the agent. Examples
agents should have -cidal (rather than -static) activity of this resistance mechanism are seen in S. aureus and
against a broad spectrum of microorganisms.
Another way to classify antimicrobial agents is by
their mode of action (Table 12.5). The ultimate effect of Table 12.5 Mode of Action of Antimicrobial Agents
these agents is to inhibit essential functions in the target Mode of Action Examples
organism (Fig. 12-3). A third way to group antimicrobial
Disrupts cell wall Beta-lactams (penicillins and
agents is by their chemical structure. For example, there
synthesis or integrity cephalosporins)
are two major types of agents that inhibit cell wall syn-
Glycopeptides (vancomycin)
thesis, the -lactams with substituted ring structures and
Disrupts cell membrane Polymyxins (polymyxin B)
the glycopeptides.
structure or function Bacitracin
Inhibits protein synthesis Aminoglycosides (gentamicin)
Resistance to Antimicrobial Agents Tetracyclines
Macrolides (erythromycin)
Microorganisms naturally develop defenses to antimicro-
Lincosamides (clindamycin)
bial agents. Resistant Staphylococcus, Pseudomonas, and
Inhibits nucleic acid Quinolones (ciprooxacin)
Klebsiella spp. are becoming commonplace in health-
synthesis or integrity Metronidazole
care institutions. Long-term therapy with antibiotics such
Inhibits metabolite Sulfamethoxazole
as vancomycin may lead to development of resistant
synthesis Trimethoprim
clones of organisms. These clones may persist in low

Essential nism is seen in gram-negative bacteria that change their

metabolism outer membrane proteins (porins) in order to decrease the
Cell wall integrity
Protein
inux of the antimicrobial agent. If the agent cannot get
synthesis into the cell and bind to its target, then it is not effective
in inhibiting or killing the bacterium.
All these resistance mechanisms involve a genetic
change in the microorganism (Table 12.7). These genetic
changes are most commonly brought about by mutation
and selection processes. If a mutation results in a survival
or growth advantage, cells with the mutation will eventu-
Membrane
integrity
ally take the place of those without the mutation, which
are less able to survive and procreate. This process is
stimulated by antibiotic exposure, especially if the levels
of antibiotics are less than optimal. For example, S.
Nucleic acid aureus developed resistance to antibiotics that target its
metabolism
penicillin-binding protein (PBP1) by replacing PBP1 with
Figure 12-3 Sites of antimicrobial action. Depending on
the type of organism, several structures can be affected by
PBP2a encoded by the mecA gene. PBP2a found in
antimicrobial agents. All of these are essential for cell growth methicillin-resistant S. aureus (MRSA) has a low binding
and survival. affinity for methicillin.
Another genetic resistance mechanism is the acquisi-
tion of genetic factors from other resistant organisms
N. gonorrhoeae that produce -lactamase, an enzyme through transformation with plasmids carrying resistance
that cleaves the -lactam ring of the -lactam antimicro- genes or transduction with viruses carrying resistance
bials, such as the penicillins. Cleavage of the -lactam genes. Genetic factors can also be transferred from one
ring destroys the activity of penicillin, rendering the bacterium to another by conjugation (see Chapter 1 for a
organism resistant to the action of the penicillin. Second, discussion of these processes). Genetically directed resist-
organisms produce altered targets for the antimicrobial ance can pass between organisms of different species. For
agent. Mutations in the gene encoding for a penicillin- example, MRSA (vancomycin-sensitive S. aureus) can
binding protein, for example, change the structure of the gain vancomycin resistance from vancomycin-resistant
protein such that penicillin can no longer bind to its tar- E. faecalis. Vancomycin and other glycopeptides act by
get and thus loses its effectiveness. Finally, bacteria preventing the cross-linking of the peptidoglycan, thereby
exhibit changes in the transport of the antimicrobial agent inhibiting cell wall production. Several genes have been
either into or out of the cell. An example of this mecha- found in enterococci that encode altered binding proteins,
Table 12.6 Resistance Mechanisms

Mechanism Example Examples of Agents Affected
Destruction of agent -lactamases -lactams
Elimination of agent Multidrug efflux systems -lactams, uoroquinolones,
macrolides, chlorampheni-
col, trimethoprim
Altered cell wall structure Thick cell walls that exclude Vancomycin
agent
Altered agent binding sites -lactams
Alternate metabolic pathways Altered enzymes Sulfonamides, trimethoprim

cance especially when organisms persist in patients being

Genes Conferring Resistance to
Table 12.7
Antimicrobial Agents in Particular Organisms78 treated with antimicrobial agents that are generally con-
sidered effective against the particular isolate or when
Organism Antimicrobial Gene(s) conferring
Agent resistance
large numbers of organisms are observed in normally
sterile uids such as blood, cerebrospinal uid, or urine.
Staphylococcus Oxacillin mecA Susceptibility can be determined by phenotypic or geno-
aureus typic methods. Phenotypic methods are generally used for
Streptococcus Penicillin pbp1a and pbp1b aerobic bacteria, some mycobacteria, and yeast. For other
pneumoniae organisms, such as viruses and lamentous fungi, pheno-
Gram-negatives -lactams tem, shv, oxa, ctx-m typic methods are not well standardized. Phenotypic
Enterococcus Vancomycin vanA, vanB, vanC, vanD, methodologies include disk diffusion, broth dilution, and
vanE, vanG direct detection of resistance factors, such as -lactamase.
Salmonella Quinolones gyrA, gyrB, parC, parE Susceptibility testing measures the minimum inhibitory
Mycobacterium Isoniazid katG, inhA concentration (MIC) of an antimicrobial agent or the least
tuberculosis Rifampin rpoB amount of antimicrobial agent that is needed to inhibit the
growth of an organism. There are established guidelines
vanA, vanB, vanC, vanD, vanE, and vanG. The expres- that state the MICs that are considered susceptible or
sion of vanA and vanB is inducible and transferred from resistant for a given organism and antimicrobial agent
cell to cell by plasmids carrying vancomycin resistance pair. Determination of MICs as a method to detect antimi-
genes on a transposon77 (Fig. 12-4). The resulting van- crobial resistance is a phenotypic method. Although MIC
comycin-resistant S. aureus (VRSA) uses lactic acid methods are well established, and the results are generally
instead of alanine to build its cell wall. The VRSA cell reliable with regard to in vivo effectiveness of an agent for
wall, then, does not contain the target structure (D-ala-D- an organism, the methods can give equivocal results and
ala) for vancomycin. are time-consuming, with results not available for at least
Mutations in the following genes are associated with 48 hours after the specimen is collected.
the development of resistance to particular drugs: rpoB Molecular methods detecting genes directly involved
mutation is associated with rifampin resistance, and in the resistance of an organism to a particular agent are
mutations in katG, inhA, ahpC, and ndh genes are asso- being increasingly used in particular situations. There are
ciated with resistance to isoniazid.78 four reasons for using molecular-based methodologies to
determine antimicrobial resistance. First, when an organ-
ism has an MIC at or near the breakpoint of resistance,
Molecular Detection of Resistance detection of mutated genes contributing to resistance
Often the development of resistance is detected by per- would be irrefutable evidence not to use the agent.
forming in vitro susceptibility testing. Testing for altered Second, genes involved in the resistance of organisms to
sensitivity to antimicrobial agents is of clinical signi- antimicrobial agents can be detected directly in the clini-
ORF 1 ORF 2 vanA vanS vanH vanA vanX vanY vanZ
Tn1546
58K VRSA
plasmid
Figure 12-4 Vancomycin-
resistant S. aureus (VRSA) plasmid
carrying transposon Tn1546 with
vancomycin-resistance genes.

cal specimen closer to the time of collection and save the infections due to MRSA and has been accomplished
time required to isolate the organism and perform pheno- through the development of PCR and other amplication
typic MIC determinations on isolated colonies. With no assays that can be performed directly on a clinical sam-
requirement for culturing potentially dangerous microor- ple. Many assays have been tested for sensitivity and
ganisms, there is less hazardous exposure for the technol- specicity and have performed well.79
ogist as well. Third, monitoring the spread of a resistance Enterococcus was the rst organism in which glyco-
gene in multiple isolates of the same organism is more peptide resistance was observed.80 Since then, van-
useful in epidemiological investigations than following comycin resistance has been observed in other organisms.
the trend in the MIC. Finally, molecular methods are con- Of most concern is emerging resistance to vancomycin in
sidered the gold standard when new phenotypic assays the staphylococci.81 PCR was used to detect the resistance
are being developed.78 genes vanA, vanB, vanC1, and vanC2 in fecal samples as
One of the most effective antibiotics, penicillin, was a way to screen for vancomycin-resistant enterococci
rst used therapeutically in the early 1940s. Resistance to (VRE).11 The specicity of the vanA primers was 99.6%
penicillin by the production of -lactamases by organisms when compared with isolation of VRE in culture. The use
was rst recorded soon after that. Streptococcus pyogenes of four primers allowed for the detection of VRE in
is one of very few organisms that are still predictably sus- 85.1% of the samples. Real-time PCR has also been used
ceptible to penicillin today. Penicillin and other -lactam to detect VRE in fecal surveillance specimens. Whereas
antimicrobials inhibit bacteria by interfering with an PCR of vanA and vanB was more sensitive when per-
enzyme that is involved in the synthesis of the cell wall. formed on enrichment broths rather than directly from
In the laboratory, penicillin was modied to make it resist- fecal swabs, 88% of specimens that were culture-positive
ant to the -lactamases (also known as penicillinases) that for VRE were PCR-positive.82 Because PCR is faster than
were being produced by the bacteria. Penicillinase-resist- traditional culture methods and has comparable sensitiv-
ant penicillins, e.g., methicillin or oxacillin, were the ity and specicity to culture, it is an attractive method for
products of that research. Staphylococcal infections were screening large numbers of samples for a particular target.
treated successfully with methicillin/oxacillin for years The use of molecular methods to detect antimicrobial
before the emergence of resistance was rst observed in resistance in M. tuberculosis is particularly attractive
1965.79 MRSA and methicillin-resistant coagulase-nega- because traditional methods of determining antimicrobial
tive staphylococci have become a major cause of infec- susceptibility take days, if not weeks. The longer a patient
tions acquired nosocomially as well as in the community. with tuberculosis is inadequately treated, the more likely
As described above, expression of an altered penicillin- the organism develops resistance. Multidrug-resistant M.
binding protein (PBP2 or PBP 2a) encoded by the mecA tuberculosis is a major problem around the world.83 One
gene is the mechanism by which these organisms have group reported on the evolution of drug resistance of M.
become resistant. Oxacillin cannot bind to the altered tar- tuberculosis in a patient who was noncompliant with the
get, and therefore it has no effect on the bacterial cells. treatment protocol. They found that in over 12 years of
Rapid identication of MRSA isolates in clinical spec- poorly treated tuberculosis, subpopulations of the organ-
imens by direct detection of mecA is critical for effective ism emerged due to the acquisition and accumulation of
patient management and prevention of nosocomial mutations that rendered the organism resistant to isoni-
azid, rifampin, and streptomycin.84 Many nucleic acid
amplication protocols have been developed to directly
detect mutations in the genes associated with conferring
Historical Highlights resistance to isoniazid and rifampin.8590 In general, these
Methicillin is no longer used for in vitro testing or assays have demonstrated excellent sensitivity and speci-
in vivo therapy. The abbreviation MRSA is still used city and provide rapid determination of drug suscepti-
even though oxacillin or cefoxitin are used for in bility either directly from sputum or from cultures.
vitro testing and ucloxacillin and dicloxacillin are Thus, the advantages of using nucleic acid ampli-
used in its place in vivo. cation assays for the determination of drug resistance is
the rapid and specic detection of mutations in genes

associated with resistance to particular antimicrobial

Table 12.8 Epidemiological Typing Methods
agents, providing irrefutable evidence of resistance in a
short period. Class Methods
Phenotypic Biotyping, growth on selective media
Antimicrobial susceptibility
Molecular Epidemiology Serotyping, immunoblotting
An epidemic is a disease or condition that affects many Bacteriophage typing
unrelated individuals at the same time. A rapidly spread- Protein, enzyme typing by electrophoresis
ing outbreak of an infectious disease is an epidemic. A Genotypic Plasmid analysis
pandemic is a disease that sweeps across wide geograph- Restriction endonuclease mapping
ical areas. Epidemiology includes collection and analysis Pulsed eld gel electrophoresis
of environmental, microbiological, and clinical data. In Ribotyping
microbiology, studies are performed to follow the spread Arbitrarily primed PCR, RAPD PCR
of pathogenic organisms within the hospital (nosocomial Melt curve analysis
infections), from the actions of the physician (iatrogenic REP-PCR, ERIC PCR, ITS, spa typing
infections), and in the community. Molecular epidemiol-
ogy is the study of causative genetic and environmental
and genera to unique to each organism. Some of these
factors at the molecular level. Results of epidemiological
sequences are strain- or species-specic and can be used
studies ascertain the origin, distribution, and best strate-
for epidemiological analysis. DNA analysis is highly
gies for prevention of disease. In infectious disease, these
reproducible and, depending on the target sequences, can
efforts are facilitated by the ability to determine the
discriminate between even closely related organisms.
genetic similarities and differences among microbiologi-
Most (but not all) molecular methods offer denitive
cal isolates.
results in the form of DNA sequences or gel band and
In the laboratory, molecular methods are very useful for
peak patterns that can be interpreted objectively, which is
identifying and typing infectious agents.91 This is inform-
less difficult than subjective determinations that often
ative in a single patient for therapeutic efficacy as well as
require experienced judgment. With commercial sys-
in groups of patients for infection control. Typing systems
tems, test performance has become relatively simple for
are based on the premise that clonally related isolates
some molecular epidemiology tests, whereas others re-
share molecular characteristics distinct from unrelated
quire a higher level of laboratory expertise.
isolates. Molecular technology provides analytical alter-
natives from the chromosomal to the nucleotide sequence
level. These genotypic methods, in addition to established Molecular Strain Typing Methods
phenotypic methods, enhance the capability to distinguish for Epidemiological Studies
microorganisms. Whereas phenotypic methods are based In community or clinical settings, when the same organ-
on a range of biological characteristics, such as antigenic ism is isolated multiple times, whether in the same patient
type or growth requirements, genotypic procedures target or from different patients, the physician wants to know if
genomic or plasmid DNA (Table 12.8). Genome scanning the isolates were independently acquired, i.e., came from
methods, such as restriction enzyme analysis followed by different sources, or if they came from the same source.
PFGE, have been very useful in nding genetic similari- With this knowledge, the physician can act to control the
ties and differences. More recently, amplication and transmission of the organism, especially if it is being
sequencing methods have been utilized for this purpose. transmitted from a common source and that source has
The ability to discern genetic differences with increasing been identied. Most of the time, these analyses are
detail enhances the capability to type organisms regard- performed on organisms that have been transmitted noso-
less of their complexity. All methods, however, have ben- comially, but sometimes procedures to determine related-
ets and limitations with regard to instrumentation, ness are performed on isolates from community outbreak
methodology, and interpretation. situations.92
Molecular methods are based on DNA sequence. DNA There are many laboratory methods that can be used to
sequences range from highly conserved across species determine the relatedness of multiple isolates, both phe-

notypic (e.g., by serology and antimicrobial susceptibil- M 0 1 2 3 4 5 6

ity patterns) and genotypic (e.g., pulsed eld gel elec-
trophoresis and ribotyping).93 The phenotypic methods
suffer from a lack of reproducibility, and the ability to
discriminate between isolates is not very good. Genoty-
pic methods are used almost exclusively to type bacterial
strains to determine the relatedness of multiple isolates
and will be summarized in this section.
M 0 1 2 3 4 5 6
Plasmid Analysis
Plasmid analysis, or as it was known in the past, plasmid
ngerprinting,94 involves isolation and restriction map-
ping of bacterial plasmids. The same bacterial strain can
have different plasmids carrying different phenotypes or
resistance patterns. For this analysis, plasmid DNA is
isolated from the specimen or culture and then digested
with restriction enzymes. Plasmids are distinguished by
the pattern of fragments generated when cut with the 1 2 3 4 5 6 7
appropriate enzymes. Restriction analysis can also be
performed on chromosomal DNA for organisms with
small genomes. For organisms with larger genomes,
whole genome restriction enzyme analysis often yields
complex patterns that are more difficult to interpret.
Pulsed Field Gel Electrophoresis

Most molecular epidemiological tests are performed
using pulsed eld gel electrophoresis (PFGE), which
can identify organisms with larger genomes or multiple
chromosomes. For PFGE analysis, the DNA is digested
with restriction enzymes that cut infrequently within
the genomic sequences. The resulting large (hundreds
of thousands of base pairs) fragments are resolved by
PFGE (see Chapter 5 for a more detailed description of
this system). Patterns of organisms will differ depending
on the chromosomal DNA sequence of the organisms
(Fig. 12-5). Tenover and colleagues devised a system to
interpret the patterns of a test organism in comparison
with the strain of organism known to be involved in the
outbreak.95 The interpretation of PFGE results is fairly Figure 12-5 PFGE results of seven test strains (top panel).
straightforward and follows the rule of three (Table The fragment shifts are marked in the middle panel. Strains 1,
3, and 5 are the same as the outbreak strain (O). Strains 2 and
12.9). This method has been used for typing numerous 6 have apparently one genetic difference, resulting in two
species, including strains of Pseudomonas aeruginosa, fragment differences. Strain 4 has seven fragment differences,
Mycobacterium avium, Escherichia coli, N. gonorrhoeae, indicating more than six genetic differences and is not related
VRE, and MRSA. Intralaboratory and interlaboratory to the outbreak. PFGE of coagulase-negative Staphylococcus
computerized databases of band patterns can be stored for (bottom). Lanes 1 and 7, molecular weight markers; lanes 2
and 3 are two isolates that are same; lanes 4, 5, and 6 are
reference. A national PFGE database is stored at the three isolates that are the same but different from the isolates
Centers for Disease Control and Prevention (CDC) in lanes 2 and 3. (Courtesy of Mary Hayden, MD, Rush Medical
(www.cdc.gov/pulsenet/index.htm). One disadvantage to Laboratories, Rush University Medical Center, Chicago, IL.)

Table 12.9 Criteria for PFGE Pattern Interpretation

Genetic Fragment
Category Differences* Differences* Epidemiological Interpretation
Indistinguishable 0 0 Test isolate is the same strain as the
outbreak strain
Closely related 1 23 Test isolate is closely related to the
outbreak strain
Possibly related 2 46 Test isolate is possibly related to the
outbreak strain
Different 3 6 Test isolate unrelated to the outbreak
*Compared with the outbreak strain
performing PFGE to type strains is the time involved to ribotyping. For this method, probes target the 16S and
perform the assay. It can take 23 days to complete one 23S rRNA genes. RFLP and ribotyping have been applied
analysis.91 in industrial as well as clinical microbiology.100,101
RFLP can be investigated more rapidly using PCR
Restriction Fragment Length amplication with gene-specic primers (locus-specic
Polymorphism Analysis RFLP, or PCR-RFLP). This method requires amplica-
Restriction fragment length polymorphism (RFLP) tion of specic regions by PCR (see Chapters 7 and 9 for
analysis by Southern blot is the same technique rst more details on this PCR and PCR-RFLP). The ampli-
used to identify and investigate human genes (see cons are then cut with restriction enzymes, yielding bands
Chapter 6). This method is performed by cutting DNA of informative size. The advantage of this procedure, in
with restriction enzymes, resolving the resulting frag- addition to its speed, is the simple band patterns, which
ments by gel electrophoresis, and then transferring the are much easier to interpret. Although the method is lim-
separated fragments to a membrane for probing with ited by the sequences that can be amplied and differen-
a specic probe. Gene-specic probes are used to iden- tiated through restriction enzyme digestion, proper gene
tify or subtype microorganisms such as P. aeruginosa in selection provides a highly reproducible and discrimina-
cystic brosis patients and nosocomial L. pneumophila tory test.102 In one study, an 820-bp amplied fragment of
infections.96,97 the ureC gene from Helicobacter pylori digested with
Insertion elements are segments of DNA that can move Sau3A and Hhal yielded 14 different Sau3A patterns and
independently throughout the genome and insert them- 15 different Hhal patterns. These patterns were informa-
selves in multiple locations. Strains can be typed based tive as to antibiotic sensitivity of the various types to clar-
on how many insertions are present and where they are ithromycin or clarithromycin-omeprazole dual therapy.103
located. Strains that are the same will have the same
number and location of elements. For strain typing of M. Arbitrarily Primed PCR
tuberculosis by this method, the probe is complementary Arbitrarily primed PCR, or random amplied polymor-
to IS6110 and will bind to restriction fragments on the phic DNA (RAPD) assay, is a modied PCR using 10-
membrane that contain the insertion sequence, resulting baselong oligonucleotides of random sequences to
in a series of bands that can be easily analyzed and com- prime DNA amplication all over the genome.104,105 The
pared.98 This is the preferred method for typing M. tuber- gel pattern of amplicons produced is characteristic of a
culosis isolates using the IS6110 insertion element.99 given organism. If two organisms have the same pattern,
The gene targets selected for this procedure depend on they are considered the same type. If the patterns differ,
the organism under investigation and which genes will be they are different types. The RAPD assay is relatively
most informative. Ribosomal RNA genes are highly in- rapid and inexpensive; however, producing consistent
formative over a range of microorganisms, which is the results may be technically demanding. Accurate interpre-
basis for a modication of the RFLP procedure called tation of RAPD raw data requires that the procedure con-

(A)
M C
(B)
M C
Figure 12-6 RAPD gel results. An unacceptable gel

pattern is represented in panel A. The bands are
smeared, and variable producing patterns are too
complex for positive identication of unrelated strains.
The gel pattern represented in panel B is acceptable.
Strain differences can be clearly identied by varia-
tions from the known strain (C). Molecular weight
markers are shown in lane M.
ditions are followed strictly so that pattern differences AFLP may detect more polymorphisms than RAPD
(not necessarily patterns) are reproducible (Fig. 12-6). analysis and is faster than PFGE. The procedure is more
technically demanding, however, than REP-PCR. Gel
Amplied Fragment Length patterns may also be complex (Fig. 12-8). Both high
Polymorphism Assay and low reproducibility of the method have been
Amplied fragment length polymorphism (AFLP) is a reported.106,108
name, rather than an acronym, chosen by the inventors for
this assay due to its resemblance to RFLP.106 The AFLP Interspersed Repetitive Elements
assay is based on the amplication of DNA fragments Copies of conserved sequences are found throughout the
generated by cutting the test genome with restriction genomes of most organisms. These sequences may have
enzymes.107 DNA isolated from the test strain is digested arisen from viral integration or movement of transpos-
with HindIII or other restriction enzyme (Fig. 12-7). The able elements (stretches of DNA that move from one
adaptor-ligated fragments are then amplied in two steps location to another in a nonmendelian fashion, also called
with primers complementary to the adaptor sequences. jumping genes). The genomic location of these structures
Nucleotides placed on the 3 end of the primers select for are related to species type and can be used to distinguish
specic sequences in the restriction fragments. The am- between bacterial isolates.
plicons can then be resolved by gel or capillary electro- Enterobacterial repetitive intergenic consensus (ERIC)
phoresis (uorescently labeled primers are used for sequences are 126-bp long genomic sequences found in
capillary electrophoresis). The pattern will be characteris- some bacterial species that are highly conserved, even
tic of the strain or type of organism. This assay can be though they are not located in coding regions.109 These
performed with one or two enzymes (e.g., EcoR1/MseI or sequences are located between genes in operons or
BamH1/PstI ). upstream or downstream of single open reading frames.

Chromosomal DNA
HindIII fragment
5 AAG CTT A 3
3 A TTC G A A 5
Ligate adaptors
Adaptor Adaptor
5 AAG CTT A AGC T T 3
3 TTCGA A TTC G A A 5
Amplify with
pre-selective primers Figure 12-7 AFLP analysis begins with
restriction digestion of chromosomal DNA.
N
The resulting fragments (top) are ligated
5 AAG CTT A AGC T T 3 with adaptors compatible with the restric-
3 TTCGA A TTC G A A 5 tion enzyme ends and complementary to
N primers used to amplify them. The rst
Amplify with amplication is performed with preselec-
selective primers tive primers that end in a 3 base (N)
selected by the user. Selective primers
NNN
with three added 3 bases are used for a
5 AAG CTT A AG C T T 3 second round of PCR. This selection results
3 TTCGA A TTC G A A 5 in a characteristic pattern; only a fraction
of the original fragments will be repre-
NNN
sented in the gel pattern.
ERIC sequences are anked by inverted repeats that could loop structures, as do ERIC and REP. About 25 of these
form stem-loop or cruciform structures in DNA. These elements are present in the S. pneumoniae genome.
sequences are found only in gram-negative organisms,
such as Bartonella, Shigella, Pseudomonas, Salmonella, Internal Transcribed Spacer Elements
Enterobacter, and others. The ribosomal RNA genes comprise the most conserved
A related type of repetitive element, the repetitive region in the genome. These genes are arranged as an
extragenic palindromic (REP) sequence, is similar to the operon, including a small subunit, 18S rRNA, 5.8S rRNA,
ERIC sequence in that it occurs in noncoding regions and and a large subunit, 28S rRNA. The internal transcribed
contains an inverted repeat. REP sequences differ from spacer (ITS) 1 and 2 elements (ITS1 and ITS2) are found
ERIC sequences in size in being only 38 bp long, being in regions separating the 18S and the 28S rRNA genes.
more numerous in the genome, and being present in mul- ITS1 is located between the 18S and the 5.8S gene, and
tiple copies at a single location (Fig. 12-9).110 PCR primed ITS2 is located between the 5.8S and the 28S rRNA
from these elements yields a series of products that can be genes. Two additional elements, intergenic spacer (IGS)
resolved by gel, capillary electrophoresis, or microu- regions, IGSI and IGSII, are located between the rDNA
idics111 into characteristic patterns (Fig. 12-10). These repeat units (Fig. 12-11). These elements are used for the
elements have been used for typing of clinically important identication and typing of yeast and molds. The ITS
organisms such as Clostridium difficile112 and fungal sequences are conserved within species but polymorphic
pathogens.113 between species.114,115 The ITS can be amplied using
Another repetitive element, BOX, was discovered in S. primers directed to the unique 17S and 26S gene se-
pneumoniae. BOX elements consist of different combi- quences. The resulting amplicons can be analyzed by
nations of subunits, boxA, boxB, and boxC, 59, 45, and sequencing, single-strand conformation polymorphism,
50 bp long, respectively. Although these elements are not density gradient gel electrophoresis, restriction enzyme
related to ERIC and REP sequences, they do form stem- analysis, or sequence-specic PCR.116118

1 1 2 2 3 3 known isolates (spa typing) is used to identify MRSA.

Almost 400 repeat proles or spa types have been dened.
A similar sequence structure in the coagulase gene
(coa) has also been used for S. aureus typing (coa typ-
ing).120 The coa VNTR units are 81 bp in length, and
fewer than 70 repeat proles have been described. PCR
amplication and sequence analysis are used to analyze
coa types. The discriminatory power of this method is
increased by analysis of other repeated sequences else-
where in the MRSA genome. The combination of spa
and VNTR typing has discriminatory power equal to
PFGE, with a more rapid turnaround time.
Multilocus Sequence Typing

Multilocus sequence typing (MLST) is used to character-
ize bacterial isolates using sequences of internal frag-
ments of housekeeping genes.121,122 Six or seven genes
are sequenced over 450500 bases, and the sequences are
assigned as alleles. Examples of housekeeping genes
used in S. aureus MLST are shown in Table 12.10.
Distinct alleles can be dened as a single base pair differ-
ence or multiple changes resulting from recombination or
other genetic events. An isolate type is the collection of
Figure 12-8 Banding patterns generated by uorescent
all seven alleles or the allelic prole, also called the
AFLP analysis. Note that duplicate specimens (1, 2, and 3) do
not produce the exact pattern because of band shifts and
sequence type. Bacteria have enough variation so that
different band intensities. there are multiple alleles of each housekeeping gene (30
alleles/locus), making up billions of allelic proles.123,124
Because the data generated by MLST is text sequence,
spa Typing the results can be compared with those in large databases,
MRSA contains a variable number tandem repeat e.g. pubmlst.org
(VNTR) element in the 3 coding region of the protein A
gene (spa).119 The element consists of repeat units 21 or
Comparison of Typing Methods
24 bp long. Repeat units also vary by sequence of at least
one position, with 38 sequence types so far described. The Genotypic methods used for strain typing are evaluated
spa element can have 216 repeat units. Analysis of these and compared based on ve criteria. First, the target
elements by PFGE or sequencing and comparison to organism must be typable by the method used to detect it
ERIC sequence
GTGAATCCCCAGGAGCTTACATAAGTAAGTGACTGGGGTGAGCG
REP sequence
GCC G/T GATGNCG G/A CG C/T NNNNN G/A CG C/T CTTATC C/A GGCCTAC
Figure 12-9 The central inverted repeat of an 126-bp ERIC sequence (top) and a consensus
REP sequence (bottom). ERIC sequences contain multiple inverted repeats (arrows) that can gen-
erate a secondary structure consisting of several stems and loops. REP sequences contain a con-
served inverted repeat that forms a stem with a loop that includes 5 bp of variable sequence (N).

Isolate A
Table 12.10 Example of Housekeeping Genes
Sequenced in an MLST Test
Number
Isolate B Gene Gene Product of Alleles
ArcC Carbamate kinase 52
AroE Shikimate dehydrogenase 88
GlpF Glycerol kinase 55
M A B M A B U
Gmk Guanylate kinase 51
Pta Phosphate acetyltransferase 57
tpi Triosephosphate isomerase 74
YqiL Acetyl coenzyme A acetyltransferase 66
tinguish between unrelated strains (discriminatory

power). Reproducibility and discriminatory power are
important for establishment of databases that can be used
Figure 12-10 Species identication by REP or ERIC primed by independent laboratories. Fourth, ease of interpreta-
amplication. REP and ERIC sequences are present in different tion of results is important. Unclear or complex results
chromosomal locations in bacterial subtypes A and B. PCR,
will lower reproducibility and discriminatory power.
which extends outward oriented primers hybridized to the
repeated sequences, generates amplicons of different sizes Finally, ease of test performance is important in order to
based on the placement of the element as shown in the minimize chance of error or ambiguous results. Rating of
gel depicted in the bottom left panel where only one representative methods is shown in Table 12.11.
amplicon is shown. Multiple REPs and ERICs throughout the The most desirable typing method is the one that will
bacterial chromosome generate multiple amplicons with
type all strains and have excellent reproducibility, dis-
characteristic gel patterns (bottom right). An unknown isolate
(U) is identied as the same strain as isolate B. M, molecular criminatory power, and ease of performance and inter-
weight markers pretation. Unfortunately, no such method ts this prole,
so the laboratory professionals performing these types of
analyses may have to sacrice ease of performance, for
(typing capacity). A test that detects a genotypic or phe- example, in order to get excellent discriminatory power
notypic characteristic that is not expressed in all members when they are choosing which molecular typing method
of a species will not accurately detect the target organ- will be performed in their laboratory.
isms at all times. A molecular assay must target a reason- In conclusion, molecular-based methods are available
ably polymorphic DNA sequence, alleles of which are for the detection, identication, and characterization of a
unambiguously associated with a given strain. Second, number of bacteria. For some organisms, the assays are
the method must be reproducible. A reproducible used almost exclusively, such as for N. gonorrhoeae, C.
method yields the same result on repeated testing of the trachomatis, and B. pertussis. For other organisms,
same organism or strain. Variations in cell characteristics, molecular-based tests are used to provide rapid results
such as antigens or receptor expression, lower repro- and supplement traditional testing such as for M. tuber-
ducibility (precision). Third, the method must clearly dis- culosis. Finally, molecular-based methods are still in the
One rRNA repeat unit

rRNA
SSU (18S) ITS1 5.8S ITS2 LSU (28S) IGS1 5S IGS2 SSU (18S) ITS1 5.8S ITS2 LSU (28S) IGS1 5S
Figure 12-11 Ribosomal RNA genes are arranged in multiple tandem units that include the
major rRNA transcript (18S-28S) and the 5S gene. ITSs are located within the major transcript tem-
plate area and IGSs in the region between the repeat units surrounding the 5S rRNA gene.

Table 12.11 Performance Comparison of Representative Molecular Epidemiology Methods*

Method Typing Capacity Discriminatory Power Reproducibility Ease of Use Ease of Interpretation
Plasmid analysis Good Good Good High Good
PFGE High High High Moderate Goodmoderate
Chromosomal RFLP High Good Good High Moderatepoor
Ribotyping High High High Good High
PCR-RFLP Good Moderate Good High High
RAPD High High Poor High Good-High
AFLP High High Good Moderate High
Repetitive elements Good Good High High High
Sequencing High High High Moderate Good-High
*from Olive and Bean89
Intralaboratory
Interpretation is inuenced by the quality of the data
development stage for most bacteria and will probably be the best evidence for the presence of that virus. But even
performed more routinely in the future. detecting IgM, the rst isotype of antibody produced in
an acute infection, is not without problems. If the patient
is in the very early stages of infection, IgM titers may be
Viruses below detection limits and would be interpreted as nega-
Molecular-based methods have beneted the laboratory tive. When the patient is infected with a virus and the
diagnosis of viruses probably more than any other organ- antibodies are not detectable, they are in the window
ism. In general, viruses are diagnosed by testing for anti- period. During this time, the patient is infected and infec-
bodies against the virus, by measuring the presence or tious, yet antibodies are not detectable.
absence of viral antigens, or by detecting the growth of a Antigen detection testing is available in the clinical lab-
virus in a culture system. Although some of these meth- oratory for only some viruses. Assays that measure viral
ods are well-established for certain viruses, they all have antigens are available more often for Respiratory Syncy-
major disadvantages associated with them. tial Virus, Inuenza Virus, Rotavirus, Herpes Simplex
Even though laboratory testing is available for anti- Virus (HSV), Cytomegalovirus (CMV), and Hepatitis B
bodies against most viruses, the detection of antibodies Virus (HBV). Viral antigens are detected by enzyme
against a virus is an indirect method of diagnosis. The immunoassays or direct immunouorescent assays most
host immune response needs to be stimulated by the virus often.
to produce antibodies. If a patient is immunodecient and The primary method used in clinical virology laborato-
does not make antibodies, the lack of antibodies is due to ries to detect and identify viruses in body uids is by tis-
host factors and not due to the lack of the virus, although sue or cell cultures. Monolayers of host cells are grown in
the lack of antibodies is often interpreted as a lack of the vitro, the patients specimen is inoculated onto the cells,
virus. Using antibodies to diagnose an infection is often and changes in the cells due to viral infection, called cyto-
a retrospective indication of the infection. To interpret pathic effect, are observed microscopically by the tech-
antibody testing with the most condence, paired sera nologist. The identity of the virus is conrmed using
should be collected, one collected during the acute phase uorescently labeled monoclonal antibodies. While cul-
of the infection and the other collected as the patient is ture is often the gold standard for many viruses, in partic-
convalescing, and the titers of antibodies measured in ular, Adenovirus, Enteroviruses, CMV, Inuenza, and
both samples. A fourfold or greater rise in titer level from HSV, it is not applicable for other viruses because the
the acute sample to the convalescent sample indicates the viruses do not grow in current in vitro culture systems,
presence of the virus during the acute stage. Detecting such as the hepatitis viruses. Another disadvantage to
IgM antibodies in particular during an acute infection is viral culture is the amount of time before viral growth is

detectable. Although centrifuging the sample onto the

Table 12.12 Genomes of Human Viruses
monolayer in the shell vial system has decreased detec-
tion time; days to weeks, depending on the virus, can pass Double-Stranded DNA Viruses
before detection of cytopathic effect. Furthermore, some Adenovirus
viruses do not produce a cytopathic effect on infecting BK virus
cells, or the cytopathic effect that is produced is subtle Cytomegalovirus
and easily missed. In these cases, the cultures will be Epstein-Barr virus
reported as a false negative. Another disadvantage of Hepatitis B virus
using viral cultures to detect and identify viral infections Herpes simplex virus 1
is that the specimen must be collected in the acute phase Herpes simplex virus 2
of the disease, i.e., in the rst 5 days of the illness. After Human papillomavirus
5 days, the amount of virus in body uids decreases sig- JC virus
nicantly and may result in false-negative cultures. Molluscum virus
As current diagnostic methods used to detect and iden- Rotavirus
tify viruses have so many disadvantages, tremendous Vaccinia virus
opportunity exists to ll that void with molecular-based Varicella-zoster virus
assays. Nucleic acid amplication assays have quickly Single-stranded DNA virus:
become indispensable in the clinical virology labora- Parvovirus
tory. Molecular methods are well suited to target the var- Double-stranded RNA virus:
ious congurations of nucleic acids found in human Rotavirus
pathogenic viruses (Table 12.12). Target amplication Single-stranded RNA viruses:
assays such as PCR, reverse transcriptase PCR (RT- Arboviral encephalitis viruses*
PCR), quantitative (or real-time) PCR (qPCR), and Colorado tick fever virus
transcription-mediated amplication (TMA) as well as Coronavirus*
signal amplication assays such as branched DNA Coxsackie virus*
(bDNA) amplication and hybrid capture are used in the Dengue virus*
clinical virology laboratory to diagnose or monitor viral Echovirus*
infections. Table 12.13 is a summary of the viruses for Hepatitis A virus*
which nucleic acid amplication assays are available Hepatitis C virus
(either commercially or performed in-house) along with Hepatitis D virus
the type of amplication procedure, the targeted genes, Hepatitis E virus
and clinical utility. Molecular-based tests for HIV and Human T-cell leukemia virus
HCV are used more extensively in clinical laboratories; Human immunodeciency virus
they are discussed in more detail below. Inuenza virus
Measles virus
Mumps virus
Human Immunodeciency Virus
Norwalk virus, norovirus
Human immunodeciency virus (HIV) is unique among Parainuenza virus
the RNA viruses in that it is a retrovirus that makes a Poliovirus*
DNA copy of genomic RNA using virally encoded Rabies virus
reverse transcriptase. There are two types of HIV: HIV-1 Respiratory syncytial virus
and HIV-2. HIV-2 is a minor isolate found mainly in West Rhinovirus*
Africa and is less pathogenic than HIV-1, causing more Rubella virus*
latent infections and, rarely, AIDS. HIV rapidly mutates Yellow fever virus*
and recombines so that there are multiple groups that are *Positive RNA; directly translated
then divided into clades, or subtypes, of the virus that Negative RNA; complimentary to the translated strand
are found in different places of the world.25,128 HIV group Retroviral replication requires a DNA intermediate

Table 12.13 Nucleic Acid Amplication Tests for Viruses 8,125127

Virus NAA Methodology Amplied Target Dynamic Range/Sensitivity Clinical Utility
Human PCR: gag gene; 155 bp (HIV-1 400-750,000 copies/mL Viral quantitation
immunode- HIV-1 DNA group M (subtypes A- (standard) Disease prognosis
ciency virus (Roche) H), not HIV-2 or HIV-1 50-100,000 copies/mL Treatment monitoring
RT-PCR (Amplicor group O) (ultrasensitive)
and COBAS;
Roche)
NASBA: gag (similar to Amplicor) 176,0003,470,000
NucliSense (bio HIV-1 groups M, O, and N copies/mL
Merieux)
bDNA: pol; subtypes of group M 75500,000 copies/mL
Versant HIV-1 (subtypes A-G), but not
(Bayer) group O
Cytomegalovirus Hybrid capture Immediate-early 1400-600,000 copies/ml Detect CMV DNA in organ
(CMV) (Digene) antigen 1 transplant and AIDS
PCR Major immediate-early 400-50,000 copies/mL patients and congenitally
antigen infected infants
NASBA Glycoproteins B and H Viral load determinations
qPCR Major capsid protein Detect HSV when asymp-
Herpes simplex PCR Thymidine kinase tomatic or when cultures
virus-1 and qPCR DNA polymerase are negative
-2 (HSV) DNA-binding protein Diagnosis of HSV
Glycoproteins B, C, D, encephalitis and neonatal
and G infections
Epstein-Barr PCR EBNA1 EBV-associated malignan-
virus (EBV) qPCR LMP-1 cies
Detect EBV in asympto-
matic immunocompro-
zmised hosts
Human papillo- Hybrid capture L1 or E1 open reading 105 copies/mL Detection of HPV in endo-
mavirus (HPV) (FDA-approved) frames cervical swabs
PCR Differentiation of low-risk
qPCR and high-risk types
Monitoring women with
abnormal Pap smears
Hepatitis B virus PCR 100040,000 copies/mL Prognosis and monitoring
bDNA 0.75000 meq/mL of antiviral treatment
Hybrid capture 142,0001,700,000,000 response
copies/mL (standard)
470056,000,000 copies/
mL (ultrasensitive)
Parvovirus B19 PCR Diagnosis of infections

Table 12.13 Nucleic Acid Amplication Tests for Viruses 8,125127 (continued)
Respiratory syncytial RT-PCR Fusion glycoprotein (F) Detection of RSV
virus (RSV) gene Differentiate between
Nucleoprotein (N) gene subgroups A and B
Parainuenza viruses RT-PCR Hemagglutinin-neu- Epidemiology
raminidase conserved
regions
5 noncoding region of F
gene
Inuenza viruses RT-PCR Conserved matrix (M) Diagnose infections
genes (inuenza A and B)
Nucleocapsid protein Characterize isolates
(inuenza A) Can be type- and subtype-
NS1 gene (inuenza B) specic
Metapneumovirus RT-PCR Fusion (F) gene
RNA polymerase (L) gene
Coronavirus RT-PCR RNA polymerase gene Used to detect and charac-
Nucleoprotein gene terize the SARS virus
Norwalk virus RT-PCR RNA polymerase gene
Rotavirus RT-PCR VP7 gene
VP4 gene
Hepatitis C virus RT-PCR 5 untranslated region 600-800,000 IU/mL
bDNA (UTR)
5 UTR and core protein 3200-40,000,000
gene copies/mL
West Nile virus RT-PCR Variety of gene targets 0.11 PFU Used for diagnosis and
NASBA based on genome of type 0.01 PFU surveillance
strain NY99
Rubella virus RT-PCR Surface glycoprotein, E1, Variable; Sensitivity of Primarily for fetal diag-
gene 310 copies is best nosis
Used for diagnosis when
serum is not available
May be used to conrm
positive serological
results
Mumps virus RT-PCR Hemagglutinin, neuramini- Differentiate strains
dase, P, SH, and F genes
Measles virus RT-PCR M, H, F, N When culture is not practi-
cal or genotyping is
required for diagnosis
of MIBE or SSPE
Differentiation of vaccine
and wild-type strains

Table 12.13 Nucleic Acid Amplication Tests for Viruses 8,125127 (continued)
Enteroviruses RT-PCR Conserved 5 nontrans- Performed on CSF to rule
(group A lated region out enteroviral menin-
and B Cox- gitis
sackieviruses,
echoviruses,
and others)
BK Virus PCR Large T protein Diagnosis of progressive
(polyomavirus) multifocal leukoen-
cephalopathy
Detection in kidney
transplant patients
MIBE Measles inclusion body encephalitis
SSPE Subacute sclerosing panencephalitis
PFU Plaque-forming units
M causes 95% of the infections due to HIV around the measure the amount of HIV p24 antigen. Nucleic acid
world. Group M is further divided into eight clades (A, B, amplication assays are performed after someone has
C, D, F, G, H, and J). Group M, clade B, is found most been diagnosed as having HIV to determine how actively
often in the United States and Europe. Group O HIV is the virus is replicating (viral load), when to start anti-
found primarily in West Africa, and group N is found in retroviral therapy, and to monitor efficacy of treatment.
Cameroon.128
To infect host cells, the HIV surface molecules gp120 Viral Load Determination
and gp 41 interact with CD4, a molecule that is expressed The amount of HIV or viral load is used as a marker for
primarily on the surface of helper T lymphocytes and is disease prognosis as well as to track the timing and effi-
also found on macrophages, dendritic cells, and other cacy of antiretroviral therapy. Patients are 10 times more
antigen-presenting cells. Chemokine receptors, in partic- likely to progress to AIDS within 5 years if they have
ular CCR5, on dendritic/Langerhans cells and macro- viral loads above 100,000 copies/mL within 6 months of
phages/monocytes, and CXCR4 on CD4 T cells form a seroconversion.128 The aim of antiretroviral therapy is to
complex with CD4 on the cell surface and also engage get the viral load below 50 copies/mL of blood. Patients
gp120. After attachment to host cells via CD4-gp120 who maintain viral levels at less than 10,000 copies/mL
binding, the virus enters the cell, where reverse tran- in the early stages of the infection are at decreased risk of
scriptase makes cDNA from viral RNA. The cDNA inte- progression to AIDS.
grates into the host DNA where it either persists in a Patients who are effectively treated with antiretroviral
stage of latency as the provirus or is replicated actively. therapy will have a signicant reduction in viral load 1
Transcription and translation of viral peptides as well as week after the initiation of therapy. The lack of signicant
production of viral RNA are performed by cellular com- decrease in viral load during this time indicates the lack of
ponents under the direction of virally encoded regulatory efficacy.128 Highly active antiretroviral therapy (HAART),
proteins (i.e., tat, rev, nef, and vpr).128 consisting of two reverse transcriptase inhibitors com-
Diagnosis of HIV infection is accomplished by detect- bined with a protease inhibitor or a non-nucleoside
ing antibodies specic for HIV in an EIA and conrming reverse transcriptase inhibitor, have been shown to reduce
the specicity of detected antibodies for HIV products in viral loads below the detection limits of even ultrasensi-
a Western blot. In infants who have maternal IgG and in tive assays; these levels remain undetectable for more
patients suspected of incubating HIV in whom antibody than 3 years.129 In patients receiving HAART, 2 log10
tests are negative, antigen detection tests are available that decreases in viral load have been documented. Viral load

testing should be performed in conjunction with the deter- ter AIDS Cohort Study, an ongoing project monitoring
mination of CD4 counts. In general, but not always, viral the clinical histories of treated and untreated HIV-
load and CD4 counts are inversely proportional; that is, infected men. The Department of Health and Human
the higher the viral load, the lower the CD4 count.127 Services (DHHS) recommends an objective of maximal
Molecular-based methods that are used to quantify suppression of viral replication down to undetectable lev-
HIV in patient samples include PCR for integrated DNA, els by sensitive analysis.
RT-PCR for viral RNA, nucleic acid sequence-based The rst commercially produced tests could detect
amplication (NASBA), and bDNA (see Table 12.13). viral loads down to 400500 copies/mL plasma; however,
See Table 12.14 for a comparison of the advantages and suppression to less than 20 copies/mL plasma was asso-
disadvantages of each of these assays for HIV viral load ciated with longer response to therapy than suppression
determination.127 Viral load determinations should be below 500 copies/mL.133 These observations emphasize
made before therapy is started, 28 weeks after therapy the importance of a highly sensitive assay with a very low
initiation to see the initial response, and then every 34 limit of detection for optimal treatment strategy and
months to assess therapeutic effectiveness. Because patient care. The lower limit of detection is dened as the
nucleic acid amplication assays use different amplica- lowest viral concentration that can be detected 95% of the
tion techniques, and sometimes different standards for time in the test assay. Currently available FDA-approved
quantifying, results from one method may not be compa- HIV tests include the Bayer VERSANT HIV-1 RNA 3.0
rable with another method. In general, viral loads deter- Assay (bDNA), the Roche Amplicor MONITOR Test
mined by the Amplicor RT-PCR (version 1.0) are about (RTPCR), and the bioMerieux NucliSens HIV-1 QT Test
twofold higher than loads determined either by bDNA (NASBA), with lower limits of detection of 75, 50, and
(version 2.0) or by NASBA.130,131 On the other hand, viral 176 viral copies per ml plasma, respectively. The Abbott
loads determined by the bDNA (version 3.0) and RealTime HIV-1 (qPCR) assay has also been devel-
Amplicor RT-PCR (version 1.5) were similar.132 Even oped as a more automated method. This test has a limit of
though results obtained by different methods are becom- detection of 40 viral copies/mL.
ing more and more comparable, it is still recommended In addition to sensitivity, all test methods including
that laboratory professionals use the same method to HIV tests should have certain characteristics (Table
determine viral loads when monitoring patients over time. 12.15). Accuracy is an important feature of viral load test-
Quantitative HIV-1 RNA testing in plasma has been ing. Accuracy is established by calibration of assays to a
the standard for monitoring drug therapy and HIV dis- common standard. The test must have quantitative as well
ease progression. Laboratory measurements of viral load as qualitative accuracy that is a true measure of the viral
and clinical disease have been described by the Multicen- level over a range of values. DHHS and the International
Table 12.14 Advantages and Disadvantages of the

Nucleic Acid Amplication Methods Table 12.15 Test Performance Features
for HIV Viral Loads for Viral Load Measurement
Test Advantages Disadvantages Characteristic Description
bDNA High throughput No internal con- Sensitivity Lowest level detected at least 95% of the time
Broad dynamic range trol Accuracy Ability to determine true value
Applicable for group False positives Precision Reproducibility of independently determined
M subtypes AG reported test results
Amplicor Internal control Limited dynamic Specicity Negative samples are always negative and
RT-PCR Good specicity range positive results are true positives
NASBA Broad dynamic range Does not detect Linearity A serial dilution of standard curve closely
Performed on many all non-B sub- approximates a straight line
specimen types and types Flexibility Accuracy of measurement of virus regardless
volumes of sequence variations

AIDS Society have set viral load levels for initiation of Affymetrix, Santa Clara, CA), or reverse hybridizing
therapy. These levels must be consistently identied in using the line probe assay (VERSANT HIV-1 Protease
independent laboratories as accurately as possible. Real- and RT Resistance Assays, LiPA, Bayer Diagnostics).
time PCR methods offer linear measurement over a wider Sequencing is performed most often; there are currently
range than other methods. This precludes the requirement two commercially-available kits for this purpose: Trugene
for dilution of high-titer specimens before analysis. The HIV-I genotyping kit and OpenGene DNA-sequencing
precision or reproducibility of the test is important for system (Bayer Corp., Tarrytown, NY) and ViroSeq HIV-1
establishment of statistically signicant differences in the genotyping system (Applied Biosystems, Foster City,
viral load over a serial testing period. The DHHS denes CA). Once the sequence of the patients virus is known, it
a minimally signicant change as a threefold increase or must be compared with a wild-type sequence to identify
decrease in viral load/mL plasma. High specicity of a the mutations present in the patients isolate if any.
test provides condence that a positive result is truly pos- After the mutations have been identied, the signi-
itive. All subtypes of virus should be detected with equal cance of those mutations for their impact on antiretrovi-
efficiency to avoid under- or overestimating viral loads of ral therapy must be assessed, and this is generally
certain subgroups. accomplished through the analysis of mutations by com-
There is not much variability in viral loads among puter algorithms. Interpretation of genotyping results
repeated samples for all of the methods, e.g., quantifying with regard to the impact of a mutation on the develop-
RNA in the same patient will not change much (approxi- ment of resistance is very complicated. Resistance muta-
mately 0.3 log10 unit) over time as long as the patient is tions have been well characterized for individual agents,
clinically stable and antiretroviral therapy has not begun but HIV-positive patients are more often on cocktails of
or changed.134 In order to be clinically relevant, viral load drugs rather than one drug. Therefore, the impact of a
changes from one determination to another must be at mutation on multiple drugs must be considered. In addi-
least threefold different (0.5 log10 unit). HIV-positive tion, if HIV has multiple mutations, the interpretation of
patients may experience transient increases in viral loads more than one mutation with respect to multiple drugs
when they have other infections or receive vaccinations, becomes more complex. Finally, mutations can affect
but levels will return to baseline within a month.135-137 multiple drugs, leading to cross-resistance. The compu-
Prociency testing is available from the College of ter algorithm that is used to analyze genotypes takes
American Pathologists (CAP; Northeld, IL) and the into account primary and secondary mutations, cross-
CDC. The World Health Organization (WHO) has an resistance, and the interactions that can occur between
HIV-1 RNA reference standard. Acrometrix (Benicia, mutations to affect the resistance.140
CA), Boston Biomedica, Inc. (West Bridgewater, MA), Mutations found by genotyping are generally divided
and IMPATH-BCP, Inc. (Franklin, MA) have external into two groups: primary resistance mutations and sec-
standards and verication panels for HIV-1 viral load ondary resistance mutations. Primary resistance muta-
testing. tions are those that are specic for a particular drug,
reduce the susceptibility of the virus for that drug, and
Genotyping appear in the viral genome shortly after treatment with
Genotyping is used to monitor the development of anti- that agent has begun. The mutated enzyme is generally
retroviral drug resistance in HIV. Most of the antiretrovi- not as active as the normal enzyme, so viral replication is
ral drugs target the reverse transcriptase and protease decreased but still occurs. As treatment with the drug con-
enzymes, so these are the genes that are most often exam- tinues, secondary or compensatory mutations occur that
ined in genotyping procedures. Thus far, more than 100 try to recover the ability of the virus to replicate at a nor-
mutations associated with drug resistance have been mal rate. The secondary mutations do not affect the sus-
identied in HIV-1.138,139 ceptibility of the virus to the drug but rather help the virus
To perform genotyping, viral RNA is extracted, and replicate in the presence of the drug when one of its repli-
PCR is used to amplify the whole protease gene and part cation enzymes is not 100% functional.128 Once a resis-
of the reverse transcriptase gene. The products are ana- tance genotype has been identied, the drug therapy of the
lyzed for the presence of mutations by sequencing, patient should be changed as soon as possible to avoid the
hybridizing onto high-density microarrays (GeneChip, development of secondary mutations in the virus.

the fact that the envelope proteins that are exposed to the
Advanced Concepts host immune response are antigenic and elicit the produc-
tion of antibodies, but these proteins are encoded by
For more information about specic mutations and hypervariable regions much like antibody genes them-
the interactions of mutations, see: http://hiv-web. selves, resulting in extensive variation in the envelope
lanl.gov, http://www.iasusa.org, http://www.hivdb. proteins and escape of the virus from antibodies.
stanford.edu/hiv/ and references 136 and 137. Diagnosis of HCV infections is similar to the approach
used for HIV diagnosis. Serology is used to detect the
presence of antibodies against HCV. If the patient has
The results of genotyping procedures are reported by HCV antibodies, the specicity of the antibodies for
listing the mutations that have been identied in the pro- HCV antigens is measured by Western blot, where the
tease and reverse transcriptase genes and the impact presence of antibodies with multiple HCV-specicities
those mutations will have on each drug in terms of no conrms the diagnosis.
evidence of resistance, possible resistance, resistance, or Nucleic acid amplication assays for the qualitative
insufficient evidence. The mutations are indicated by detection and quantitation of HCV are performed by a
reporting a change in the amino acid that is coded by the variety of methods, including RT-PCR (Amplicor HCV;
changed codon, where the wild-type amino acid is writ- Roche Molecular Systems), transcription-mediated
ten followed by the position of the codon that is changed, amplication (VERSANT HCV RNA qualitative assay;
followed by the new amino acid. For example, a mutation Bayer Diagnostics, Tarrytown, NY), and branched DNA
in codon 184 of the reverse transcriptase gene from ATG (VERSANT HCV RNA 3.0; Bayer Diagnostics). The
to GTG results in an amino acid change from methionine qualitative HCV RNA assays are performed on patients
to valine, or M184V. This particular mutation makes the with positive HCV antibody results to conrm active
virus resistant to lamivudine.140 infection or on immunocompromised patients (who are
As with all other molecular-based assays, HIV geno- often coinfected with HIV) in whom HCV infection is
typing procedures need to employ adequate quality and suspected but antibody tests are negative. The quantita-
contamination controls. The sensitivity of the methods tive HCV RNA assays are used as for HIV to determine
for detecting a minority of virions that contain mutations the viral load and to monitor viral replication in response
in the midst of a majority of wild-type virions is an to antiviral therapy. The viral load and the HCV genotype
important consideration. The sensitivity of the automated are used to determine the therapeutic protocol, both type
sequencing methods has been reported to be 20%, and of drug(s) as well as duration.141
the LiPA has a reported sensitivity of 4% (i.e., it can Six genotypes, 1a, 1b, 2, 3, 4, 5, and 6, and 80 subtypes
detect as few as 4/100 mutants in the presence of 96/100 of HCV have been identied. The genotype of HCV pres-
wild types).140 Prociency testing is available from CAP ent in a given patient determines the treatment protocol
and Acrometrix. Acrometrix and Boston Biomedica Inc. that is used on that patient as particular genotypes are
provide independent control materials for use in geno- associated with certain antiviral resistance patterns.141
typing assays. The HCV genotype is determined by analyzing the 5
untranslated region because it is the most highly con-
served region of the genome. Methods available in the
Hepatitis C Virus laboratory for HCV genotyping are PCR with RFLP
HCV is an enveloped RNA virus that causes viral hepati- analysis and reverse hybridization (Inno-LiPA, Bayer
tis and cirrhosis and is also associated with causing hepa- Corp.), cleavase fragment length polymorphism analysis
tocellular carcinoma. The virus is transmitted parenterally (Third Wave Technologies; Madison, WI), and direct
like HIV. Acute infections are often asymptomatic and DNA sequencing (TRUGENE; Bayer Corp.). PCR
rarely associated with jaundice; thus, patients with acute amplicons produced by the Amplicor HCV Test (Roche
HCV infections are usually not diagnosed at this stage. Diagnostics; Indianapolis, IN) can be analyzed by the
Among HCV-positive patients, 85% will develop chronic Inno-LiPA or TRUGENE methods to determine the
hepatitis, and even most of these patients will be asymp- genotype.140 Inno-LiPA and TRUGENE methods are
tomatic. The development of chronic infections is due to comparable in the identication of HCV genotypes, with

direct comparison studies demonstrating 91%99% con- one clinical specimen, as in multiplex PCR, is going to be
cordance between methods.140 a great advantage in the diagnosis of respiratory and gen-
Patients who have viral loads greater than 2,000,000 ital tract diseases in particular. Multiplex PCR assays
copies/mL of plasma will not respond as well to conven- have been described for the respiratory viruses alone or
tional interferon-ribavirin therapy compared with patients in conjunction with bacterial respiratory tract
who have fewer than 2,000,000 copies/mL. Determining pathogens.53,143,144 Multiplex PCR assays were described
the genotype of the virus is more critical to predicting earlier in the chapter for the bacterial causes of geni-
treatment outcomes because genotypes 2 and 3 will tourinary diseases, and multiplex assays have been devel-
respond better to treatment than genotype 1.127 Physicians oped for genitourinary specimens for the detection of
are looking for a 2 log10 decrease in HCV RNA as an indi- bacterial agents as well as viral agents of genitourinary
cation of the likelihood that a patient will respond to treat- tract disease. While multiplex assays may seem like a
ment. Patients who have a 2 log10 decrease in HCV RNA shotgun approach to microbiology, the ability to differ-
12 weeks after treatment begins have a 65% chance of entiate quickly between multiple organisms that can
responding, dened by the lack of detection of HCV RNA cause the same symptoms from one clinical specimen
in qualitative assays where the detection limit is 50-100 will enable physicians to treat their patients quickly and
copies of virus/mL of plasma. In contrast, patients who do effectively, leading to better treatment outcomes and, just
not have a 2 log10 decrease in HCV RNA 12 weeks after as important, reducing the transmission of organisms
treatment begins have only a 3% chance of responding.142 from inappropriately treated patients.
Summary Fungi
The use of molecular methods to detect and/or further Applications of molecular-based testing for fungal organ-
characterize some viruses is well entrenched in the work- isms are less numerous than those for bacterial or viral
load of the clinical virology laboratory, e.g., HIV and organisms. Fungi are important causes of human disease,
HCV, to the point that clinicians routinely base treatment especially in immunocompromised patients. Fungal
decisions on the results of these assays. Patient manage- infections are most often diagnosed by direct staining
ment without these results is negatively affected. For other methods and isolation of the causative agent in culture.
viruses, molecular-based testing is increasing in signi- As for other organisms, traditional smears and cultures
cance, in particular for Cytomegalovirus, BK virus, and are affected by sensitivity, organism viability, and the
Epstein-Barr virus detection in transplant or immunocom- length of time required for the organism to grow. In addi-
promised hosts; HBV viral loads; and Human Papillo- tion, laboratory-acquired infections from fungi are a
mavirus detection in cervical samples. For other viruses, major risk for laboratory personnel. Despite these prob-
molecular-based assays are used only in special situa- lems, direct smears and isolation of fungi are still the
tions or when traditional diagnostic tests are negative and major method for detecting fungi in clinical samples.
there is a high index of suspicion that the virus is present, To detect fungi in clinical samples, broad-range PCR
such as for measles, mumps and rubella viruses. Finally, and subsequent analysis is most often used. In this assay,
the use of molecular-based tests for some viruses associ- primers anneal to DNA sequences that are common to
ated with outbreaks has positively impacted the rapid most of the clinically relevant fungi, such as Candida,
identication of the etiological agent, because the molec- Aspergillus, Rhizopus and other zygomycetes, and
ular-based methods are faster and more sensitive and spe- Histoplasma and other dimorphic fungi.145 Once the
cic than traditional laboratory techniques, e.g., for sequences are amplied, hybridization to species-specic
coronaviruses (severe acute respiratory syndrome probes or sequencing is used to identify the fungus to the
[SARS]), Norwalk virus, and West Nile virus. genus or genus and species level.
The development of molecular-based assays for the Fungi growing in culture are typically identied by
detection, identication, and characterization of viruses their microscopic and macroscopic morphologies. For
will increase over the next few years. The automation is some of the fungi, though, gene probes have been devel-
increasing as is the sensitivity and specicity of the oped to conrm the identity of the organism growing
assays. In addition, the ability to detect multiple agents in in culture. The AccuProbe assays (GenProbe, Inc., San

Diego, CA) are available for Histoplasma, Blastomyces,

Coccidioides, and Cryptococcus neoformans. The use of Case Study 12 1
DNA probes for these organisms is faster and less haz- During a holiday weekend at a luxury hotel, guests
ardous than determining the microscopic morphology. began to complain of stomach-u with nausea and
vomiting. In all, more than 100 of the 200 guests
Parasites who had dined at the hotel the previous evening
described the same symptoms. Eight people had
Parasites are typically detected and identied by mor- symptoms severe enough to warrant hospitalization.
phology directly in clinical specimens. This method of Most, however, recovered within 2448 hours of the
diagnosis is subject to false negatives because of low onset of symptoms. Health officials were notied.
organism concentrations and depends greatly on appro- Interviews and epidemiological analyses pointed to
priately trained personnel. Molecular-based testing has a Norwalk-like virus, or norovirus, infection, proba-
been limited for the parasites mainly because parasites bly foodborne. Stool specimens (15 ml) and speci-
are not a major cause of disease in developed countries. mens from the suspected food sources (500 mg)
Recognition that travelers from parasite-endemic coun- were sent for laboratory analysis by RT-PCR. RNA
tries bring the parasite to developed countries and can extracted with 1,1,2 trichloro-1,2,2, triuoroethane
serve as a reservoir for transmitting the parasite and that was mixed with a guanidium thiocyanate buffer and
expertise in identifying parasites by morphology is isolated by organic (phenol-chloroform) procedures.
declining have made the development of molecular-based cDNA was synthesized using primers specic to the
assays for parasite detection and identication more of a viral RNA polymerase gene. Strain-specic PCR
need than a luxury. primers were used to amplify the viral gene. The
Recently, PCR assays have been developed for the fol- amplicons, resolved by agarose gel electrophoresis,
lowing parasites:146 are shown in the gure below.
Trypanosoma cruzi in patients with chronic Chagas
disease
Trypanosoma brucei subspecies gambiense and
rhodesiense
Plasmodium in blood and speciation
Leishmania and differentiation to the species level
Toxoplasma gondii in suspected congenital and cen-
tral nervous system infections
Entamoeba histolytica
Cryptosporidium in water
RT-PCR products were resolved on
Microsporidial detection in stool and small intestine
separate gels. Amplicons from four affected indivi-
biopsies duals (lanes 14, left). Lane 5, positive control; lane 6,
sensitivity control; lane 7, negative control; lane 8,
The development of multiplex PCR assays to detect
reagent blank. Specimens from suspected food
multiple parasites in stool samples would be extremely sources (lanes 14, right). Lane 5, salad lettuce from
useful. First, multiple parasites can cause diarrhea, and the distributor; lanes 68, specimens from three hotel
morphology is the only way to differentiate between employees working the day of the outbreak; lane 9,
causative agents. Second, patients can have multiple molecular weight marker.
intestinal parasites at the same time, and laboratory detec-
tion of the presence of all parasites is important. Finally, 1. Do these patients have norovirus?
multiple parasites are transmitted in the same water sup- 2. What is the source of the organism?
ply; thus, detection of all parasites and appropriate water 3. When did the source get contaminated? Did the
treatment will reduce large-scale outbreaks of waterborne source come into the hotel infected, or was it
parasites. infected inside the hotel?


Five students from different local community high A 39-year-old HIV-positive male has been moni-
schools suffered recurrent skin infections with tored closely since he was diagnosed as HIV-posi-
chronic wounds. Nasal swabs and skin specimens tive 5 years ago. The man was on HAART and
from the students were screened for MRSA by inoc- compliant. He was relatively healthy and had not
ulation onto Mueller-Hinton agar supplemented even had a cold in the last 4 years. The man had HIV
with NaCl (0.68 mol/L) containing 6 g/mL of viral loads as determined by Amplicor RT-PCR,
oxacillin. The cultured organisms exhibited an MIC which were always around 10,000 copies/mL, never
of more than 32 g/mL vancomycin and a zone of varying more than 0.2 log10 unit, until the last 6
inhibition of less than 14 mm in diameter. Isolates months, when his viral loads were trending up to
were sent to the CDC and referred for molecular 25,500, then 48,900, with his most recent result
testing. DNA isolated from the ve cases and a con- being 55,000 copies/mL. Genotyping performed on
trol strain were embedded in agarose plugs and virus isolated from the patient revealed a mutation
digested with SmaI for PFGE analysis. A depiction in the reverse transcriptase gene of M41L that is
of the gel pattern is shown in the gure below. associated with resistance to zidovudine (AZT).
1. What is the signicance of the viral load results
M 1 2 3 4 5 6 7 M
over the last 6 months?
2. What is the implication of the genotyping result
for the patients therapy?
3. How should this patient be monitored in the
future?
STUDY QUESTIONS
1. Which of the following genes would be analyzed to

PFGE patterns of isolated strains. M, molecular weight
markers. Lanes 15, isolates from the community infections;
determine whether an isolate of Staphylococcus
Lanes 6 and 7, unrelated hospital isolates. aureus is resistant to oxacillin?
a. mecA
Further PCR testing was performed on the iso- b. gyrA
lates for virulence factors, particularly for mecA c. inhA
gene sequencing and detection of the Panton- d. vanA
Valentine leukocidin (PVL) genes, lukS-PV and
lukF-PV. The results from these tests revealed that 2. Which of the following methods is a genotypic
all ve isolates contained the PVL genes and the method used to compare two isolates in an epidemio-
type IV mecA element. logical investigation?
1. Are all or some of the ve isolates the same or a. Biotyping
different? Which isolates are the same, and b. Serotyping
which are different? What is the evidence to sup- c. Ribotyping
port your answer? d. Bacteriophage typing
2. Was there a single source for these organisms or
multiple sources? 3. For which of the following organisms does caution
need to be exercised when evaluating positive PCR

results because the organism can be found as normal 8. A patient has antibodies against HCV and a viral load
ora in some patient populations? of 100,000 copies/mL. What is the next test that
a. Neisseria gonorrhoeae should be performed on this patients isolate?
b. HIV a. Riboyping
c. Chlamydophila pneumoniae b. PCR-RFLP
d. Streptococcus pneumoniae c. Hybrid capture
d. Inno-LiPA HCV genotyping
4. Which of the following controls are critical for ensur-
ing that amplication is occurring in a patient sample References
and that the lack of PCR product is not due to the pres- 1. Brisson-Noel A, Gicquel B, Lecossier D, et al.
ence of inhibitors? Rapid diagnosis of tuberculosis by amplication
a. Reagent blank of mycobacterial DNA in clinical samples. Lancet
b. Sensitivity control 1989;2:1069-1071.
c. Negative control 2. De Wit D, Steyn L, Shoemaker S, et al. Direct
d. Amplication control detection of Mycobacterium tuberculosis in
clinical specimens by DNA amplication.
5. A PCR assay performed to detect Bordetella pertussis Journal of Clinical Microbiology 1990;28:
on sputum obtained from a 14-year-old girl who has 2437-441.
had a chronic cough had two bands, one consistent 3. Eisenach KD, Cave MD, Bates JH, et al.
with the internal control and the other consistent with Polymerase chain reaction amplication of a
the size expected for amplication of the B. pertussis repetitive DNA sequence specic for Mycobac-
target. How should these results be interpreted? terium tuberculosis. Journal of Infectious Disease
a. False positive for B. pertussis 1990;161:977-81.
b. The girl has clinically signicant B. pertussis 4. Bracca A, Tosello ME, Girardini JE, et al. Molecu-
infection lar detection of Histoplasma capsulatum var. capsu-
c. B. pertussis detection is more likely due to colo- latum in human clinical samples. Journal of
nization Clinical Microbiology 2003;41:1753-55.
d. Invalid because two bands were present 5. Martagon-Villamil J, Shrestha N, Sholtis M, et al.
Identication of Histoplasma capsulatum from cul-
6. Which of the following is a disadvantage of ture extracts by real-time PCR. Journal of Clinical
molecular-based testing? Microbiology 2003;41:1295-98.
a. Results stay positive longer after treatment than 6. Bialek R, Gonzalez GM, Begerow D, et al.
do cultures Coccidioidomycosis and blastomycosis: Advances
b. Results are available within hours in molecular diagnostics. FEMS Immunology &
c. Only viable cells yield positive results Medical Microbiology 2005;45:355-60.
d. Several milliliters of specimen must be submitted 7. Johnson SM, Simmons KA, Pappagianis D. Ampli-
for analysis cation of coccidioidal DNA in clinical specimens
by PCR. Journal of Clinical Microbiology 2004;42:
7. A molecular-based typing method that has high typing 1982-85.
capacity, reproducibility and discriminatory power, 8. Fiebelkorn KR, Nolte FS. RNA Virus Detection.
moderate ease of performance, and good to moderate In Persing DH, Tenover FC, Versalovic J, et al,
ease of interpretation is: eds. Molecular Microbiology. Diagnostic Princi-
a. Repetitive elements ples and Practice. Washington, DC: ASM Press,
b. PFGE 2004.
c. Plasmid analysis 9. Hall, GS. Molecular diagnostic methods for the
d. PCR-RFLP detection of Neisseria gonorrhoeae and Chlamydia

trachomatis. Reviews in Medical Microbiology 20. Association for Molecular Pathology statement.
2005;16:69-78. Recommendations for in-house development
10. Geha DJ, Uhl JR, Gustaferro CA, et al. Multiplex and operation of molecular diagnostic tests.
PCR for identication of methicillin-resistant American Journal of Clinical Pathology. 1999;
staphylococci in the clinical laboratory. Journal 111:449-63.
of Clinical Microbiology 1994;32:1768-72. 21. Espy M, Uhl JR, Sloan LM, et al. Real-time PCR
11. Satake S, Clark N, Rimland D, et al. Detection of in clinical microbiology: Applications for routine
vancomycin-resistant enterococci in fecal samples laboratory testing. Clinical Microbiology Reviews
by PCR. Journal of Clinical Microbiology 1997; 2006;19:165-256.
35:2325-30. 22. Kolbert, CP, Rys, PN, Hopkins M, et al. 16S
12. Hunt JM, Roberts GD, Stockman L, et al. Detection ribosomal DNA sequence analysis for identica-
of a genetic locus encoding resistance to rifampin tion of bacteria in a clinical microbiology labora-
in mycobacterial cultures and in clinical specimens. tory. In Persing DH, Tenover FC, Versalovic J,
Diagnostic Microbiology and Infectious Disease et al, eds. Molecular Microbiology. Diagnostic
1994;18:219-27. Principles and Practice. Washington, DC:ASM
13. Cockerill III FR, Uhl JR, Temesgen Z, et al. Press, 2004.
Rapid identication of a point mutation of the 23. Clarridge JE. Impact of 16S rRNA Gene Sequence
Mycobacterium tuberculosis catase-peroxidase Analysis for Identication of Bacteria on Clinical
(katG) gene associated with isoniazid resist- Microbiology and Infectious Diseases. Clinical
ance. Journal of Infectious Disease 1995;171: Microbiology Reviews. 2004;17:840-62.
240-45. 24. Ieven M, Loens K, Goossens H. Detection and
14. Relman DA, Schmidt TM, MacDermott RP, et al. characterization of bacterial pathogens by nucleic
Identication of the uncultured bacillus of acid amplication: State of the art review. In
Whipples disease. New England Journal of Persing DH, Tenover FC, Versalovic J, et al, eds.
Medicine 1992;327:293-301. Molecular Microbiology. Diagnostic Principles and
15. Sefers S, Pei Z, Tang Y-W. False positives and false Practice. Washington, DC:ASM Press, 2004.
negatives encountered in diagnostic molecular 25. Winn WC, Allen S, Janda W, et al. Konemans
microbiology. Reviews in Medical Microbiology Color Atlas and Textbook of Diagnostic Micro-
2005;16:59-67. biology, 6th ed. Baltimore: Lippincott Williams
16. Nolte FS, Caliendo AM. Molecular Detection and & Wilkins, 2006.
Identication of Microorganisms. In Murray PR, 26. Cole ST, Brosch R, Parkhill J, et al. Deciphering
Baron EJ, Jorgensen JH, et al. Manual of Clinical the biology of Mycobacterium tuberculosis from
Microbiology, 8th ed. Washington, DC: ASM the complete genome sequence. Nature 1998;393:
Press, 2003. 537-44.
17. Becker S, Franco JR, Simarro PP, et al. Real-time 27. Brosch R, Gordon SV, Eiglmeier K, et al. Geno-
PCR for detection of Trypanosoma brucei in human mics, biology, and evolution of the Mycobacterium
blood samples. Diagnostic Microbiology and Infec- tuberculosis complex. In Hatfull GF, Jacobs WR,
tious Disease 2004;50(3):193-99 . eds. Molecular Genetics of Mycobacteria.
18. Loens K, Ursi D, Goossens H, et al. Molecular Washington, DC: ASM Press, 2000.
diagnosis of Mycoplasma pneumoniae respiratory 28. Lipsky BA, Gates J, Tenover FC, et al. Factors
tract infections. Journal of Clinical Microbiology affecting the clinical value of microscopy for acid-
2003;41:4915-23. fast bacilli. Reviews of Infectious Diseases 1984;6:
19. National Committee for Clinical Laboratory Stan- 214-22.
dards. Molecular diagnostic methods for infectious 29. European Society of Mycobacteriology. Decon-
diseases; Approved guideline. (MM3-A). Wayne, tamination, microscopy, and isolation. In Yates MD,
PA: NCCLS, 1995. Groothuis DG, eds. Diagnostic Public Health

Mycobacteriology. London: Bureau of Hygiene 38. Chan EL, Antonishyn N, McDonald R, et al. The
and Tropical Disease, 1991. use of TaqMan PCR assay for detection of
30. Jost KCJ, Dunbar DF, Barth SS, et al. Identication Bordetella pertussis infection from clinical speci-
of Mycobacterium tuberculosis and M. avium com- mens. Archives of Pathology and Laboratory
plex directly from smear-positive sputum specimens Medicine 2002;126:173-76.
and BACTEC 12B cultures by high-performance 39. Yih W, Silva E, Ida J, et al. Bordetella holmesii
liquid chromatography with uorescence detection like organisms isolated from Massachusetts patients
and computer-driven pattern recognition models. with pertussis-like symptoms. Emerging Infectious
Journal of Clinical Microbiology 1995;35:907-14. Diseases 1999;5:441-43.
31. Chapin-Robertson K, Dahlberg S, Waycott S, et al. 40. Templeton KE, Scheltinga SA, van der Zee A, et al.
Detection and identication of Mycobacterium Evaluation of real-time PCR for detection of and
directly from BACTEC bottles by using a DNA- discrimination between Bordetella pertussis,
rRNA probe. Diagnostic Microbiology & Infectious Bordetella parapertussis, and Bordetella holmesii
Disease 1993;17:203-207. for clinical diagnosis. Journal of Clinical
32. Gamboa F, Fernandez G, Padilla E, et al. Compara- Microbiology 2003;41:4121-26.
tive evaluation of initial and new versions of the 41. Grayston JT. Background and current knowledge of
Gen-Probe Amplied Mycobacterium tuberculosis Chlamydia pneumoniae and atherosclerosis.
direct test for direct detection of Mycobacterium Journal of Infectious Disease 2000;181:S402-S410.
tuberculosis in respiratory and nonrespiratory speci- 42. Everett KD, Bush RM, Anderson AA. Amended
mens. Journal of Clinical Microbiology 1998;36: description of the order Chlamydiales, proposal of
684-89. Parachlamydiaceae fam. nov. and Simkaniaceae
33. DAmato RF, Wallman AA, Hochstein LH, et al. fam. nov., each containing one monotypic genus,
Rapid diagnosis of pulmonary tuberculosis by using revised taxonomy of the family Chlamydiaceae,
Roche AMPLICOR Mycobacterium tuberculosis including a new genus and ve new species and
PCR test. Journal of Clinical Microbiology 1995; standards for the identication of organisms.
33:1832-34. International Journal of Systematic Bacteriology
34. Piersimoni C, Callegaro C, Nista D, et al. Compara- 1999;49:415-40.
tive evaluation of two commercial amplication 43. Boman J, Gaydos CA, Quinn TC. Molecular
assays for direct detection of Mycobacterium diagnosis of Chlamydia pneumoniae infection.
tuberculosis complex in respiratory specimens. Journal of Clinical Microbiology 1999;37:
Journal of Clinical Microbiology 1997;35: 3791-99.
193-96. 44. Fang GD, Fine M, Orloff J, et al. New and emerg-
35. Kerr JR, Matthews RC. Bordetella pertussis infec- ing etiologies for community-acquired pneumonia
tion: Pathogenesis, diagnosis, management, and the with implications for therapy: A prospective multi-
role of protective immunity. European Journal of center study of 359 cases. Medicine 1990;69:
Clinical Microbiology and Infectious Diseases 307-16.
2000;19:77-88. 45. Muder RR, Yu VL, Fang GD. Community-acquired
36. Dragsted DM, Dohn B, Madsen J, et al. Compari- legionnaires disease. Seminars in Respiratory
son of culture and PCR for detection of Bordetella Infections 1989;4:32-39.
pertussis and Bordetella parapertussis under rou- 46. Stout JE, Rihs JD, Yu VL. Legionella. In Murray
tine laboratory conditions. Journal of Medical PR, Baron EJ, Jorgensen JH, et al. Manual of
Microbiology 2004;53:749-54. Clinical Microbiology, 8th ed. Washington, DC:
37. Fry NK, Tzivra O, Li YT, et al. Laboratory diagno- ASM Press, 2003.
sis of pertussis infections: the role of PCR and 47. Rantakokko-Jalava K, Jalava J. Development of
serology. Journal of Medical Microbiology 2004; conventional and real-time PCR assays for detec-
53:519-25. tion of Legionella DNA in respiratory specimens.

Journal of Clinical Microbiology 2001;39:2904- 56. Messmer TO, Sampson JS, Stinson A, et al. Com-
2910. parison of four polymerase chain reaction assays
48. Reischl U, Linde H-J, Lehn N, et al. Direct detec- for specicity in the identication of Streptococcus
tion and differentiation of Legionella spp. and pneumoniae. Diagnostic Microbiology and Infec-
Legionella pneumophila in clinical specimens by tious Disease 2004;49:249-54.
dual-color real-time PCR and melting curve analy- 57. Dagan R, Shriker O, Hazan I, et al. Prospective
sis. Journal of Clinical Microbiology 2002;40: study to determine clinical relevance of detection of
3814-17. pneumococcal DNA in sera of children by PCR.
49. de Barbeyrac B, Berner-Poggi C, Febrer F, et al. Journal of Clinical Microbiology 1998;36:669-73.
Detection of Mycoplasma pneumoniae and 58. Lorente MLL, Falguera M, Nogues A, et al.
Mycoplasma genitalium in clinical samples by Diagnosis of pneumococcal pneumonia by poly-
polymerase chain reaction. Clinical Infectious merase chain reaction (PCR) in whole blood: A
Disease 1993;17:83-89. prospective clinical study. Thorax 2000;55:133-37.
50. Falguera M, Nogues A, Ruiz-Gonzalez A, et al. 59. Murdoch DR, Anderson TP, Beynon KA, et al.
Detection of Mycoplasma pneumoniae by poly- Evaluation of a PCR assay for detection of
merase chain reaction in lung aspirates from Streptococcus pneumoniae in respiratory and non-
patients with community-acquired pneumonia. respiratory samples from adults with community-
Chest 1996;110:972-76. acquired pneumonia. Journal of Clinical
51. Ieven M, Usrsi D, Van Bever H, et al. Detection of Microbiology 2003;41:63-66.
Mycoplasma pneumoniae by two polymerase chain 60. Totten PA, Manhart LE, Centurion-Lara A. PCR
reactions and role of M. pneumoniae in acute respi- detection of Haemophilus ducreyi, Treponema
ratory tract infections in pediatric patients. Journal pallidum, and Mycoplasma genitalium. In Persing
of Infectious Disease 1996;173:1445-52. DH, Tenover FC, Versalovic J, et al, eds. Molecular
52. Kai MS, Kamiya H, Yabe H, et al. Rapid detection Microbiology. Diagnostic Principles and Practice.
of Mycoplasma pneumoniae in clinical samples by Washington, DC: ASM Press, 2004.
the polymerase chain reaction. Journal of Medical 61. Dragovic B, Greaves K, Vashisht A, et al.
Microbiology 1993;38:166-70. Chlamydial co-infections among patients with gon-
53. Grondahl B, Puppe W, Hoppe A, et al. Rapid identi- orrhea. International Journal of STD and AIDS
cation of nine microorganisms causing acute res- 2002;13:261-63.
piratory tract infections by single-tube multiplex 62. Janda WM, Knapp JS. Neisseria and Moraxella
reverse transcription-PCR: Feasibility study. catarrhalis. In Murray PR, Baron EJ, Jorgensen JH,
Journal of Clinical Microbiology 1999;37:1-7. et al. Manual of Clinical Microbiology, 8th ed.
54. Khanna M, Fan J, Pehler-Harrington K, et al. The Washington, DC: ASM Press, 2003.
pneumoplex assays, a multiplex PCR-enzyme 63. Norris SJ, Pope V, Johnson RE, et al. Treponema
hybridization assay that allows simultaneous detec- and other human host-associated spirochetes. In
tion of ve organisms, Mycoplasma pneumoniae, Murray PR, Baron EJ, Jorgensen JH, et al. Manual
Chlamydia (Chlamydophila) pneumoniae, of Clinical Microbiology, 8th ed. Washington, DC:
Legionella pneumophila, Legionella micdadei, and ASM Press, 2003.
Bordetella pertussis, and its real-time counterpart. 64. Liu H, Rodes B, Chen C-Y, et al. New Tests for
Journal of Clinical Microbiology 2005;43:565-71. syphilis: Rational design of a PCR method for
55. McDonough EA, Barrozo CP, Russell KL, et al. A detection of Treponema pallidum in clinical speci-
multiplex PCR for detection of Mycoplasma pneu- mens using unique regions of the DNA polymerase
moniae, Chlamydophila pneumoniae, Legionella I gene. Journal of Clinical Microbiology 2001;
pneumophila, and Bordetella pertussis in clinical 39:1941-46.
specimens. Molecular and Cellular Probes 2005; 65. Palmer HM, Higgins SP, Herring AJ, et al. Use of
19:314-22. PCR in the diagnosis of early syphilis in the United

Kingdom. Sexually Transmitted Diseases 2003;79: of Staphylococcus aureus. Science 2003;302:

479-83. 1569-71
66. Chui L, Albritton W, Paster B, et al. Development 78. Tenover FC, Rasheed JK. Detection of antimicro-
of polymerase chain reaction for diagnosis of chan- bial resistance genes and mutations associated with
croid. Journal of Clinical Microbiology 1993;31: antimicrobial resistance in microorganisms. In
659-64. Persing DH, Tenover FC, Versalovic J, et al, eds.
67. Gu XX, Rossau R, Jannes G, et al. The rrs (16S)-rrl Molecular Microbiology. Diagnostic Principles and
(23S) ribosomal intergenic spacer region as a target Practice. Washington, DC: ASM Press, 2004.
for the detection of Haemophilus ducreyi by a 79. Metan G, Zarakolu P, Unal S. Rapid detection of
hemi-nested-PCR assay. Microbiology 1998;144: antibacterial resistance in emerging gram-positive
1013-1019. cocci. Journal of Hospital Infection 2005;61:93-99.
68. Fraser CM, Gocayne JD, White O, et al. The mini- 80. Leclercq R, Derlot E, Duval J, et al. Plasmid-
mal gene complement of Mycoplasma genitalium. mediated resistance to vancomycin and teicoplanin
Science 1995;270:397-403. in Enterococcus faecium. New England Journal of
69. Tully JG, Taylor-Robinson D, Cole RM, et al. A Medicine 1988;319:157-61.
newly discovered mycoplasma in the human uro- 81. Centers for Disease Control and Prevention.
genital tract. Lancet 1981;1:1288-91. Staphylococcus aureus resistant to vancomycin-
70. Jensen JS, Hansen HT, Lind K. Isolation of Myco- United States, 2002. Morbidity and Mortality
plasma genitalium strains from the male urethra. Weekly Report 2002;51;565-567.
Journal of Clinical Microbiology 1996;34:286-91. 82. Palladino S, Kay ID, Flexman, JP, et al. Rapid
71. Jensen JS, Uldum SA, Sondergard-Andersen J, et Detection of vanA and vanB genes directly from
al. Polymerase chain reaction for detection of clinical specimens and enrichment broths by real-
Mycoplasma genitalium in clinical samples. Journal time multiplex PCR assay. Journal of Clinical
of Clinical Microbiology 1991;29:46-50. Microbiology 2003;41:2483-86.
72. Palmer HM, Gilroy CB, Furr PM, et al. Develop- 83. Espinal MA, Laszlo A, Simonsen, L, et al. Global
ment and evaluation of the polymerase chain reac- trends in resistance to antituberculosis drugs. New
tion to detect Mycoplasma genitalium. FEMS England Journal of Medicine 2001;344:1294-303.
Microbiology Letters 1991;61:199-203. 84. Meacci F, Orru G, Iona E, et al. Drug resistance
73. Jensen JS, Borre MB, Dohn B. Detection of evolution of a Mycobacterium tuberculosis strain
Mycoplasma genitalium by PCR amplication of from a noncompliant patient. Journal of Clinical
the 16S rDNA gene. Journal of Clinical Microbio- Microbiology 2005;43(7):3114-20.
logy 2003;41:261-66. 85. Grace Lin S-Y, Probert W, Lo M, et al. Rapid detec-
74. Yoshida T, Deguchi T, Ito M, et al. Quantitative tion of isoniazid and rifampin resistance mutations
detection of Mycoplasma genitalium from rst-pass in Mycobacterium tuberculosis complex from cul-
urine of men with urethritis and asymptomatic men tures or smear-positive sputa by use of molecular
by real-time PCR. Journal of Clinical Microbiology beacons. Journal of Clinical Microbiology. 2004;
2002;40:1451-55. 42:4204-08.
75. Deguchi T, Maeda S-I. Mycoplasma genitalium: 86. Mokrousov I, Otten T, Filipenko M, et al. Detection
Another important pathogen of non-gonococcal ure- of isoniazid-resistant Mycobacterium tuberculosis
thritis. Journal of Urology 2002;167:1210-17. strains by a multiplex allele-specic PCR assay tar-
76. Orle KA, Gates CA, Martin DH, et al. geting katG codon 315 variation. Journal of Clini-
Simultaneous PCR detection of Haemophilus cal Microbiology 2002:40:2509-12.
ducreyi, Treponema pallidum and herpes simplex 87. de Viedma DG, del Sol Diaz Infantes M, Lasala F,
virus types 1 and 2 from genital ulcers. Journal of et al. New real-timer PCR able to detect in a single
Clinical Microbiology 1996;34:49-54. tube multiple rifampin resistance mutations in
77. Weigel L, Clewell DB, Gill SR, et al. Genetic ana- Mycobacterium tuberculosis. Journal of Clinical
lysis of a high-level vancomycin-resistant isolate Microbiology 2002:40:988-95.

88. Cavusoglu C, Turhan A, Akinci P, et al. Evaluation mophila serogroup 3. Journal of Clinical Micro-
of the genotype MTBDR assay for rapid detection biology 1990;28:242-45.
of rifampin and isoniazid resistance in Mycobac- 98. Riley LW. Molecular Epidemiology of Infectious
terium tuberculosis isolates. Journal of Clinical Diseases. Principles and Practices. Washington,
Microbiology 2006;44:2338-42. DC:ASM Press, 2004.
89. Bang D, Andersen AB, Thomsen VO. Rapid geno- 99. Van Embden JDA, Cave MD, Crawford JT, et al.
typic detection of rifampin- and isoniazid-resistant Strain identication of Mycobacterium tuberculo-
Mycobacterium tuberculosis directly in clinical sis by DNA ngerprinting: Recommendations for
specimens. Journal of Clinical Microbiology 2006; a standardized methodology. Journal of Clinical
44:2605-08. Microbiology 1993;31:406-409.
90. Ruiz, M, Torres MJ, Llanos AC, et al. Direct detec- 100. Lima P, Correia AM. Genetic ngerprinting of
tion of rifampin- and isoniazid-resistant Mycobac- Brevibacterium linens by pulsed-eld gel elec-
terium tuberculosis in auramine-rhodaminepositive trophoresis and ribotyping. Current Microbiology
sputum specimens by real-time PCR. Journal of 2000;41:50-55.
Clinical Microbiology 2004;42:1585-89. 101. Pignato S, Giammanco G, Grimont F, et al.
91. Olive DM, Bean P. Principles and applications of Molecular typing of Salmonella enterica subsp.
methods for DNA-based typing of microbial organ- enterica serovar Wien by rRNA gene restriction
isms. Journal of Clinical Microbiology 1999;37: patterns. Research in Microbiology 1992;143:
1661-69. 703-709.
92. Tenover FC. Bacterial strain typing through the 102. Al Dahouk S, Tomaso H, Prenger-Berninghoff E,
decades: A personal reection. In Persing DH, et al. Identication of Brucella species and bio-
Tenover FC, Versalovic J, et al, eds. Molecular types using polymerase chain reaction-restriction
Microbiology. Diagnostic Principles and Practice. fragment length polymorphism (PCR-RFLP).
Washington, DC: ASM Press, 2004. Critical Reviews in Microbiology 2005;31:
93. Tenover FC, Arbeit RD, Goering RV. How to select 191-96.
and interpret molecular strain typing methods for 103. Stone G, Shortridge D, Flamm RK, et al. PCR-
epidemiological studies of bacterial infections: A RFLP typing of ureC from Helicobacter pylori
review for healthcare epidemiologists. Infection isolated from gastric biopsies during a European
Control and Hospital Epidemiology 1997;18: multi-country clinical trial. Journal of Antimicro-
426-39. bial Chemotherapy 1997;40:251-56.
94. Schaberg DR, Tompkins LS, Falkow S. Use of 104. Lowe A, Hanotte O, Guarino L. Standardization of
agarose gel electrophoresis of plasmid deoxyri- molecular genetic techniques for the characteriza-
bonucleic acid to ngerprint gram-negative tion of germ plasm collections: The case of ran-
bacilli. Journal of Clinical Microbiology 1981; dom amplied polymorphic DNA (RAPD). Plant
13:1105-10. Genetic Resources Newsletter 1996;107:50-54.
95. Tenover F, Arbeit RD, Goering RV, et al. Interpret- 105. Munthali M, Ford-Lloyd B-V, Newbury HJ. The
ing chromosomal DNA restriction patterns pro- random amplication of polymorphic DNA for
duced by pulsed-eld gel electrophoresis: Criteria ngerprinting plants. PCR Methods and Applica-
for bacterial strain typing. Journal of Clinical tions 1992;1:274-76.
Microbiology 1995;33:2233-39. 106. Dijkshoorn L, Aucken H, Gerner-Smidt P, et
96. Loutit J, Tompkins S. Restriction enzyme and al. Comparison of outbreak and nonoutbreak
Southern hybridization analyses of Pseudomonas Acinetobacter baumannii strains by genotypic and
aeruginosa strains from patients with cystic bro- phenotypic methods. Journal of Clinical Micro-
sis. Journal of Clinical Microbiology 1991;29: biology 1996;34:1519-25.
2897-2900. 107. Gibson R, Slater E, Xerry J, et al. Use of an
97. Tram C, Simonet M, Nicolas MH, et al. Molecular ampliedfragment length polymorphism tech-
typing of nosocomial isolates of Legionella pneu- nique to ngerprint and differentiate isolates of

Helicobacter pylori. Journal of Clinical Micro- gatus, Aspergillus avus and Aspergillus niger.
biology 1998;36:2580-85. Medical Mycology 2004;42:433-37.
108. Kremer K, Arnold C, Cataldi A, et al. Discrimina- 119. Shopsin B, Gomez M, Montgomery SO, et al.
tory power and reproducibility of novel DNA typ- Evaluation of protein A gene polymorphic region
ing methods for Mycobacterium tuberculosis DNA sequencing for typing of Staphylococcus
complex strains. Journal of Clinical Microbiology aureus strains. Journal of Clinical Microbiology
2005;43:5628-38. 1999;37:3556-63.
109. Hulton C, Higgins CF , Sharp PM. ERIC se- 120. Shopsin B, Gomez M, Waddington M, et al. Use
quences: A novel family of repetitive elements in of coagulase gene (coa) repeat region nucleotide
the genomes of Escherichia coli, Salmonella sequences for typing of methicillin-resistant
typhimurium and other enterobacteria. Molecular Staphylococcus aureus strains. Journal of Clinical
Microbiology 1991;5:825-34. Microbiology 2000;38:3453-56.
110. Versalovic J, Koeuth T, Lupski JR. Distribution of 121. Birtles A, Hardy K , Gray SJ, et al. Multilocus
repetitive DNA sequences in eubacteria and appli- sequence typing of Neisseria meningitidis directly
cation to ngerprinting of bacterial genomes. from clinical samples and application of the
Nucleic Acids Research 1991;19:6823-31. method to the investigation of meningococcal dis-
111. Healy M, Reece K, Walton D, et al. Identication ease case clusters. Journal of Clinical Micro-
to the species level and differentiation between biology 2005;43:6007-6014.
strains of Aspergillus clinical isolates by auto- 122. Rakeman J, Bui U, Lafe K, et al. Multilocus DNA
mated repetitive sequencebased PCR. Journal of sequence comparisons rapidly identify pathogenic
Clinical Microbiology 2004;42:4016-24. molds. Journal of Clinical Microbiology 2005;43:
112. Spigaglia P, Mastrantonio P. Evaluation of repeti- 3324-33.
tive element sequencebased PCR as a molecular 123. Maiden M, Bygraves JA, Feil E, et al. Multilocus
typing method for Clostridium difficile. Journal of sequence typing: A portable approach to the identi-
Clinical Microbiology 2003;41:2454-57. cation of clones within populations of pathogenic
113. Hierro N, Gonzlez A, Mas A, et al. New PCR- microorganisms. Proceedings of the National
based methods for yeast identication. Journal of Academy of Sciences 1998;95:3140-45.
Applied Microbiology 2004;97:792-801. 124. Urwin R, Maiden MC. Multilocus sequence typ-
114. Bruns T, White TJ, Taylor JW. Fungal molecular ing: A tool for global epidemiology. Trends in
systematics. Annual Review of Ecology 1991;22: Microbiology 2003;11:479-87.
525-64. 125. Scheuermann RH, Domiati-Saad R, Rogers BB.
115. Hillis D, Dixon M. Ribosomal DNA: Molecular DNA virus detection. In: Persing DH, Tenover FC,
evolution and phylogenetic inference. Quarterly Versalovic J, Wang Y-W, Unger ER, Relman DA,
Review of Biology 1991;66:411-53. and White TJ, eds. Molecular Microbiology.
116. Kumar M, Shukla PK. Use of PCR targeting of Diagnostic Principles and Practice. ASM Press,
internal transcribed spacer regions and single- Washington DC, 2004.
stranded conformation polymorphism analysis of 126. Klein RS and El Khoury J. Emerging Viral Patho-
sequence variation in different regions of rRNA gens. In: Persing DH, Tenover FC, Versalovic J,
genes in fungi for rapid diagnosis of mycotic ker- Wang Y-W, Unger ER, Relman DA, and White TJ,
atitis. Journal of Clinical Microbiology 2005;43: eds. Molecular Microbiology. Diagnostic Princi-
662-68. ples and Practice. ASM Press, Washington DC,
117. Lebuhn M, Bathe S, Achouak W, et al. Compara- 2004.
tive sequence analysis of the internal transcribed 127. Hill CE and Caliendo AM. Viral Load Testing. In
spacer 1 of Ochrobactrum species. Systematic and Persing DH, Tenover FC, Versalovic J, et al, eds.
Applied Microbiology 2005;29:265-75. Molecular Microbiology. Diagnostic Principles
118. Sugita C, Makimura K, Uchida K, et al. PCR and Practice. Washington, DC: ASM Press, 2004.
identication system for the genus Aspergillus and 128. Schupbach J. Human Immunodeciency Viruses.
three major pathogenic species: Aspergillus fumi- In: Murray PR, Baron EJ, Jorgensen JH, Pfaller

MA, Yolken RH. Manual of Clinical Microbio- 137. Staprans SI, Hamilton BL, Follansbee SE, et al.
logy, 8th ed. ASM Press, Washington DC, 2003. Activation of virus replication after vaccination
129. Lathey, JL, Hughes MD, Fiscus SA, Pi T, Jackson of HIV-1-infected individuals. Journal of Experi-
JB, Rasheed S, Elbeik T, Reichman R, Japour A, mental Medicine 1995;182:1727-37.
DAquila RT, Scott W, Griffith BP, Hammer SM, 138. Hanna GJ, DAquila RT. Clinical use of genotypic
Katzenstein DA, and the AIDS Clinical Trials and phenotypic drug resistance testing to monitor
Group Protocol 175 Team. Variability and prog- anti-retroviral chemotherapy. Clinical Infectious
nostic values of virologic and CD4 cell measures Disease. 2001;32:774-82.
in human immunodeciency virus type 1-infectd 139. Hirsch MS, Conway B, DAquila RT, et al. Antire-
patients with 200-500 CD4 cells/mm3 (ACTG troviral drug resistance testing in adults with HIV-
175). Journal of Infectious Disease 1998;177: 1 infection. Journal of the American Medical
617-24. Association 2001;283:2417-26.
130. Nolte FS, Boysza J, Thurmond C, et al. Clinical 140. Caliendo AM, Yen-Lieberman B. Viral genotyping.
comparison of an enhanced-sensitivity branched- In Persing DH, Tenover FC, Versalovic J, et al,
DNA assay and reverse transcription-PCR for eds. Molecular Microbiology. Diagnostic Princi-
quantitation of human immunodeciency virus ples and Practice. Washington, DC: ASM Press,
type 1 RNA in plasma. Journal of Clinical 2004.
Microbiology 1998;36:716-20. 141. Shuhart MC, Gretch DR. Hepatitis C and G
131. Dyer JR, Pilcher CD, Shepard R, et al. Compari- viruses. In Murray PR, Baron EJ, Jorgensen JH,
son of NucliSens and Roche Monitor assays for et al. Manual of Clinical Microbiology, 8th ed.
quantitation of levels of human immunodeciency Washington, DC: ASM Press, 2003.
virus type 1 in plasma. Journal of Clinical Micro- 142. Lee SS, Heathcote EJ, Reddy KR, et al.
biology 1999;37:447-49. Prognostic factors and early predictability of sus-
132. Elbeik T, Charlebois E, Nassos P, et al. Quantita- tained viral response with peginterferon alfa-2a
tive and cost comparison of ultrasensitive human (40KD). Journal of Hepatology 2002;37:500-506.
immunodeciency virus type 1 RNA viral load 143. Templeton KE, Scheltinga SA, Beersma MFet al.
assays: Bayer bDNA quantiplex versions 3.0 Rapid and sensitive method using multiplex real-
and 2.0 and Roche PCR Amplicor Monitor time PCR for diagnosis of infections by inuenza
version 1.5. Journal of Clinical Microbiology a and inuenza b viruses, respiratory Syncytial
2000;38:1113-20. virus, and Parainuenza viruses 1, 2, 3, and 4.
133. Raboud J, Montaner JS, Conway B, et al. Suppres- Journal of Clinical Microbiology 2004;42:
sion of plasma viral load below 20 copies/ml is 1564-69.
required to achieve a long-term response to ther- 144. Hindiyeh M, Hillyard DR, Carroll KC. Evaluation
apy. AIDS 1998;12:1619-24. of the Prodesse Hexaplex multiplex PCR assay for
134. Saag MS, Holodniy M, Kuritzkes DR, et al. HIV direct detection of seven respiratory viruses.
viral load markers in clinical practice. Nature American Journal of Clinical Pathology 2001;116:
Medicine 1996;2:625-29. 218-24.
135. Donovan RM, Bush CE, Markowitz NP, et al. 145. Van Burik JA, Myerson D, Schreckhise RW, et al.
Changes in virus load markers during AIDS- Panfungal PCR for detection of fungal infection
associated opportunistic diseases in human in human blood specimens. Journal of Clinical
immunodeciency virusinfected persons. Microbiology 1998;36:1169-75.
Journal of Infectious Disease 1996;174:401-403. 146. Petri Jr WA. Overview of the development, utility,
136. OBrien WA, Grovit-Ferbas K, Namazi A, et al. and future of molecular diagnostics for parasitic
Human immunodeciency virustype 1 replication disease. In Persing DH, Tenover FC, Versalovic J,
can be increased in peripheral blood of seroposi- et al, eds. Molecular Microbiology. Diagnostic
tive patients after inuenza vaccination. Blood Principles and Practice. Washington, DC: ASM
1995;86:1082-89. Press, 2004.
Molecular Detection
of Inherited Diseases
OUTLINE OBJECTIVES
THE MOLECULAR BASIS OF INHERITED Describe mendelian patterns of inheritance as exhibited
DISEASES by family pedigrees.
CHROMOSOMAL ABNORMALITIES
Give examples of laboratory methods designed to detect
PATTERNS OF INHERITANCE IN SINGLE-
single-gene disorders.
GENE DISORDERS
MOLECULAR BASIS OF SINGLE- Discuss nonmendelian inheritance, and give examples
GENE DISORDERS of these types of inheritance, such as mitochondrial
Lysosomal Storage Diseases disorders and trinucleotide repeat expansion diseases.
MOLECULAR DIAGNOSIS OF SINGLE- Show how genomic imprinting can affect disease
GENE DISORDERS phenotype.
Factor V Leiden
Hemochromatosis
Cystic Fibrosis
Cytochrome P-450
SINGLE-GENE DISORDERS WITH
NONCLASSICAL PATTERNS
OF INHERITANCE
Mutations in Mitochondrial Genes
Trinucleotide Repeat Expansion
Disorders
Genomic Imprinting
Multifactorial Inheritance
LIMITATIONS TO MOLECULAR TESTING
310

Molecular Detection of Inherited Diseases Chapter 13 311
Molecular and cytogenetic analyses are a critical compo-

nent of diagnostic testing, especially for diseases that
arise from known genetic events. The identication of a
Advanced Concepts
molecular or chromosomal abnormality is a direct obser- According to the Lyon hypothesis (or Lyons
vation of the source of some diseases. Methods to detect hypothesis) rst stated by Mary Lyon in 1961, only
gene and chromosomal mutations are discussed in one X chromosome remains genetically active in
Chapters 8 and 9. This chapter will present examples of females.33,34 In humans, one X chromosome is inac-
clinical laboratory tests commonly performed in molecu- tivated at random about the 16th day of embryonic
lar genetics using these techniques. development. The inactive X can be seen as a Barr
body (X chromatin) in the interphase nucleus. Not
all X genes are shut off in the inactivated X chro-
The Molecular Basis mosome. Furthermore, reactivation of genes on the
of Inherited Diseases inactivated X occurs in germ cells before the rst
meiotic division for production of eggs.
Mutations are heritable changes in DNA nucleotide
sequences. These changes range from single base pair or
point mutations of various types to chromosomal aneu-
ploidy (see Chapter 8). Not all mutations lead to disease.
Polymorphisms are proportionately represented geno-
Chromosomal Abnormalities
types in a given population (see Chapter 11). Sequence Genome mutations (abnormalities in chromosome num-
polymorphisms can be located within genes or outside of ber) can be detected by karyotyping, ploidy studies using
genes. Benign polymorphisms are useful for mapping dis- ow cytometry, and uorescent in situ hybridization
ease genes, determining parentage, and identity testing. (FISH) studies (see Chapter 8). Polyploidy (more than
Balanced polymorphisms can have offsetting phenotypes. two of any autosome) in animals usually results in infer-
Epigenetic alterations do not change the primary DNA tility and abnormal appearance. Aneuploidy (gain or loss
sequence. Epigenetic changes consist of three different of any autosome) occurs with 0.5% frequency in term
forms: DNA methylation, usually alterations of cytosine pregnancies and 50% in spontaneous abortions. Aneu-
in CpG islands; genomic imprinting, and chromatin ploidy is usually caused by erroneous separation of chro-
remodeling. DNA methylation shuts down RNA tran- mosomes during egg or sperm production (chromosomal
scription. Genomic imprinting selectively inactivates non-disjunction). Autosomal trisomy/monosomy (three
chromosomal regions, e.g., X chromosome inactivation. copies/one copy of a chromosome instead of two) results
Chromatin remodeling sequesters large regions of chro- from fertilization of gametes containing an extra chromo-
mosomal DNA through protein binding and histone mod- some or missing a chromosome (n 1 or n 1 gametes,
ication. Histone modication controls availability of respectively). Autosomal monosomy is generally, but not
DNA for RNA transcription. always, incompatible with life. Sex chromosome aneu-
Mutations in germ cells result in inherited disease. ploidy is more frequently tolerated, although associated
Mutations in somatic cells result in cancer and some con- with phenotypic abnormalities.
genital malformations. Diseases with genetic components Mosaicism, two or more genetically distinct popula-
are often referred to as congenital (born with) diseases. tions of cells from one zygote in an individual (in contrast
Congenital disorders are not necessarily heritable, how- to chimerism: two or more genetically distinct cell pop-
ever. Congenital disorders are those present in individuals ulations from different zygotes in an individual), results
at birth. Specically, congenital disorders result when from mutation events affecting somatic or germ cells.
some factor, such as a drug, a chemical, an infection, or Early segregation errors during fertilized egg division oc-
an injury, upsets the developmental process. Thus, a baby casionally give rise to mosaicism. Mosaicism is relatively
can have a heritable disease, such as hemophilia, that can common with sex chromosomes, e.g., 45,X/47,XXX
be passed on to future generations or a congenital condi- (normal female chromosome complement is 46, XX). In
tion, such as spina bida, that cannot be passed on. this case, later nondisjunction will yield additional popu-

Table 13.1 Examples of Genome Mutations

Disorder Genetic Abnormality Incidence Clinical Features
Downs syndrome Trisomy 21, 47,XY,21 1/700 live births Flat facial prole, mental retardation,
cardiac problems, risk of acute
leukemia, eventual neuropathological
disorders, abnormal immune system
Edwards syndrome Trisomy 18, 47,XY,18 1/3000 live births Severe, clenched st; survival less than
1 year
Pataus syndrome Trisomy 13, 47,XY,13 1/5000 live births Cleft palate, heart damage, mental
retardation, survival usually less than
6 mo
Klinefelters syndrome 47,XXY 1/850 live births Male hypogonadism, long legs, gyneco-
mastia (male breast enlargement),
low testosterone level
XYY syndrome 47,XYY 1/1000 live births Excessive height, acne, 1%2% behav-
ioral disorders
Turners syndrome 45,X and variants 1/2000 live births Bilateral neck webbing, heart disease,
failure to develop secondary sex
characteristics, hypothyroidism
Multi X females 47,XXX; 48,XXXX 1/1200 newborn females Mental retardation increases with
increasing X
lations. Rarely, autosomal haploids will be lost with the Examples of diseases arising from inherited chromosome
retention of the triploid lineage, e.g., 45,XY,-21, structure abnormalities are shown in Table 13.2
46,XY/47,XY,21 46,XY/47,XY,21. Examples of Chromosome translocations are another type of fre-
genome mutations are shown in Table 13.1 quently observed structural abnormality. Translocations
Chromosome mutations (abnormalities in chromo- are usually somatic events (not inherited) and are most
some structure) larger than 4 million bp can be seen by commonly seen in cancer (see Chapter 14).
karyotyping; smaller irregularities can be seen with the
higher resolution of FISH (see Chapter 8). Structural Patterns of Inheritance
alterations include translocations (reciprocal, nonrecipro-
cal), inversions (paracentric, pericentric), deletions (ter-
in Single-Gene Disorders
minal, interstitial, ring), duplications (isochromosomes), Most phenotypes result from the interaction of multiple
marker chromosomes, and derivative chromosomes. genetic and environmental factors. Some phenotypes,
Structural mutations require breakage and reunion of however, are caused by alteration of a single gene. If the
DNA. Chromosomal breakage is caused by chemicals and phenotype occurs as predicted by mendelian genetics,
radiation. Chromosomal breakage also results from chro- patterns of inheritance can be established. Patterns of
mosome breakage syndromes, e.g., Fanconis anemia, inheritance (transmission patterns) are determined by
Blooms syndrome, and ataxia telangiectasia. Some aber- examination of family histories. A pedigree is a diagram
rations have no immediate phenotypic effect (reciprocal of the inheritance pattern of a phenotype of family mem-
translocations, inversions, some deletions, some inser- bers (Fig 13-1). There are three main transmission pat-
tions). Approximately 7.4% of conceptions have chromo- terns: autosomal-dominant, autosomal-recessive, and
some mutations. Chromosome mutations are observed in X-linked or sex-linked recessive. These patterns refer to
50% of spontaneous abortions and 5% of stillbirths. the disease phenotype.

Table 13.2 Examples of Chromosomal Mutations

Disorder Genetic Abnormality Incidence Clinical Features
DiGeorges syndrome and del(22q) 1/4000 live births CATCH 22 (cardiac abnormality/abnormal
velocardiofacial syndrome facies, T-cell decit, cleft palate, hypercal-
cemia)
Cri du chat syndrome del(5p) 1/20,0001/50,000 Growth deciency, catlike cry in infancy, small
live births head, mental retardation
Contiguous gene syndrome; del(11p) 1/15,000 live births Aniridia (absence of iris), hemihypertrophy (one
Wilms tumor, aniridia, side of the body seems to grow faster than the
genitourinary anomalies, other), and other congenital anomalies
mental retardation syndrome
In autosomal-dominant transmission, a child of an sible for the disease phenotype. Gain of function muta-
affected individual and an unaffected mate has a tions include gene expression/stability defects that gener-
50%100% recurrence risk or likelihood of expressing ate gene products at inappropriate sites or times.
the disease phenotype (Fig. 13-2). The phenotype of a Autosomal-recessive is the largest category of men-
loss of function mutation depends on the type of protein delian disorders. The recurrence risk is 25% if siblings
affected. Even though only one copy of a gene is mu- are affected, indicating the presence of the recessive
tated, the mutated protein can interfere with the function mutation in at least one of the parents. The margin of
of the normal proteins produced from the unmutated safety, that is, having two copies of every gene, requires
chromosome. Complex metabolic pathways are suscepti- the loss of the normal allele through somatic events (loss
ble to loss of function mutations because of extensive of heterozygosity) or homozygosity for manifestation of
interactions between and among proteins. Key structural the disease phenotype. Autosomal-recessive diseases are
proteins, especially multimeric complexes, risk dominant more often observed as a result of inbreeding where two
negative phenotypes (Fig. 13-3). Gain of function muta- individuals heterozygous for the same mutation produce
tions are less common than loss of function mutations. In offspring (Fig. 13-4). New mutations are rarely detected
this case, new properties of the mutant allele are respon- in autosomal-recessive transmission patterns. Almost all
inborn errors of metabolism are autosomal-recessive.1
Risk factors for neoplastic diseases, tumor suppressor
gene mutations (see Chapter 14), fall in this category.
All sex-linked disorders are X-linked because rela-
tively few genes are carried on the Y chromosome. X-
linked mutations are almost always recessive. X-linked
Advanced Concepts
Male Female Autosomal-dominant mutations can originate from
new mutations in germ cells; that is, DNA changes
Deceased male Deceased female
that arise in cells that produce eggs or sperm.
Affected male Affected female Establishment of a new mutation as a dominant
Figure 13-1 A pedigree is a diagram of family phenotype
mutation in a family or in a population is inuenced
or genotype. The pedigree will display the transmission pattern by its effect on reproductive tness.
of a disease.

Figure 13-2 In an autosomal-dominant transmission pat-

tern, heterozygous individuals express the affected phenotype
(lled symbols).
Figure 13-4 Autosomal-recessive mutations are not
expressed in heterozygotes. The phenotype is displayed
only in a homozygous individual; in this illustration, pro-
dominant diseases are rare, e.g., vitamin Dresistant duced by the inbreeding of two cousins (double hor-
rickets. Even though one X chromosome is inactivated in izontal line).
females, the inactivation is reversible so that a second
copy of X-linked genes is available. In contrast, males are
hemizygous for X-linked genes, having only one copy on expressivity is a range of phenotypes in individuals with
the X chromosome. Males, therefore, are more likely to the same gene lesion. Variable expressivity reects the
manifest the disease phenotype (Fig. 13-5). interaction of other gene products and the environment
Penetrance is the frequency of expression of disease on the disease phenotype.
phenotype in individuals with a gene lesion. Complete
penetrance is expression of the disease phenotype in Molecular Basis of
every individual with the mutated gene. Complete pene- Single-Gene Disorders
trance is common in recessive phenotypes. Variable
Single-gene disorders affect structural proteins, cell sur-
face receptor proteins, growth regulators, and enzymes.
Chromosomes Examples of diseases resulting from such disorders are
shown in Table 13.3. Examples of molecular methods that
Monomers Tetramers have been or could be used to detect these gene lesions
are also listed. See Chapters 9 and 10 for more detailed
+ +
explanations of the methodologies. Note that not all of
+ Normal
these methods are in common use in molecular diagnos-
function
+ tics. Some diseases are effectively analyzed by morpho-
+ + logical studies or clinical chemistry. For instance,
hemoglobin S is classically detected by protein elec-
trophoresis. Final diagnosis requires physiological, mor-
phological, and laboratory results.
+ +
+
Abnormal
+

Figure 13-3 Dominant negative mutations affect multi-

meric proteins. In this illustration, a single mutant monomer Figure 13-5 X-linked recessive diseases are carried by
affects the function of the assembled tetramer. females but manifested most often in males.

Table 13.3 Single Gene Disorders and Molecular Methods

Examples of
Type of Protein Type of Disease Example Gene (Location) Type of Mutation Molecular Methods
Structural Hemoglobino- Sickle cell anemia Hemoglobin beta Missense Sequencing, PCR-
pathies (11p15.5) RFLP
Connective tissue Marfans syndrome Fibrillin (15q21.1) Missense Sequencing, linkage
disorders analysis20
Cell membrane Muscular dystrophy Dystrophin, DMD Deletion Southern blot
associated pro- (Xp12.2) RFLP21, multi-
tein dysfunction plex PCR, link-
age analysis
Cell surface Hypercholes- Familial hypercho- Low-density lipopro- Deletions, point Probe
receptor teremia lesteremia tein receptor mutations amplication,22
proteins (19p13.2) sequencing
Nutritional disor- Vitamin Dresistant Vitamin D receptor Point mutations Southern blot RFLP,
ders rickets (12q12-q14) sequencing
Cell growth Fibromas Neurobromatosis Neurobromin Missense, Sequencing, linkage
regulators type 1 (von tumor suppressor frameshift, splice analysis
Recklinghausens (17q11.2) site mutations
disease)
Fibromas Neurobromatosis Merlin tumor sup- Nonsense, Linkage analysis
type 2 (von pressor, NF-2 frameshift, splice
Recklinghausens (22q12) site mutations
disease)
Cancer predispo- Li-Fraumeni syn- p53 tumor suppres- Missense mutations Sequencing, SSCP,
sition drome* sor gene, TP53 DGGE
(17p13)
Enzymes Metabolic dis- Alkaptonuria Homogentisic acid Missense, cDNA sequenc-
eases (ochronosis) oxidase (3q21- frameshift, splice ing,23 SSCP24
q23) site mutations
Phenylketonuria Phenylalanine hy- Splice site, mis- Ligase chain reac-
droxylase, PAH or sense mutations, tion,25,26 direct
PKU1 (12q24.1) deletions sequencing
Immunode- Severe combined Adenosine deami- Point mutations Direct sequencing,
ciencies immunodeciency nase (20q13.11) capillary elec-
trophoresis27
*A signicant proportion of LFS and LFL (Li-Fraumenilike) kindred do not have demonstrable TP53 mutations.
Lysosomal Storage Diseases or outside the cell through phagocytosis or endocytosis

(heterophagy). Lysosomal storage disorders result from
Lysosomes are cellular organelles in which cellular prod- incompletely digested macromolecules due to loss of
ucts of ingestion are degraded by acid hydrolase enzymes enzyme function. Storage disorders include defects in any
(Fig. 13-6). These enzymes work in an acid environment. proteins required for normal lysosomal function, giving
Substrates come from intracellular turnover (autophagy) rise to physical abnormalities. The organs affected depend

Phagocytosis
Food
particles
Phagosome Lysosome
Products of Golgi
digestion apparatus
Undigested
material Autophagy Nucleus
Cellular
material
lysosome
Recycled
material
Figure 13-6 The lysosome is a depository for cell debris. The lysosome contains enzymes that are
active in its acid environment to digest proteins delivered from phagocytosis of foreign bodies, endo-
cytosis, and autophagy of internal cellular components such as mitochondria.
on the location and site of degradation of substrate mate-

rial. Examples of storage diseases are shown in Table Molecular Diagnosis
13.4. These disorders are screened by gene product test- of Single-Gene Disorders
ing; that is, measuring the ability of serum enzymes to
Genetic lesions in single-gene disorders are detected by a
digest test substrates. With the discovery of genes that
variety of hybridization/amplification methods and
code for the enzymes and their subunits, molecular testing
nucleotide sequencing. Examples of some frequently
has been used to some extent. Mutations can be detected
tested genes are given below.
by direct sequencing, usually after an initial biochemical
screening test for loss of enzyme activity.
Factor V Leiden
Discovered in 1994, the Leiden mutation (1691 AG,
Table 13.4 Storage Diseases R506Q) in the coagulation factor V gene F5 (1q23)
Substrate Accumulated Disease
causes a hypercoagulable (thrombophilic) phenotype.
This genotype is present in heterozygous form in 4%7%
Sphingolipids Tay-Sachs disease
of the general population, and 0.06%0.25% of the pop-
Glycogen Von Gierkes, McArdles, and
ulation is homozygous for this mutation. Overall, the
Pompes disease
annual occurrence of deep venous thrombosis is 1 per
Mucopolysac- Hurler, Sheie (MPS I), Hunter
every 1000 persons. The disorder is treated with antico-
charides (MPS II), Sanlipo (MPS III),
agulants. The risk of thrombosis increases with contra-
Morquio (MPS IV), Maroteauz-
ceptive use in women (Table 13.5).
Lamy (MPS VI), Sly (MPS VII)
Several approaches have been taken to test for the
Mucolipids PseudoHurler polydystrophy
Leiden mutation. Polymerase chain reaction (PCR) meth-
Sulfatides Niemann-Pick disease
ods include the use of PCR-RFLP (restriction fragment
Glucocerebrosides Gauchers disease
length polymorphism) or SSP-PCR (PCR with sequence-

Exon 10
Table 13.5 Risk of Thrombosis Relative to
Normal (1) Under the Indicated F5 gene
Genetic (F5, Prothrombin) and
Environmental (OCP) Inuences
Status Risk of Thrombosis
Normal 1
Mutant A
Oral contraceptive (OCP) use 4
Prothrombin mutation, heterozygous 3 Normal G
Prothrombin mutation OCP 16
R506Q heterozygous 57
R506Q heterozygous OCP 3035
R506Q homozygous 80 +/+ +/m m/m
R506Q homozygous OCP 100 148 bp
123 bp
specic primers; Figs. 13-7 and 13-8). Nonamplication Figure 13-8 In sequence-specic PCR, a primer with thymi-
methods, such as Invader technology, have also been dine as its nal 3 base will yield a product only if the adenine
developed to test for this gene mutation. nucleotide is present. The resulting 148 bp PCR product reects
the presence of the mutation. By designing a primer slightly
shorter than but complementary to the normal (G) in the tem-
Exon 10 plate, a distinct, shorter 123-bp normal product is amplied. In
a heterozygous individual, both products will appear.
F5 gene
Prothrombin is the precursor to thrombin in the coagu-

lation cascade and is required for the conversion of b-
Mnl I site MnlI site
rinogen to brin. A mutation in the 3 untranslated region
Normal G of the gene that codes for prothrombin or coagulation fac-
tor II, F2 (11p11-q12), results in an autosomal-dominant
Mnl I site increased risk of thrombosis (see Table 13.5). Labora-
Mnl I site destroyed
tories may test for both F2 and F5 mutations. Both may
Mutant A
be present in the same individual, in which case the risk
of thrombosis is greater than with one of the mutations
alone. An example of a multiplex PCR-RFLP method to
+/+ +/m m/m simultaneously test for both mutations was described pre-
153 bp viously (see Fig. 9-22). In this method, primers that
116 bp amplify prothrombin and factor V are designed to destroy
or produce HindIII restriction sites in the presence of the
67 bp
F5 or F2 mutation, respectively. The sizes of the ampli-
cons and their restriction fragments allow resolution of
37 bp
both simultaneously by agarose gel electrophoresis. The
Figure 13-7 PCR-RFLP for the factor V Leiden mutation. The fragment patterns in each lane reveal the F2 and F5 nor-
R506Q amino acid substitution is caused by a G to A change mal or mutant genotypes for each specimen.2
in exon 10 of the F5 gene. This DNA mutation destroys an Mnl I
restriction enzyme site. An amplicon including the site of the
mutation, when cut with Mnl I, will yield three fragments in Hemachromatosis
normal DNA (/) and two products in homozygous mutant
DNA (m/m). A heterozygous specimen (/m) will yield a Hemachromatosis is an autosomal-recessive condition
combination of the normal and mutant pattern. that causes overabsorption of iron from food. Iron accu-

mulation subsequently causes pancreas, liver, and skin Exon 4

damage, heart disease, and diabetes. Classically, diagno- HFE gene
sis is made through measurement of blood iron levels,
transferrin saturation, or liver biopsy. This condition is
easily treated by phlebotomy.
At the molecular level, hemachromatosis is caused by
Rsa1 site
dysfunction of the hemachromatosis type I gene, HFE or
HLA-H (6p21.3). HFE codes for a membrane-bound pro-
Normal G
tein that binds with 2 microglobulin and transferrin on
the membrane of cells in the small intestine and also on
Rsa1 site Rsa1 site
the placenta. The protein directs iron absorption based on
cellular iron loads. In the absence of HFE function, intes- Mutant A
tinal cells do not sense iron stores, and iron absorption
continues into overload.
The most frequently observed mutation in hemachro- +/+ +/+ m/m +/m +/+ +/+
matosis is C282Y, present in approximately 10% of
240 bp
the white population, with disease frequency of 23 per
1000 people. Other mutations most frequently detected 140 bp
in the HFE protein are H63D and S65C (Fig. 13-9). The
110 bp
C282Y mutation is detectable using PCR-RFLP (Fig.
13-10). Figure 13-10 Detection of the C282Y mutation by PCR-
RFLP. The GA mutation in exon 4 of the HFE gene produces
a site for the restriction enzyme, Rsa1. This region is rst ampli-
ed using primers anking exon 4 of the gene (arrows). In a
H63D and S65C mutations normal specimen, the enzyme will produce two fragments,
Outside of cell
240 bp and 140 bp. If the mutation is present, the 140-bp nor-
1 heavy chain mal fragment is cut to a 110-bp and a 30-bp fragment (the
30-bp fragment is not shown). Heterozygous individuals will
S S 2
have both the 140-bp and the 110-bp fragments.
NH2
NH2 Cystic Fibrosis
2 -microglobulin Cystic brosis (CF) is an autosomal-recessive life-
S
S
S 3 threatening disorder that causes severe lung damage and
S
nutritional deciencies. With earlier detection by genetic
Cell membrane HOOC C282Y mutation analysis and improved treatment strategies, people with
CF can live beyond the fourth decade of life and live more
comfortably. CF affects the cells that produce mucus,
sweat, saliva, and digestive juices. Normally, these secre-
tions are thin, but in CF a defective gene causes the secre-
tions to become thick and sticky. Respiratory failure is
Cytosol the most dangerous consequence of CF. About 30,000
American adults and children are living with the disorder.
HOOC Although there is no cure, gene therapy may someday
Figure 13-9 The HFE protein is associated with 2-
help correct lung problems in people with CF.
microglobulin in the cell membrane. The location of CF is caused by loss of function of the CF transmem-
the frequently occurring mutations is shown. brane conductance regulator, CFTR gene (7q31.2). The

gene codes for a chloride channel membrane protein. The There are over 30 reported variations of CYP-450
rst and most frequently observed mutation in CFTR is a enzymes. Enzymes are classied according to families
3-bp deletion that removes a phenylalanine residue from and subfamilies. For example, CYP2A6 is cytochrome P-
position 508 of the protein (F508del).3 More than 1300 450, subfamily IIA, polypeptide 6. CYP1A2 and the
other mutations and variations have been reported in and enzymes in the CYP2 and CYP3 families are considered
around the CFTR gene in diverse populations. A list of to be most important in drug metabolism. Some of the
mutations, their locations, and references is available enzymes reported to inhibit or induce drug metabolism
through the Human Genome Variation Society at include CYP1A2, CYP2A6, CYP2B6, CYP2C8,
www.genet.sickkids.on.ca CYP2C9, CYP2C18, CYP2C19, CYP2D6, CYP2E1,
Genetic testing for CF is important for diagnosis and CYP3A4, and CYP3A5-7. The genes coding for these
genetic counseling, as early intervention is most effective enzymes are located throughout the genome.
in relieving symptoms of the disease. Molecular tests Genetic polymorphisms of cytochrome P-450 genes
have been designed to detect a variety of mutations that are unequally distributed geographically and in different
have been described in CF. Methods include RFLP, PCR- ethnic populations. Testing for these polymorphisms is
RFLP, heteroduplex analysis, temporal temperature gra- used to predict the response to drugs sensitive to metab-
dient gel electrophoresis, single-strand conformation olism by this enzyme system. In the laboratory, testing
polymorphism (SSCP), SSP-PCR, Invader, bead array for CYP-450 polymorphisms is performed by allele-
technology (Tag-It, TM Bioscience), and direct sequenc- specic PCR for particular polymorphisms. Multiple
ing. The decisions as to which mutations and how many P-450 genetic variants may be screened by microarray or
mutations are tested are still not completely dened. bead array technology.
Population differences and variable expressivity inu-
ence the choice of mutations to be covered.
Single-Gene Disorders
Cytochrome P-450 With Nonclassical
Patterns of Inheritance
Cytochrome P-450 comprises a group of enzymes local-
ized to the endoplasmic reticulum. These enzymes are Mitochondrial mutations, genomic imprinting, and
mono-oxygenases; that is, they participate in enzymatic gonadal mosaicism do not follow mendelian rules of
hydroxylation reactions and also transfer electrons to inheritance. Mitochondrial mutations are inherited
oxygen: maternally (Fig. 13-11). Genomic imprinting is responsi-
A-H B-H2 O2 A-OH B H2O ble for specic expression of genes in different cells and
where A is the substrate, B is the hydrogen donor. tissues. Imprinting is reset at meiosis and fertilization and
These enzymes inuence steroid, amino acid, and drug is different in egg and sperm production.
metabolism using NADH or NADPH as hydrogen Gonadal mosaicism is the generation of new muta-
donors. Oxygenation of lipophilic drugs renders them tions in germ line cells. The mutated cells give rise to
more easily excreted. eggs or sperm carrying the mutation, which then becomes
The cytochrome P-450 system is present in high con- a heritable phenotype. Unusual pedigrees result (Fig. 13-
centrations in the liver and small intestine where the 12). Gonadal mosaicism is expected when phenotypically
enzymes metabolize and detoxify compounds taken in normal parents have more than one affected child, e.g., in
orally. The P-450 system varies from one person to osteogenesis imperfecta, an autosomal-dominant pheno-
another. This may in part account for different effects of type in a child from unaffected parents.
drugs on different people. Hormones, caffeine, chemo-
therapeutic drugs, antidepressants, and oral contraceptives
Mutations in Mitochondrial Genes
are examples of compounds affected by these polymor-
phisms.4,5 CYP-450 polymorphisms may also compound Mitochondria are cellular organelles responsible for
interactions of multiple drugs taken simultaneously.6,7 energy production. Mitochondria contain their own ge-

Figure 13-11 Mitochondrial mutations are

maternally inherited.
tory elements (see Chapter 11). A database of mitochon-

Advanced Concepts drial genes and mutations is available at www.MITO-
MAP.org8
An example of the nature of imprinting is illustrated Mutations in mitochondrial genes affect energy pro-
by comparison of mules and hinnies. A mule is the duction and are therefore manifested as diseases in the
product of a male horse and a female donkey. A most energy-demanding organs, muscle and the nervous
hinny is the product of a female horse and a male system.9,10 Mutations in several genes in the mitochondr-
donkey. These animals are quite different in pheno- ial genome have been dened. These mutations result in
type, even though they contain essentially the same a number of disease syndromes involving muscular and
genotype. Another illustration of the effects of neurological disorders (Table 13.6).
imprinting is seen in animals cloned by nuclear Mitochondrial mutations are easily detected by a vari-
transfer. Because this process bypasses the genera- ety of molecular methods. Southern blot is used for
tion of eggs and sperm and fertilization, imprinting detecting large deletions (Fig. 13-14). Point mutations
is not reset, and cloned animals display unexpected are frequently analyzed by PCR-RFLP (Fig. 13-15).
phenotypes, such as larger size or early onset of age- Interpretation of mutation analysis is complicated, how-
related diseases. ever, by the extent of heteroplasmy (mutated mitochon-
dria and normal mitochondria in the same cell) and the
nature of the mutation.11 A range of phenotypes may be
present, even in the same family.
nome, a circular DNA molecule 16,569 base pairs in
length (Fig. 13-13). The mitochondrial genome contains
37 genes, including a 12S and 16S rRNA, 22 tRNAs, HV 1 HV 2
and 13 genes required for oxidative phosphorylation. In (342 bp) (268 bp)
addition, the mtDNA contains a 1000-nt control region
PH1
that encompasses transcription and replication regula-
PH2
PL LHON
14484T>C
MELA
3243A>G Deleted
areas
LHON
3460G>A
LHON
11778G>A
MERRF
Figure 13-12 Gonadal mosaicism arises as a result of a 8344A>G MERRF
new mutation. In this example, a dominant disease pheno- 8393T>G
type has been inherited from two unaffected parents. The Figure 13-13 Mutations and deletions throughout the mito-
mutation is present only in the germ cells of the rst-genera- chondrial genome are associated with muscular and neuro-
tion parents but is inherited in all cells of the offspring. logical disorders.

Table 13.6 Diseases Resulting From Mutations in Mitochondrial Genes

Disorder Gene Affected Molecular Methodology
Kearnes-Sayre syndrome 28 Southern blot, PCR, PCR-RFLP
27 kb deletions
Pearsons syndrome Deletions Southern blot analysis of leukocytes,
PCR-RFLP29
Pigmentary retinopathy, chronic progres- tRNA (tyr) deletion,30 deletions PCR-RFLP, Southern blot analysis of
sive external ophthalmoplegia muscle biopsy31
Lebers hereditary optic neuropathy Cyt6 and URF* point mutations PCR-RFLP
Mitochondrial myopathy, encephalopathy, tRNA (leu) point mutations PCR-RFLP, sequencing
lactic acidosis, and strokelike episodes
Myoclonic epilepsy with ragged red bers tRNA (lys) point mutations PCR-RFLP
Deafness
Neuropathy, ataxia, retinitis pigmentosa (NARP) ATPase VI point mutation PCR-RFLP
Subacute necrotizing encephalomyelopathy ATPase VI, NADH:ubiquinone PCR-RFLP
with neurogenic muscle weakness, ataxia, oxidoreductase subunit muta-
retinitis pigmentosa (Leighs with NARP) tions
Mitochondrial DNA depletion syndrome Thymidine kinase gene mutations PCR, sequencing
*Unknown reading frame
Genes that control mitochondrial functions are also

found on the nuclear genome (Table 13.7). Unlike mito-
chondrial mutations that display maternal inheritance,
these disorders have autosomal patterns of inheritance.
Although the causative gene mutation is located on a
nuclear gene, analysis of mitochondria may still show
deletions or other mutations caused by the loss of the
nuclear gene function.
Spec. 1 2 3
Mspl U C U C U C
551 bp
345 bp
Figure 13-14 A mitochondrial deletion as revealed by 206 bp
Southern blot. DNA was cut with PvuII, a restriction enzyme
that cuts once in the mitochondrial genome. The membrane
was probed for mitochondrial sequences. Normal mito-
chondria (N) yield one band at 16.6 kb when cut with
PvuII (C). Supercoiled, nicked, and a few linearized
mitochondrial DNA circles can be seen in the uncut DNA
(U). DNA from a patient with Kearnes-Sayres syndrome (P) Figure 13-15 Detection of the NARP mitochondrial point
yields two mitochondrial populations, one of which has mutation (ATPase VI 8993TC or TG) by PCR-RFLP. The PCR
about 5 kb of the mitochondrial genomedeleted sequences. product was digested with the enzyme MspI (C) or undigest-
Because both normal and mutant mitochondria are ed (U). If the mutation is present, the enzyme will cut the
present, this is a state of heteroplasmy. (Photo courtesy PCR product into two pieces, as seen is specimen 3. (Photo
of Dr. Elizabeth Berry-Kravis, Rush University Medical courtesy of Dr. Elizabeth Berry-Kravis, Rush University Medical
Center.) Center.)

Table 13.7 Some Disorders Caused by Nuclear Gene Mutations

Disorder Gene Affected (Location) Molecular Methodology
Mitochondrial DNA depletion Succinate-CoA ligase, ADP-forming, beta subunit, Southern blot
syndrome SUCLA 2 (13q12.2-q13)
Mitochondrial neurogastrointestinal Platelet-derived endothelial cell growth factor, Sequencing
encephalomyopathy ECGF (22q13-qter)
Progressive external ophthalmoplegia Chromosome 10 open reading frame 2, C10ORF2 Southern blot, SSCP,
(10q24); polymerase, DNA, gamma, POLG sequencing32
(15q25); solute carrier family 25 (mitochondrial
carrier), member 4, SLC25A4/ANT1, (4q25)
Trinucleotide Repeat drome (more than 2000 CGG repeats) that the region
Expansion Disorders is microscopically visible (Fig. 13-17). The CGG repeat
expansion 5 to the FMR-1 gene also results in methy-
Triplet repeats are short tandem repeats (STRs) with 3-bp lation of the region and transcriptional shut-down of
repeating units (see Chapter 11 for more detailed expla- FMR-1.
nation of STRs). During DNA replication and meiosis, Symptoms of fragile X syndrome include learning dis-
these STRs can expand (or contract) in length. Triplet- orders and mental retardation (IQ ~20), long face, large
repeat mutations may occur in coding and noncoding ears, and macro-orchidism (large genitalia). Symptoms
sequences of genes. The most well-known examples of are more apparent at puberty. Symptoms increase in
triplet repeat expansion diseases are fragile X syndrome severity with each generation in a fragile X family (Fig.
and Huntingtons disease. 13-18).
In addition to the fragile X chromosome observed by
Fragile X Syndrome karyotyping, the state of the repeat expansion is also ana-
Fragile X syndrome is associated with a triplet repeat lyzed using PCR and by Southern blot. Although premu-
(CGG) expansion in the noncoding region 5 to the tations in fragile X carriers are easily detected by PCR,
fragile X mental retardation gene, FMR-1 (Fig. 13-16). Southern blot is required to detect the full fragile X
The expansion becomes so large in full fragile X syn- expansion that could cover thousands of base pairs.
Normal
Advanced Concepts 5 CGG(CGG)555 FMR-1 3
In addition to family history, clinical tests including Amplification

electroencephalography, neuroimaging, cardiac Premutation (carrier)
electrocardiography, echocardiography, magnetic 5 CGGCGGCGG(CGG)56200 FMR-1 3
resonance spectroscopy, and exercise testing are
important for accurate diagnosis of mitochondrial Amplification and methylation
disorders. High blood or cerebrospinal uid lactate Full mutation (affected)
concentrations as well as high blood glucose levels 5 CGGCGGCGGCGGCGGCGG(CGG)2002000+ FMR-1 3
are observed in patients with some mitochondrial Figure 13-16 Triplet (CGG) repeat expansions in
diseases. More direct tests, such as histological sequences 5 to the FMR-1 gene are observed in fragile X car-
examination of muscle biopsies and respiratory riers (up to 200 repeats) and fully affected individuals (more
than 200 repeats). Normally there are fewer than 60 repeats.
chain complex studies on skeletal muscle and skin
Expansion results from amplication of the triplet sequences
broblasts, are more specic for mitochondrial dys- during meiotic recombination events. The very large repeats
function. (more than 200 repeats) are methylated on the C residues.
This methylation turns off FMR-1 transcription.

Unaffected carrier
Learning disabled
FXS
Fragile X chromosome
(in metaphase) Figure 13-18 The symptoms of fragile X syndrome (FXS) be-
Figure 13-17 The fragile X chromosome is characterized come more severe with each generation. The fragile X chro-
by a threadlike process just at the telomere of the long arm mosome cannot be transmitted from fathers to sons but can
(arrow). This is the site of disorganization of chromatin struc- be transmitted from grandfathers to grandsons through their
ture by the GC-rich repeat expansions. daughters.
Southern blot also reveals cases of mosaicism where both Huntingtons Disease
premutations and full fragile X chromosomes are present Huntingtons disease, rst described by George Hunting-
in separate cell populations from the same patient (Fig. ton in 1872, is associated with expansion within the
13-19). Huntingtin structural gene (4p16.3). In this repeat expan-
Figure 13-19 Detection of premutations by PCR (left) and full fragile X mutations by
Southern blot (right). Primers (one of which is labeled with 32P) anking the repeat region are
used to generate labeled PCR products. Premutations appear as large amplicons in the 5090
repeat range on the autoradiogram at left. Normal samples fall in the 2040 repeat range. Full
fragile X repeats are too large and GC rich to detect by standard PCR. Southern blots reveal
full mutations in three of the samples shown. The inactive (methylated) X chromosome in four
female patients is detected by cutting the DNA with a methylation-specic restriction enzyme.
(Photos courtesy of Dr. Elizabeth Berry-Kravis, Rush University Medical Center.)

protein to aggregate in plaques, especially in nervous tis-

Advanced Concepts sue, causing the neurological symptoms seen in this dis-
ease.12 The expansion does not reach the size of the
The function of the FMR-1 gene product is not fully fragile X expansion and is detectable by standard PCR
understood. The FMR protein has domains similar methods (Fig. 13-20).
to those of RNA binding proteins. Based on these
observations, FMR may control expression of other
Idiopathic Congenital Central
genes by binding to certain RNA structures and pre-
Hypoventilation Syndrome
venting translation.35,36
Idiopathic congenital central hypoventilation syndrome
(CCHS) is a rare pediatric disorder characterized by inad-
equate breathing while asleep. More-affected children
sion, the sequence CAG expands from 937 repeats to may also experience hypoventilation while awake. CCHS
3886 in the Huntington gene. The clinical symptoms of occurs in association with an intestinal disorder called
Huntingtons disease include impaired judgment, slurred Hirschsprungs disease and symptoms of diffuse auto-
speech, difficulty in swallowing, abnormal body move- nomic nervous system dysregulation/dysfunction. A
ments (chorea), personality changes, depression, mood number of gene mutations have been observed in CCHS,
swings, unsteady gait, and an intoxicated appearance. including a polyalanine expansion of the paired-like
With an onset in the thirties or forties, these symptoms do homeobox (PHOX2b) gene (4p12)13. The Phox2b pro-
not become obvious until the fourth or fth decade of tein is a transcription factor containing a domain (home-
life, usually after family planning. The child of a person obox) similar to other proteins that bind DNA.
with Huntingtons disease has a 50% chance of inheriting In CCHS a triplet repeat expansion occurs inside of the
the disorder. Genetic counseling, therefore, is important PHOX2b gene, resulting in the insertion of multiple ala-
for younger persons with family histories of this disease, nine residues into the protein. The severity of the disease
especially with regard to having children. increases with increasing numbers of repeats. The expan-
In contrast to fragile X, where the repeat expansion sion is detected by PCR (Fig. 13-21).14
takes place 5 to the coding sequences, the Huntington CCHS is usually apparent at birth. In some children, a
expansion occurs within the coding region of the gene. late onset of the disease occurs at 24 years of age. An
The triplet expansion inserts multiple glutamine residues estimated 62%98% of patients with CCHS have the
in the 5 end of the Huntingtin protein. This causes the PHOX2b gene mutation.15
Figure 13-20 The Huntingtin repeat

expansion occurs within the coding
region of the Huntingtin gene. The
expansion is detected directly by PCR
using primers anking the expanded
region (top). A 32P-labeled primer is used,
and the bands are detected by autora-
diography of the polyacrylamide gel
(bottom). In this example, PCR products
from the patient (P) fall within the normal
range with the negative control (-). The
positive control () displays the band
sizes expected in Huntingtons disease.
(Photos courtesy of Dr. Elizabeth Berry-
Kravis, Rush University Medical Center.)

PHOX2b exon 3
PAGE
(Normal)
(Normal)
Agarose
(rapid test)
Figure 13-21 The triplet repeat expansion of PHOX2b includes triplets that code for ala-
nine (top). The expansion is detected by PCR with a 32P-labeled primer and polyacrylamide
gel electrophoresis (center) or by standard PCR and agarose gel electrophoresis (bottom).
Normal specimens yield a single PCR product. CCHS specimens yield another larger prod-
uct in addition to the normal product. The standard PCR test can rapidly show the pres-
ence of the expansion, and the PAGE test allows determination of the exact number of
alanine codons that are present in the expansion. (Photos courtesy of Dr. Elizabeth Berry-
Kravis, Rush University Medical Center.)
Other Triplet Expansion Disorders egg and sperm production and is different in DNA
Fragile X, Huntingtons disease, and CCHS are three of a brought in by the egg or the sperm upon fertilization. The
group of diseases caused by trinucleotide repeat disorders. difference is exhibited in genetic disorders in which one
This category of diseases is subclassied into polygluta- or the other allele of a gene is lost.
mine expansion disorders, which includes Huntingtons Uniparental disomy/deletion demonstrates the nature of
disease, and nonpolyglutamine expansion disorders, imprinting on chromosome 15. A deletion in the paternal
examples of which are listed in Table 13.8. chromosome 15, del(15)(q11q13), causes Prader-Willi
syndrome. Symptoms of this disorder include mental
retardation, short stature, obesity, and hypogonadism.
Genomic Imprinting
Loss of the same region from the maternal chromosome
Genomic imprinting is transcriptional silencing through 15 results in Angelmans syndrome, a disorder with very
histone or DNA modication. Imprinting occurs during different symptoms, including ataxia, seizures, and inap-
Table 13.8 Examples of Nonpolyglutamine Expansion Disorders

Disorder Gene Repeat Expansion, (Normal) (Symptomatic)*
Fragile XE Fragile X mental retardation 2 (Xq28) GCC (635) (over 200)
Friedreichs ataxia Frataxin, FRDA or X25 (9q13) GAA (734) (over 100)
Myotonic dystrophy Dystrophia myotonica protein kinase CTG (537) (over 50)
(9q13.213.3)
Spinocerebellar ataxia type 8 Spinocerebellar ataxia type 8 (13q21) CTG (1637) (110250)
Spinocerebellar ataxia type 12 Spinocerebellar ataxia type 12 (5q3133) CAG (728) (6678)
*The phenotypic effects of intermediate numbers of repeats is not known.
Although CAG codes for glutamine, this expansion occurs outside of the coding region of this gene and is not translated.

propriate laughter. Both syndromes can occur in four Molecular testing may discover genetic lesions in the
ways: a deletion on the paternal or maternal chromosome absence of symptoms. This raises a possible problem as
15, a mutation on the paternal or maternal chromosome to whether treatment is indicated. Finally, most diseases
15, a translocation with loss of the critical region from one are caused by dysfunction of multicomponent systems so
chromosome, and maternal or paternal uniparental dis- that several genetic lesions may be present or polymor-
omy in which both chromosomes 15 are inherited from phic states of other normal genes may inuence the dis-
the mother and none from the father or vice versa. ease state. As array technology and haplotype mapping
Cytogenetic methods are still used to test for these designed to scan at the genomic level are further devel-
genetic lesions. Translocations and some deletions are oped, these methods may contribute to better diagnosis of
detectable by standard karyotyping. High resolution complex diseases.
karyotyping can detect smaller deletions; however, other
cases are not detectable microscopically. Newer methods
such as FISH with labeled probes to the deleted region16 Case Study 13 1
can detect over 99% of cases. PCR of RFLP or STR
A young mother was worried about her son. Having
analysis has been used to demonstrate uniparental dis-
observed others, she was very aware of how her
omy.17 As imprinting (DNA methylation) is different on
baby was expected to grow and acquire basic skills.
maternal and paternal chromosomes, methylation-spe-
As the child grew, however, he showed signs of slow
cic PCR18 and Southern blot using methylation-specic
development. His protruding ears and long face
restriction enzymes19 have also been proposed as meth-
were becoming more noticeable as well. The pedia-
ods to aid in the diagnosis of these disorders.
trician recommended chromosomal analysis for the
mother and child. A constriction at the end of the X
Multifactorial Inheritance
chromosome was found in the sons karyotype. The
Most disorders (and normal conditions) are controlled by mothers karyotype was normal 46,XX. A Southern
multiple genetic and environmental factors. Multifactorial blot analysis for Fragile X was performed on a
inheritance is displayed as a continuous variation in pop- blood specimen from the mother, but showed not
ulations, with normal distribution, rather than as a specic obvious abnormality. PCR analysis produced the
inheritance pattern. Nutritional or chemical exposures following results:
alter this distribution. The range may be discontinuous,
with a threshold of manifestation. The phenotypic expres-
sion is conditioned by the number of controlling genes
inherited. The chance of a rst-degree relative having a
similar phenotype is 2%7%.
Limitations to
Molecular Testing
Although molecular testing for inherited diseases is
extremely useful for early diagnosis and genetic counsel-
ing, there are circumstances in which genetic testing may
not be the optimal methodology. To date, most therapeu-
tic targets are phenotypic so that treatment is better
directed to the phenotype. In genes with variable expres-
sivity, nding a gene mutation may not predict the sever-
ity of the phenotype. For instance, clotting time and PCR analysis of the FMR promoter region showing
transferrin saturation are better guides for anticoagulant two normal patterns (lanes 1 and 2) and the mothers
treatment than the demonstration of the causative gene pattern.
mutations.


A 14-year-old girl with muscle weakness and vision A 40-year-old man was experiencing increasing
difficulties (retinopathy) was referred for clinical joint pain, fatigue, and loss of appetite. He became
tests. A muscle biopsy was performed, and aberrant alarmed when he suffered heart problems and con-
mitochondria were observed in thin sections. sulted his physician. Routine blood testes revealed
Histochemical analysis of the muscle tissue revealed high serum iron (900 g/dL) and 80% transferrin
cytochrome oxidase deciency in the muscle cells. saturation. Total iron binding capacity was low (100
A skeletal muscle biopsy specimen was sent to the g/dL). The man denied any extensive alcohol
molecular genetics laboratory for analysis of mito- intake. A blood specimen was sent to the molecular
chondrial DNA. Southern blot analysis of PvuII cut genetics laboratory for analysis. The results are
mitochondrial DNA exhibited a band at 16,000 bp in shown below:
addition to the normal mitochondrial band at 16,500
bp as shown below:
PCR-RFLP analysis of exon 4 of the HFE gene. The PCR

product contains 1 recognition site for the restriction
enzyme, RsaI. An additional RsaI site is created by the
C282Y (GA) mutation, the most common inherited
mutation in hemochromatosis. This extra site results in
a fragments of 240 bp, 110 bp (arrow) and 30 bp
(not shown) instead of the 240 bp and 140 bp normal
fragments. Lane 1, molecular weight markers; lane 2,
Southern blot of mitochondrial DNA uncut (U) and cut normal control; lane 3, homozygous C282Y; lane 4,
with PvuII (C). Lanes 1 and 2, normal control; lanes 3 and heterozygous C282Y; lane 5, patient specimen; lane
4, patient. Arrow points to a 16,000 kb band. 6, reagent blank.
Case Study 13 4
A 30-year-old woman was brought to the emergency out APC. An ELISA test for D-dimer was positive.
room with a painfully swollen left leg. She informed The patient was immediately treated with heparin,
the nurses that she was taking contraceptives. Deep and blood samples were taken. A blood sample was
vein thrombosis was suspected, and compression sent to the molecular genetics laboratory to test for
ultrasound was ordered to look for pulmonary the factor V Leiden 1691 GA mutation and pro-
embolism. A clotting test for APC resistance thrombin 20210 GA mutations. The results are
resulted in a 1.5 ratio of clotting time with and with- shown below:
(continued on following page)


(continued)
Agarose gel electrophoresis showing the band pattern

for prothombin 20210/factor V Leiden mutation detection
by multiplex SSP-PCR-RFLP. Specimens were cut with HindIII.
Lane 1, molecular weight marker; lane 2, normal control
(prothrombin, 407 bp 99 bp, factor V, 241 bp); lane 3,
heterozygous control, prothrombin (407, 384, 99, 23
bp)/factor V Leiden (241, 209, 323 bp); lane 4, homozy-
gous factor V Leiden, normal prothrombin; lane 5, homozy-
gous prothrombin 20210 mutation/normal factor V; lane 6,
patient specimen; lanes 7 and 8, normal specimens.
5. The factor V Leiden mutation can be detected by:

STUDY QUESTIONS a. PCR-RFLP
b. SSP-PCR
1. Which of the following is not a triplet repeat expan- c. Invader technology
sion disorder? d. All of the above methods
a. Fragile X syndrome
b. Huntingtons disease 6. The most frequently occurring mutation in the HFE
c. Factor V Leiden gene results in the replacement of cysteine (C) with
d. Congenital central hypoventilation syndrome tyrosine (Y) at position 282. How is this expressed
according to the recommended nomenclature?
2. A gene was mapped to region 3, band 1, subband 1, of
7. MELAS is a disease condition that results from an A
the long arm of chromosome 2. How would you
to G mutation at position 3243 of the mitochondrial
express this location from an idiogram?
genome. This change creates a single ApaI restriction
site in a PCR product, including the mutation site.
3. Which of the following can be detected by PCR? What would you expect from a PCR-RFLP analysis
a. Large mitochondrial deletions for this mutation on a patient with MELAS?
b. Full fragile X disorder a. A single PCR product resistant to digestion with
c. Mitochondrial point mutations ApaI
b. A single PCR product that cuts into two frag-
4. A patient was tested for Huntingtons disease. PCR ments upon digestion with ApaI
followed by PAGE revealed 25 CAG units. c. A single PCR product only if the mutation is
a. This patient has Huntingtons disease present
b. This patient has a 1/25 chance of contracting d. Two PCR products
Huntingtons disease
c. This patient is normal at the Huntington locus 8. A father affected with a single gene disorder and an
d. The test is inconclusive unaffected mother have four children (three boys and

a girl), two of whom (one boy and the girl) are 2. Huber S, McMaster KJ, Voelkerding KV. Analytical
affected. Draw the pedigree diagram for this family. evaluation of primer engineered multiplex poly-
D16S539, an STR, was analyzed in the family. merase chain reactionrestriction fragment length
The result showed that the father had the 6,8 alleles, polymorphism for detection of factor V Leiden and
the mother had the 5,7 alleles. The affected children prothrombin G20210A. Journal of Molecular
had the 5,6 and 6,7 alleles, and the unaffected chil- Diagnostics 2000;2:15357.
dren had the 5,8 and 7,8 alleles. 3. Kerem B, Buchanan JA, Durie P, et al. DNA marker
a. If D16S539 is located on chromosome 16, where haplotype association with pancreatic sufficiency in
is the gene for this disorder likely to be located? cystic brosis. American Journal of Human Gene-
b. To which allele of D16S539 is the gene linked? tics 1989;44:82734.
How might one perform a DNA analysis for the 4. Orlando R, Piccoli P, De Martin S, et al. Effect of
presence of the disorder? the CYP3A4 inhibitor erythromycin on the pharma-
a. Analyze D16S539 for the 6 allele by PCR cokinetics of lignocaine and its pharmacologically
b. Sequence the entire region of the chromosome active metabolites in subjects with normal and
where D16S539 was located impaired liver function. British Journal of Clinical
c. Test as many STRs as possible by PCR Pharmacology 2003;55:8693.
d. Use Invader technology to detect the unknown 5. Orlando R, Piccoli P, De Martin S, et al.
gene mutation. Cytochrome P450 1A2 is a major determinant of
lidocaine metabolism in vivo: Effects of liver func-
9. Exon 4 of the HFE gene from a patient suspected of tion. Clinical Pharmacology and Therapeutics
having hereditary hemachromatosis was amplied 2004;75:8088.
by PCR. The G to A mutation, frequently found in 6. Jin Y, Desta Z, Stearns V, et al. CYP2D6 geno-
hemachromatosis, creates an Rsa1 site in exon 4. type, antidepressant use, and tamoxifen meta-
When the PCR products are digested with Rsa1, bolism during adjuvant breast cancer treatment.
which of the following results would you expect to Journal of the National Cancer Institute 2005;
see if the patient has the mutation? 97:3039.
a. None of the PCR products will be cut by Rsa1 7. Granfors M, Backman JT, Laitila J, et al. Oral con-
b. There will be no PCR product amplied from traceptives containing ethinyl estradiol and gesto-
the patient DNA dene markedly increase plasma concentrations and
c. The patients PCR product will yield extra bands effects of tizanidine by inhibiting cytochrome P450
upon Rsa1 digestion 1A2. Clinical Pharmacology and Therapeutics
d. The normal control PCR products will yield extra 2005;78:40011.
Rsa1 bands compared with the patient sample 8. Brandon M, Lott MT, Nguyen KC, et al. MITO-
Rsa1 will not distinguish normal from mutant. MAP: A human mitochondrial genome database
10. Most people with the C282Y or H63D HFE gene 2004 update. Nucleic Acids Research 2005;33:
mutations develop hemachromatosis symptoms. This D611D13.
is a result of: 9. Leonard J, Schapira AH. Mitochondrial respiratory
a. Iron loss chain disorders I: Mitochondrial DNA defects.
b. Excessive drinking Lancet 2000;355:299304.
c. High penetrance 10. Leonard J, Schapira AH. Mitochondrial respira-
d. Healthy lifestyle tory chain disorders II: Neurodegenerative disor-
e. Glycogen accumulation ders and nuclear gene defects. Lancet 2000;355:
38994.
References 11. Moraes C, Atencio DP, Oca-Cossio J, et al.
1. Cotran RS, Kumer V, Collins T. Robbins Pathologi- Techniques and pitfalls in the detection of patho-
cal Basis of Disease, 6th ed. Philadelphia: W. B. genic mitochondrial DNA mutations. Journal of
Saunders, 1999. Molecular Diagnostics 2003;5:197208.

12. Marx J. Huntingtons research points to possible 22. Wang J, Ban MR, Hegele RA. Multiplex ligation-
new therapies. Science 2005;310:4345. dependent probe amplication of LDLR enhances
13. Amiel J, Laudier B, Atti-Bitach T, et al. Polyala- molecular diagnosis of familial hypercholesterole-
nine expansion and frameshift mutations of the mia. Journal of Lipid Research 2005;46:36672.
paired-like homeobox gene PHOX2b in congenital 23. Ramos S, Hernandez M, Roces A, et al. Molecular
central hypoventilation syndrome. Nature Genetics diagnosis of alkaptonuria mutation by analysis of
2003;33:45961. homogentisate 1,2 dioxygenase mRNA from urine
14. Weese-Mayer D, Berry-Kravis EM, Zhou L, et al. and blood. American Journal of Medical Genetics
Idiopathic congenital central hypoventilation syn- 1998;78:19294.
drome: Analysis of genes pertinent to early auto- 24. Felbor U, Mutsch Y, Grehn F, et al. Ocular
nomic nervous system embryologic development ochronosis in alkaptonuria patients carrying
and identication of mutations in PHOX2b. mutations in the homogentisate 1,2-dioxygenase
American Journal of Medical Genetics 2003; gene. British Journal of Ophthalmology 1999;
123A:26778. 83:68083.
15. DAlessandro V, Mason II TBA, Pallone MN, 25. Landegren U, Kaiser R, Sanders J, et al. A ligase-
et al. Late-onset hypoventilation without PHOX2b mediated gene detection technique. Science 1988;
mutation or hypothalamic abnormalities. Journal 24:107780.
of Clinical Sleep Medicine 2005;1:16972. 26. Tuchman M. Molecular diagnosis of medium-chain
16. Nieuwint A, Van Hagen JM, Heins YM, et al. Rapid acyl-coA dehydrogenase deciency by oligonucleo-
detection of microdeletions using uorescence in tide ligation assay. Clinical Chemistry 1998;44:
situ hybridisation (FISH) on buccal smears. Journal 1011.
of Medical Genetics 2000;37:e4. 27. Carlucci F, Tabucchi A, Aiuti A, et al. Capillary
17. Mutirangura A, Greenberg F, Butler MG, et al. electrophoresis in diagnosis and monitoring of
Multiplex PCR of three dinucleotide repeats in the adenosine deaminase deciency. Clinical Chemistry
Prader-Willi/Angelman critical region (15q11-q13): 2003;49:183038.
Molecular diagnosis and mechanism of uniparental 28. Zeviani M, Moraes CT, DiMauro S, et al. Deletions
disomy. Human Molecular Genetics 1993;2:14351. of mitochondrial DNA in Kearnes-Sayre syndrome.
18. Chotai K, Payne SJ. A rapid, PCR-based test for Neurology 1988;38:133946.
differential molecular diagnosis of Prader-Willi and 29. De Coo I, Gussinklo T, Arts PJ, et al. A PCR
Angelman syndromes. Journal of Medical Genetics test for progressive external ophthalmoplegia
1998;35:47275. and Kearns-Sayre syndrome on DNA from blood
19. Glenn C, Saitoh S, Jong MT, et al. Gene structure, samples. Journal of Neurological Science 1997;
DNA methylation, and imprinted expression of the 149:3740.
human SNRPN gene. American Journal of Human 30. Raffelsberger T, Rossmanith W, Thaller-Antlanger
Genetics 1996;58:33546. H, et al. CPEO associated with a single nucleotide
20. Toudjarska I, Kilpatrick MW, Lembessis P, et al. deletion in the mitochondrial tRNATyr gene.
Novel approach to the molecular diagnosis of Neurology 2001;57:2298301.
Marfan syndrome: Application to sporadic cases 31. Moraes C, DiMauro S, Zeviani M, et al. Mitochon-
and in prenatal diagnosis. American Journal of drial DNA deletions in progressive external oph-
Medical Genetics 2001;99:294302. thalmoplegia and Kearns-Sayre syndrome. New
21. Upadhyaya M, Maynard J, Rogers MT, et al. England Journal of Medicine 1989;320:129399.
Improved molecular diagnosis of facioscapulo- 32. Kiechl S, Horvth R, Luoma P, et al. Two families
humeral muscular dystrophy (FSHD): Validation with autosomal-dominant progressive external oph-
of the differential double digestion for FSHD. thalmoplegia. Journal of Neurology Neurosurgery
Journal of Medical Genetics 1997;34:47679. and Psychiatry 2004;75:112528.

33. Anderson J. The Lyon hypothesis. British Medical 35. Sohn E. Fragile Xs missing partners identied.
Journal 1963;5367:121516. Science 2001;294:1809.
34. Davidson R. The Lyon hypothesis. Journal of 36. Moine H, Mandel J-L. Do G quartets orchestrate
Pediatrics 1964;65:76575. fragile X pathology? Science 2001;294:248788.
Molecular Oncology
OUTLINE OBJECTIVES
CLASSIFICATION OF NEOPLASMS Identify checkpoints in the cell division cycle that are
MOLECULAR BASIS OF CANCER critical for regulated cell proliferation.
ANALYTICAL TARGETS OF List molecular targets that are useful for diagnosisng
MOLECULAR TESTING and monitoring solid tumors.
Gene and Chromosomal Mutations in
Solid Tumors Explain how microsatellite instability is detected.
Microsatellite Instability Describe loss of heterozygosity and its detection.
Loss of Heterozygosity
Contrast cell-specic and tumor-specic molecular
GENE REARRANGEMENTS IN targets.
LEUKEMIA AND LYMPHOMA
V(D)J Recombination Show how clonality is detected using antibody and
Detection of Clonality T-cell receptor gene rearrangements.
Translocations in Hematological Describe translocations associated with hematological
Malignancies malignancies that can be used for molecular testing.
Interpret data obtained from the molecular analysis of
patients cells, and determine if a tumor population is
present.
332

Molecular Oncology Chapter 14 333
Oncology is the study of tumors. A tumor, or neoplasm, is

a growth of tissue that exceeds and is not coordinated with
normal tissue. Tumors are either benign (not recurrent)
Advanced Concepts
or malignant (invasive and tending to recur at multiple As imaging technology advanced, several efforts
sites). Cancer is a term that includes all malignant tumors. were made for classication of NHL. The earliest
Molecular oncology is the study of cancer at the molecu- was the Rappaport classication in 1966, developed
lar level, using techniques that allow direct detection of at the Armed Forces Institute of Pathology. The Keil
genetic alterations, down to single base pair changes. classication, used in Europe, and the Lukes and
Collins classication, used in the United States,
were proposed in 1974. In 1982 an international
Classication of Neoplasms group of hematopathologists proposed the Working
Cancer is generally divided into two broad groups, solid Formulation for Clinical Usage for classication of
tumors and hematological malignancies. Solid tumors are NHL.139 The Working Formulation was revised in
designated according to the tissue of origin as carcino- 1994 by the International Lymphoma Study Group,
mas (epithelial) or sarcomas (bone, cartilage, muscle, which proposed the World Health Organization/
blood vessels, fat). Teratocarcinomas consist of multi- Revised European-American Classication of Lym-
ple cell types. Benign tumors are named by adding the phoid Neoplasms (REAL). The REAL classication
suffix -oma directly to the tissue of origin. For exam- included genetic characteristics in addition to mor-
ple, an adenoma is a benign glandular growth. An adeno- phological tissue architecture. With increasing abil-
carcinoma is malignant. ity to detect molecular characteristics of cells,
Metastasis is the movement of dislodged tumor cells including patterns of gene expression, classication
from the original (primary) site to other locations. Only will continue to evolve.
malignant tumors are metastatic. No one characteristic of
the primary tumor predicts the likelihood of metastasis.
Both tumor and normal cell factors are involved. The gory. Some of the physiological symptoms of plasma cell
presence of metastasis increases the difficulty of treat- tumors are related to the secretion of immunoglobulin
ment. Clinical analysis may be performed to detect the fragments by these tumors.
presence of relocated or circulating metastasized cells to
aid in treatment strategy.
With regard to hematological malignancies, tumors Molecular Basis of Cancer
arising from white blood cells are referred to as leukemias Cancer is caused by nonlethal mutations in DNA. The
and lymphomas. Leukemia is a neoplastic disease mutations affect two types of genes: oncogenes and
of blood-forming tissue in which large numbers of white tumor suppressor genes. These genes control the cell
blood cells populate the bone marrow and peripheral division cycle (Fig. 14-1).
blood. Lymphoma is a neoplasm of lymphocytes that Oncogenes promote cell division. Oncogenes include
forms discrete tissue masses. The difference between cell membrane receptors that are bound by growth fac-
these diseases is not clear, as lymphocytic leukemias and tors, hormones, and other extracellular signals. These
lymphomas can display bone marrow and blood symp- receptors transduce signals through the cell membrane
toms similar to those of leukemias. Furthermore, chronic into the cytoplasm through a series of protein modica-
lymphomas can progress to leukemia. Conversely, leuke- tions that ultimately reach the nucleus and activate fac-
mias can display lymphomatous masses without overpop- tors that initiate DNA synthesis (move the cell from G1
ulation of cells in the bone marrow. to S phase of the cell cycle) or mitosis (move from G2 to
Within lymphomas, Hodgkins disease is a histologi- M). Oncogenes also support cell survival by inhibiting
cally and clinically different disease than all other types of apoptosis, or self-directed cell death. More than 100
lymphoma, termed non-Hodgkins lymphoma (NHL). oncogenes have been identied in the human genome.
Plasma cell neoplasms, which arise from terminally dif- Tumor suppressors slow down or stop cell division.
ferentiated B cells, are also classied in a separate cate- Tumor suppressors include factors that control transcrip-

S
DNA synthesis
and chromosome
G1 replication
Cell growth
G2
Cell growth
M
Mitosis Figure 14-1 The cell division cycle. After mitosis (M),
and there are two haploid (one diploid) complements of
cytokinesis chromosomes (46 chromosomes) in the G1 phase of
the cell division cycle. DNA is replicated during the S
phase, resulting in four haploid (two diploid) comple-
ments in the G2 phase. The chromosomes are distrib-
uted to two daughter cells at mitosis each receiving
46 chromosomes. Cancer results when the cell
division cycle proceeds from G1 to S or G2 to
M phase inappropriately.
tion, or translation of genes required for cell division. ratory. These include tests that target tissue-specic or
Tumor suppressors also participate in repairing DNA tumor-specic genes. Tissue-specic targets are molec-
damage and in promoting apoptosis. Tumor suppressors ular characteristics of the type of tissue from which a
counteract the movement of the cell from G1 to S or G2 tumor arose. The presence of DNA or RNA from these
to M phase. These two points are therefore referred to as targets in abnormal amounts or locations is used
the G1 checkpoint and G2 checkpoint in the cell divi- to detect and monitor the presence of the tumor. For
sion cycle. More than 30 tumor suppressor genes have example, molecular tests are designed to detect DNA or
been identied. RNA from cytokeritin genes in gastric cancer, carci-
In cancer cells, mutations in oncogenes are usually noembryonic antigen in breast cancer, and rearranged
gain of function mutations, resulting from amplication immunoglobulin or T-cell receptor genes in lymphoma.
or translocation of DNA regions containing the genes or Although tissue-specic markers are useful, they are also
activating mutations that cause aberrant activity of the expressed by normal cells, and their presence does not
proteins. Mutations in tumor suppressor genes are usually always prove the presence of cancer.
loss of function mutations, resulting in inactivation of the In contrast, tumor-specic genes are not expressed in
tumor suppressor gene products. These mutations may normal cells and are, therefore, more denitive with
occur through deletion, translocation, or mutation of the respect to the presence of tumor. Tumor-specic genetic
genes. Molecular laboratory testing aids in the diagnosis structures result from genome, chromosomal, or gene
and treatment strategies for tumors by detecting abnor- abnormalities in oncogenes and tumor suppressor genes
malities in specic tumor suppressors or oncogenes. that are associated with the development of the tumor.
Gene mutations and chromosomal translocations are
Analytical Targets found in solid tumors, leukemias, and lymphomas.
Genome mutations, or aneuploidy, result in part from
of Molecular Testing the loss of coordinated DNA synthesis and cell division
Although not yet completely standardized, several tests that occurs when tumor suppressors or oncogenes are
are performed in almost every molecular pathology labo- dysfunctional. Research is ongoing to nd more of these

tumor-specic markers to improve molecular oncology as the avian erythroblastic leukemia viral oncogene ho-
testing. molog 2, or ERBB2, which codes for a 185-kd cell mem-
The following sections describe procedures most com- brane protein that adds phosphate groups to tyrosines on
monly performed in molecular pathology laboratories; itself and other proteins (tyrosine kinase activity). This
however, due to the rapid advances in this area, the de- receptor is one of several transmembrane proteins with
scriptions cannot be all-inclusive. The discussion is tyrosine kinase activity (Fig. 14-2). It is very similar to a
divided into solid tumor testing and testing for hemato- family of epidermal growth factor receptors that are over-
logical malignancies. As will be apparent, however, some expressed in some cancers2 (Fig. 14-3).
tests are applicable to both types of malignancies. In normal cells, this protein is required for cells to grow
and divide. HER2/neu is overexpressed in 25%30% of
human breast cancers, in which overexpression of
Gene and Chromosomal
HER2/neu is a predictor of a more aggressive growth and
Mutations in Solid Tumors
metastasis of the tumor cells. It is also an indication for
A number of tests are routinely performed to aid in the use of anti-HER2/neu antibody drug, Herceptin (tras-
diagnosis, characterization, and monitoring of solid tuzumab) therapy, which works best on tumors overex-
tumors. Some of these tests have been part of molecular pressing HER2/neu. Herceptin therapy is indicated
pathology for many years. Others are relatively new to presently for women with HER2/neu-positive (HER2/neu
the clinical laboratory. The methods applied to detect overexpressed) breast cancer that has spread to lymph
molecular characteristics of tumors are described in nodes or other organs.
Chapters 610 of this text. Of all testing for the overexpression of the HER2/neu
oncogene, 80%95% is performed by immunohisto-
Human Epidermal Growth Factor Receptor 2,
chemistry (IHC) using monoclonal and polyclonal anti-
HER2/neu/erb-b2 1 (17q21.1)
bodies to detect the HER2/neu protein. The HercepTest
HER2/neu was discovered in rat neuro/glioblastoma was developed by Dako and Genentech as a method to
cell lines in 1985.1 Later it was found to be the same gene dene conditions for performance and interpretation of
Outside of cell
Cysteine-rich
domain
Immunoglobulin-like
Transmembrane
domain
domain
Cell membrane
Kinase
domain
EGFR IGFR NGFR PDGFR FGFR VEGFR EPHR
Cytoplasm
Figure 14-2 Receptor tyrosine kinases include epidermal growth factor receptor (EGFR), insulin
growth factor receptor (IGFR), nerve growth factor receptor (NGFR), platelet-derived growth fac-
tor receptor (PDGFR), broblast growth factor receptor (FGFR), vascular endothelial growth factor
receptor (VEGFR), and ephrin receptor (EPHR). These molecules share similarities in that they
include a kinase domain, transmembrane domain, cysteine-rich domain, and immunoglobulin-
like domain. The EPH receptor has two bronectin type III domains.

Orange and a CEP 17 probe that binds to the centromere

Outside of cell
of chromosome 17 labeled in SpectrumGreen. The copy
EGF Heregulins NRG number of HER2/neu relative to the copy number of CEP
TGF- ? NRG 1-2 Heregulins 17 indicates whether HER2/neu is amplied (present in
multiple copies on the same chromosome). Data are
reported as a ratio of the number of HER2 signals to
chromosome 17 centromere signals. A ratio of more than
2 is considered positive or amplied. The number of sig-
nals are enumerated in 50100 cells.
Cell
membrane Chromogenic in situ hybridization (CISH) is another
method that has been used to detect HER2/neu gene
amplication6,7 CISH is a less expensive method that
may be more accessible to community laboratories.
EGFR HER2 HER3 HER4 Using a standard bright eld microscope, CISH technol-
HER1 ErbB-2 ErbB-3 ErbB-4 ogy also detects deletions, translocations, or change in
ErbB-1 the number of chromosomes. An attractive feature of
CISH is that the slide images are permanent, facilitating
Cytoplasm
documentation and consultations. Initially, in situ
Figure 14-3 The ErbB family of growth factor receptors
includes the HER2 receptor and EGFR. The factors that bind to
hybridization with chromogenic detection by gene-
these receptors on the cell surface begin a cascade of specic probes was limited by high background and
events including autophosphorylation and phosphorylation of low signal intensity. Newer highly specic probes with
other proteins by the receptors. These factors include the epi- repetitive sequences removed, such as Zymeds Subtrac-
dermal growth factor (EGF), human transforming growth fac-
tion Probe Technology, were designed to address these
tor alpha (TGF-), heregulins, and neuregulins (NRG). EGF,
NRG heregulins are small peptides that are active in the
limitations. CISH has shown 86%96% concordance
development of various cell types such as gastric mucosa, with FISH in comparison studies of Her-2/neu ampli-
the heart, and the nervous system. cation.8
Although FISH and CISH are more accurate and less
subjective methods than IHC, IHC is faster, less expen-
the IHC test. The IHC test, which is cheaper and more sive, and allows the pathologist to assess target gene
readily available in most institutions, works best on fresh expression along with other visible landmarks on the
or frozen tissue. Fluorescent in situ hybridization (FISH), slide. Furthermore, protein overexpression (detectable by
which measures DNA and RNA of HER2/neu, is more IHC) can occur without gene amplication (detectable by
reliable than IHC, especially in older, xed tissue,3,4 but ISH). Some laboratories use IHC as an initial screening
is less readily available. method and then conrm results with FISH or CISH.
Southern, Northern, and Western studies have shown
Epidermal Growth Factor Receptor, EGFR (7p12)
that HER2/neu gene amplication is highly correlated
with the presence of increased HER2/neu RNA and pro- The epidermal growth factor receptor gene (EGFR,
tein.5 In contrast to IHC, which measures increased ERBB1) is another member of the ERBB family of
amounts of HER2/Neu protein, FISH directly detects growth factor receptors that also includes ERB3/HER3
increased copy numbers of the HER2/neu gene in DNA. and ERB4/HER4 (see Fig. 14-3). All of these proteins are
HER2/neu gene amplication occurs as a result of tan- located in the cell membrane and form dimers with one
dem duplication of the gene or other genetic events as the another upon binding of growth factor from outside the
tumor cells continue to divide. FISH testing for HER2/ cell (Fig. 14-4). Binding of growth factors evokes the
neu gene amplication requires a labeled probe for the tyrosine kinase activity of the receptors and initiates pro-
HER2/neu gene and a differently labeled control probe liferation signals through the cell cytoplasm.
for the centromere of chromosome 17. For instance, the EGFR is frequently overexpressed in solid tumors.
PathVysion reagent set (Vysis) includes the HER-2 probe Overexpression has been correlated with poor clinical
that spans the entire HER2/neu gene labeled in Spectrum outcome in research studies. For this reason the EGF

Outside of cell
of response or prognosis is complex because several
Growth factor
clinical and genetic factors contribute to response to tar-
geted therapies as well as the natural course of the tumor.
These include intronic polymorphisms in the EGFR
gene,18 expression of other components of the signal
Tyrosine
kinase transduction pathway,19,20 or other tumor suppressors
receptor such as p53.21
Kirsten rat sarcoma viral oncogene homolog, K-ras
(12p12), Neuroblastoma ras, N-ras (1p13), Harvey
Cell Kinase rat sarcoma viral oncogene homolog, H-ras (11p15)
membrane domain
Signals from extracellular stimuli, such as growth fac-
Cytoplasm tors or hormones, are transmitted through the cell cyto-
plasm to the nucleus, resulting in cell proliferation or
Figure 14-4 Upon binding by epidermal growth factor
differentiation (Fig. 14-5). The mitogen-activated protein
(EGF), the EGFR receptor in the cell membrane forms a kinase (MAPK) pathway is a cascade of phosphorylation
dimer with itself or with other members of the ERBB family of events that is the major pathway of signal transduction
receptors. The dimerization initiates a cascade of events, from the cell membrane to the nucleus. Critical compo-
starting with phosphorylation of the receptor itself catalyzed
by the kinase domain.
Growth factor
receptor has been an attractive target for design of thera- Tyrosine kinase
peutic drugs. Monoclonal antibodies such as cetuximab receptor
(Erbitux) have been developed to block ligand (growth
factor) binding to the receptor. Agents have also been Mitogen
designed to inhibit the kinase activity of the receptor. Of
these tyrosine kinase inhibitors, erlotinib (Tarceva), ge-
Normal cell growth
tinib (Iressa), and sunitinib malate (Sutent) have had the
most study in clinical trials.
IHC analysis of EGFR expression, similar to the test-
ing for HER2/neu overexpression, has been used to pre-
No mitogen
dict response to monoclonal antibody drugs.9 The Dako
Cytomation EGFR PharmDx test kit has been approved
by the United States Food and Drug Administration for
Cell arrest or apoptosis
this application. Interpretation of the results of EGFR
expression testing and the predictive value of the test are No mitogen plus
not always straightforward, however.10 Quantitative real- oncogene or
time polymerase chain reaction (PCR) and FISH analysis tumor suppressor
have also been proposed as methods to assess EGFR gene mutation
gene copy number.11
One possible predictor of response to tyrosine kinase
inhibiting agents is specic mutations found in the
kinase domain of the protein.12-15 These mutations can be
detected by a number of methods, including sequence- Figure 14-5 Normally, cells grow in the presence of nutri-
ents and factors that stimulate cell division (mitogens). Lack
specic PCR, single-strand conformational polymor-
of mitogen stimulation results in cell arrest, or apoptosis. If
phism (SSCP), and direct sequencing.12,16,17 To date, oncogene or tumor suppressor gene mutations stimulate
detection of mutations in the EGFR kinase region is aberrant growth signals, cells grow in the absence of con-
not yet approved as a clinical test. Testing for predictors trolled stimulation.

nents of this pathway are small proteins that bind to GTP

in order to become active. These small GTP binding
proteins include the ras genes that receive signals from
Advanced Concepts
the cell surface proteins and activate the initial steps of Regulation of ras GTPase activity is controlled by
the MAPK cascade (Fig. 14-6). Mutations in ras proto- rasGAP. Several other GAP proteins besides
oncogenes occur in many types of cancers. rasGAP are important in signal transduction. Two
clinically important proteins of the GAP family of
proteins are the gene product of the neurobromato-
sis type-1 (NF1) locus and the gene product of the
Outside of cell breakpoint cluster region (BCR) gene. The NF1
gene is a tumor suppressor gene, and the protein
Growth factor
encoded is called neurobromin. The BCR locus is
Activated tyrosine rearranged in the Philadelphia chromosome (Ph)
kinase receptor observed in chronic myelogenous leukemias and
Cell membrane
acute lymphocytic leukemias.
GEF Ras GAP

P (active)
GTP P Mammals have three different ras genes that produce
Ras Ras
four similar proteins, K-ras4A, K-ras4B, N-ras, and H-
(inactive) (inactive)
ras. The Ras proteins differ only in their carboxy termini,
GDP
the end of the proteins that anchor them to the inner sur-
Raf
face of the cell membrane (Table 14.1, Fig. 14-7). Be-
cause they bind and hydrolyze GTP for energy, the ras
genes are members of a family of G-proteins. The GTP
Ras
(active) hydrolysis is regulated by GTPase activating proteins
GTP Raf (GAPs).
Mutations in K-ras are the most common oncogene
P
MEK
mutations in human cancers. The most frequently occur-
MEK
ring mutations are located in codons 12, 13, 22, and 61 of
P the ras gene. These mutations affect sequences coding for
MAPk MAPk
Cytoplasm the GTP-binding domain of the protein and throw the Ras
Table 14.1 Four ras Proteins Synthesized From Three

Nucleus
Genes, K-ras, N-ras, and H-ras*
Protein Modication Location
K-ras4A Farnesylation ?
palmitoylation
K-ras4B Farnesylation Plasma membrane
Figure 14-6 Activation of membrane-bound K-ras is initi- polybasic aminoacids
ated by activated receptors bound to mitogens (growth fac- N-ras Farnesylation Golgi
tors or hormones). Active K-ras bound to GTP then initiates a palmitoylation
cascade of phosphorylation events that end in the nucleus, Farnesylation Golgi
H-ras
where transcription factors modulate gene expression.
GDP/GTP exchange on K-ras is modulated by GTPase activat-
palmitoylation
ing proteins (GAPs), guanosine nucleotide exchange factors *K-ras4A and K-ras4B arise from alternate splicing of transcripts of the
(GEFs), and guanosine nucleotide dissociation inhibitors (GDIs). same gene.

Outside of cell
Cell
membrane
Farnesyl Palmitate
Cytoplasm Ras
Figure 14-7 Ras proteins are anchored to the cell

membrane through farnesyl groups (chemical struc-
ture at bottom) and palmitoyl groups on the ras pro- CH3 CH3 CH3
teins. K-ras has only farnesyl groups, whereas N-ras
and H-ras have both farnesyl and palmitoyl groups. H3C C CH CH2 CH2 C CH CH2 CH2 C CH CH3
protein into a permanently active state that does not Ewing Sarcoma, EWS (22q12)
require stimulation from GTP hydrolysis. As a result, the
A group of tumors arising from primitive neuroecto-
Ras proteins harboring these single nucleotide substitu-
dermal tissue (PNET)/Ewings sarcomas comprise a fam-
tions remain constitutively active in the GTP-bound form.
ily of childhood neoplasms referred to as the Ewing
K-ras mutations are highly correlated with tumor his-
family. Although immunohistochemical staining for the
tology and may predict the progress of tumorigenesis in
cell surface enzyho HBA71 (p30/p32MIC2), a neuron-
early-stage tumors. Furthermore, the presence of K-ras
specic enzyme, is helpful in diagnosis of these tumors,
mutations may affect treatment strategy, especially with
no unique characteristics distinguish the different types
targeted therapies such as kinase inhibitors and farnesyl
of tumors that make up this group.
transferase inhibitors (K-ras protein is localized to the
Detection of specic translocations by cytogenetic or
cell membrane through a farnesyl group). ras mutations
molecular methods is useful for diagnostic and prognostic
are detected and indentied by SSCP screening and
accuracy (Table 14.2). Translocations involving the EWS
direct sequencing. Site-specic methods such as pyrose-
gene at 22q12 (also called EWSR1 for EWS breakpoint
quencing have also been developed. The PyroMark
region 1) with the FLI-1 gene at 11q24, t(11;22)(q24;q12)
KRAS kit can be used to specically genotype codons 12
are present in 85% of Ewings sarcomas. Another translo-
and 13. In addition, mutations in codon 61 can be ana-
cation between EWS and the ERG gene at 21q22 is pres-
lyzed using a second primer set provided in the test. A
ent in 5%10% of Ewings sarcomas. Other partners for
biochip test for detection of multiple specic mutations
the EWS gene, such as ETV1 at 7p22, E1AF at 17q12, and
by hybridization is also available.22,23
FEV at 2q33, are present in fewer than 1% of cases.24,25
Advanced Concepts Table 14.2 EWS Translocation Partners

Translocation Tumor
K-ras must be associated with cellular membranes in
EWS-FLI-1 Ewings sarcoma, peripheral PNET (72%)
order to act. The membrane association is driven by
EWS-ERG Ewings sarcoma, peripheral PNET (11%)
the hydrophobic farnesyl group covalently attached
EWS-WT1* Desmoplastic small round cell tumor
to the ras protein by the enzyme farnesyl transferase.
EWS-ATF1 Clear cell sarcoma
In the absence of farnesyl modification, even
mutated ras proteins are not active. Therefore, thera- *The WT1 gene is also associated with Wilms tumor (WT), one of the
common solid tumors of childhood, accounting for 8% of childhood can-
pies have been designed to inhibit the farnesylation cers. Several genes or chromosomal areas affect the development of WT:
of ras. These are farnesyl transferase inhibitors. WT1 at 11p13, WT2 at 11p15.5, WT3 at16q, WT5 at 7p15-p11.2, and
WT4 at 17q12-q21.

The occurrence of these rearrangements was rst revealed either of two related genes on the X chromosome, syn-
by cytogenetics26,27 and then by PCR methods.28 ovial sarcoma translocated to X (SSX1 and SSX2). The
Current laboratory testing at the molecular level latter genes are two of ve variants, SSX1, SSX2, SSX3,
involves detection of the tumor-specic translocations by SSX4, and SSX5. With rare exceptions, only SSX1 and
reverse transcriptase polymerase chain reaction (RT-PCR) SSX2 are fused to SYT in the t(X;18) translocation.31 The
(Fig. 14-8). Positive results are revealed by the presence fusion gene acts as an aberrant transcription factor, with
of a 120-190bp PCR product. Negative specimens will both activation and repression functions from the SYT
not yield a product. As with all assays of this type, an and SSX portions, respectively.
amplication control, such as GAPDH or 18S RNA (see The t(X;18) translocation is detected by FISH or RT-
Chapter 7), must accompany all samples to avoid false- PCR.32,31 In the latter method, total RNA reverse-
negative results. These tests can be performed on fresh, transcribed to cDNA is amplied with primers specic
frozen, or paraffin-embedded tissue.25,29,30 Primers to ad- for SSX and SYT genes. In a seminested version of this
ditional EWS translocation partners are used to detect procedure, the SSX primer used in the rst round is a con-
related PNET tumors. sensus primer for both SYT-SSX1 and SYT-SSX2. After
the rst amplication, SSX1- and SSX2-specic primers
Synovial sarcoma translocation, chromsome 18
discriminate between the two translocation types. The
synovial sarcoma breakpoint 1 and 2, SYT-SSX1,
PCR products are detected by agarose gel electophoresis
SYT-SSX2 t(X;18)(p11.2;q11.2)
and ethidium bromide staining. This method can be per-
A recurrent reciprocal translocation between chromo- formed on fresh, frozen, or xed tissue, depending on the
some 18 and the X chromosome is found in synovial sar- condition of the specimen RNA.
coma, a rare type of cancer of the muscle, fat, brous
Paired box-Forkhead in rhabdomyosarcoma, PAX3-
tissue, blood vessels, or other supporting tissue of the
FKHR, PAX7-FKHR, t(1;13), t(2;13)
body. Synovial sarcoma accounts for 8%10% of all sar-
comas and occurs mostly in young adults. About 80% of Rhabdomyosarcoma (RMS) is the most common
cases have the t(X;18) translocation. soft-tissue sarcoma of childhood, accounting for 10% of
The t(X;18) translocation fuses the synovial sarcoma all solid tumors in children. In addition to alveolar rhab-
translocation, chromosome 18 gene (SS18 or SYT) with domyosarcoma (ARMS), there are two additional histo-
EWS gene FLI1 gene
Chromosome 22 Chromosome 11
Translocation
EWS gene FLI1 gene
Fusion gene
Figure 14-8 RT-PCR is used to detect the

Fusion mRNA isolated
t(11:22) mutation in Ewings sarcoma. One
from cells
primer is designed to hybridize to the EWS gene
Reverse transcriptase
Primer on chromosome 22 and one primer to the FLI1
gene on chromosome 11. If the translocation
has occurred, the resulting fusion transcript iso-
cDNA lated from the tumor cells will yield cDNA that is
Primer ampliable with the EWS and FLI1 primers.

logical forms of RMS: embryonal (RMS-E) and primitive the p53 protein have been used for this purpose. Because
(RMS-P). Although histological classication of RMS is normal p53 protein is transient, signicant staining (2
sometimes difficult, accurate diagnosis is important for or above on a scale of 0 to 4) of p53 is considered pos-
management and treatment of this malignancy because itive for the mutation.
ARMS has a worse prognosis than other subtypes. SSCP (see Chapter 9) and direct sequencing (see
Translocations involving the Forkhead in the Rhab- Chapter 10) of microdissected tumor tissue are other
domyosarcoma Gene (FKHR, also called FOXO1A) and methods often used to detect TP53 mutations. Sequenc-
the paired box genes (PAX3 and PAX7) are frequently ing and SSCP methods cover only exons 58 or 49 of
found in ARMS.33 The chimeric genes resulting from the the TP53 gene, because these exons encode the regions
translocations encode transcriptional activators with involved in DNA binding and protein-protein interac-
DNA-binding motifs homologous to the forkhead tran- tive functions of the p53 protein. Screening is routinely
scription factor rst discovered in the fruit y, Drosophila. performed on frozen or xed paraffin-embedded tumor
PAX-FKHR translocations have been observed in all sub- tissue.
types of RMS but are more characteristic of ARMS. Both IHC analysis of protein and DNA analysis are
Furthermore, PAX7-FKHR, t(2;13), is associated with bet- used to screen for somatic p53 mutations. A number of
ter outcome than PAX3-FKHR, t(1;13). Mutations in the studies, however have shown that mutations detected by
PAX3 gene are also found in Waardenburgs syndrome, a IHC do not correlate with mutations found by direct
congenital auditory pigmentary syndrome.34 DNA analysis.40-42 There are several explanations for
The majority of ARMS displays the t(2;13) transloca- these discrepancies (Table 14.3). Use of microarray tech-
tion, with the t(1;13) variant present with 1/3 frequency nology to screen expression of multiple genes along with
as t(2;13).35 Both translocations are detected by FISH, TP53 has been proposed as a more accurate method for
RT-PCR, and real-time PCR.36-38 predicting survival than either IHC or mutation analysis
of TP53 alone.43 Methods that include sequencing of the
Tumor protein 53, TP53 (17p13)
entire TP53 coding region on cDNA, in combination with
Mutations in TP53 are found in all types of cancer, and IHC, is another accurate approach.41,44
about 50% of all cancers have TP53 mutations. The gene In addition to screening for somatic alterations, muta-
product of TP53, p53, is a 53,000-dalton DNA-binding tion analysis of TP53 is also performed to aid in the diag-
protein that controls expression of other genes. Normally, nosis of Li-Fraumeni syndrome, a cancer-prone condition
p53 participates in the arrest of cell division in the event caused by inherited mutations in the p53 gene. In this
of DNA damage. The arrest in the G1 phase of the cell
cycle allows repair enzymes to correct the DNA damage
before DNA synthesis begins. Once the damage is Table 14.3 Sources of Potential Inaccuracies
repaired, p53 protein is removed by binding to another of p53 Mutation Analysis
protein, MDM2, and degradation. When p53 is not func- Method False Positive False Negative
tional, replication proceeds on damaged templates,
IHC Staining of normal Deletions or mutations in
resulting in the potential for further genetic abnormali-
p53 protein p53 that remove Ab
ties. Also, the mutant protein does not degrade properly
binding epitopes; pro-
and accumulates in the cell nucleus and cytoplasm.
moter mutations
Several studies have shown that mutated TP53 in
SSCP Alternate conform- Less than 5% mutant cells
tumor tissue is an indicator of poor prognosis in breast,
ers; silent DNA in specimen; mutations
lung, colon, and other types of cancers. The signicance
polymorphisms outside of the exons
of TP53 status as a predictor of decreased survival time
screened
or tumor relapse is, however, controversial.39 Part of the
Sequencing PCR mutagenesis; Less than 10% mutant
controversy arises from the different methods used to
high background cells in specimen;
detect TP53 mutations. The most common method is
mutations outside of
detection of the stabilized mutant protein by IHC. Several
sequenced area
monoclonal antibodies directed at different epitopes in

case, normal tissue will be heterozygous for the mutation, Approximately 5% of breast cancers result from inher-
removing the challenge of isolating pure samples of ited gene mutations, mostly in the breast cancer genes
tumor tissue. Once an inherited mutation is detected, BRCA148,49 and BRCA2.50,51 Women who carry a muta-
further analysis of relatives requires targeting only that tion in BRCA1 have a 60%80% lifetime risk of breast
mutation. or ovarian cancer. Men carrying a mutation, especially
in BRCA2, have a 100-fold increased risk of breast
Ataxia telangiectasia mutated gene, ATM (11q22) cancer compared with men without a mutation, as well
as increased risk of colon and prostate cancer. Both men
Predisposition to cancer is one symptom of the neuro-
and women can transmit the mutation to subsequent gen-
logical disease ataxia telangiectasia (AT). AT occurs in
erations.
at least 1/40,000 live births. This disease is caused by
The BRCA1 gene product has a role in embryonic
mutations in the ATM (A-T mutated) gene on chromo-
development, and both BRCA1 and BRCA2 gene prod-
some 11. ATM mutations are also present in some types of
ucts may also be involved in DNA repair. BRCA1 and
leukemias and lymphomas. Carriers of the autosomal-
BRCA2 interact with the RAD51 protein, possibly as a
recessive mutations in ATM are at increased risk for devel-
complex to repair damaged DNA.52
oping leukemia, lymphoma, or other types of cancers.
SSCP, PTT, ddF (see Chapter 9), and other procedures
The ATM gene product is a member of the phospha-
have been used to screen for mutations in these genes. The
tidylinositol-3 kinase family of proteins that respond to
screening method used for clinical applications, however,
DNA damage by phosphorylating other proteins involved
is direct sequencing. Three mutations, 187delAG (also
in DNA repair and/or control of the cell cycle. The ATM
called 185delAG) and 5382insC in BRCA1 and 6174delT
protein participates in pausing the cell cycle at the G1 or
in BRCA2, occur frequently in particular ethnic popula-
G2 phase to allow completion of DNA repair.
tions.53,54 These known mutations can be easily detected
Direct DNA sequencing is the method of choice for
by a number of targeted assays, including sequence-
detection of ATM mutations, especially in family mem-
specic PCR and allele-specic oligomer hybridization.
bers of carriers of previously identied mutations.
Just as with any genetic analysis, testing for BRCA1
Another method used is SSCP.45,46 A functional test for
and BRCA2 mutations requires thorough patient counsel-
repair of double-strand breaks induced by irradiation is
ing and education.55,56 The signicance of a BRCA muta-
also performed for ATM. For this assay, exponentially
tion will depend on several factors, including penetrance
growing cells are irradiated (1.5 Gy/min), and after 2
of the gene mutations.57 If a mutation is not detected in
hours Colcemid (0.06 g/mL) is added to inhibit spindle
the coding sequences of the genes, the possibility of
formation. The cells are harvested 2 hours later for
mutations in the noncoding regions cannot be ruled out.
Giemsa staining, and the karyotypes are examined. The
ratio of aberrations/cell is calculated from the number of Von Hippel-Lindau gene,VHL (3p26)
chromatid and chromosome breaks (counted as one
Benign blood vessel tumors in the retina were rst
breakage event) in addition to dicentric chromosomes,
reported by Eugen von Hippel, a German ophthalmolo-
translocations, ring chromosomes, and chromatid
gist, in 1895. In 1926, Arvid Lindau, a Swedish patholo-
exchange gures (counted as two breakage events).47
gist, further noted that these retinal tumors were linked to
If a mutation is identied in a patient with ataxia
tumors in the blood vessels in other parts of the central
telangiectasia, other family members may be tested for
nervous system, sometimes accompanied by cysts in the
the presence of the same mutation. Presence of a muta-
kidneys and other internal organs, and that the condition
tion in family members identies those with increased
was heritable. The Von Hippel-Lindau syndrome
risk of AT. Heterozygous carriers of an ATM mutation
(VHL) is now recognized as a genetic condition involv-
may also be at increased risk for mantle cell lymphoma,
ing the abnormal growth of blood vessels in organs, espe-
B-cell lymphocytic leukemia, or T-cell prolymphocytic
cially those that are particularly rich in blood vessels. It
leukemia.
is caused by mutations in the VHL gene, which is located
Breast Cancer 1 gene, BRCA1 (17q21), and Breast on the short arm of chromosome 3. Normally, VHL func-
Cancer 2 gene, BRCA2 (13q12) tions as a tumor suppressor gene, promoting cell differ-

entiation. VHL may also play a role in sensing hypoxia The RET gene is an example of how different muta-
(low oxygen levels in tissues).58 VHL syndrome is a pre- tions in the same gene result in different diseases.
disposition for renal cell carcinoma and other cancers.59 Translocations that result in overexpression of RET are
Deletions, point mutations, and splice site mutations found in thyroid papillary carcinomas. Point mutations
have been described in patients with VHL. In addition, that activate RET (also called MEN2A) are found in inher-
cases of renal cell carcinoma and tumors of the adrenal ited multiple endocrine neoplasia (MEN) syndromes, a
gland are accompanied by varied somatic mutations in group of diseases resulting in abnormal growth and func-
the VHL gene.60,61 Mutations in the VHL gene are de- tion of the pituitary, thyroid, parathyroid, and adrenal
tectable by SSCP, and linkage studies have been reported glands. In contrast, loss of function mutations in the RET
as a method to detect inherited mutations in family mem- gene are found in Hirschsprungs disease, a rare con-
bers.62 Direct sequencing, however, is the preferred genital lack of development of nerve cells in the colon
method of testing for VHL gene mutations. that results in colonic obstruction. Mutations have been
reported in about 50% of congenital cases and 20%
V-myc avian myelocytomatosis viral-related onco-
of sporadic cases of this disorder. Because about 16%
gene, neuroblastoma-derived, MYCN or n-myc
of children with congenital central hypoventilation
(2p24)
syndrome (CCHS) have Hirschsprungs disease, RET
The n-myc gene on the short arm of chromosome 2 mutations were also sought in CCHS. Most of the muta-
(2p24) is amplied in cases of neuroblastoma and tions detected were determined as polymorphic variants,
retinoblastoma. n-myc is an oncogene that is counteracted however.68
by the tumor suppressor gene, neurobromatosis type 1 Detection of RET gene mutations can aid in diagnosis
(NF1). The n-myc gene product is a member of the MYC of MEN diseases.69,70 Clinical testing targets mainly
family of proteins (see c-myc). exons 10, 11, and 16, where most reported mutations
n-myc gene amplication is detectable by FISH or dot have been found. Screening for RET gene mutations has
blot analysis.63-65 Transcription of n-myc may also be been performed by PCR-RFLP, direct sequencing, SSCP,
measured using real-time PCR.66 and denaturing gradient gel electrophoresis (DGGE).70-72
Rearranged During Transfection (RET) proto-onco- Other molecular abnormalities
gene, (10q11)
Increasing numbers of molecular abnormalities are
The RET proto-oncogene is located on the long arm of being used to aid in the diagnosis and monitoring of solid
chromosome 10 (10q11). The RET gene product is a tumors. Some examples of potential diagnostic targets
membrane tyrosine kinase that participates in sending cell are shown in Table 14.4. As molecular aberrations in
growth and proliferation signals to the nucleus.67 The oncogenes and tumor suppressor genes are identied,
RET gene is 55 kb in length. The rst intron in the gene molecular analysis becomes more important in their
covers about 24 kb, with exons 2 to 20 contained in the rapid and accurate detection.
remaining 31 kb. This general structure of a large rst
intron with small exons is characteristic of tyrosine kinase
Microsatellite Instability
receptors, such as the KIT, EGFR, and platelet derived
growth factor (PDGF) receptors. Lynch syndrome, or hereditary nonpolyposis colorectal
cancer (HNPCC), is an inherited form of colon carci-
noma, accounting for about 5% of all colon cancers.73-76
Predisposition to cancer in this syndrome is caused by
Advanced Concepts mutations in the MSH2 and MLH1 genes. Mutations in
The n-myc gene encodes a nuclear protein with a the MSH6 and hPMS2 genes have also been found. These
basic helix-loop-helix (bHLH) domain that dimer- genes are responsible for correcting replicative errors and
izes with another bHLH protein in order to bind mismatched bases in DNA, a process called mismatch
DNA. repair (MMR). The MMR system was originally discov-
ered in bacteria (Escherichia coli) and further studied in

Table 14.4 Molecular Abnormalities in Some Solid Tumors

Gene Location Mutation Detection Method Associated Disease
Adenomatous polyposis 5q21 5q deletion, t(5;10) Southern blot, FISH, Familial adenomatous polyposis
of the colon sequencing, SSCP of the colon
Retinoblastoma (Rb, RB1) 13q14.1 13q deletion, t(X;13) Southern blot, FISH, Retinal neoplasm, osteosarcoma
sequencing
MET proto-oncogene, 7q31 Missense mutations Sequencing Renal carcinoma
hepatocyte growth
factor receptor
KIT proto-oncogene, 4q12 Missense mutations Sequencing Gastrointestinal stromal tumors
stem cell factor
receptor (SCFR)
Folliculin (FLCL, BHD) 17p11.2 Insertions, deletions in Sequencing Birt-Hogg-Dube syndrome (hair
a C8 tract in exon 11 follicle hamartomas, kidney
tumors)
Fumarate hydratase 1q42.1 Frameshift mutations Sequencing Hereditary leiomyomatosis,
renal cell cancer
yeast (Saccharomyces cerevisiae). Similar (homologous)

genes were subsequenctly identied in humans and
named after the bacterial and yeast genes (Table 14.5). MutL PMS2
Their gene products form a protein complex that binds to MutS
MutH
mismatched bases in the DNA double helix or loops
formed by replicative errors. At the end of S phase (DNA
replication), the system recognizes errors in the newly CH3 CH3
synthesized daughter strand and uses the template strand, Exonuclease,
which is methylated, as a guide for repair (Fig. 14-9). SSB,
Helicase
Included in the types of DNA lesions that are repaired
by this system are replication errors (RERs) caused by
CH3 CH3
Table 14.5 Genes of the MMR System Polymerase,
Ligase
Human Gene Bacterial Gene Function
MSH2 MutS Single mismatch, loop repair
MSH3 MutS Loop repair
MSH4 MutS Meiosis CH3 CH3
MSH5 MutS Meiosis
Figure 14-9 The mismatch repair system recognizes
MSH6/GTBP MutS Single mismatch repair
a mismatch (top) in the newly synthesized unmethylated
MLH1 MutL Mismatch repair strand of DNA. The complex of proteins recruits exonu-
hPMS2 MutL Mismatch repair (postmeiotic cleases, single-strand DNA binding proteins (SSB),
segregation in yeast) and helicases to remove the erroneous base (center).
hPMS1 MutL Mismatch repair (postmeiotic Polymerases and DNA ligase then replace the
missing bases.
segregation in yeast)

TTTTTTT
AAAAAAA
TTTTTTT
Replication TTTTTT
AAAAAAA error AAAAAA
T TTTTT
A
AAAAAA TTTTTTT
AAAAAAA
Figure 14-10 Replication errors result from slippage during DNA replication. If the error is
not repaired, the next round of replication will create a new allele (top, right) of the original
locus. Additional uncorrected errors will produce more alleles.
slippage between the replication apparatus and the DNA peaks in the tumor tissue compared with the normal tis-
template (Fig. 14-10). RERs occur especially in sue) is strong evidence for HNPCC.
microsatellites where 13 nucleotides are repeated in the The National Cancer Institute has recommended that
DNA sequence (see Chapter 11). If the errors remain in screening two mononucleotide repeat loci, BAT25 and
the DNA until the next round of replication, new alleles BAT26, and three dinucleotide repeat loci, D5S346,
will arise, generating increasing numbers of alleles for the D2S123, and D17S250, is sufficient for determination of
locus, or microsatellite instability (MSI). In contrast, a MSI.79 Alternate markers have been proposed, and some
stable locus will retain the same alleles through many laboratories test additional loci to ensure amplication
rounds of replication. Microsatellite slippage occurs of at least ve loci.80,81 Further, mononucleotide repeat
about every 1000 to 10,000 normal cell divisions, most of structures may be more sensitive markers for MSI than
which are repaired in normal cells. Dysfunction of one or dinucleotide repeats, so that some laboratories prefer
more components of the MMR system will result in MSI, mononucleotide repeat loci.
an increase in the number of alleles due to loss of repair. If at least two of the ve or the majority of loci show
The majority of MMR mutations in HNPCC are found in instability, the specimen is classied as high instability
the MSH2 and MLH1 genes. Mutations in hPMS2 account (MSI-H). Tumors showing MSI in one or a minority of
for fewer than 1%, and mutations in hPMS1 and MSH3 loci tested are classied as low instability (MSI-L). If no
are rare. Although direct sequencing of the affected genes MSI is detected in the loci tested, the tumor is stable
is denitive and identies the specic mutation in a fam- (MSS). With the present state of clinical correlation,
ily, the test is expensive and may miss mutations outside MSI-L and MSS tumors are interpreted as microsatellite-
of the structural gene sequences or in other genes.77,78 stable, and MSI-H tumors are considered microsatellite-
About 90% of HNPCC cases display MSI. Because unstable. MSI-H is reported as MSI-unstable with an
loss of MMR gene function causes MSI, MSI can be used
to screen indirectly for mutations in the MMR genes. If a
person has inherited a mutation in one copy of an MMR N = Normal
T = Tumor
gene, somatic mutation of the remaining copy will result N T N T N T
in the MSI phenotype in the tumor cells. MSI, therefore,
will be apparent in the tumor where both functional
copies of the gene have been lost but not in normal tissue
that retains one normal copy of the gene. To perform
this test, therefore, normal and tumor tissue from the
patient must be compared. MSI is apparent from the
increased number of alleles in the tumor tissue com-
pared with that in the normal tissue. MSI is detected by
PCR amplication of microsatellite loci and gel elec- Unstable loci (MSI)
trophoresis (Fig. 14-11) or capillary gel electrophoresis Figure 14-11 Microsatellite instability (MSI) is detected by
(Fig. 14-12). The detection of instability (more bands or increased alleles compared with stability at the same locus.

ber tandem repeats (VNTR) loci closely linked to the dis-

ease gene. Amplication of loci in tumor cells with LOH
N will reveal a loss of the allele linked to the normal allele
of the gene when compared with the mutant allele (Fig.
14-13). Comparing peak heights in normal (N) and tumor
(T) tissues, the formula for LOH is:
T
(peak height of normal allele in N/peak height of normal allele in T)
(peak height of mutant allele in T/peak height of mutant allele in N)
N A ratio of less than 0.5 or more than 2 indicates LOH.
Alternately, LOH is assumed if the peak height of the
normal allele in the tumor is less than 40% of the height
T of the normal allele in the normal DNA.
Gene Rearrangements in
N
Leukemia and Lymphoma
Gene rearrangements analyzed for hematological malig-
nancies include V(D)J recombination, the normal intra-
T chromosomal rearrangements in B and T lymphocytes as
well as the abnormal interchromosomal translocations
that can occur in any cell type.
Figure 14-12 MSI detected by capillary gel electrophoresis.
DNA from tumor (T) is compared with DNA from normal cells
from the same patient (N). Increased alleles in the tumor Homologous chromosomes
scans reveal instability at those loci (top four scans). Stable
loci look the same in normal and tumor tissue (bottom two Normal
Normal Mutant
scans).
allele allele
Fluorescence
STR Diseased gene
increased likelihood that the patient has HNPCC.79 If
MSI is discovered, the inherited mutation can be con-
rmed by immunohistochemistry and/or direct sequenc-
ing of the MLH1, MSH2, and/or MSH6 genes.82 Normal
Loss of Heterozygosity Tumor

Normal Mutant
Once a gene mutation is identied in a family, targeted allele allele
resequencing is used to test for the mutation in other fam-
Fluorescence
ily members. In an inherited condition such as HNPCC

or inherited breast and ovarian cancer, blood samples are
sufficient for mutation analysis in unaffected individuals.
In tumor cells, further testing for loss of heterozygosity
(LOH) may be performed. LOH reveals the loss of the Figure 14-13 Loss of heterozygositiy (LOH) is detected by
PCR and capillary electrophoresis of heterozygous STR loci
good allele at a locus, uncovering the homologous linked to disease genes. A deletion or loss of the normal
locus with a recessive mutation. LOH can be detected by allele uncovering a recessive mutant allele is identied by
PCR amplication of heterozygous STR or variable num- the loss of the STR linked to the normal gene (right).

Mature
Early B cell precursors Pre-B cell B cell
plasma cell
IgH GR IgH GR IgL GR IgH + IgL GR
Lymphoid
Early thymocytes Common
stem cell
thymocytes
Cytotoxic T cell
TCR and GR TCR and GR
Helper T cell
Figure 14-14 Gene rearrangements (GR) are normal processes that occur in B and T lymphocytes as they
mature from lymphoid stem cells. The genes coding for immunoglobulin heavy and light chains (IgH and IgL,
respectively) begin the rearrangement process in early B cells and preB cells. The T-cell receptor (TCR) genes
rearrange in the order , , , and chains.
V(D)J Recombination body protein (Fig. 14-15). These include 123129 vari-
able (VH) regions (3846 functional gene segments) and
To develop antibody diversity, lymphocytes undergo 9 joining (JH) regions (6 functional), one of which will
normal genetic rearrangement of immunoglobulin (Ig) connect one variable region with a constant (CH) region of
heavy and light chain genes and T-cell receptor genes the antibody or receptor. There are 11 constant regions (9
(Fig. 14-14). The gene rearrangement process is a series functional). The immunoglobulin heavy chain gene also
of intrachromosomal recombination events mediated by contains 27 diversity (DH) regions (23 functional), one of
recombinase enzymes that recognize specic sequences which will connect the variable and joining regions. The
anking the gene segments. This process occurs inde- V segments are each preceded by a leader region (L). The
pendently in each lymphocyte, so that a repertoire of anti- leader region codes for a short sequence of amino acids
bodies is available to match any random invading antigen. found on the amino terminus of the protein that mark the
antibody for secretion or membrane insertion.
Immunoglobulin Heavy Chain As B lymphocytes mature, selected gene segments are
Gene Rearrangement in B Cells joined together so that the rearranged gene contains only
Each antibody consists of two heavy chains and two light one of each VH, DH, and JH segment (see Fig. 14-15).
chains. The locus coding for the immunoglobulin heavy Initially, one DH and one JH segment are joined together.
chain is located on chromosome 14. The unrearranged, or The DNA between the two segments is looped out and
germline, conguration of the immunoglobulin heavy lost. The DH-JH rearrangement occurs in both alleles of
chain locus consists of a series of gene segments or the heavy chain gene locus on both chromosomes. Then
repeated exons coding for the functional parts of the anti- in only one allele, a VH segment is chosen and joined to

Germline
L VH1 L VHN DH JH C
Advanced Concepts
The constant region determines the isotype of the
antibody IgM, IgD, IgG, IgE, or IgA. Each cell can
make only one heavy chain protein, although the
isotype of the heavy chain may change. A mature B
cell will initially produce IgD and some membrane
IgM that will migrate to the cell surface to act as the
antigen receptor. Upon antigen stimulation, the B
L V DJ C cell will differentiate into a plasma cell expressing
large amounts of secreted IgM. Some cells will
Figure 14-15 Immunoglobulin heavy chain gene on chro- undergo a class-switch recombination, placing the
mosome 14 consists of a series of variable (V), diversity (D), VDJ gene next to the genes encoding the IgG, IgE,
and joining (J) gene segments (germline conguration). The V or IgA constant regions. The B cells will express a
segments are accompanied by a short leader region (L). One
of each type of segment, V, D, and J, is selected and com-
different isotype during the secondary response.
bined by an intrachromosomal recombination event, rst D Most commonly, IgM (primary response) gives way
and J, and then V and D. The C (constant) segments are to IgG (secondary response). Production of IgE or
joined through splicing or a secondary recombination event, IgA instead of IgG can also occur, although the reg-
class switching. ulation of these switching events is not well under-
stood. Class switching is mediated by different
recombinase enzymes than those responsible for
the DH segment. The completion of the gene rearrange- VDJ recombination.
ment process on only one of the two immunoglobulin
heavy chain gene alleles is referred to as allelic exclusion.
The rearrangement on the other chromosome will proceed
if the rst rearrangement fails or is not productive. by a secondary recombination event (class switching).
When the DNA is cut in the process of the gene The maintenance of the constant regions in the DNA
rearrangement, terminal deoxynucleotidyl transferase allows for antibody-type switching during the immune
may add nucleotides at the V-D-J junctions, further diver- response.
sifying the coding sequences of individual antibody
genes. After the V(D)J rearrangement occurs, the gene is Immunoglobulin Light Chain
transcribed, and one of the constant regions is joined Gene Rearrangement in B Cells
to the nal messenger RNA by splicing or, alternatively, Like the Ig heavy chain gene on chromosome 14, the Ig
light chain genes consist of a series of gene segments in
the germline conguration (Fig. 14-16). Two separate
genes code for the Ig light chains, the kappa locus on
Advanced Concepts chromosome 2 and the lambda locus on chromosome 22.
At the kappa locus, there is a single constant gene seg-
The recombination events of the gene rearrangement, 5 joining (J) gene segments and at least 76 vari-
ment are mediated by recombination activating able (V) gene segments (3035 functional) belonging to
genes RAG1 and RAG2. These genes code for 7 sequence-related families.83,84 In addition there is a
enzymes that recognize short recombination signal kappa deleting element (KDE) located 24 kbp 3 to the
sequences in the DNA where they form a complex constant region. This element determines deletion of the
that initiates the cutting and religating of the DNA. Ig constant region in cells producing Ig lambda light
chains. The Ig lambda gene locus consists of 52 variable

(A)
V315 V311 V210 V19 V18 V37
V16 V15 V24 V73 V52
V41 J15 IgKC KDE
(B)
V170 V163 V150 V949 V548 V147 V746
V545 V144 V74 V142 VVII411 V141 V140 V138 V537 V136
V736 V234 V321 V120 V319
V218 V317 V316 V43 V32 V31 J1 C1
J2 C2 J3 C3 J4 C4 J5 C5 J6 C6 J7 C7
Figure 14-16 Immunoglobulin kappa (A) and lambda (B) light chain loci consist of gene segments for variable (V),
joining (J), and constant (C) regions. The variable regions are classied into sequence-related families (V1-Vn). Each
member of the family is given a number; for example, V7-4 is the fourth member of the V7 sequence family. Some of
the gene segments are nonfunctional (open boxes). Recombination sites (triangles) are juxtaposed to each gene seg-
ment. Arrows denote primer binding sites for PCR clonality testing.
(V) gene segments (2933 functional) from 10 V fami- During differentiation of the B cells from precursor
lies and 7 J (45 functional) and 711 C gene segments stem cells, rearrangement, recombination, and mutation
(45 functional) occupying 1140-kb of DNA.85 of the immunoglobulin V, D, and J regions ultimately
Immunoglobulin light chain gene rearrangement is results in functional VJ (light chain) and VDJ (heavy
similar to that described for the immunoglobulin heavy chain) genes.
chain gene. Selected gene segments are joined together
with loss of the intervening DNA and possible insertion T-Cell Receptor Gene Rearrangement
of nucleotides at the junction. The kappa locus rearranges The T-cell receptor is composed of two of four chains, ,
rst and then the lambda locus, if necessary. If the , , and , with characteristic structures resembling
lambda locus rearranges, the kappa locus undergoes a immunoglobulin V, J and C regions (Fig. 14-17). The
secondary recombination through the KDE so that the and chains are encoded on chromosome 14 (the gene
cell does not produce both types of light chains. is located inside of the gene), and and are located


Antibody diversity is ensured by three separate The T-cell receptor gene is anked by TCR
events during and after the gene rearrangement deleting elements. Recombination between these
process. The rst is the selection of gene segments. elements or between V and J result in deletion of
The second is the imprecise joining of the segments the TCR gene.
together with addition of nucleotide bases at the
junction.140 Third, after the gene rearrangement
process has nished and the B cell has encountered
antigen, somatic hypermutation occurs in the vari- Rearrangement of the T-cell receptor chains proceeds
able regions of the rearranged heavy and light chain in a similar manner as in the immunoglobulin genes. The
genes. This mutation process requires the action of V, (D), and J segments are joined together with addition
an enzyme called activation-induced cytidine deam- or deletion (trimming) of nucleotides at the junctions
inase, altering C residues to base pair with A instead between the gene segments.
of G residues, resulting in different amino acid sub- The extracellular domains of the T-cell receptor dimers
stitutions in the antibody protein. Changing of the are held in conformation by interchain disulde bridges
variable region sequences underlies the process of between cysteine residues in the T-cell receptor peptides.
affinity maturation. As the B cells replicate, those The T-cell receptor chains also have a hydrophobic trans-
producing antibodies with greater affinity to the membrane region and a short cytoplasmic region.
antigen are favored, generating subclones of cells Although most cells express the receptor, recep-
that may replace the original reactive clone. Over tors can represent a predominant population in certain
the course of an infection, therefore, antibodies with tissues, such as the intestinal tract.
increased affinity are produced.
Detection of Clonality
Gene rearrangements occur independently in each lym-
on chromosome 7. The four chains form pairs, making phocyte so that a normal population of lymphocytes is
two types of receptors, and . T-cell receptor genes polyclonal with respect to their rearranged immunoglob-
have fewer variable gene segments than the immunoglobulin or T-cell receptor genes. Over-representation of a
ulin genes, and the genes for the and chains have no single rearrangement in a specimen cell population can
diversity regions (Table 14.6). The V regions of the recep- be an indication of and characteristic for a lymphoma or
tor chains undergo gene rearrangement by intrachromoso- leukemia. When over 1% of cells make the same gene
mal recombination as described for the immunoglobulin rearrangement, the cell population is referred to as mon-
genes (Fig. 14-18). oclonal with respect to the rearranged genes.
D J
V V 1 2 1 2 C V J J2 C
V
1 2 VN D1 J1 C D2 J2 C2 V
V
1 2 3 4 5 6 7 8 VA 9 10 B 11 JP1 J J1 C1 JP2 J2 C 2
Figure 14-17 General structure of the T-cell receptor genes. The gene for
the delta T-cell receptor chain is contained in the alpha locus (top). The beta
and gamma chains are located at separate loci.

V1 2 3 4 5 6 7 8 VA 9 10 B 11 JP1 JP J1 C1 JP2 J2 C2
Figure 14-18 T-cell receptor gamma

gene rearrangement occurs through
selection of variable (V) and joining (J) V1 2 3 4 5 6 7 8 VA 9 J2 C2
segments.
are visible for two reasons. First, a normal patient speci-

Advanced Concepts men contains cells other than lymphocytes that do not
undergo gene rearrangement. The second reason for the
It is important to distinguish a large monoclonal presence of the germline bands is that only one chro-
population of tumor cells from a reactive clone or mosome in a lymphocyte undergoes gene rearrangement,
oligoclone or reactive clone of cells responding to leaving the homologous chromosome in the germline
an antigen. Oligoclones are not only smaller but state. If the rst rearrangement fails or is unproductive,
transient in nature so that they should not be consis- then the second chromosome will rearrange. This occurs
tently present in serial analyses. in fewer than 10% of lymphocytes for the heavy chain
gene.
In a normal specimen, there will be millions of immu-
noglobulin gene rearrangements so that no one rearrange-
Immunoglobulin Heavy Chain ment is present in high enough amounts to be visible as
Gene Rearrangements non-germline bands on the membrane or autoradiogram;
Clonality can be detected by Southern blot.86-88 With thus, only the germline bands will be visible. If, however,
regard to the immunoglobulin heavy chain gene, restric- 2%5% of the cells in the specimen consist of a clone of
tion sites are mapped in the germline conguration. cells all with the same gene rearrangement, that clone will
BamH1, EcoR1, and HindIII are enzymes commonly be detected by the presence of additional bands different
used for this procedure (Fig. 14-19). When the germline from the germline bands (Fig. 14-20). Interpretation of
sequence is rearranged, the restriction sites are moved, the results is positive if extra bands are present and nega-
created, or deleted, resulting in a unique restriction pat- tive if only the germline bands are present.
tern for every gene rearrangement. DNA cut with the
restriction enzymes is transferred to a nitrocellulose
membrane and probed to the joining region of the gene. HindIII
11 kb
HindIII
Normal results should reveal the expected fragments
18 kb
generated from the germline DNA, in the example, an BamHI BamHI
18kbp EcoR1 fragment, an 18 kbp BamH1 fragment, and
L VH1 L VHN DH JH C
an 11 kbp Hind III fragment. The normal fragments
18 kb
Table 14.6 T-Cell Receptor Gene Segments EcoRI EcoRI
T-Cell Variable Diversity Joining Constant

Receptor Gene Gene Gene Gene
Chain Segments* Segments Segments* Segments Labeled probe
54/45 0 60/50 1 Figure 14-19 Restriction map of the germline immunoglob-
67/47 2 14/13 2 ulin heavy chain gene. The fragments indicated by the arrows
will be detectable with the probe shown at the bottom. Gene
3 3 4 2
rearrangement will affect the placement of the restriction sites
14/6 0 5 2 such that fragments of different sizes will be generated from a
*Total gene segments/functional gene segments rearranged gene.

DNA from the specimen. This is not always available,

Advanced Concepts either because the specimen is limiting with respect to
cell number or it is in poor condition as in paraffin-
Three enzymes are used for this assay to avoid false- embedded specimens. Moreover, artifacts such as cross-
positive results due to cross-hybridization artefacts hybridizations may complicate interpretation of Southern
(see Chapter 6). The chance of true rearranged blot results.
bands being identical to cross-hybridization patterns Gene rearrangement monoclonality at the immuno-
for all three enzymes is negligible. In addition, globulin heavy chain gene locus is also analyzed by PCR.
cross-hybridization patterns are constant with the For this method, forward primers complementary to the
same hybridization conditions, in contrast to true variable region and reverse primers to the joining or con-
monoclonal gene rearrangement bands that differ stant regions of the B cellrearranged genes are used.89
for each monoclonal population. The resulting amplicons are resolved by agarose, poly-
acrylamide or capillary electrophoresis. A normal cell
population will yield amplicons consisting of fragments
Analysis of clonality by Southern blot affords the of different lengths, yielding a cloud or smear of bands.
advantage of detecting all gene rearrangements, including A monoclonal cell population will yield a predominant or
incomplete rearrangements involving only the D and J single band. The presence of the band is interpreted as a
regions of the gene. The Southern blot method is limited positive result.
by the requirement for at least 2030 g of high-quality For immunoglobulin heavy chain gene rearrangement,
different approaches to the variable region primer bind-
ing sites have been taken (Fig. 14-21). The immunoglob-
ulin heavy chain gene variable region is divided into two
types of domains. The complementarity determining
regions (CDRs) code for the amino acids that will con-
tact the antigen. The CDRs, therefore, are the most vari-
able, or unstable, in sequence. The framework regions
(FRs) code for the amino acids that have more of a struc-
tural role in the antibody protein and are more stable in
Advanced Concepts
The main limitation to detection of clonality by
PCR is the loss of the FR3 primer binding site due
to the gene rearrangement process that may destroy
or remove the sequences bound by the FR3 primer.
To address this issue, some laboratories use addi-
tional forward primers that bind to framework 2
(FR2) and framework 1 (FR1). Other methods uti-
Figure 14-20 Colorimetric results from an immunoglobulin
lize primers to the leader region in addition to the
heavy chain gene rearrangement test by Southern blot with FR primers.92,141,142 These primers increase the
colorimetric detection. Lane 1, molecular weight markers. number of gene rearrangements that can be ampli-
Lanes 2, 6, and 8 show the normal 18-kbp, 18-kbp, and 11-kbp ed and therefore detected by this assay. If the gene
bands expected from the germline gene in a normal speci-
rearrangement cannot be amplied, clonality at the
men cut with EcoR1, BamH1, and HindIII, respectively. Lanes 3,
6, and 9 show patient DNA with a monoclonal cell popula-
immunoglobulin heavy chain gene locus cannot be
tion. Lanes 4, 7, and 10 show a patient with no detectable used for diagnosis or monitoring.
monoclonality.

L V DJ C L V DJ C
FR1 CDR1 FR2 CDR2 FR3 FR1 CDR1 FR2 CDR2 FR3
DH7
Amplification
Figure 14-22 Immunglobulin heavy chain gene rearrange-
ment by PCR with amplication from the diversity region.
Forward primers complementary to the diversity region and
reverse primers complementary to the joining region yield a
polyclonal pattern in normal samples. The DH7 primer will yield
a specic 350-bp product from the unrearranged (germline)
Amplification products gene due to the short distance between the DH7 gene seg-
ment and the joining region primer.
5-most joining region (JH1) are used to amplify the

DH-JH junction. The primer complementary to the DH7-27
segment, the sequences closest to the joining region, will
yield a dened product from the Ig heavy chain gene in
the germline conguration (Fig. 14-22). Diversity region
primers are also useful for targeting incomplete rear-
Figure 14-21 Immunglobulin heavy chain gene rearrange- rangements where the variable region primer binding
ment by PCR with amplication from the variable region. sites are lost91,92
Forward primers complementary to the variable region Another approach to the detection of B-cell clonality is
and reverse primers complementary to the joining region are to make patient-specic primers. For this method, a con-
used to amplify the diversity region (top). In a polyclonal
sensus primer is used to amplify the rearranged gene from
specimen, amplication products in a range of sizes will result.
These products produce a dispersed pattern on an ethidium a positive specimen. The amplication product is then
bromidestained agarose gel (lanes 4, 8, 11). If at least 1% of puried from the gel or from the PCR reaction mix and
the sample is representative of a monoclonal gene sequenced. Primers exactly matching the variable region
rearrangement, that product will be amplied preferentially sequence of that specimen are then manufactured for use
and revealed as a sharp band by gel electrophoresis
on subsequent samples. The advantage of this method is
(lanes 3, 6, 9, and 10).
that it is more sensitive, as fewer or none of the gene
rearrangements from normal cells are amplied. Further-
sequence. Standard methods for clonality utilize a for- more, the tumor load can be measured quantitatively by
ward consensus primer to the innermost framework real-time PCR. The disadvantage of this approach is that
region (FR3) and the reverse primer complementary to the method is more time-consuming to perform, and the
the joining region. The consensus primer has sequences primers used are patient-specic. Moreover, in a patient
that match the most frequently occurring sequences in with a chronic condition, for whom monitoring is likely
the FR3 region and may not be identical to any one to be done, tumors cells may undergo mutation in the
sequence. Enough nucleotides will hydrogen-bond, how- variable region and inactivate the specic primer binding,
ever, to match most rearranged variable regions. requiring manufacture of new primers.
Primers directed at the diversity region are useful for
amplication of the germline conguration of the immu- Immunoglobulin Light Chain
noglobulin heavy chain genes as well as DH-JH rearranged Gene Rearrangements
genes.90 Primers complementary to the 7 family-specic The immunoglobulin light chain genes are also targets for
sequences of the diversity region and a primer to the clonality detection.9395 In addition to Southern blot, PCR

and RT-PCR have been used to detect light chain gene J1 C3

clonality. Targeting the immunoglobulin light chain genes
is especially useful for tumors arising from terminally V J Intron C
differentiated B cells (plasma cells) that have undergone
extensive somatic hypermutation at the heavy chain gene V1
locus. In these tumors, the rearranged heavy chain genes Figure 14-24 The immunoglobulin light chain lambda
are frequently unampliable, yielding false-negative locus can be amplied by standard PCR procedures from the
variable region to the joining region or the constant region.
results because of accumulation of base changes in the
Reverse transcriptase PCR is used with the constant region
variable region primer binding sites. Most of these tumors primers to eliminate the intron between the constant and
are ampliable, however, at the light chain genes.96 joining regions.
Gene rearrangements in the kappa light chain locus are
amplied using primers complementary to the sequence
families of the V region or to the intron between the J ments by Southern blot and PCR.99101 For Southern blot
regions and C. Opposing primers are complementary to studies, probes complementary to the variable, joining,
C and to one or more of the ve joining regions. and diversity regions of the T-cell receptor genes are used
Alternately, the KDE can be used for a primer binding to detect monoclonal populations. Just as with immuno-
site (Fig. 14-23). Using the KDE allows detection of globulin gene rearrangements, no one gene rearrange-
lambda-expressing cells that have deleted J or C.97 ment should be visible in a normal specimen. The
Approximately one-third of B-cell malignancies have presence of a large monoclonal population is revealed by
Ig gene rearrangements.98 Ig gene rearrangements are the bands detectable in addition to the germline bands
also present in 5%10% of kappa-expressing B-cell seen in the normal control (Fig. 14-25).
tumors. Therefore, detection of clonality at the Ig locus The T-cell receptor gene rearrangement assays done
on chromosome 22 is also useful for conrming or mon- by PCR target most often the TCR gene. Assays are
itoring diagnosis of B-cell leukemias and lymphomas. also performed on the TCR and TCR genes. Detec-
Forward primers complementary to V gene segments tion of gene rearrangements in TCR is difficult due
and reverse primers to the J and C gene segments are to the 85-kb length of the J gene segments. TCR gene
frequently used for these assays (Fig. 14-24). rearrangements may be inferred from TCR gene dele-
tions.101 Primers are designed complementary to the
T-Cell Receptor Gene Rearrangements rearranged gene segments (Fig. 14-26). Multiple primer
T-cell receptor gene rearrangements are performed in a sets are often used to ensure detection of the maximum
manner similar to the immunoglobulin gene rearrange- potential gene rearrangement.102 PCR will yield a pro-
VK JK Intron CK
VK2 VK4 VK5 VK3 VK6 VK7
VK JK Intron CK KDE
Figure 14-23 The immunoglobulin light chain

kappa locus can be amplied by standard PCR
VK KDE VK JK Intron KDE
procedures from the variable region, the intronic
region, or the kappa deleting element.

1 2 3 4 5 6 7 8 9 10 11
Figure 14-25 T-cell receptor gene rearrangements

detected by Southern blot using a probe mixture of Figure 14-27 T-cell receptor gene rearrangement
sequences complementary to J1and J2. Lane 1, by PCR and heteroduplex analysis. Bands were separated
molecular weight markers. Lanes 2, 5, and 8, normal by polyacrylamide gel electrophoresis and stained with
control cut with EcoR1, BamH1, and HindIII, respectively. ethidium bromide. Lanes 2 and 4 show a polyclonal
Lanes 3, 6, and 9, a negative specimen cut with EcoR1, pattern. A positive result (monoclonal pattern) is shown
BamH1, and HindIII, respectively. Lanes 4, 7, and 10, in lane 3. Lane 1, molecular weight marker; lane 5
positive specimen cut with EcoR1, BamH1, and HindIII, reagent blank.
respectively. Note the additional bands in the positive
specimen lanes.
used to improve resolution of the polyclonal and mono-
clonal patterns.103
duct consistent with a single gene rearrangement in a
positive sample, whereas a normal sample will yield a Banding Patterns
polyclonal pattern (Fig. 14-27). Due to the limited range Interpretation of clonality by PCR depends on gel band-
of lengths of the population of rearranged T-cell receptor ing patterns. False-negative results may arise from
genes, heteroduplex analyis, SSCP, or DGGE may be primers that do not match the gene rearrangement in
the tumer. False-positive results arise from artifactual
J single bands. Patterns of multiple single bands may arise
from specimens with low cell numbers, such as cere-
brospinal uids or paraffin sections. In this case, usually
more than one or two single bands occur. The bands
V D1 D2 may not indicate monoclonality, rather that only a few
D3 J cells are present. These cells may or may not be malig-
nant. False single band patterns may also occur within
polyclonal smears detected by nondenaturing polyacry-
lamide gels (PAGEs). Heteroduplex analysis is recom-
V D2 mended if amplicons are resolved by nondenaturing
J1 J2
PAGEs.
Similar problems may arise with resolution by capillary
electrophoresis where peak heights and widths are com-
V1 V9 V10 V11 pared to distinguish wide polyclonal peaks from narrow
Figure 14-26 T-cell receptor gene rearrangements monoclonal spikes.104 Pretreatments such as eosin stain-
detected by PCR use primers to the variable, diversity, ing may yield false single bands by capillary elec-
and joining regions of the rearranged genes. trophoresis.105

Translocations in chain gene. The translocation may occur through cryptic

Hematological Malignancies recognition sites for the gene rearrangement recombinase
enzymes on chromsome 18. As a result, an abnormal
Gene rearrangements in immunoglobulin and T-cell interchromosomal exchange occurs, instead of the nor-
receptor genes are normal and take place regardless of mal intrachromosomal exchange events described in the
the presence of malignancy. The unique nature of the previous section (Fig. 14-28). There are several break-
gene rearrangement system with cell-specic antibody points in the chromosome 18 region 3 to the BCL2 gene,
and antibody receptor formation are exploited in nding most of which occur in the major breakpoint region
abnormal cell populations clonally derived from these (MBR). About 10%20% of the breakpoints fall into a
cell-specic features. Targeting these gene rearrange- cluster closer to the BCL2 gene, thousands of bases from
ments, however, can only be applied to tumors arising the MBR, in the minor cluster region (MCR). An inter-
from lymphocytes. Other types of malignancies, such as mediate cluster region (ICR) and other breakpoints out-
myeloid tumors, cannot be analyzed using these targets. side of MBR and MCR have also been reported.106,107
Often, development of the cancer state results in DNA Molecular detection of the t(14;18) translocation is
anomalies, such as translocations or other types of muta- performed by Southern blot or PCR. For Southern blot, a
tions, that can be applied to clinical discovery and moni- probe to the MBR region of chromosome 18 will reveal
toring of tumors. These abnormal genetic events aid in the translocation by the presence of bands different from
diagnosis of specic types of hematological tumors, such those expected from normal chromosome 18 (Fig. 14-29).
as the translocations that are highly associated with The Southern blot procedure has the advantage of detect-
chronic myelogenous leukemia, promyelocytic leukemia, ing all breakpoints. The translocation is more easily and
or follicular lymphoma. Mutations or disruptions of rapidly detected by PCR. Forward primers to chromo-
expression of tumor suppressor genes and oncogenes are some 18 and reverse primers complementary to the Ig
usually involved in hematological malignancies, which heavy chain joining region will yield a product only if the
has helped to determine the molecular events leading to two chromosomes have been joined by the translocation.
the tumor phenotype. The amplicons are visualized by gel electrophoresis as
Translocations are the exchange of DNA between chro- shown in Figure 14-30 or by capillary electrophoresis, the
mosomes (see Chapter 8). If the translocation disrupts latter method requiring uorescent labeling of one of the
activity or expression of oncogenes or tumor suppressor PCR primers.
genes, a cancer phenotype can occur. Several transloca- The t(14;18) translocation can also be detected using
tions are frequently found in certain types of tumors. real-time PCR. Several methods are available for this
t(14;18)(q32;q21) analysis, and although laboratory methods differ, results
are reasonably consistent in comparison testing.108,109
The reciprocal translocation between the long arms of
chromosomes 14 and 18 moves and disregulates the
IgH
BCL2 gene located on chromosome 18q21.3. BCL2 (B-
Chromosome 14
cell leukemia and lymphoma 2 or B-cell CLL/lymphoma X
2) is an oncogene. The gene product of BCL2 is a mem-
ber of a group of related proteins that control apoptosis BLC 2
Chromosome 18
(cell death initiated by internal cellular signals). The Bcl2
protein inhibits apoptosis in B lymphocytes, that is,
enhances survival of cells that normally would die.
BLC 2 IgH
Survival of genetically damaged cells may contribute to
t(14;18) translocated chromosome
the development of tumors. One of the most frequent
Figure 14-28 The t(14;18) translocation moves the BCL2
hematological malignancies, follicular lymphoma, is
gene intact to the long arm of chromosome 14 next to the
associated with the t(14;18) translocation. joining region of the immunoglobulin heavy chain gene (IgH).
The translocation partner of chromosome 18 is chro- The translocation breakpoints on chromosome 18 are 3 to the
mosome 14 in the vicinity of the immunoglobulin heavy BCL2 gene (arrow indicating the direction of transcription).

Most methods include a standard curve for regression

analysis of the test sample measurements (Fig. 14-31).
Alternatively, internal controls, such as known amounts
of plasmid DNA, may be added to the test specimens. In
this method, the amount of translocated cells (or translo-
cated chromosomes) is determined relative to the internal
control. There are several approaches to reporting nal
results. Most frequently, results are reported as percent
translocated cells in the specimen tested. For instance,
the raw number of translocated cells is determined by lin-
ear regression analysis (using the formula y mx b).
The raw number of cells is then divided by the number of
total cells represented in the PCR reaction.
For example: for a dilution series ranging 5010,000
translocated cells in 1 million untranslocated cells, the
standard curve generates the formula y 1.5631Ln(x)
42.396, where y is the threshold cycle number (see
Chapter 7) and x is the number of translocated cells (50
ng of DNA was used per sample). Using this formula, if
a given sample crosses the uorescent threshold at y
Figure 14-29 Analysis of the t(14;18) gene translocation by 36 cycles (average of duplicate measurements), the num-
Southern blot with chemiluminescent detection. Lanes 3, 6, ber of cells (x) is approximately 60 cells. Assuming that
and 9 are the normal control cut with EcoR1, BamH1, and
50 ng of DNA represents 7500 cells (1 ng of DNA
HindIII, respectively. Lanes 1, 4, and 7 show results from a nor-
mal patient specimen. Lanes 2, 5, and 8 are results from a
approximately 150 cells), 60/7500 0.008. 0.008
100
specimen positive for the t(14;18) translocation. Note the 0.8% translocated cells in the specimen. For the
extra bands in the positive specimen. t(14;18) translocation, sensitivities of 0.0025% have been
JH primers
BLC2 gene IgH
MBR primers MCR primers
Figure 14-30 Analysis of the

t(14;18) gene translocation by PCR
with agarose gel electrophoresis.
Several primers are used for detec-
tion of the translocated chromosome
(top). Because the forward primers
are on chromosome 18 and the
reverse primers are on chromosome
14, a PCR product will be generated
only from the t(14;18) translocated
chromosome (bottom). M, molecular
weight marker; , positive specimen;
-, negative specimen; P, positive
control; S, sensitivity control; N,
negative control.

40 include an estimation of false-negative results expected

due to breakpoints that remove the binding sites for the
35
primers used. Unless a translocation has been previously
Cycle
30
observed by a given PCR method, a negative result may
be reported as indeterminate, acknowledging that a
25 translocation may be present but undetectable with the
10 100 1000 10,000 primers used.
Cells
t(9;22)(q34;q11)
The t(9;22) translocation is a reciprocal exchange
between the long arms of chromosomes 9 and 22. The
translocation generates the Philadelphia chromosome
(Ph1), which is present in 95% of cases of chronic myel-
Figure 14-31 t(14;18) translocation analysis by real-time
ogenous leukemia (CML), 25%30% of adult acute lym-
PCR. A standard curve is established using cultured cells with phoblastic leukemia (ALL), and 2%10% of pediatric
the t(13;18) translocation (Dhl-6) counted and diluted into cul- ALL. The breakpoints of the t(9;22) translocation occur
tured cells without the translocation (HL-60). The results shown within two genes, the breakpoint cluster region (BCR)
are from DNA isolated from each mixture of cells and ana- gene on chromosome 22 and the cellular counterpart of
lyzed by real-time PCR using a TaqMan probe.
the Abelson leukemia virus tyrosine kinase (c-abl) on
chromosome 9 (Fig. 14-32). The result of the transloca-
tion is a chimeric or fusion gene with the head of the
reported, with a linear range of 0.01%10%.110 Data are BCR gene and the tail of the c-abl gene. Both genes are
accumulating to determine the clinical signicance of the tyrosine kinases; that is, they phosphorylate other genes
qualitative and quantitative results.111113 at tyrosine residues. The fusion gene is also a kinase but
The main limitation of any PCR procedure targeting has aberrant kinase activity.
the t(14;18) translocation is the inability of the primers to There are two major forms of the BCR/ABL fusion
detect all of the possible breakpoints on chromosome 18. gene, joining either exon 13 or 14 (b2 or b3) of the BCR
Several primer pairs and sets of primer pairs have been gene to c-abl exon 2 (a2; Figure 14-33). The b2a2 or
designed to address this problem.89 Test reports should b3a2 fusion genes code for a 210 kilodalton protein,
BCR gene on chromosome 22

m-BCR M-BCR
minor breakpoint major breakpoint
e1 b1 b2 b3
c-abl gene on chromosome 9

1B 1A a2 3 4 5 6 7 8 9 10 11
Figure 14-32 The t(9;22) translocation begins with breakage of chromosomes 9 and 22 in introns
of the BCR and c-abl genes (arrows). The breakpoints are located within introns of both genes.

e1 b1 b2 b3 a2 3 4 5 6 7 8 9 10 11
e1 b3 a2 11
Fusion mRNA AAAAA
(8.5 kb)
Fusion protein p210bcr-abl
e1 b1 b2 b3 a2 3 4 5 6 7 8 9 10 11
e1 a2 11
Fusion mRNA
(7 kb)
Fusion protein p190bcr-abl
Figure 14-33 p210 and p190 are the two main fusion proteins produced by the t(9;22) translocation. They differ in the amount
of the BCR gene that is attached to the c-abl gene.
p210. A third form of the fusion gene joins exon 1 of BgI Bam Hind
1 2 3 4 5 6 7
BCR with exon a2 of c-abl, resulting in expression of an
e1a2 transcript, which codes for a p190 protein. Another,
less common, fusion junction occurs at exon 19 of the
BCR gene (c3). The c3a2 transcript encodes a p230 pro-
tein. All of the fusion proteins have been observed in
CML; however, p190 occurs mostly in ALL.
Detection of the t(9;22) translocation can be performed
by Southern blot in a manner similar to that described
above for detection of t(14;18). One probe used for this
test is a 1.2-kb fragment complementary to the 3 end of
the BCR gene. Restriction fragment patterns will differ in
translocated cells (Fig. 14-34). Other probes to BCR may
also be used to ensure detection of all breakpoints. Figure 14-34 Southern blot of a t(9;22) translocation
The common rationale for detection of translocations with a probe to the 3 end of the BCR gene. Lane 1, molecu-
by PCR is used for t(9;22); that is, forward primers are lar weight marker; lanes 2, 4, and 6, normal control cut with
designed to hybridize to the BCR gene on chromosome 22 BglII, BamH1, and HindIII, respectively; lanes 3, 5, and 7,
a specimen positive for the translocation cut with BglII,
and reverse primers to chromosome 9 in the c-abl gene
BamH1, and HindIII, respectively. Note the shift in the sizes
(Fig. 14-35). A product will result only if the two genes of the bands in lanes 3 and 5 compared with lanes 2
are joined by the translocation. Due to the length of the and 4. (A doublet is not quite resolved from the larger
introns that separate the primer binding sites, nested RT- band in lane 7.)

e1 a2 3 4 5 6 7 8 9 10 11
e1 b1 b2 b3 a2 3 4 5 6 7 8 9 10 11
1B 1A a2 3 4 5 6 7 8 9 10 11
Figure 14-35 Location of primers (horizontal arrows) for PCR analysis of the minor breakpoint region (top) and the major
breakpoint region (middle). The c-abl gene itself may be used as an amplication control (bottom). The intron and exon lengths
are not drawn to scale. Vertical arrows denote locations of breakpoints.
PCR has been commonly utilized.114,115 To minimize the the RNA integrity control for the t(9;22) translocation, but
risk of false-positive results, this method may require con- any unique gene with constitutive expression may be
rmatory testing, especially for adult ALL.116 Several rec- used. Target amplicons can be detected by agarose gel
ommendations for optimal performance have been electrophoresis and ethidium bromide staining (Fig. 14-
proposed, including the use of primers capable of detect- 36) or by capillary gel electrophoresis. Fluorescent
ing both major and minor breakpoints in the BCR gene dyelabeled primers are required for the latter detection
and an internal RNA integrity control (or amplication method.
control) to avoid false-negative results from poor RNA Real-time PCR provides quantitative estimation of
quality or inadequate cDNA synthesis.117118 Transcripts treatment response, especially with novel therapies for
from the abl or BCR genes are used most frequently for CML and ALL. Although cytogenetic methods, espe-
translocation amplification
products controls
(bcr-abl) (abl)
Figure 14-36 Results of a standard RT-PCR test for the t(9;22) transloca-
tion. Lane 1, molecular weight marker; lane 2, b3a2 breakpoints; lane 3,
b2a2 breakpoints; lanes 4 and 5, e1a2 breakpoints; lane 6, negative speci-
men; lanes 711 are RNA integrity (amplication) controls for specimens in
lanes 26; lane 12, reagent blank.

cially FISH and standard RT-PCR, are most practical for 49

47
diagnosis and in the early stages of treatment, quantita- 45
tive PCR provides a valuable estimation of tumor load 43
Cycle number
41
over the course of treatment.119,120 39
Because transcript levels are being measured using RT- 37
35
PCR, it is important to stabilize the specimen RNA on 33
receipt, for example by resuspending the white blood 31
29
cells in protective buffers (see Chapter 4). Another rec- 27
ommendation is to collect at least 10 mL of peripheral 25
10 100 1000 10,000 100,000 1,000,000
blood for analysis to avoid false-negative results.121 Translocated copies
Primers used for this method are similar to those used for
1.0e+004
standard PCR. A TaqMan probe provides the uorescent
signal. A standard curve or a high and low positive con-
1.0e+003
trol and negative control should accompany each run.
Frequently used TaqMan methods report measurements
1.0e+002
as a ratio of the BCR-abl transcript level to the RNA 1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49
integrity control, usually the abl transcript, the BCR tran- Cycle number
script, or the transcript of a housekeeping gene, such as Figure 14-37 Real-time PCR analysis of transcript levels
G6PDH119,122124 For example, a standard curve for tran- requires a standard curve of known transcript numbers. The
number of translocated transcripts in the specimen can then
script number (Fig. 14-37) generates the formula, y be determined from the standard curve.
1.7318Ln(x) 48.627, where y is the threshold cycle
number and x is the number of transcripts. If quantitative
PCR analysis of the patient specimen RNA yielded a This reciprocal translocation between the long arms of
threshold cycle number of 39 (average of duplicate sam- chromosomes 15 and 17 results in fusion of the retinoic
ples) for BCR-abl transcripts and a threshold cycle num- acid receptor alpha (RARA) gene on chromosome 15 with
ber of 30 for the abl transcripts, then solving for x yields the myelocytic leukemia (MYL, or PML) gene on chro-
300 BCR-abl transcripts and 50,000 abl transcripts in the mosome 17. Both genes contain zinc nger binding
sample. Thus, (300/50,000)
100 0.6%. motifs and therefore bind DNA as transcription factors.
Data are still being collected with regard to the clinical The PML/RARA fusion is found specically in promyelo-
signicance of the quantitative results. A three-log drop cytic leukemia. The presence of this translocation is also
in transcript levels or a BCR-abl/abl
100 level below a predictor of the response to retinoic acid therapy that is
0.05% have been proposed as indicators of good prog- used as treatment for this disease. The translocation forms
nosis.125 126 a fusion gene with the rst three (type A or S transloca-
tion) or six (type B or L translocation) exons of the PML
t(15;17)(q22;q11.2-q12)
gene joining to exons 26 of the RARA gene (Fig. 14-38).
Test methods similar to those described above for
BCR-abl translocation are used to detect t(15;17).
Reverse transcriptase PCR and real-time reverse tran-
Advanced Concepts scriptase PCR are most frequently used. Primers comple-
A slightly different formula, [BCR-abl/(abl - BCR- mentary to sequences in exon 3 or 6 of the PML gene and
abl)]
100, for the transcript ratio is used if the abl exon 2 of RARA generate products only if the transloca-
primers also amplify the BCR-abl translocation.143 tion has occurred. The presence of the translocation prod-
In the calculation shown in the text, BCR-abl/abl
uct, therefore, is interpreted as a positive result. As with
100 yields 0.6%; [BCR-abl/(abl - BCR-abl)]
100 any test of this type, an amplication control is required
yields 0.85%. to avoid false-negative results. For quantitative PCR,
results normalized to an internal control, using calcula-

PML gene RARA gene
1 2 3 4 5 6 2 3 4 5 6
Figure 14-38 Location of primers for

PCR analysis of the long (top) and the
short (bottom) translocated genes. The
rst three or six exons of the PML gene
1 2 3 2 3 4 5 6
is fused to exon 2 of the RARA gene.
The intron and exon lengths are not
drawn to scale.
tions as described above, yield the most consistent day- tion is thought to be a denite characteristic of MCL;
to-day results (lowest coefficient of variance).127 however, only 50%70% of MCLs have a detectable
t(11;14).
t(11;14)(q13;q32)
Methods for detection of t(11;14) are similar to those
This translocation joins the immunoglobulin heavy used for t(14;18) translocation described above. Southern
chain gene region on chromosome 14 with part of the blot methods have been replaced mostly with PCR and
long arm of chromosome 11. The cyclin D1 (CCND1) RT-PCR.128 In situ hybridization to detect an increase in
gene, also called the parathyroid adenomatosis 1 gene CCDN1 transcription has also been proposed.129 Of the
(PRAD 1) or BCL1, on chromosome 11 is attached to the breakpoints on chromosome 11, 80% are in the major
long arm of chromosome 14 in the intron between the translocation cluster 5 to the CCND1 gene (Fig. 14-39).
immunoglobulin heavy chain gene joining and constant The rest are dispersed in other areas 5 or 3 of the gene.
regions. The translocation increases expression of PCR analysis detects 40%60% of the translocation
CCND1, resulting in passage of the cell cycle from the breakpoints.130 A PCR product will result only if
G1 to the S phase of the cell cycle. This translocation the translocation has occurred (and the primer binding
is found primarily in mantle cell lymphoma (MCL) but
may also be present in chronic lymphocytic leukemia, B-
prolymphocytic leukemia, plasma cell leukemia, multiple Chromosome 11
myeloma, and splenic lymphoma. The t(11;14) transloca- MTC MTC2 MTC3 CCND1
Advanced Concepts Chromosome 14

IgHC J D V
In this translocation, the reciprocal fusion gene
RARA/PML is also expressed in 70%80% of cases
of APL. Nonreciprocal events can produce either
fusion alone as well.144,145 Although the reciprocal
fusion may participate in the tumorigenesis process, IgHC J CCND1
t(11;14)
it does not predict response to all transretinoic acid
therapy.146 The presence of the reverse transcript
may be used to conrm the translocation and could Figure 14-39 The t(11;14) breakpoints in chromosome 11
(top) and chromosome 14 (center) are indicated by the verti-
be useful in cases where the PML/RARA transcript cal arrows. Primers are complementary to the joining region of
is poorly expressed. the immunoglobulin heavy chain gene and the CCND1 gene
(bottom).

Chromosomes:
Advanced Concepts 14 8 t(8,14) translocation
A variety of molecular events can result in the over-

expression of c-myc. The DNA virus Epstein Barr
virus (EBV) is associated with Burkitts lym-
phoma.147 EBV induces cell proliferation and, thus,
provides more opportunity for translocation events.
Certain types of another DNA virus, human papillo-
mavirus, inserted into the vicinity of c-myc cause
overexpression of the gene.148 Transposable ele-
ments such as LINE-1 elements may also destabi-
lize oncogenes.149
sites are maintained). The PCR product can be detected

by gel or capillary electrophoresis.
t(8;14)(q24;q11)
Figure 14-40 The t(8:14) breakpoint detected by
The avian myelocytomatosis viral oncogene homolog CISH (Invitrogen). Two probes labeled with biotin or
(c-myc) gene on chromosome 8 is one member of a gene digoxigenin are complementary to sequences anking
the chromosome 14 breakpoint. In the absence of the
family including n-myc and l-myc. The c-myc gene codes
translocation (left), the probes will appear next to one
for a helix-loop-helix/leucine zipper transcription factor another in the nucleus. The translocation (right) will
that binds to another protein, Max, and activates tran- move one probe to chromosome 14, leaving the other
scription of other genes. The t(8;14) is associated with behind on chromosome 8, resulting in separation of the
Burkitts lymphoma; in addition, translocations at (2;8) signals in the nucleus.
and t(8;22) are found in about 10% of Burkitts lym-
phomas. also be used to detect the t(8;14) translocation with sepa-
In the t(8;14) translocation, the breakpoints on chro- rate probes to chromosomes 8 and 14 or with chromo-
mosome 8 are spread over a 190-kbp region 5 to and some 14 probe pairs (Fig. 14-40).132 Overexpression of
within the c-myc gene. As a result of the t(8;14) translo- c-myc is detectable by Northern blot.133 Amplication of
cation, the c-myc gene is separated from its normal pro- the gene can be detected by FISH using a 120-kb c-myc
moter and regulatory region and moved into the switch (8q24.12-q24.13) probe labeled with SpectrumOrange
recombination region of the immunoglobulin heavy (Vysis).134
chain gene on chromosome 14. In the t(2;8) and the
t(8;22) translocations, the chromosome 8 breakpoints are FMS-related Tyrosine Kinase 3 (FLT3), 13q12
3 to the gene, and c-myc is moved into the immunglobu- Four classes of growth factor receptor tyrosine kinases
lin kappa or lambda locus, respectively. Translocations of have been categorized (see Figure 14-2).135 One class,
c-myc into the T-cell receptor alpha gene have also been represented by the ERBB family, was described in ear-
reported.131 lier sections. A second class includes dimeric receptors
In the laboratory, c-myc translocations are commonly such as the insulin growth factor receptor as well as
detected by Southern blot analysis with a probe comple- several proto-oncogenes. Members of the third class,
mentary to exon 3 of the c-myc gene; for instance, a 32P- including FMS, PDGF, FLT1, and KIT, display ve
or digoxigenin-labeled 1.4-kb ClaI-EcoRI restriction immunoglobulin-like domains in the extracellular region,
fragment. Interphase FISH and CISH (Invitrogen) can and the catalytic domain is interrupted by a hydrophilic

interkinase sequence of variable length. The broblast mutations include internal tandem duplications (ITD)
growth factor receptors represent the fourth class, which close to the transmembrane domain or point mutations
differ from the third class by having only three im- affecting an aspartic acid residue in the kinase domain
munoglobulin-like domains in the extracellular region (D835 mutations). The ITD can easily be detected by
and a short kinase insert in the intracellular domain. PCR with primers anking the potentially duplicated
FLT3 is a member of the third class of tyrosine kinase region. The size of the amplicon observed by agarose or
receptors.136 capillary gel electrophoresis will increase in the event of
Particular mutations in FLT3 aberrantly activate the an ITD.137 D835 mutations can be detected by PCR-
FLT3 kinase and predict poor prognosis in AML. These RFLP, where an EcoRV restriction site is destroyed by
Table 14.7 Chromosomal Abnormalities Associated With Leukemias and Lymphomas

Disease Chromosomal Mutation
Pre-B acute lymphoblastic leukemia t(1;19)
Acute lymphocytic leukemia t(4;11), t(11;14), t(9;22), del(12)(p11) or (p11p13) or t(12)(p11), i(17q)
B-cell leukemia t(2;8), t(8;14), t(8;22), t(11;14)
Acute T-lymphocytic leukemia t(11;14), del(9)(p21 or 22)
Acute myeloid leukemia/myelodysplastic syndrome t(11q23)-multiple partners
Acute myeloid leukemia (M2) t(8;21), t(6;9)
Acute promyelocytic leukemia (M3) t(15;17), 14q
Acute myelomonocytic leukemia (M4) t(11;21), inv(16)(p13q22)
Acute monocytic leukemia (M5) t(9;11), del(11)(q23), t(11q23)-multiple partners
Chronic myelogenous leukemia t(9;22), t(11;22), 8, 12, i(17q)
Acute lymphocytic leukemia t(9;22), t(12;21), t(8;14), t(2;8), t(8;22), t(11q)
Acute nonlymphocytic leukemia t(8;21), -Y
Chronic lymphocytic leukemia 14q, 12, t(14;19), del(11)(q22), del(13q), del(17)(p13)
T-chronic lymphocytic leukemia Inv(14)(q11q32) or t(14;14)(q11;q32)
Burkitts lymphoma t(8;14), t(2;8), t(8;22)
Diffuse large B-cell lymphoma t(3q27), t(14;18); t(8;14)
T-cell lymphoma t(8;14)
Follicular lymphoma t(14;18), t(8;14)
Mantle cell lymphoma t(11;14)
Multiple myeloma t(14q32), 14q
Acute nonlymphocytic leukemia inv(3q)(q21q26),dup(3q),t(3q;3q), -5 or
Myeloproliferative/myelodysplastic disease del(5)(q12q33), -7 or del(7)(q22), 8, 9
Myeloproliferative/myeloblastic disease del(13)(q12 or q14), 21
Hairy cell leukemia 14q
Waldenstrms macroglobinemia 14q
Mucosa-associated lymphoid tissue lymphoma t(11;18), t(14;18), t(1;14)
Polycythemia vera del(20)(q11.2q13.3)

the presence of the mutation or by real-time PCR with

FRET probes.138 In performing these assays, it is impor- Case Study 14 1
tant to have adequate representation of tumor cells in the A 40-year-old woman with a history of non-
specimen to avoid false-negative results from the pres- Hodgkins lymphoma reported to her physician for
ence of an excess of normal cells. follow-up testing. Her CBC was normal, including a
WBC count of 11,000/L. Morphological studies
Additional Chromosomal Abnormalities on a bone marrow biopsy and a bone marrow aspi-
Tumor suppressor genes and oncogenes are disrupted rate revealed several small aggregates of mature and
by numerous genetic events. A number of specic abnor- immature lymphocytes. Flow cytometry studies
malities are associated with particular diseases (Table were difficult to interpret as there were too few B
14.7). These chromosome irregularities are targets for cells in the bone marrow aspirate specimen. No
diagnosis of the associated diseases. chromosomal abnormalities were detected by cyto-
To date, many molecular oncology tests are developed genetics. A bone marrow aspirate tube was also sent
by an individual library from published or original pro- for molecular analysis; namely, immunoglobulin
cedures rather than purchased as a set of reagents or in kit heavy chain gene rearrangement and t(14;18) gene
form from a commercial source. Often the nal details of translocation analysis by PCR. The immunoglobulin
these procedures are determined empirically so that, in heavy chain gene rearrangement results are shown
detail, a test procedure can differ from one laboratory in lane 4 of the gel image below:
to another. Even after the test procedure is established,
trouble-shooting performed as the procedure is put to use
on a routine basis may further modify the procedure.
Some reactions that work well for short-term research
purposes may prove to be less consistent under the
demands of the clinical laboratory setting.
Biotechnology is rapidly developing standard reagent
sets for the most popular tests, but these may also differ
from one supplier to another. Furthermore, due to market
demands, test reagent kits may be modied or discontin-
ued. If replacement reagents are available, they may not
be identical to those previously used. Ongoing tests then
have to be optimized. This can be a concern where turn- Immmunoglobulin heavy chain gene rearrangement
around times are critical. results (left): lane 1, molecular weight marker; lanes 2 to
It then becomes the responsibility of the technologist 4, patient specimens; lane 5, positive control; lane 6,
sensitivity; lane 7, negative control; lane 8, reagent
to perform and monitor tests on a regular basis to main-
blank. t(14;18) gene translocation test (right): lane 1,
tain consistency and accuracy of results. The technologist molecular weight marker; lanes 2 to 6, patient speci-
who understands the biochemistry and molecular biology mens; lane 7, positive control; lane 8, sensitivity; lane
of these tests will be better able to respond to these prob- 9, negative control.
lems. In addition, with the quickened evolution of the sci-
ences, a knowledgeable technologist can better recognize
significant discoveries that offer potential for test
improvement.

Case Study 14 2
A 54-year-old woman with thrombosis, a high In the CBC, white blood cell and neutrophil counts
platelet count (900,000/L), and a decreased were normal. Iron stores were also in normal range. A
erythrocyte sedimentation rate was tested for blood sample was submitted to the molecular pathol-
polycythemia vera. Megakaryocyte clusters and ogy laboratory for JAK2 V617F mutation analysis.
pyknotic nuclear clusters were observed in a bone The results are shown below:
marrow biopsy. Overall cellularity was decreased.
Agarose gel electrophoresis of SSP-PCR amplicons. Extension of a JAK2

V617F-specic primer produces a 270-bp band in addition to the normal
500- and 230-bp bands. Lane 1, molecular weight markers; lane 2, patient
specimen; lane 3, V617F mutant control; lane 4, normal control; lane 5,
reagent blank.
Case Study 14 3
Paraffin-embedded sections were submitted to the for conrmation of the location of tumor cells on the
molecular diagnostics laboratory for p53 mutation sections. These cells were dissected from the slide.
analysis. The specimen was a small tumor (intra- DNA isolated from the microdissected tumor cells
ductal carcinoma in situ) discovered in a 55-year- was screened by SSCP for mutations in exons 49
old woman. Lymph nodes were negative. Slides of the p53 gene. The results for exon 5 are shown
stained with hematoxylin and eosin were examined below:
Polyacrylamide gel electrophoresis with silver stain detection of p53 exon 5 (left). Lane 1, normal; lane 2, patient;
lane 3, normal. Direct sequencing (right) revealed a CT (GA) base change, resulting in a RH amino acid change
at position 175.

Case Study 14 4
Colon carcinoma and three polyps were resected in to the molecular pathology laboratory for micro-
a right hemicolectomy of a 33-year-old man. satellite instability testing. DNA was isolated from
Without a family history, the mans age and the tumor cells dissected from four paraffin sections and
location of the tumor warranted testing for here- from the patients white blood cells. Both were
ditary nonpolyposis colorectal carcinoma. Histo- amplied at the ve microsatellite loci recom-
logical staining was negative for MSH2 protein. mended by the National Cancer Institute. Results
Paraffin sections and a blood sample were submitted are shown below:
BAT25 BAT26 D17S250 D2S123 D5S346

MSI analysis of normal cells (N, top row) and tumor cells (T, bottom row) at the ve NCI loci.
Case Study 14 5 STUDY QUESTIONS

A 23-year-old college student was sent to the stu-
dent health office with a painful bruise that persisted 1. What are the two important checkpoints in the cell
for several weeks. He was referred to the local hos- division cycle that are crossed when the regulation of
pital, where the physician ordered a bone marrow the cell division cycle is affected?
biopsy and a CBC. His white blood cell count was
2. An EWS-FLI-1 mutation was detected in a solid tumor
28,000/L; red blood cells, 2 million/L; hemoglo-
by RT-PCR. Which of the following does this result
bin 8, hematocrit 20, platelets, 85,000/L. Neu-
support?
trophils were 7%, lymphocytes were 5%, and blasts
a. Normal tissue
were 95%. The pathologist who examined the bone
b. Ewings sarcoma
marrow biopsy requested ow cytometry analysis of
c. Inherited breast cancer
the aspirate. The cells expressed 84% CD20, 82%
d. Microsatellite instability
CD34, 92% HLA-DR, and 80% CD10/CD19. The
results of these tests indicated a diagnosis of acute 3. Mutation detection, even by sequencing, is not deni-
lymphoblastic leukemia. A blood specimen was sent tive with a negative result. Why?
to the cytogenetics laboratory for chromosomal
analysis. Twenty metaphases examined had a nor- 4. A PCR test for the bcl-2 translocation is performed on
mal 46,XY chromosomal complement. Interphase a patient with suspected follicular lymphoma. The
FISH was negative for t(9;22) in 500 nucleii. results show a bright band at about 300 bp for this
patient. How would you interpret these results?

5. Which of the following misinterpretations would 10. Interpret the following results from a translocation
result from PCR contamination? assay.
a. False positive for the t(15;17) translocation M 1 2 3 Pos Sens Neg Blank
b. False negative for the t(15;17) translocation
c. False negative for a gene rearrangement
6. After amplication of the t(12;21) breakpoint by RT-

PCR, the PCR products along with the proper molec-
ular weight standard were loaded and resolved on an
agarose gel. What might be the explanation for each of Target
the following observations when the gel is exposed to
ultraviolet light? (Assume that positive and amplica- Amp control
tion controls and a reagent blank control are included
in the run.)
a. The gel is blank (no bands, no molecular weight Are the samples positive, negative, or indetermi-
standard) nate?
b. Only the molecular weight standard is visible Sample 1:
c. The molecular weight standard is visible; there Sample 2:
are bands in every lane at 200 bp, even in the Sample 3:
reagent blank lane
References
1. Yang-Feng T, Schechter AL, Weinberg RA, et al.
7. What is observed on a Southern blot for gene rear-
Oncogene from rat neuro/glioblastomas (human gene
rangement in the case of a positive result?
symbol NGL) is located on the proximal long arm of
a. No bands
human chromosome 17 and EGFR is conrmed at
b. Germline bands plus rearranged bands
7p13-q11.2. Cytogenetics and Cell Genetics
c. Smears
1985;40:784.
d. Germline bands only
2. Rowinsky E. The ERBB family: Targets for thera-
peutic development against cancer and therapeutic
8. Cyclin D1 promotes passage of cells through the G1 strategies using monoclonal antibodies and tyrosine
to S checkpoint. What test detects translocation of this kinase inhibitors. Annual Review of Medicine 2004;
gene to chromosome 14? 55:43357.
a. t(14;18) translocation analysis (BCL2, IGH) 3. Pauletti G, Godolphin W, Press MF, et al. Detection
b. t(15;17) translocation analysis (PML/RARA) and quantitation of HER-2/neu gene amplication
c. t(11;14) translocation analysis (BCL1/IGH) in human breast cancer archival material using uo-
d. t(8;14) translocation analysis (MYC/IGH) rescence in situ hybridization. Oncogene 1996;13:
6372.
9. Why is the Southern blot procedure superior to the 4. Press M, Slamon DJ, Flom KJ, et al. Evaluation of
PCR procedure for detecting clonality in some cases? HER-2/neu gene amplication and overexpression:
a. Southern blot requires less sample DNA than Comparison of frequently used assay methods in a
does PCR molecularly characterized cohort of breast cancer
b. The PCR procedure cannot detect certain gene specimens. Journal of Clinical Oncology 2002;20:
rearrangements that are detectable by Southern 30953105.
blot 5. Slamon D, Godolphin W, Jones LA, et al. Studies of
c. Southern blot results are easier to interpret than the HER-2/neu proto-oncogene in human breast and
PCR results ovarian cancer. Science 1989;244:70712.
d. PCR results are not accepted by the College of 6. Kounelis S, Kapranos N, Malamos N, et al. Evalua-
American Pathologists tion of HER-2 gene status in breast cancer by

chromogenic in situ hybridization: Comparison ing with potential implications on pharmacologic

with immunohistochemistry. Anticancer Research treatment. Journal of Clinical Oncology 2005;23:
2005; 25:93946. 85765.
7. Tanner M, Gancberg D, Di Leo A, et al. Chromoge- 17. Pan Q, Pao W, Ladanyi M. Rapid polymerase chain
nic in situ hybridization: A practical alternative for reactionbased detection of epidermal growth factor
uorescence in situ hybridization to detect HER- receptor gene mutations in lung adenocarcinomas.
2/neu oncogene amplication in archival breast can- Journal of Molecular Diagnostics 2005;7:396403.
cer samples. American Journal of Pathology 2000; 18. Taron M, Ichinose Y, Rosell R, et al. Activating
157:146772. mutations in the tyrosine kinase domain of the epi-
8. Madrid M, Lo RW. Chromogenic in situ hybridiza- dermal growth factor receptor are associated with
tion (CISH): A novel alternative in screening improved survival in getinib-treated chemore-
archival breast cancer tissue samples for HER-2/neu fractory lung adenocarcinomas. Clinical Cancer
status. Breast Cancer Research 2004;6:R593R600. Research 2005;11:587885.
9. Spaulding D, Spaulding BO. Epidermal growth fac- 19. Tonon G, Wong K-K, Maulik G, et alA. High-
tor receptor expression and measurement in solid resolution genomic proles of human lung cancer.
tumors. Seminars in Oncology 2002;29:4554. Proceedings of the National Academy of Sciences
10. Younes M. Is immunohistochemistry for epidermal 2005;102:962530.
growth factor receptor expression a poor predictor 20. Han S, Hwang PG, Chun DH, et al. Epidermal
of response to epidermal growth factor receptor growth factor receptor (EGFR) downstream mole-
targeted therapy? Journal of Clinical Oncology cules as response predictive markers for getinib in
2005;23:923. chemotherapy-resistant nonsmall cell lung cancer.
11. Murthy S, Magliocco AM, Demetrick DJ. Copy International Journal of Cancer 2005;113:10915.
number analysis of c-erb-B2 (HER-2/neu) and 21. Jassem J, Jassem E, Jakobkiewicz-Banecka J, et al.
topoisomerase IIa genes in breast carcinoma by P53 and K-ras mutations are frequent events in
quantitative real-time polymerase chain reaction microscopically negative surgical margins from
using hybridization probes and uorescence in situ patients with nonsmall cell lung carcinoma. Cancer
hybridization. Archives of Pathology and Labora- 2004;100:195160.
tory Medicine 2005;129:3946. 22. Fabjani G, Kriegshaeuser G, Schuetz A, et al.
12. Paez J, Janne PA, Lee JC, et al. EGFR mutations in Biochip for K-ras mutation screening in ovarian
lung cancer: Correlation with clinical response to cancer. Clinical Chemistry;51:78487.
getinib therapy. Science 2004;304:14971500. 23. Maekawa M, Nagaoka T,Taniguchi T, et al. Three-
13. Lynch T, Bell DW, Sordella R, et al. Activating dimensional microarray compared with PCRsingle-
mutations in the epidermal growth factor receptor strand conformation polymorphism analysis/DNA
underlying responsiveness of nonsmall-cell lung sequencing for mutation analysis of K-ras codons
cancer to getinib. New England Journal of 12 and 13. Clinical Chemistry 2004; 50:132227.
Medicine 2004;350:212939. 24. Navarro S, Noguera R, Pellan A, et al. Atypical
14. Tsao M-S, Sakurada A, Cutz J-C, et al. Erlotinib in pleomorphic extraosseous Ewing tumor/peripheral
lung cancer: Molecular and clinical predictors of primitive neuroectodermal tumor with unusual phe-
outcome. New England Journal of Medicine 2005; notypic/genotypic prole. Diagnostic Molecular
353:13344. Pathology 2002;11:915.
15. Shepherd F, Pereira JR, Ciuleanu T, et al. Erlotinib 25. Qian X, Jin, L, Shearer B, et al. Molecular diagno-
in previously treated nonsmall-cell lung cancer. sis of Ewings sarcoma/primitive neuroectodermal
New England Journal of Medicine 2005;353: tumor in formalin-xed paraffin-embedded tissues
12332. by RT-PCR and uorescence in situ hybridization.
16. Marchetti A, Martella C, Felicioni L, et al. EGFR Diagnostic Molecular Pathology 2005;14:2328.
mutations in nonsmall-cell lung cancer: Analysis 26. Noguera R. Cytogenetics and tissue culture of small
of a large series of cases and development of a round cell tumors of bone and soft tissue. Seminars
rapid and sensitive method for diagnostic screen- in Diagnostic Pathology 1996;13:17183.

27. Akerman M, Dreinhofer K, Rydholm A, et al. 38. Edwards R, Chatten J, Xiong Q-B, et al. Detection
Cytogenetic studies on ne-needle aspiration sam- of gene fusions in rhabdomyosarcoma by reverse
ples from osteosarcoma and Ewings sarcoma. transcriptasepolymerase chain reaction assay of
Diagnostic Cytopathology 1996;15:1722. archival samples. Diagnostic Molecular Pathology
28. Takeuchi T, Iwasaki H, Ohjimi Y, et al. Renal 1997;6:9197.
primitive neuroectodermal tumor: A morphologic, 39. Kyzas P, Loizou KT, Ioannidis JP. Selective report-
cytogenetic, and molecular analysis with the estab- ing biases in cancer prognostic factor studies.
lishment of two cultured cell lines. Diagnostic Journal of the National Cancer Institute 2005;
Molecular Pathology 1997;6:30917. 97:104355.
29. Adams V, Hany MA, Schmid M, et al. Detection 40. Lohmann D, Ruhri C,Schmitt M, et al. Accumula-
of t(11;22)(q24;q12) translocation breakpoint in tion of p53 protein as an indicator for p53 gene
paraffin-embedded tissue of the Ewings sarcoma mutation in breast cancer: Occurrence of false-
family by nested reverse transcriptionpolymerase positives and false-negatives. Diagnostic Molecular
chain reaction. Diagnostic Molecular Pathology Pathology 1993;2:3641.
1996;5:10713. 41. Casey G, Lopez ME, Ramos JC, et al. DNA
30. Kelley T, Tubbs RR, Prayson RA. Molecular diag- sequence analysis of exons 2 through 11 and
nostic techniques for the clinical evaluation of immunohistochemical staining are required to
gliomas. Diagnostic Molecular Pathology 2005; detect all known p53 alterations in human malig-
14:18. nancies. Oncogene 1996;13:1971-81.
31. Panagopoulos I, Mertens F, Isaksson M, et al. 42. Visscher D, Sarkar FH, Shimoyama RK, et al.
Clinical impact of molecular and cytogenetic nd- Correlation between p53 immunostaining patterns
ings in synovial sarcoma. Genes Chromosomes and gene sequence mutations in breast carcinoma.
Cancer 2001;31:36272. Diagnostic Molecular Pathology 1996;5:18793.
32. Nilsson G, Skytting B , Xie Y, et al. The SYT-SSX1 43. Miller L, Smeds J, George J, et al. An expression
variant of synovial sarcoma is associated with a signature for p53 status in human breast cancer
high rate of tumor cell proliferation and poor clini- predicts mutation status, transcriptional effects,
cal outcome. Cancer Research 1999;59:318084. and patient survival. Proceedings of the National
33. Barr F, Galili N, Holick J, et al. Rearrangement of Academy of Sciences 2005; 102:13550555.
the PAX3 paired box gene in the paediatric solid 44. Falette N, Paperin MP,Treilleux I, et al. Prognostic
tumour alveolar rhabdomyosarcoma. Nature value of p53 gene mutations in a large series of
Genetics 1993;3:11317. node-negative breast cancer patients. Cancer
34. Tassabehji M, Newton VE, Liu X-Z, et al. The Research 1998;58:145155.
mutational spectrum in Waardenburg syndrome. 45. Liu Q, Feng J, Buzin C, et al. Detection of virtually
Human Molecular Genetics 1995;4:213137. all mutations-SSCP (DOVAM-S): A rapid method
35. Whang-Peng J, Knutsen T, Theil K, et al. Cytoge- for mutation scanning with virtually 100% sensitiv-
netic studies in subgroups of rhabdomyosarcoma. ity. BioTechniques 1999;26:93242.
Genes Chromosomes Cancer 1992;5:299310. 46. Buzin C, Wen CY, Nguyen VQ, et al. Scanning by
36. Jin L, Majerus J, Oliveira A, et al. Detection of DOVAM-S detects all unique sequence changes in
fusion gene transcripts in fresh-frozen and forma- blinded analyses: Evidence that the scanning condi-
lin-xed paraffin-embedded tissue sections of soft- tions are generic. BioTechniques 2000;28:74653.
tissue sarcomas after laser capture microdissection 47. Girard P-M, Foray N, Stumm M, et al.
and RT-PCR. Diagnostic Molecular Pathology Radiosensitivity in Nijmegen breakage syndrome
2003;12:22430. cells is attributable to a repair defect and not cell
37. Tiffin N, Williams RD, Shipley J, et al. PAX7 cycle checkpoint defects. Cancer Research 2000;
expression in embryonal rhabdomyosarcoma sug- 60:488188.
gests an origin in muscle satellite cells. British 48. Castilla L, Couch FJ, Erdos MR, et al. Mutations
Journal of Cancer 2003;89:32732. in the BRCA1 gene in families with early-onset

breast and ovarian cancer. Nature Genetics suppressor gene in nonfamilial clear cell renal
1994; 8:38791. carcinoma. Human Molecular Genetics 1994;3:
49. Smith S, DiCioccio RA,Struewing JP, et al. Locali- 216973.
sation of the breast-ovarian cancer susceptibility 61. Bender B, Gutsche M, Glasker S, et al. Differential
gene (BRCA1) on 17q1221 to an interval of or genetic alterations in von Hippel-Lindau syndrome
1 cM. Genes Chromosomes Cancer 1994;10: associated and sporadic pheochromocytomas.
7176. Journal of Clinical Endrocrinology and Metabolism
50. Stratton M, Ford D, Neuhasen S, et al. Familial 2000;85:456874.
male breast cancer is not linked to the BRCA1 locus 62. Glenn G, Linehan WM, Hosoe S, et al. Screening
on chromosome 17q. Nature Genetics for von Hippel-Lindau disease by DNA polymor-
1994;7:103107. phism analysis. Journal of the American Medical
51. Wooster R, Bignell G, Lancaster J, et al. Identica- Association 1992;267:122631.
tion of the breast cancer susceptibility gene BRCA2. 63. de Cremoux P, Thioux M, Peter M, et al. Poly-
Nature 1995;378:78992. merase chain reaction compared with dot blotting
52. Brugarolas J, Jacks T. Double indemnity: p53, for the determination of N-myc gene amplication
BRCA and cancer. Science 1997;3:72122. in neuroblastoma. International Journal of Cancer
53. Satagopan J, Offit K, Foulkes W, et al. The life-time 1997;72:51821.
risks of breast cancer in Ashkenazi Jewish carriers 64. Shapiro D, Valentine MB, Rowe ST, et al. Detec-
of BRCA1 and BRCA2 mutations. Cancer Epidemi- tion of N-myc gene amplication by uorescence
ology Biomarkers and Prevention 2001;10:46773. in situ hybridization: Diagnostic utility for neurob-
54. Tonin P, Weber B, Offit K, et al. Frequency of lastoma. American Journal of Pathology
recurrent BRCA1 and BRCA2 mutations in 1993;142:133946.
Ashkenazi Jewish breast cancer families. Nature 65. Grady-Leopardi E, Schwab M, Ablin AR, et al.
Medicine 1996;2:117983. Detection of N-myc oncogene expression in human
55. Lerman C, Narod S, Schulman K, et al. BRCA1 neuroblastoma by in situ hybridization and blot
testing in families with hereditary breast-ovarian analysis: relationship to clinical outcome. Cancer
cancer. A prospective study of patient decision Research 1986;46:319699.
making and outcomes. Journal of the American 66. Layeld L, Willmore-Payne C, Shimada H, et al.
Medical Association 1996;275:188592. Assessment of -Nmyc amplication: A comparison
56. Botkin J, Croyle RT, Smith KR, et al. A model proof FISH, quantitative PCR monoplexing, and tradi-
tocol for evaluating the behavioral and psychosocial tional blotting methods used with formalin-xed,
effects of BRCA1 testing. Journal of the National paraffin-embedded neuroblastomas. Analytical and
Cancer Institute 1996;88:87282. Quantitative Cytology and Histology 2005;27:514.
57. Phelan C, Rebbeck TR, Weber BL, et al. Ovarian 67. Takahashi M, Ritz J, Cooper GM. Activation of a
cancer risk in BRCA1 carriers is modied by the novel human transforming gene, ret, by DNA
HRAS1 variable number of tandem repeat (VNTR) rearrangement. Cell 1985;42(2):58188.
locus. Nature Genetics 1996;12:30911. 68. Bolk G, Salomon R, Pelet A, et al. Segregation at
58. Pastore Y, Jedlickova K,Guan Y, et al. Mutations of three loci explains familial and population risk in
von Hippel-Lindau tumor-suppressor gene and con- Hirschsprung disease. Nature Genetics 2002;31:
genital polycythemia. American Journal of Human 8993.
Genetics 2003;73:41219. 69. Stratakis C. Clinical genetics of multiple endocrine
59. Wait S, Vortmeyer AO, Lonser RR, et al. Somatic neoplasias, Carney complex and related syndromes.
mutations in VHL germline deletion kindred corre- Journal of Endocrinology 2001;24:37083.
late with mild phenotype. Annals of Neurology 70. Sanso G, Domene HM, Garcia R, et al. Very early
2004;55:23640. detection of RET proto-oncogene mutation is cru-
60. Foster K, Prowse A,van den Berg A, et al. Somatic cial for preventive thyroidectomy in multiple
mutations of the von Hippel-Lindau disease tumour endocrine neoplasia type 2 children: Presence of

C-cell malignant disease in asymptomatic carriers. for colon cancer. New England Journal of Medicine
Cancer 2002;94:32330. 2001;344:1196206.
71. Attie T, Pelet A, Edery P, et al. Diversity of RET 82. Halvarsson B, Lindblom A, Rambech E, et al.
proto-oncogene mutations in familial and sporadic Microsatellite instability analysis and/or immunos-
Hirschsprung disease. Human Molecular Genetics taining for the diagnosis of hereditary nonpolyposis
1995;4:138186. colorectal cancer? Virchows Archiv 2004;444:
72. Seri M, Yin L, Barone A, et al. Frequency of RET 13541.
mutations in long- and short-segment Hirschsprung 83. Weichhold G, Ohnheiser R, Zachau HG. The
disease. Human Mutation 1997;9:24349. human immunoglobulin kappa locus consists of two
73. Lynch H, Smyrk TC, Watson P, et al. Genetics, natu- copies that are organized in opposite polarity.
ral history, tumor spectrum and pathology of heredi- Genomics 1993;16:50311.
tary nonpolypoisis colorectal cancer: An updated 84. Barbie V, Lefranc M-P. The human immunoglobulin
review. Gastroenterology 1988;104:153549. kappa variable (IGKV) genes and joining (IGKJ)
74. Lynch H, Smyrk TC, Lynch JF. Overview of natural segments. Experimental and Clinical Immunogene-
history, pathology, molecular genetics and manage- tics 1998;15:17183.
ment of HNPCC (Lynch syndrome). International 85. Frippiat J-P, Williams SC,Tomlinson IM, et al.
Journal of Cancer 1996;69:3843. Organization of the human immunoglobulin lambda
75. Xia L, Shen W, Ritacca F, et al. A truncated light-chain locus on chromosome 22q11.2. Human
hMSH2 transcript occurs as a common variant in Molecular Genetics 1995;4:98391.
the population: Implications for genetic diagnosis. 86. Yuen E, Brown RD. Southern blotting of IgH
Cancer Research 1996;56:228992. rearrangements in B-cell disorders. Methods in
76. Srivastava S, Rossi SC. Early detection research Molecular Medicine 2005;113:85103.
program at the NCI. International Journal of 87. Arber D. Molecular diagnostic approach to non-
Cancer 1996;69:3537. Hodgkins lymphoma. Journal of Molecular
77. Shin K-H, Shin J-H, Kim J-H, et al. Mutational Diagnostics 2000;2(4):17890.
analysis of promoters of mismatch repair genes 88. Beishuizen A, Verhoeven MA, Mol EJ, et al.
hMSH2 and hMLH1 in hereditary nonpolyposis col- Detection of immunoglobulin kappa light-chain
orectal cancer and early onset colorectal cancer gene rearrangement patterns by Southern blot
patients: Identication of three novel germline analysis. Leukemia 1994;8:222836.
mutations in promoter of the hMSH2 gene. Cancer 89. van Dongen J, Langerak AW, Bruggemann M, et al.
Research 2002;62:3842. Design and standardization of PCR primers and
78. Sun X, Zheng L, Shen B. Functional alterations of protocols for detection of clonal immunoglobulin
human exonuclease 1 mutants identied in atypical and T-cell receptor gene recombinations in suspect
hereditary nonpolyposis colorectal cancer syn- lymphoproliferations: Report of the BIOMED-2
drome. Cancer Research 2002;62:602630. Concerted Action BMH4-CT98-3936. Leukemia
79. Boland C, Thibodeau SN, Hamilton SR, et al. A 2003;12:22572317.
National Cancer Institute workshop on microsatel- 90. Muschen M, Rajewsky K, Brauninger A, et al. Rare
lite instability for cancer detection and familial pre- occurrence of classical Hodgkins disease as a T-
disposition: Development of international criteria cell lymphoma. Journal of Experimental Medicine
for the determination of microsatellite instability 2000;191:38794.
in colorectal cancer. Cancer Research 1998;58: 91. Gonzalez D, Garcia-Sanz R. Incomplete DJH
524857. rearrangements. Methods in Molecular Medicine
80. Frazier M, Sinicrope FA, Amos CI, et al. Loci for 2005;113:16573.
efficient detection of microsatellite instability in 92. Gonzalez D, Balanzategui A, Garcia-Sanz R, et al.
hereditary nonpolyposis colorectal cancer. Onco- Incomplete DJH gene rearrangements of the IgH
logy Reports 1999;6:497505. gene are frequent in multiple myeloma patients:
81. Watanabe T, Wu TT, Catalano PJ, et al. Molecular Immunobiological characteristics and clinical appli-
predictors of survival after adjuvant chemotherapy cations. Leukemia 2003;17:13981403.

93. Araujo M, Carvalhais A, Campos A, et al. Clonal- rearrangements demonstrates the need for multiple
ity detection in apheresis products from multiple primer sets. Journal of Molecular Diagnostics
myeloma and non-Hodgkin lymphoma patients. 2003;5:8287.
Transplantation Proceedings 2000;32:2676. 103. Theodorou I, Bigorgne C, Delfau MH, et al. VJ
94. van der Velden V, Willemse MJ, van der Schoot rearrangements of the TCR gamma locus in
CE, et al. Immunoglobulin kappa-deleting element peripheral T-cell lymphomas: Analysis by poly-
rearrangements in precursor-B acute lymphoblas- merase chain reaction and denaturing gradient
tic leukemia are stable targets for detection of gel electrophoresis. Journal of Pathology 1996;
minimal residual disease by real-time PCR. 178:30310.
Leukemia 2002;16:92836. 104. Lee S, Berg KD, Racke FK, et al. Pseudo-spikes
95. Shiokawa S, Nishimura J, Ohshima K, et al. are common in histologically benign lymphoid tis-
Establishment of a novel B-cell clonality analysis sues. Journal of Molecular Diagnostics 2000;
using single-strand conformation polymorphism 2:14552.
of immunoglobulin light chain messenger signals. 105. Murphy K, Berg KD, Geiger T, et al. Capillary
American Journal of Pathology 1998;153: electrophoresis artifact due to eosin: implications
13931400. for the interpretation of molecular diagnostic
96. Buckingham L, Vardouniotis A, Coon JS. assays. Journal of Molecular Diagnostics 2005;
Molecular detection of multiple myeloma at the 7:14348.
immunoglobulin light chain locus. Journal of 106. Batstone P, Goodlad JR. Efficacy of screening the
Molecular Diagnostics 2002;4:241. intermediate cluster region of the bcl2 gene in fol-
97. Rosenquist R, Menestrina F, Lestani M, et al. licular lymphoma by PCR. Journal of Clinical
Indications for peripheral light-chain revision and Pathology 2004;58:8182.
somatic hypermutation without a functional B-cell 107. Albinger-Hegyi A, Hochreutener B, Abdou M-T,
receptor in precursors of a composite diffuse large et al. High frequency of t(14;18)-translocation
B-cell and Hodgkins lymphoma. Laboratory breakpoints outside of major breakpoint and minor
Investigation 2004;84:25362. cluster regions in follicular lymphomas: Improved
98. Tumkaya T, van der Burg M, Garcia-Sanz R, et al. polymerase chain reaction protocols for their
Immunoglobulin lambda isotype gene rearrange- detection. American Journal of Pathology
ments in B-cell malignancies. Leukemia 2001;15: 2002;160:82332.
12127. 108. Gomez M, Wu X, Wang YL. Detection of bcl-
99. Breit T, Wolvers-Tettero IL, Beishuizen AV, et al. 2-IGH using single-round PCR assays. Diagnostic
Southern blot patterns, frequencies, and junctional Molecular Pathology 2005;14:1722.
diversity of T-cell receptor delta gene rearrange- 109. Hsi E, Tubbs RR, Lovell MA, et al. Detection
ments in acute lymphoblastic leukemia. Blood of bcl-2/J(H) translocation by polymerase chain
1993;82:306374. reaction: A summary of the experience of the
100. Miller J, Wilson SS, Jaye DL, et al. An automated molecular oncology survey of the College of
semiquantitative B- and T-cell clonality assay. American Pathologists. Archives of Pathology and
Journal of Molecular Diagnostics 1999; Laboratory Medicine 2002;126:902908.
4:10117. 110. McGregor D, Keever-Taylor CA, Bredeson C, et
101. Szczepanski T, Beishuizen A, Pongers-Willemse al. The implication of follicular lymphoma
MJ, et al. Cross-lineage T-cell receptor gene patients receiving allogeneic stem cell trans-
rearrangements occur in more than ninety percent plantation from donors carrying t(14;18)-
of childhood precursor-B acute lymphoblastic positive cells. Bone Marrow Transplant 2005;
leukemias: Alternative PCR targets for detection 35:104954.
of minimal residual disease. Leukemia 1999;13: 111. Montoto S, Lopez-Guillermo A, Colomer D, et al.
196205. Incidence and clinical signicance of bcl-2/IgH
102. Lawnicki L, Rubocki RJ, Chan WC, et al. The dis- rearrangements in follicular lymphoma. Leukemia
tribution of gene segments in T-cell receptor gene and Lymphoma 2003;44:7176.

112. Ladetto M, Mantoan B, Ricca I, et al. Recurrence row cytogenetics. British Journal of Haematology
of bcl-2/IgH polymerase chain reaction positivity 1999;107:58799.
following a prolonged molecular remission can be 121. Muller M, Hardt T, Paschka P, et al. Standardiza-
unrelated to the original follicular lymphoma tion of preanalytical factors for minimal residual
clone. Experimental Hematology 2003;31(9): disease analysis in chronic myelogenous leukemia.
78488. Acta Haematologica 2004;112:3033.
113. Colleoni G, Duarte LC, Kerbauy FR, et al. 122. Moravcova J, Regner J, Mouckova D, et al.
Possible inuence of clinical stage and type of Disease status in patients with chronic myeloid
treatment in the persistence of residual circulating leukemia is better characterized by bcr-abl/bcr
t(14;18)-positive cells in follicular lymphoma transcript ratio than by bcr-abl transcript level,
patients. Leukemia and Lymphoma 2004;45: which may suggest a role of normal bcr gene in
53945. the disease pathogenesis. Neoplasma 2005;52:
114. Maurer J, Janssen JW, Thiel E, et al. Detection of 11925.
chimeric bcr-abl genes in acute lymphoblastic 123. Jones C, Yeung C, Zehnder JL. Comprehensive
leukaemia by the polymerase chain reaction. validation of a real-time quantitative bcr-abl assay
Lancet 1991;337:105558. for clinical laboratory use. American Journal of
115. Gleissner B, Gakbuget N, Bartram CR, et al. Clinical Pathology 2003;120(1):4248.
Leading prognostic relevance of the BCR-ABL 124. Neumann F, Herold C, Hildebrandt B, et al. Quan-
translocation in adult acute B-lineage lymphoblas- titative real-time reverse-transcription polymerase
tic leukemia: A prospective study of the German chain reaction for diagnosis of bcr-abl positive
Multicenter Trial Group and conrmed poly- leukemias and molecular monitoring following
merase chain reaction analysis. Blood 2002; allogeneic stem cell transplantation. European
99:153643. Journal of Haematology 2003;70:110.
116. Gleissner B, Rieder H,Thiel EF, et al. Prospective 125. Hughes T, Kaeda J, Branford S, et al: International
bcr-abl analysis by polymerase chain reaction in Randomised study of interferon versus STI571
adult acute B-lineage lymphoblastic leukemia: study group: Frequency of major molecular
Reliability of RT-nested PCR and comparison to responses to imatinib or interferon alfa plus
cytogenetic data. Leukemia 2001;15:183440. cytarabine in newly diagnosed chronic myeloid
117. Burmeister T, Maurer J, Aivado M, et al. Quality leukemia. New England Journal of Medicine
assurance in RT-PCRbased BCR/ABL diagnos- 2003;349:142332.
tics: Results of an interlaboratory test and a stan- 126. Cortes J, Talpaz M, OBrien S, et al. Molecular
dardization approach. Leukemia 2000;14:185056. responses in patients with chronic myelogenous
118. van der Velden V, Boeckx N, Gonzalez M, et al. leukemia in chronic phase treated with imatinib
Differential stability of control gene and fusion mesylate. Clinical Cancer Research 2005;11(9):
gene transcripts over time may hamper accurate 342532.
quantication of minimal residual disease: A study 127. Slack J, Bi WL, Livak KJ, et al. Preclinical valida-
within the Europe Against Cancer Program. tion of a novel, highly sensitive assay to detect
Leukemia 2004;18:88486. PML-RARa mRNA using real-time reverse-
119. Lion T, Gaiger A, Henn T, et al. Use of quantita- transcription polymerase chain reaction. Journal
tive polymerase chain reaction to monitor residual of Molecular Diagnostics 2005;3:14149.
disease in chronic myelogenous leukemia during 128. Fan H, Gulley ML, Gascoyne RD, et al. Molecular
treatment with interferon. Leukemia 1995;9: methods for detecting t(11;14) translocations in
135360. mantle-cell lymphomas. Diagnostic Molecular
120. Branford S, Hughes TP, Rudzki Z. Monitoring Pathology 1998;7:20914.
chronic leukemia therapy by real-time quantitative 129. Williams M, Nichols GE, Swerdlow SH, et al. In
PCR in blood is a reliable alternative to bone mar- situ hybridization detection of cyclin D1 mRNA

in centrocytic/mantle cell lymphoma. Annals of 140. Meier J, Lewis SM. P nucleotides in V(D)J recom-
Oncology 1995;6:29799. bination: A ne-structure analysis. Molecular and
130. Wijers-Koster P, Droese J, et al. t(11;14) with Cellular Biology 1993;13:107892.
BCL1-IGH rearrangement. Leukemia 2003;17: 141. Szczepaski T, Willemse MJ, van Wering ER, et al.
229698. Precursor-B-ALL with DHJH gene rearrange-
131. Erikson J, Finger L, Sun L, et al. Deregulation of ments have an immature immunogenotype with a
c-myc by translocation of the alpha-locus of the T- high frequency of oligoclonality and hyperdiploidy
cell receptor in T-cell leukemias. Science 1986; of chromosome 14. Leukemia 2001; 15:141523.
232:88486. 142. Campbell M, Zelenetz AD, Levy S, et al. Use of
132. Siebert R, Matthiesen P, Harder S, et al. Appli- family-specic leader region primers for PCR
cation of interphase uorescence in situ hybridiza- amplication of the human heavy chain variable
tion for the detection of the Burkitt translocation region gene repertoire. Molecular Immunology
t(8;14)(q24;q32) in B-cell lymphomas. Blood 1992;29:193203.
1998;91:98490. 143. Wang L, Pearson K, Pillitteri L, et al. Serial moni-
133. Choi J-Y, Hong Y-S, Park H-Y. Stimulation of c- toring of bcr-abl by peripheral blood real-time
myc proto-oncogene expression by transforming polymerase chain reaction predicts the marrow
growth factor a in human ovarian cancer cells. cytogenetic response to imatinib mesylate in
Experimental and Molecular Medicine 1997;29: chronic myeloid leukaemia. British Journal of
203208. Haematology 2002;118:77177.
134. Blancato J, Singh B, Liu A, et al. Correlation of 144. Lafage-Pochitaloff M, Alcalay M, Brunel V, et al.
amplication and overexpression of the c-myc Acute promyelocytic leukemia cases with nonreci-
oncogene in high-grade breast cancer: FISH, in procal PML/RARA or RARA/PML fusion genes.
situ hybridisation and immunohistochemical Blood 1995;85:116974.
analyses. British Journal of Cancer 2004;90: 145. Vizmanos J, Larryoz MJ, Odero MD, et al. Two
161219. new molecular PML-RARA variants: Implications
135. Ullrich A, Schlessinger J. Signal transduction by for the molecular diagnosis of APL. Haematolo-
receptors with tyrosine kinase activity. Cell 1990; gica 2002;87:ELT37.
61:20312. 146. Mozziconacci M, Liberatore C, Brunel V, et al. In
136. Rosnet O, Mattei M-G, Marchetto S, et al. Isola- vitro response to all-trans retinoic acid of acute
tion and chromosomal localization of a novel promyelocytic leukemias with nonreciprocal
FMS-like tyrosine kinase gene. Genomics 1991;9: PML/RARA or RARA/PML fusion genes. Genes
38085. Chromosomes Cancer 1998;22:24150.
137. Mills K, Gilkes AF, Walsh V, et al. Rapid and 147. Lacy J, Summers WP, Watson M, et al. Ampli-
sensitive detection of internal tandem duplication and deregulation of myc following
cation and activating loop mutations of FLT3. Epstein-Barr virus infection of a human B-cell
British Journal of Haematology 2005; line. Proceedings of the National Academy of
130:203208. Sciences 1987;84:5838-42.
138. Scholl S, Krause C, Loncarevic IF, et al. Specic 148. Lazo P, DiPaolo JA, Popescu NC. Amplication of
detection of Flt3 point mutations by highly sensi- the integrated viral transforming genes of human
tive real-time polymerase chain reaction in acute papillomavirus 18 and its 5-anking cellular
myeloid leukemia. Journal of Laboratory and sequence located near the myc protooncogene in
Clinical Medicine 2005;145:295304. HeLa cells. Cancer Research 1989;49:430510.
139. Institute NC. Sponsored study of classication of 149. Morse B, Rotherg PG, South VJ, et al. Insertional
non-Hodgkins lymphomas: Summary and mutagenesis of the myc locus by a LINE-1
description of working formulation for clnical sequence in a human breast carcinoma. Nature
usage. Cancer 1982;49:211235. 1988;333:8790.
DNA-Based
Tissue Typing
OUTLINE OBJECTIVES
THE MHC LOCUS Describe the structure and function of the major
HLA POLYMORPHISMS histocompatibility (MHC) locus.
HLA Nomenclature List the human leukocyte antigens (HLAs) that are
MOLECULAR ANALYSIS OF THE MHC encoded by the MHC locus, and explain their role
Serological Analysis in tissue engraftment and rejection.
DNA-Based Typing
Combining Typing Results Compare and contrast the levels of typing resolution
HLA Test Discrepancies that are achieved by different laboratory methods.
Coordination of HLA Test Methods Describe the laboratory methods used to identify HLAs
ADDITIONAL RECOGNITION FACTORS by serology testing.
Minor Histocompatibility Antigens
Describe the DNA-based testing methods used for the
Nonconventional MHC Antigens
Killer Cell Immunoglobulin-like
identication of HLAs.
Receptors Explain how combining different test methods to identify
MHC DISEASE ASSOCIATION HLAs increases resolution and resolves ambiguities.
SUMMARY OF LABORATORY TESTING Discuss factors, in addition to the HLAs, that affect
engraftment.
Relate the use of HLA typing for conrming disease
diagnosis and predisposition.
376

DNA-Based Tissue Typing Chapter 15 377
The major histocompatibility complex (MHC) is a

group of genes located on the short arm of chromosome
6. In humans, the MHC gene products are called human
leukocyte antigens (HLAs). The HLAs were named for The genetic contribution to transplant rejection was
their role in rejection of transplanted organs. Kidney, rst proposed in 1927 when Bover observed that
heart, liver, lungs, skin, pancreas, corneas, blood, bone skin transplants between identical twins were not
marrow, and hematopoietic stem cells can be trans- rejected like those from genetically distinct individ-
planted from one human to another. Transplanted organs, uals.70 The genes involved were rst described in
except in the case of identical twins, are allografts, indi- mice by Gorer.71 Snell72 used mouse cell lines to fur-
cating genetic differences between the donor of the organ ther dene a genetic locus, which he called H for his-
and the recipient. When a transplant is performed, com- tocompatibility. Gorer referred to the gene products
patibility (matching) of the HLA of the organ donor and of this locus as antigen II, and the combined term H-
the recipient increases the chance for a successful 2 was subsequently used for the MHC locus in mice.
engraftment that will function for several years. If the
donor and recipient are not HLA-matched, then the recip-
ients immune system (primarily mediated by T lympho-
cytes as well as B lymphocytes) will recognize the donor ing these loci was designed from the observation that
organ as non-self (foreign) and will mount an immune large immature mononuclear cells proliferated if lympho-
response against the organ, resulting in its destruction, cytes from unrelated individuals were mixed and cultured
loss of function, and rejection by the recipient. together.3,4 Results from this mixed lymphocyte culture
The role of the clinical laboratory is to evaluate the (MLC) reaction did not always agree with the results of
HLAs of potential donors and recipients and to aid in pre- serological typing, however. The discrepancy was partly
diction of successful engraftment and the avoidance of resolved by the discovery of additional genes comprising
graft versus host disease (GVHD). GVHD is the recip- the HLA-D locus.57
rocal of graft rejection whereby immunocompetent cells HLAs are divided into three classes (I, II, and III), all
in the donor organ recognize recipient cells as foreign encoded by a gene complex located on chromosome 6p
and attack and destroy the recipient cells, resulting in sig- (Fig. 15-1). The MHC locus includes genes other than
nicant morbidity and potential mortality to the recipient. those that code for the HLA. Cytokine genes and genes
The process of HLA identication utilizes methods encoding tumor necrosis factor (TNF-) and tumor
targeting cell-associated antigens as well as serum anti- necrosis factor (TNF-) are located inside of the main
bodies. Most tissue typing, as HLA identication is com- HLA complex.8
monly called, is performed by serological methods using
antibodies to the different HLA found in the human pop-
ulation. Increasingly, however, DNA typing methods are
being implemented for this purpose, increasing the sensi-
Advanced Concepts
tivity and specicity of the typing procedure. Despite the discovery of the MHC gene products as
mediators of transplant rejection, recognition of
allografts (organs from genetically different donors)
The MHC Locus is not the main function of these glycoproteins.
The human MHC locus was discovered in the early HLAs appear on the surface of cells of the immune
1950s. Investigators independently noted that blood from system, allowing cell-cell communication during
women who had borne children or from previously trans- immune functions. Immune reactions involve and
fused persons contained antibodies that agglutinated are restricted by interactions between T lympho-
leukocytes.1,2 This discovery led to serological typing cytes (cells involved in cell-mediated immunity), B
methods that originally identied two polymorphic gene lymphocytes (antibody-producing cells), and the
loci, HLA-A and HLA-B, followed soon after by the MHC molecules.73,74
identication of HLA-C and other genes. A test for typ-

0 1 2 3 4 Mb
DP DQ DR
TNF
Chromosome 6 B C A
HLA: Class II Class III Class I

Figure 15-1 The MHC locus on chromosome 6 covers about 4 Mb of DNA, depending on the individual. Class I genes are
36 kb long, and class II genes are 411 kb in length. TNF- and TNF- are not part of the polymorphic HLA system.
In addition to the main MHC locus, gene regions molecules (designated as D) are only expressed constitu-
extending beyond the HLA-DP genes toward the cen- tively on professional antigen-presenting cells, such as
tromere and HLA-F toward the telomere comprise the B lymphocytes, dendritic cells, and macrophages. As
extended MHC locus (xMHC). The xMHC locus covers illustrated in Figure 15-2, class I molecules consist of a
8 Mb and includes the hemochromatosis gene HLA-F long (heavy) chain of 346 amino acids (44 kD) associated
(also called HFE), the farthest telomeric gene in the com- with a smaller peptide, called -2 microglobulin, which
plex.9,10 The most centromeric locus of the extended is 99 amino acids (12 kD) in size and is not encoded in the
MHC is the tapasin region. Tapasin is required for anti- MHC. The two chains are associated with one another on
genic peptide processing.11,12 Some genes that are associ- the cell surface by noncovalent bonds. The class I heavy
ated with disease conditions, such as HFE linked to the chain displays short branched-chained sugars, making
MHC locus, are the basis for the association of particular this molecule a glycoprotein. The heavy chain is also a
disease states with HLA type (see Chapter 11). The role transmembrane polypeptide, anchoring the complex at the
of the immune system in other disease states, such as surface of the cell. Class II molecules consist of two trans-
autoimmune diseases and susceptibility to infections, membrane polypeptides, an chain with three domains,
also links HLA type to disease. 1, 2, and 3, and a chain, with two domains, 1 and
The gene products of the MHC, class I, II, and III pro- 2. The two polypeptides associate, forming a groove
teins, are present in different amounts on different tissues between the 1 and 1 domains that will hold fragments
(Table 15.1). Class I and II are the strongest antigens of antigen that have been engulfed and processed by the
expressed on cells. Class I molecules (designated as A, B, cell (extracellular antigens). In contrast, antigens bound to
or C) are expressed on all nucleated cells, whereas class II class I molecules (where the peptide-binding domain is
Table 15.1 Genes of the Major Histocompatibility Locus

MHC Region Gene Products Tissue Location Function
Class I HLA-A, HLA-B, HLA-C All nucleated cells Identication and destruction of
abnormal or infected cells by
cytotoxic T cells
Class II HLA-D B lymphocytes, monocytes, Identication of foreign antigen by
macrophages, dendritic cells, helper T cells
activated T cells, activated
endothelial cells, skin
(Langerhans cells)
Class III Complement C2, C4, B Plasma proteins Defense against extracellular
pathogens
Cytokine genes TNF-, TNF- Plasma proteins Cell growth and differentiation

Outside of cell
Advanced Concepts
Class II Class I
Class I and II molecules present fragments of anti- 1 1 2 1
gens, usually about nine amino acids long, to T lym-
S S
phocytes. Class I and II molecules vary from one S S
another (are polymorphic), sometimes by a single
amino acid. Due to these polymorphisms, different 2 2 3
HLA molecules (HLA types) vary in their efficiency
S S S S
of binding antigen fragments, resulting in a range of S S S S
immune responses to a given antigen. This distinc-
2-
tion can affect symptoms of disease; for example,
microglobulin
the likelihood of persons of a particular HLA type
infected with HIV to develop full immunode-
ciency.68,75,76 Cell
membrane
Cytosol
formed between the 1 and 2 domains) are generated
from the processing of macromolecules synthesized chain chain chain
within the cell (intracellular antigens).
Figure 15-2 Class II (left) and class I (right) polypeptides.
Class II antigens consist of two chains, and . Class I anti-
HLA Polymorphisms gens consist of a heavy chain and a light chain associated
together with a molecule of -2 microglobulin.
Genes of the MHC are the most polymorphic genes of
the human genome. Polymorphisms in this locus were
rst dened phenotypically by acceptance or rejection (Fig. 15-3). The changes range from a single base pair
of tissue or by reaction with dened antibodies (sero- (single nucleotide polymorphisms) to loss or gain of
logical typing). Molecular typing methods reveal HLA entire genes. A particular sequence, or version, of an HLA
polymorphisms as base changes in the DNA sequence gene is an allele of that gene. The HLA type is the col-
(A)
CGG GCC GCG GTG GAC ACC TAC TGC AGA CAC AAC TAC GGG GTT GGT GAG AGC TTC ACA
CGG GCC GCG GTG GAC ACC TAT TGC AGA CAC AAC TAC GGG GCT GTG GAG AGC TTC ACA
CGG GCC GCC GTG GAC ACC TAT TGC AGA CAC AAC TAC GGG GCT GTG GNN NNN NNN NNN
(B)
CGG GCC GCG GTG GAC ACC TAC TGC AGA CAC AAC TAC GGG GTT GGT GAG AGC TTC ACA
T C TG
C T C
C TG * * *** *** ***
Figure 15-3 DNA polymorphisms in the HLA-DRB1 gene. The initial sequence (DRB1*0101) is written at the top of
panel A. Aligned underneath are two alleles of this region, DRB1*01022 and DRB*0103. The green bases are those
that differ from DRB1*0101. N indicates unknown or unsequenced bases. Panel B shows a different way of present-
ing the alleles. A dash indicates identity to the consensus sequence. Only the polymorphic bases are written. The
asterisk indicates unknown or unsequenced bases.

lection of alleles detected by phenotypic or genotypic typ- HLA Nomenclature

ing methods.
Thus, each HLA gene can differ in sequence from one Polymorphisms are alterations in DNA and/or protein
individual to another, except for identical twins. A set of sequences shared by at least 2% of a dened population.
particular alleles on the same chromosome is a haplo- Formally, alterations present at lower frequencies are
type (Fig. 15-4). These alleles are inherited together as a called mutations or variants. Structurally, mutations and
block of chromosomal sequence, unless a rare recombi- polymorphisms are the same thing, changes from a con-
nation within the region separates the alleles. An HLA sensus amino acid or nucleotide sequence. When these
haplotype is, therefore, the combination of polymorphic changes occur in a gene, the different versions of the gene
sequences or alleles in the HLA gene regions. are referred to as alleles. The polymorphic nature of the
Polymorphisms are concentrated in exons 2 and 3 of MHC, therefore, means that there are multiple alleles of
the class I genes and in exon 2 of the class II genes. These each HLA gene present in the human population. These
exons code for the amino acids that interact with anti- alleles differ by nucleotide sequence at the DNA level
genic peptides, affecting the recognition of nonself pep- (polymorphisms) and by amino acid sequence and anti-
tides. Molecular methods target these exons in HLA-A, genicity at the protein level. Polymorphisms arise mostly
HLA-B, and HLA-C class I genes and mostly HLA-DRB as a result of gene conversion events and rare chromoso-
class II genes. Other areas including introns have been mal recombinations. Each person will have a particular
investigated for potentially useful alleles.13 group of HLA alleles inherited from his or her parents
Parental genotypes
A24 A30 A1 A6
Cw1 Cw3 Cw1 Cw7 Alleles

Haplotype
B14 B7 B12 B44
X
DR14 DR15 DR5 DR14
Offspring
A24 A6 A1 A30 A6 A30 A24 A1
Cw1 Cw7 Cw1 Cw3 Cw7 Cw3 Cw1 Cw1

B14 B44 B12 B7 B44 B7 B14 B12
Figure 15-4 A haplotype is the combina-

tion of alleles that are inherited together. In
DR14 DR14 DR5 DR15 DR14 DR15 DR14 DR5 this example, parental genotypes (top) can
produce four possible genotypes in the off-
spring (bottom).

(see Chapter 11 on Human Identication.) The maternal plement genes. The w is retained with HLA-Bw4 and
and paternal HLA antigens are expressed codominantly HLA-Bw6, which are considered public (high preva-
on cells. lence) antigens.
HLA alleles were rst dened at the protein level by A list of the serologically dened alleles of the HLA
antibody recognition (serologically). A standard nomen- genes accepted by the WHO is shown in Table 15.2. The
clature for expressing serologically dened antigens was WHO official nomenclature refers to serologically
established by the World Health Organization (WHO) dened alleles: a number follows the gene region name;
Nomenclature Committee for Factors of the HLA for example, HLA-B51 denotes HLA-B antigen 51
System. In this system, HLA refers to the entire gene (dened by reaction to a known antibody). Number des-
region, and A, B, D refer to the particular locus; for ignations of new alleles of a previously-dened allele
example, HLA-A, HLA-B, or HLA-D. The HLA-D locus with broad specicity (parent allele) are followed by the
consists of subregions P, Q, M, O, and R, termed HLA- number of the parent allele in parentheses. For example,
DP, HLA-DQ, HLA-DM, and so forth. Each of these HLA-A24(9) denotes the HLA-A antigen 24 from parent
subregions consists of genes that code for either an or antigen 9. The derived antigens are called split specici-
chain polypeptide; for example, the rst polypeptide ties. Additional antigens have been dened by reactions
is encoded in the HLA-DRB1 gene (see Fig. 15-1). A between known antigens and serum antibodies (antiserum
small w is included in HLA-Cw, HLA-Bw4, and HLA- reactivity). For class I, there are 85, 188, and 42 HLA-A,
Bw6 allele nomenclature. The w denotation was origi- B, and C alleles, respectively. For class II, there are 76,
nally a designation of alleles in workshop status or 32, and 221 HLA-DPB, DQB, and DRB alleles, respec-
found in high prevalence in the population. The work- tively. These numbers will increase as new specicities
shop designation is no longer required for the HLA-C are dened.
locus; however, the w was retained for HLA-C alleles to With the introduction of molecular biology techniques
distinguish them from the C designation used for com- in the 1980s, HLA typing at the DNA level required no-
Table 15.2 Serologically Dened HLA Specicities*

HLA-A HLA-B HLA-C HLA-DR HLA-DQ HLA-DP
A1 B5 Cw1 DR1, DR103 DQ1 DPw1
A2, A203, A210 B51(5), B5102, B5103 Cw2 DR2 DQ5(1) DPw2
A3 B52(5) Cw3 DR15(2) DQ6(1) DPw3
A9 B7, B703 Cw9(w3) DR15(2) DQ2 DPw4
A23(9) B8 Cw10(w3) DR3 DQ3 DPw5
A24 (9), A2403 B12 Cw4 DR17(3) DQ7(3) DPw6
A10 B44(12) Cw5 DR18(3) DQ8(3)
A25(10) B45(12) Cw6 DR4 DQ9(3)
A26(10) B13 Cw7 DR5 DQ4
A34(10) B14 Cw8 DR11(5)
A66(10) B64(14) DR12(5)
A11 B65(14) DR6
A19 B15 DR13(6)
A74(19) B62(15) DR14(6), DR1403, DR1404
A68(28) B63(15) DR7
A69(28) B75(15) DR8
A29(19) B76(15) DR9
A30(19) B77(15) DR10

Table 15.2 Serologically Dened HLA Specicities* (continued)

HLA-A HLA-B HLA-C HLA-DR HLA-DQ HLA-DP
A31(19) B16 DR51
A32(19) B38(16) DR52
A33(19) B39(16), B3901, B3902 DR53
A36 B17
A43 B57(17)
A80 B58(17)
B18
B21
B49(12)
B50(12)
B22
B54(22)
B55(22)
B56(22)
B27, B2708
B35
B37
B40, B4005
B60(40)
B61(40)
B41
B42
B46
B47
B48
B53
B59
B67
B70
B71(70)
B72(70)
B73
B7801
B81
Bw4
Bw6
*Alleles are listed in the order of the broad antigen groups, followed by split antigens for that group, with the broad antigen number in parentheses.
Associated antigens, such as B40 and B4005, are listed together.
menclature for specic DNA sequences.1416 Many new gene name, such as HLA-DRB1, is followed by an aster-
alleles have been and are currently being dened at the isk, (*) the allele sequence family number, and a number
DNA level.17,18 A revised nomenclature is used for denot- for the specic allele (DNA sequence). For example,
ing alleles dened by DNA sequence. The alleles are A*2503 is the third specic allele, 03, of the HLA-A*25
named in sequential order as they are discovered. The family of alleles.


The WHO Nomenclature Committee has proposed The National Marrow Donor Program assigns alpha-
addition of a third digit to the allele designation to betical allele codes, such as AD or RJH to allele
accommodate more than 99 alleles; for example, combinations from submitted requests. Generic
A*2501 to A*2599 would expand to A*25999. codes can be used with several loci and allele fami-
Other ways to accommodate the growing number of lies. For example the combination of alleles,
reported alleles have been proposed.19 1501/1501N/1511/1515/1533/1534/1557/1560, in
any HLA gene is designated RDX so that
B*1501/1501N/1511/1515/1533/1534/1557/1560
B*15RDX. Allele-specic codes are used for allele
The letter N following the specic allele number indi- combinations that include more than one serological
cates a null allele, or phenotypic absence of that antigen. family or that contain an N, L, or S expression char-
For example, B*1307N denotes the 07 allele of the 13 acter. The lists of these codes and submissions for
allele family in the HLA-B locus at the DNA level. At the new codes are available at www.nmdpresearch.org
protein level, however, the encoded protein does not react
with any antibody. The B*1307N null allele is due to a
15-bp deletion in the HLA-B gene. Null alleles can also
result from nonsense, frameshift, splice site, or other pre- Ambiguity is the recognition of two or more antigens
mature stop mutations that prevent translation of the by the same antibody, or cross-reaction, so that the exact
amino acids destined to bind to antibody. allele cannot be called. Ambiguity is designated by /
Silent mutations (changes in the DNA sequence that do between the possible allele numbers or a for a series
not change the amino acid sequence), also called syn- of alleles in which the rst and last allele are named. For
onymous changes, are designated by a number following example, if a typing test results in either B*0733 or
the specic allele number. For example, A*030102 indi- B*0735, the notation is B*0733/B*0735. If a typing test
cates a synonymous allele, 02, of the rst specic allele, indicates that the allele is either B*0733, B*0734,
01, from the HLA-A*03 family of alleles. A fourth num- B*0735, or B*0736, the designation is B*0733-B*0736.
ber designation indicates that the synonymous change Ambiguity also arises from the inability of some typing
results from a polymorphism in intronic sequences methods to assign heterozygous alleles to one or the other
beyond the coding regions (exons) of the genes. Thus, chromosome. A combination of methods may be used to
A*26070101 is the 01 subtype allele of the HLA-A*2607 resolve ambiguities. Family studies are also helpful in
allele, the second 01 indicating that the polymorphism is this regard.
in an adjacent intron. Resolution is the level of detail to which the allele is
determined. Low resolution identies broad allele types
or groups of alleles. A typing of A*26 is low resolution,
which can be determined at the serological level. Typing
methods that detect specic alleles in addition to identi-
Advanced Concepts cation of all serological types are at medium resolution.
Other descriptive designations are less frequently Typing result A*2601/A*2605/A*26010/A*2615 is
used, including L, S, X and ?. The letters L and S medium resolution. High resolution typing procedures
indicate poor expression of the allele at the cell sur- can discriminate between almost all specic alleles.
face or a soluble allele, respectively. An X notation A*2601 is high resolution determined by DNA analysis.
indicates that resolution of the allele was not done, A range of methods from serological typing to direct
for example B*08X. A ? indicates that the resolution DNA sequence analysis affords the laboratory a choice of
was not clear: B*08?. low, medium, or high resolution typing. Whereas low
resolution is adequate for solid organ transplantation typ-

ing, bone marrow or stem cell transplants require high ed alleles that far outnumber the serological alleles
resolution methods. dened for these genes. Over 400 new nucleotide se-
quences were dened in just 2 years, from 2002 to 2004.
The WHO Nomenclature Committee devised rules for
Molecular Analysis of the MHC submission of new alleles for official numerical designa-
There are over 1900 HLA alleles identied so far in all tion.19 Allele sequences are stored in the GenBank, the
loci (Table 15.3). Genetic (DNA-based) typing concen- European Molecular Biology Laboratory, and the DNA
trated in the HLA-A, -B, -C, and DRB1 genes has identi- Data Bank of Japan databases. A list of newly reported
alleles is published monthly in the journals Tissue
Antigens, Human Immunology, and the International
Table 15.3 Number of HLA Alleles Identied Journal of Immunogenetics. A comprehensive dictionary
Serologically and by DNA Sequence* of antigen-DNA sequence allele equivalents is published
Gene Serology Genetic periodically.2023
Class I Identication of alleles in the laboratory serves several
HLA-A 28 207 purposes. In addition to selection of organ donors, the
HLA-B 29 412 extent of HLA-type matching between donor and recipi-
HLA-C 10 100 ent predicts the long-term survival of the donor organ in
Class II the recipient. Furthermore, because disease genes are
HLA-DRA 2 located in and around the MHC locus, certain HLA gene
HLA-DRB1 18 271 alleles are linked to disease, affording another aid in
HLA-DRB2 1 diagnosis or prediction of disease phenotypes.
HLA-DRB3 1 30 There are three approaches to analysis of HLA alleles
HLA-DRB4 1 10 in the HLA laboratory: typing, screening, and cross-
HLA-DRB5 1 15 matching. Typing is initial identication of the HLA al-
HLA-DRB6 3 leles of a specimen through protein or DNA-based meth-
HLA-DRB7 2 ods. Typing may be used both to dene HLA haplotypes
HLA-DRB8 1 and to look for specic HLA types that are linked to dis-
HLA-DRB9 1 ease states. Screening is detection of anti-human anti-
HLA-DQA1 20 bodies in serum that match known HLA alleles.
HLA-DQB1 9 45 Crossmatching is more specic screening of recipient
HLA-DMA 4 sera for antibodies against antigens displayed by poten-
HLA-DMB 6 tial organ donors.
HLA-DPA1 19
HLA-DPB1 93 Serological Analysis
HLA-DOA 8
HLA-DOB 8 Traditionally, HLA typing for organ transplantation was
Extended MHC performed serologically; that is, by antigen-antibody
HLA-E 6 recognition. Although serological testing yields only low
HLA-F 1 resolution typing results, there are some advantages to
HLA-G 14 these methods. Serological typing is a relatively rapid
MICA 57 method that reveals immunologically relevant epitopes.
MICB 18 Also, serological studies can be used to resolve ambigui-
TAP1 6 6 ties or conrm null alleles detected by other methods.
TAP2 4 4 Serological tests include HLA phenotype determination,
*The World Marrow Donor Association Quality Assurance and Working
in which patient cells are tested with known antisera
Group on HLA Serology to DNA Equivalents publishes a comprehensive (HLA typing), and screening of patient sera for anti-HLA
dictionary of antigen and allele equivalents. antibodies.

Antigen Complement Dead cell

Lymphocyte
Antibodies
+
Plasma Positive reaction

to antibody
Leukocytes
and platelets
Erythrocytes
+
Blood Negative reaction

to antibody
Figure 15-5 Crossmatching to known antibodies is performed on lymphocytes (buffy coat, left) in a 96 well plate format where
each well contains different known antibodies. If the antibody matches the cellular antigen (positive reaction, top), complement-
dependent cytotoxicity will occur, and the dead cell will take up stain (green). If the antibody does not match the cellular anti-
gen, there is no cytotoxicity.
HLA Typing Society for Histocompatibility and Immunogenetics

Lymphocytes are HLA-typed using the complement- (ASHI) has developed guidelines for numerical descrip-
dependent cytotoxicity test (CDC; Fig. 15-5).24 In this tion of the observed cytotoxicity (Table 15.4). High cyto-
procedure, multiple alleles are determined using a panel toxicity (reading 6) in a well of the plate indicates that
of antibodies against known HLA types. These antibodies the cells being tested have cell surface antigens matching
are prepared from cell lines or from donors or known the known antibody in that well. As reading is somewhat
HLA types. Plates preloaded with antibodies (typing
trays) are commercially available. Alternatively, some
laboratories construct their own antibody panels. The col-
lection of antibodies can be modied to represent ethnic
populations or antigens of high prevalence in particular
geographical areas. As the antibody preparations are used
repeatedly, the antigen binding characteristics of the var-
ious antibodies are recognized and recorded. Experienced
technologists have detailed documentation of antibody
panels, including which antibodies bind antigen well and
which antibodies bind less strongly.
To begin the typing procedure, different antibodies are
placed in each well of the typing tray. Donor or recipient
lymphocytes to be typed are distributed to the wells.
Cross reactivity is assessed by the uptake of trypan blue
or eosin red dye in cells that have been permeabilized due
to reaction with the antibody and with complement that
is activated by the antigen-antibody complexes (Fig. 15- Figure 15-6 Cells stained for cytotoxicity. Dead cells take
6). Cytotoxicity is scored by the estimated percentage of up dye, and live cells remain transparent. (Photo courtesy of
cells in a well that have taken up the dye. The American Dr. Andres Jaramillo, Rush University Medical Center.)

Some epitopes are more important than others with re-

Table 15.4 Expression of CDC
spect to organ rejection. Therefore, certain mismatches
% Dead or lysed (dyed) Interpretation Score are allowable if the critical epitopes match.
010 Negative 1
1120 Doubtful negative 2 Screening
2150 Weak positive 4 Successful organ transplant depends on minimal reaction
5180 Positive 6 of the recipient immune system to the antigens of the
81100 Strong positive 8 donor organ. Normal sera do not have antibodies against
Unreadable 0 human antigens, termed anti-human antibodies or
alloantibodies. Persons who have had a previous organ
transplant, blood transfusions, or pregnancies, however,
subjective, it is recommended that trays be read by at will have anti-human antibodies (termed humoral sensi-
least two technologists independently. An example of tization) that may react against a new donor organ. The
partial results from a CDC test is shown in Table 15.5. chance of a successful transplant is improved by dening
The results indicate that the tested cells are HLA-type the specicity of the alloantibodies and selecting a suit-
A28, B44. able organ that does not have HLA antigens correspond-
Each HLA antigen has multiple epitopes, some unique ing to the antibodies in the patients sera.25 Humoral
to that HLA antigen and some cross-reactive epitope sensitization and the identity of alloantibodies present in
groups (CREG) shared by other HLA antigens. The CDC the recipient serum are determined in a modied version
test can be performed with private antibodies, those that of the CDC assay using the patients serum as the source
bind to one specic HLA type or antibodies to broad of antibodies and reference lymphocytes of known HLA
CREG (or public antigens). Analysis of antibodies types prevalent in the general population. The reference
with shared specicities aids in narrowing the specicity, lymphocytes are dened by their recognition of panel
as illustrated in Table 15.5. As shown, all antibodies with reactive antibodies (PRA). This test against PRA reveals
A28- or B44-specicity generated cytotoxicity, support- the percentage of the general population with whom the
ing the determination of an A28, B44 haplotype. patient will cross-react.
CREG matching or residue matching (determined The percentage of the panel of lymphocytes killed by
from the amino acid sequences of the antigens) is con- the sera is referred to as %PRA. Patients with %PRA
sidered for kidney transplant screening in order to dene activity of more than 50% are considered to be highly
the spectrum of HLA-specic antibodies more precisely. sensitized; nding cross-matchnegative donors is more
difficult in these cases.26
Screening of sera with microparticles (beads) is per-
formed in laboratories with ow cytometry capability
Table 15.5 Example of Results From a CDC Assay
(Fig. 15-7). For this method, microparticles are attached
Antibody Score*
to pools of antigens derived from cell lines of dened
A2, A28, B7 8 HLA types. The microparticles are exposed to test serum,
A2, A28 6 and those beads carrying antigens that are recognized by
A10 1 antibodies present in the test serum will bind to those
A10, A11 1 antibodies. After removal of unbound antibodies, a uo-
B7, B42 8 rescently labeled secondary reporter antibody is applied,
B7, B27 8 and the antibody-bound beads are detected by ow
B7, B55 8 cytometry. The advantages of this method over the CDC
B44, B45, B21 6 test are that the reaction is performed in a single tube and
B44, B45 8 there is less subjectivity in the interpretation of results.
B44 8 Because this test uses pooled antigens, however, it can
B45 1 detect prevalence of anti-human antibodies in the test
*Scores are 18, depending on the percentage of dyed cells observed. serum but not identify which specic antibodies are pres-

(A)
ent. A negative result does preclude further alloantibody Serum antibody
assessment. A variation of this method developed by Fluorescent
Luminex Corp. and MiraiBio utilizes beads with their reporter Antigen
own internal uorescence. By conjugating known anti- antibody
Bead
gens to beads of different internal uorescence, the posi-
tively reacting antibodies can be identied while still
performing the test in the same tube.
Wash
Crossmatching (B)
The CDC test is also used for crossmatching potential
organ donors and recipients. For crossmatching, recipient
serum is the source of antibodies tested against donor
lymphocytes (Fig. 15-8). If the recipient serum kills the
donor lymphocytes, it is a positive crossmatch and con-
traindication for using the crossmatched donor. Figure 15-7 Detection of serum antibodies using bead
Other methods used for crossmatching include varia- arrays. In this illustration, separate preparations of beads are
tions on the lymphocytotoxicity assay and nonlymphocy- conjugated to two different known antigens. The patient
serum tested contains an antibody to the antigen on the
beads in (A) but not the antigen on the beads in (B). A sec-
ondary antibody targeting the bound serum antibody gener-
ates a uorescent signal detected by ow cytometry. If a
Advanced Concepts matching antibody is not present in the test serum as in
(B), no antibody will be bound.
More detailed crossmatch information is achieved
by separate analysis of B and T donor lymphocytes.
Unactivated T cells display class I antigens, and B totoxic methods that utilize ow cytometry, such as the
cells display both class I and class II antigens. bead arrays just described. Alternative methods also
Therefore, if B cells cross react with the serum anti- include enzyme-linked immunosorbent assay (ELISA)
bodies and T cells do not, the serum antibodies are using solubilized HLA antigens. ELISA can be used to
likely against class II antigens. monitor the change in antibody production over time or
humoral sensitization developing after the transplant.
Recipient serum
Antigen Complement Dead cell
Positive reaction
Lymphocytes to antibody
from organ donor
of known HLA type
Figure 15-8 Crossmatch by CDC. In this

assay, the recipient serum is the source of +
antibodies to type lymphocytes from poten-
tial organ donors. The antibodies in the
recipient serum can be identied if the HLA Negative reaction
type of the lymphocytes is known. to antibody

Mixed Leukocyte Culture serological typing.33,34 Just as with other applications of

T lymphocytes are primarily responsible for cell-medi- molecular testing, the development of amplication and
ated organ rejection. The mixed leukocyte culture (MLC) direct sequencing methods greatly advanced the analysis
is an in vitro method used to determine T-cell cross reac- of HLA polymorphisms at the DNA sequence level.
tivity between donor and recipient. The MLC assay meas- DNA typing focuses on the most polymorphic loci in
ures growth of lymphocytes activated by cross reactivity the MHC, HLA-B, and HLA-DRB. HLA-A, HLA-B,
as an indication of donor/recipient incompatibility. MLC HLA-C, and HLA-DRB are all considered important for
can also test for cell-mediated cytotoxicity and cytokine successful transplantation outcomes.35 For this reason,
production, by either the donor or recipient lymphocytes, the number of alleles in these particular loci has risen sig-
so it can be used to predict GVHD as well as recipient- nicantly compared with the number of serologically
mediated transplant rejection. For this test, cells must be dened polymorphisms.
incubated together for several days. Cell activation and Whole blood patient specimens collected in ethylene
growth are assessed by uptake of 3H-thymine. Even diamine tetra-acetic acid anticoagulant are used for DNA-
though the MLC is more likely to detect HLA mismatches based typing. Cell lines of known HLA type are used for
than serology techniques, the time and technical demands reference samples. Standards and quality assurance for
of the MLC precludes its routine use for pretransplant his- DNA-based assays have been established by ASHI
tocompatibility testing in the clinical laboratory. (www.ashi-hla.org). DNA isolation (see Chapter 4) can be
performed from white blood cell preparations (buffy coat)
Protein Gel Electrophoresis or from isolated nuclei treated with proteinase K.
The protein products of the HLA genes can be distin-
guished by mobility differences in one-dimensional gel Sequence-Specic Oligonucleotide
isoelectric focusing or two-dimensional gel electrophore- Probe Hybridization
sis methods.27,28 These typing methods have also been Hybridization of a labeled probe to immobilized ampli-
applied to forensic identication.29 Protein methods are cons of the HLA genes (dot blot) was one of the rst
limited by the demands of the methodology and the abil- methods that utilized polymerase chain reaction
ity to distinguish only those proteins that have different (PCR)amplied DNA for HLA typing.36 For this proce-
net charges. With the advent of proteomics, the use of dure (Fig. 15-9), the HLA region under investigation is
protein markers to evaluate tissue and organ transplanta- amplied by PCR using primers anking the polymor-
tion may return.30 phic sequences. Because the majority of polymorphic
sequences are located in exon 2 of the class II genes and
exons 2 and 3 of the class I genes, primers are designed
DNA-Based Typing
to target these regions.
Many people are waiting for transplant organs. Typing, An assay using 30 probes requires approximately 70
screening, and crossmatch analysis are critical for selec- l of PCR product.37 The amplicons are denatured by
tion of potential donors and successful engraftment. addition of NaOH and spotted onto a membrane in
Methods differ in sensitivity. The choice and design of 12l volumes. Spotting is done manually with a mul-
the method used, therefore, will affect the ability to pre- tichannel pipet or by a vacuum manifold with a 96 well
dict rejection risk. plate format. The spotted DNA is dried, then perma-
Limitations of serological and protein-based methods nently attached to the membrane by ultraviolet cross-
have led to the development of more rened molecular linking (exposure to ultraviolet light) or baking. Separate
DNA typing with higher powers of resolution, especially membranes are produced for each probe to be used.
for bone marrow transplantation typing. One of the rst Every membrane should include reference amplicons
DNA methods for molecular typing was restriction frag- complementary (positive control) and noncomplemen-
ment length polymorphism (RFLP) analysis by Southern tary (negative control) to all probes in the assay. Spotting
blot. This method was used to identify HLA class II alle- consistency may be checked using a consensus probe that
les.31,32 (See Chapter 6 for a description of the Southern will hybridize to all specimens on a membrane.
blot technique.) Studies showed that kidneys matched The probes used in this assay are short (1920 bases)
by RFLP typing survived longer than those matched by single-stranded DNA chains (oligonucleotides) designed

Specimen 1 (Type A*0203) Specimen 2 (Type A*0501) HLA-B, and 57 HLA-C probes and intermediate resolu-
tion with 39 HLA-A and 59 HLA-B alleles.38
TAGCGAT TAGAGAT Sequence-specic oligonucleotide probe (SSOP) may
ATCGCTA ATCTCTA also be performed in a reverse dot blot conguration in
which the allele-specic probes are immobilized on the
Amplify, denature, membrane (Fig. 15-10). In this method, the specimen
bind to membrane DNA is labeled by PCR amplication using primers
covalently attached to biotin or digoxygenin at the 5 end.
In contrast to the SSOP described above where ampli-
cons from each specimen are spotted on multiple mem-
branes, each specimen is tested for multiple alleles on a
Specimen 1 Specimen 2 single membrane. Therefore, instead of having a separate
membrane of multiple specimens for each probe, a sepa-
rate membrane of multiple probes is required for each
Probe with allele-specific probes specimen. Membranes with immobilized probes, such as
Dynal RELI, SSO HLA-Cw, and DRB typing kits are
TAGCGAT (A*02) TAGAGAT (A*05) commercially available.
A bead array system has been applied to the reverse dot
blot strategy where uorescently distinct beads carry the
oligonucleotide probes (LABType SSO, One Lambda,
Specimen 1 Specimen 2 Specimen 1 Specimen 2 Inc.). This system is commercially available for typing
Figure 15-9 The principle of the SSOP assay is shown. An of HLA-A, B, C class I, and HLA-DRB1, DRB3, DRB4,
HLA gene region is amplied from specimen DNA using DRB5, and DQB1 antigens.
generic primers (top). The amplicons are immobilized on a
membrane and probed with labeled sequences complemen-
SSOP is considered low to intermediate resolution,
tary to specic alleles. Signal from the bound probe will indi- depending on the number and types of probes used in the
cate the allele of the immobilized DNA. assay. Probe panels are listed by the 13th International
to hybridize to specic HLA alleles. The oligonucleotides

are labeled; that is, covalently attached to biotin or digo-
xygenin. (See Chapter 6 for a description of nonradioac-
tive signal detection.) Probe sequences are based on
sequence alignments of HLA polymorphic regions. The
probe sequences are aligned so that the polymorphic Color
nucleotide is in the middle of the probe sequence. signal
Hybridization conditions depend on the optimal binding
of the probe matching a test sequence in comparison with Amplicon
another sequence, differing from (not complementary to) Probe
the probe by at least one base. Spots of immobilized spec-
imens bound to specic probes give a positive colorimet-
Figure 15-10 In reverse dot blot SSOP, the probe is immobi-
ric or chemiluminescent signal. Panels of probes dene lized on the membrane. Patient DNA is amplied using primers
specic alleles according to which probe binds to the covalently bound to biotin or digoxygenin at the 5 end. The
immobilized amplied DNA under investigation. The amplicons are then hybridized to panels of probes immobilized
number of probes used depends on the design of the on a membrane (top). If the sequence of the amplicon
matches and hybridizes to that of the probe, a secondary
assay. For example, an intermediate resolution assay of
reaction with enzyme-conjugated avidin or antidigoxygenin
the HLA-DRB locus might take 3060 probes. Studies will produce a color or light signal when exposed to substrate.
have achieved high resolution identication of the major- If the sequence of the amplicon differs from that of the probe,
ity of HLA-A, B, and C alleles using 67 HLA-A, 99 no signal is generated (bottom right).

Histocompatibility Workshop at www.ikwg.org and a size distinct from the product of the allele-specic
the National Marrow Donor Program (NMDP) at primers. The two amplicons can then be resolved by
www.nmdp research.org. As some probes have multiple agarose gel electrophoresis. An illustration of the results
specificities, hybridization panels can be complex. expected from SSP-PCR is shown in Figure 15-12.
Computer programs may be used for accurate interpreta- Specimens will yield two PCR products (amplication
tion of SSOP results. control and allele-specic product) only from those wells
containing primers matching the specimen HLA allele.
Sequence-Specic PCR Wells containing primers that do not match the patients
A faster method of sequence-based typing is the use of HLA allele will have a band only from the amplication
sequence-specic primers that will amplify only specic control.
alleles (Fig. 15-11). As described in Chapter 7, the 3 end PCR plates preloaded with reaction mixes (typing
of a PCR primer must be complementary to the template trays) containing primers specic for class I and class II
for recognition by DNA polymerase. By designing DRB and DRQ genes are commercially available (Micro-
primers that end on the polymorphic sequences, success- SSP, One Lambda, Inc., and Pel Freez SSP UniTray). To
ful generation of a PCR product will occur only if the test use these products, specimen DNA is introduced into the
sequence has the polymorphic allele complementary to individual wells, and the plates are placed in the thermal
the primer. Detection of the PCR product is used to indi- cycler. Plate maps of allele-specic primers are provided
cate specic alleles. Sequence-specic PCR (SSP-PCR) for interpretation of the HLA-type. SSP-PCR has become
is faster and easier than SSOP in that no probes or label- a commonly-used method for testing potential donors
ing steps are required and the results of SSP-PCR are before transplant.
determined directly by agarose gel electrophoresis.
For SSP-PCR, isolated DNA is amplied using sets of Sequence-Based Typing
primers designed to specically amplify a panel of al- The most denitive way to analyze DNA at the nucleotide
leles. Reactions are set up in a 96 well plate format, with sequence level is by direct DNA sequencing. This is true
different allele- or sequence-specic primer sets in each for any DNA test, no less for discovery and identication
well. Each PCR reaction mix contains sequence-specic of HLA types. (See Chapter 10 for a description of DNA
primers and amplication control primers in a multiplex sequencing methodology.) Sequence-based typing (SBT)
format. The amplication control primers should yield a involves amplication of polymorphic regions; for exam-
product for every specimen (except the negative control). ple, exons 2 and 3 of the HLA-B gene (Fig. 15-13). The
The sequence-specic primers should only yield a prod- amplicons are then puried and added to a sequencing
uct if the specimen has the allele complementary to reaction mix (Fig. 15-14). Following gel or capillary gel
(matching) the allele-specic primer sequence. The am- electrophoresis, the fragment patterns or electrophero-
plication primers are designed to yield a PCR product of grams are examined for specic polymorphisms. Because
TCATGA
Amplification controls
TGACTTGCATCGTGCATCT AGCTAGCTACAGTACTACATC
ACTGAACGTAGCACGTAGA TCGATCGATGTCATGATGTAG Allele-specific product
CTTGCAT
Amplification
TCATGA
TGACTTGCATCGTGCATCT AGCTAGCTACCGTACTACATC
ACTGAACGTAGCACGTAGA TCGATCGATGGCATGATGTAG
CTTGCAT
No amplification
Figure 15-11 The sequence-specic primer ending in AGTACT will be extended only from a template carrying the poly-
morphism shown.

Reagent blank
amplification control
Figure 15-12 Results of an SSP-PCR of 95
primer sets detected by agarose gel elec-
allele-specific product
trophoresis. An amplication control is included
with each reaction to avoid false-negative results
due to amplication failure. Contamination is
monitored by a reagent blank. (Photo courtesy of
Christin Braun, Rush University Medical Center.)
HLA haplotypes are almost always heterozygous, the Isolate DNA

sequencing results often yield a heterozygous pattern at
the site of the polymorphism (Fig. 15-15). Commercial
systems including PCR and sequencing reaction mixes as
well as software programs for interpretation of results are
available. PCR
Secondary structure and other artifacts may alter the
mobility of some fragments and complicate interpreta-
tion. Furthermore, a number of events can occur that will
compromise sequence quality (see Chapter 10). Manu-
facturers of sequencing reagents supply ways to correct
most of these problems. As with any sequencing assay, it
is useful to sequence both strands of the test DNA.
Other DNA-Based Methods Clean amplicons

Almost any method that can determine DNA sequence or
detect specic sequences or sequence differences can be
applied to DNA-based HLA typing (see Chapter 9). There
Sequence amplicons
Exon 2 Exon 3
Figure 15-13 Example of primer placement for amplica- Figure 15-14 For sequenced-based typing, HLA regions
tion and sequence analysis. PCR primers (outer large arrows) from patient DNA are amplied by PCR. The PCR products are
are used to amplify the region of interest. The PCR product is then puried from unused PCR reaction components by alco-
then sequenced using four different primers (inner small hol precipitation or column or gel purication methods. The
arrows) in separate sequencing reactions. amplicons are then sequenced to detect polymorphisms.

Figure 15-15 A sequence-based typing

result for the HLA-A gene. Software is
designed to analyze the sequence of
patient DNA, compare it with the con-
sensus sequence, and identify the spe-
cic alleles by sequence polymorphisms.
(Sequence courtesy of Christin Braun, Rush
University Medical Center.)
are several variations on SSOP, SSP, and SBT, such as are the DNA-based methods used in most clinical labora-
nested PCR-SSP39 proposed for HLA typing. Another ex- tories.37,49
ample is allele-specic nested PCR-SSP, which has been
applied to subtyping of highly polymorphic alleles.40,41
Combining Typing Results
Heteroduplex (HD) analysis has been used for assess-
ment of compatible bone marrow donors at the HLA-DR At the DNA level, HLA polymorphisms differ from one
and HLA-DP loci.42 Reference strand conformation poly- another by as small as a single nucleotide base. Serolo-
morphism is a variation on the standard HD analysis; gical typing does not always distinguish subtle genetic
sample amplicons are mixed with uorescently labeled differences between types. Serological typing also re-
reference DNA of known allele sequence before denatu- quires the proper specimen. A specimen consisting of
ration and renaturation to form heteroduplexes.43 The mostly T cells, for example, from a patient treated with
homo- and heteroduplexes formed between the specimen chemotherapy, will not provide B cells (which carry class
amplicons and the reference strand are then resolved by II antigens) for testing of class II haplotypes. In contrast,
capillary gel electrophoresis. DNA-based typing is not limited by specimen type as all
Single strand conformation polymorphism (SSCP) has cells have the same HLA haplotype at the DNA level,
been applied to HLA-A, DR, DQ, and DP typing and sub- regardless of whether the cell type expresses the antigens.
typing.44,45 SSCP has been coupled with allele-specic Furthermore, synonymous DNA changes and polymor-
PCR.46 High performance liquid chromatography (HPLC) phisms outside of the protein coding regions may not
has been proposed for HLA typing as well. Conformation alter antigenicity at the protein level.
analyses, such as HD, SSCP, and HPLC, however, are For DNA-based methods, the design of molecular
limited by the complexity of the raw data and the strict methods (primer and probe selection) determines their
demands on reactions and electrophoresis conditions; level of resolution. SSOP and SSP methods require spe-
they are not routinely used in the clinical laboratory. cic primers and/or probes for each particular HLA type.
Other DNA-based typing approaches include array Only those HLA-types included in a given probe or
technology47 and pyrosequencing.48 No one method is primer set, therefore, will be identied. Sequence-based
without disadvantages with respect to technical demands, typing will only identify alleles included in the amplied
cost, or time consumption. To date, SSP, SSOP, and SBT regions that are sequenced.

Results from serological and DNA-based methods can ing. These discrepancies may be difficult to resolve, espe-
be combined to improve resolution and further dene cially if the original typing data are not accessible.
HLA types. Sequential use of SSP-PCR and PCR-RFLP
or SSOP-PCR and SSP-PCR increases the typing resolu-
Coordination of HLA Test Methods
tion of DNA-based tests.37,50 Serological testing can be
used to clarify or conrm the phenotype of alleles de- Choice of the appropriate method and resolution of HLA
tectable by DNA-based methods. The resolution of results testing are inuenced by the type of transplant. For solid
from various methods, therefore, reects a range of reso- organ transplants, antibody screening and crossmatching
lution levels (Table 15.6). The choice of method will of recipient serum against donor antigens are routinely
depend on the demand for high or low resolution typing. performed, although not always before transplantation.
Pretransplant HLA typing is often determined for kidney
and pancreas transplants, as the extent of HLA matching
HLA Test Discrepancies is directly proportional to time of survival of the donor
HLA typing may produce discrepant results, especially if organ.52,53 Given the circumstances under which heart,
different methods are used to assess the same specimen. lung, and liver transplants are performed, testing is fre-
The most common discrepancies are those between quently performed after the transplant. HLA typing for
serology and molecular testing results.51 DNA sequence solid organs is usually at the low resolution serology
changes do not always affect protein epitopes. A serology level, although for heart and lung transplants, as with kid-
type may represent several alleles at the DNA level. Also, ney transplants, studies have shown that matching HLA
a serology type may look homozygous (match to only types are benecial for organ survival.54,55 For stem cell
one antibody) where the DNA alleles are heterozygous, and bone marrow transplants, typing to high resolution
the second allele not recognized by serology. For exam- (specic alleles) is preferred in order to decrease the risk
ple, a serology type of A2 is determined to be A*02, of rejection and to avoid GVHD.56,57
A*74 at the DNA level.
Discrepancies also arise when HLA types assigned to
parent alleles based on DNA sequence homology differ Additional Recognition
from serology results that detect the same allele as a new Factors
antigen. For example, a DNA allele of B*4005 is detected Minor Histocompatibility Antigens
as a new antigen by serology and named B50. Similarly,
split alleles (subtypes of serologically dened antigens) Any donor protein that can be recognized as nonself by
can differ between DNA and serology typing due to the recipient immune system can potentially affect
the cross reactivity of antibodies used to dene the HLA engraftment. Proteins outside the MHC that inuence
antigens. graft failure are called minor histocompatibility anti-
The identication of new alleles can result in dis- gens (mHag). These antigens were the suspected cause of
crepant retyping results based on the recognition of new GVHD and graft rejection in MHC-identical trans-
alleles that were not dened at the time of an initial typ- plants.58,59 The H-Y antigen was the rst characterized
mHag.60 Investigations using molecular methods have
led to the characterization of additional mHags, includ-
Table 15.6 Resolution of HLA Typing Methods ing HA-1, CD31, HPA-1, HPA-2, HPA-3, and HPA-5.61
Evaluation of mHags in stem cell transplants can be car-
Intermediate High
Low Resolution Resolution Resolution ried out by molecular methods such as SSP-PCR.62
CDC (serology) PCR-SSP PCR-SSP
PCR-SSP PCR-SSOP PCR-SSOP Nonconventional MHC Antigens
PCR-SSOP PCR-RFLP SSP-PCR PCR-RFLP
Located within the MHC locus are the MHC class I
SSOP-PCR SSP-PCR
related MICA and MICB genes. Three pseudogene frag-
SBT
ments, MICC, MICD, and MICE are also found within

the class I region. The products of the MICA and MICB (leukocyte-associated immunoglobulin-like receptor). A
genes along with those of the retinoic acid early tran- cluster of genes coding for these receptor proteins has
script (RAET) gene cluster located on the long arm of been found on chromosome 19q13.4, the leukocyte
chromosome 6 (6p21.3) bind to the receptor NKG2D receptor cluster (Fig. 15-16).
on natural killer (NK) cells (killer cell lectin-like recep- Recipient KIR may participate in graft rejection and
tor, subfamily K, number 1 or KLRK1). These gene pro- donor KIR in GVHD.65 Specic interactions between
ducts participate in immune reactions against abnormal KIR and HLA genes are listed in Table 15.7. Just as with
cells such as tumor cells through control of NK cells and mHags, assessment of polymorphisms in KIR may be
cytotoxic T lymphocytes (CTL) expressing the T-cell added to donor selection criteria in stem cell and bone
receptor. Virus- or bacteria-infected cells may also be marrow transplant, especially with unrelated donors.66, 67
recognized and eliminated in part by this system. In contrast to HLA typing, testing for KIR is aimed at
The MICA and MICB genes are highly polymorphic. nding donors and recipients who do not match. A KIR
Approximately 60 MICA and 25 MICB alleles have been SSO commercial system using bead array technology is
reported. In contrast to the MHC class I alleles, polymor- available for typing of 16 KIR genes and variants (One
phisms in the MIC genes are distributed throughout the Lambda, Inc.).
coding regions, with no hypervariable regions. Anti-MIC
antibodies have been detected after organ transplantation,
similar to anti-HLA alloantibodies, supporting a role for MHC Disease Association
these gene products in organ rejection.63 Genetic diseases caused by single gene disorders obey
mendelian laws. Their phenotypes are either dominant or
recessive and are inherited in a predictable manner illus-
Killer Cell Immunoglobulin-
trated in pedigrees (see Chapter 13). Most diseases, how-
like Receptors
ever, are not caused by a single genetic lesion and
NK cells and some memory T cells express killer cell therefore have complex segregation patterns. Multiple
immunoglobulin-like proteins (KIR). The effect of these genes, epigenetics, and environmental factors combine to
proteins was rst observed as hybrid resistance in bring about these disease states. For diseases such as dia-
mice.64 In these experiments, mice with compromised betes, high blood pressure, and certain cancers, genetic
immune systems were still capable of rejecting grafts analysis yields results in terms of predisposition, proba-
from unrelated mice. That is, graft rejection still occurred, bility, and risk of disease.
even in the absence of a functional immune system. The Autoimmune diseases, which affect 4% of the popula-
KIR proteins have been proposed as one source of nonself tion, fall in this category. At least one of the genetic fac-
recognition outside of the MHC. The KIR proteins inter- tors involved in autoimmunity is linked to the MHC, as
act with HLA antigens, specically recognizing HLA-A, autoimmune diseases have MHC associations. Rheuma-
HLA-B, and HLA-C (class I) molecules. KIR proteins are toid arthritis, multiple sclerosis, diabetes mellitus type 1,
also expressed on myelomonocytic lineage cells (leuko- and systemic lupus erythematosus are associated with
cyte immunoglobulin-like receptor) and other leukocytes particular HLA haplotypes. Determination of a disease-
Centromeric Telomeric
2DL2 2DS3 3DP1 3DS1 2DL5A

3DL3 2DS2 2DL5B 2DP1 2DL1 2DL4 2DS1 3DL2
2DL3 2DS5 3DP1v 3DL1 2DL5B
2DS3 2DS4
2DS5
Figure 15-16 The KIR gene cluster includes a centromeric and a telomeric fragment. Gene content varies from one person to
another. A KIR haplotype can contain from 8 to 14 genes in different combinations and gene orders. For example a haplotype
may have a 2DL2 or 2DL3 gene between 2DS2 and 2DL5B genes, or the order of 2DS1 and 2DS4 can be 2DS12DS4 or 2DS42DS1.

Table 15.7 KIR and HLA Gene Interactions

KIR HLA Specicities
Advanced Concepts
2DL1, 2DS1, Cw*02, *0307, *0310, *0315, *0304, *0305, HLA types are also associated with absence of
(2DS4) *0306, *0707, *0709, *1204, *1205, *15 inherited disease. Protection from genetic diseases
(except *1507), *1602, *17, *18 is naturally enhanced by hybrid vigor or avoid-
2DL2, 2DL3, Cw*01, *03, (except *0307, *0310, *0315, ance of inbreeding. The MHC may bring about such
(2DS2) *07 (except *0707, *0709), *0708, *12 natural protection by control of mating selection to
(except *1204, *1205), *13, *14, *1507, ensure genetic mixing. For example, studies with
*16 (except *1602) mice have shown that olfactory sensation (sense of
2DL4 G smell) may play a role in mate selection. In these
2DL5 Unknown studies, female mice were able to distinguish male
3DL1 Bw4 mice with H-2 alleles different from their own.77
3DL2 A3, A11 This supports the idea of selective pressure to
3DL3 Unknown mate with HLA-dissimilar partners to increase
2DS3 Unknown genetic diversity. Another study in humans showed
2DS5 Unknown that women found the scent of T-shirts worn by
3DS1 Unknown some male subjects pleasant and others unpleasant.
The odors detected as pleasant were from HLA-
dissimilar males. The women were apparently able
associated HLA haplotype aids in diagnosis or prediction to distinguish HLA types different from their own
of disease predisposition. through sweat odors of male test subjects.78
The presence of a haplotype associated with disease is
not diagnostic on its own, however. An example is the
HLA-B27 type found in all cases of ankylosing spondyli-
tis. HLA-B27 is also the most frequently found HLA-B lated donors. The extent of HLA matching will increase
allele. Many people, therefore, with the B27 allele do not the prospect of successful transplantation with minimal
have this condition. The laboratory is usually asked to GVHD. For example, the NMDP requests HLA typing
perform HLA typing in persons showing disease symp- results for HLA-A, B, and C class I antigens and DRB1,
toms or family histories of such disease to aid or conrm DQB1, and DPB1 class II antigens for prospective bone
the diagnostic decisions. marrow donors.
Normal states are also controlled by multiple genetic Combinations of molecular tests, serum screening, and
and environmental factors. The genes for olfactory sen- crossmatching further define acceptable HLA mis-
sation, histone genes, genes encoding transcription fac- matches, and the results are used to prevent hyperacute
tors and the butyrophilin (a constituent of milk in (almost immediate) rejection in organ transplants.
mammals) gene cluster are found in the MHC. The MHC Identication of HLA types associated with disease
may play a role, not only in the predisposition to disease, also provides important information, especially for dis-
but protection from disease as well, including some ease caused by multiple genetic and environmental fac-
infectious diseases, notably HIV.68,69 In this role, certain tors. Finally, MLC, although not generally part of routine
HLA types are considered protective. clinical testing, can predict cellular factors involved in
rejection.
Summary of Laboratory Laboratory results are key for selection of compatible
donors, post-transplant evaluation, selection of optimal
Testing treatment strategy, and genetic disease predisposition.
Standard HLA testing includes a range of methods and Molecular analysis has signicantly increased the ease
test designs (Table 15.8). Determining donor and recipi- and ability to detect subtle differences in the MHC and
ent compatibility is the primary goal of pretransplant associated regions. Nucleic acid analysis will play an
testing, especially for bone marrow transplant from unre- expanding role in this area of laboratory analysis.

Table 15.8 Summary of Testing for Pre- and Post-transplant Evaluation

Purpose Test Design Methods
Determine HLA type Determine HLA types with standard references or Serology
by DNA sequence DNA-based typing
Determine serum antibody status Serum screening against known HLA antibodies CDC
ELISA
Flow cytometry
Crossmatching Compare serum of recipient with that of prospec- CDC
tive donors ELISA
Flow cytometry
Determine T-cell mediated cytotoxicity Alloreactive T-cell characterization and quantitation MLC
between donor and recipient Cytokine production
Case Study 15 1
A 50-year-old man complained of digestive disorders and the DQB1*0302 alleles. Most of the 5% of celiac
and what he presumed was allergy to several foods. He patients who are negative for the DQ2 alleles display
consulted his physician, who collected blood samples the DQ8 alleles. Serological results to detect the
for laboratory testing. The man was in a high-risk predisposing antigens, however, were equivocal.
group for certain diseases, notably celiac disease, An SBT test was performed. The indicated alleles
which would produce symptoms similar to those expe- were detected by sequence analysis. The sequence
rienced by this patient. A specimen was sent to the lab- results showed the following alleles at DQA1 and
oratory to test HLA-DQA and -DQB alleles. Almost DQB1 loci:
all (95%) people with celiac disease have the
DQA1*0501 DQB1*0201, DQB1*0401
DQA1*0501 and DQB1*0201 alleles, compared with
20% of the general population. A second predispos- Question: Is it possible that this man has celiac dis-
ing heterodimer, DQ8, is encoded by the DQA1*0301 ease based on his HLA haplotype?
Case Study 15 2
A 43-year-old man consulted his physician about a light chain gene rearrangement. The patient was ini-
lump on his neck and frequent night sweats. A tially treated with standard chemotherapy, but the
biopsy of the mass in his neck was sent to the tumor returned before the therapeutic program was
pathology department for analysis. An abnormally completed. The tumor persisted through a second
large population of CD20-positive lymphocytes was treatment with stronger chemotherapy plus local
observed by morphological examination. Flow irradiation. Nonmyeloablative bone marrow trans-
cytometry tests detected a monoclonal B-cell popu- plant was prescribed. To nd a compatible donor,
lation with coexpression of CD10/CD19 and CD5. the mans HLA type and the types of ve potential
This population was 88% kappa and 7% lambda. donors were compared. HLA-A and -B types were
The results were conrmed by the observation of a assessed by serology, and HLA-DR type was deter-
monoclonal immunoglobulin heavy chain gene mined by SSP-PCR and SSOP. The typing results
rearrangement that was also monoclonal for kappa are shown in the table.

Recipient Donor 1 Donor 2 Donor 3 Donor 4 Donor 5

A*0302 A*6601/04 A*2601 A*0302 A*3103/04 A*2610
A*2610 A*0302 A*4301 A*0309 A*0309
B*3906 B*0711 B*1528 B*3801 B*2702 B*3508
B*5307 B*5701 B*3919 B*3901 B*3501
DRB1*0801 DRB1*0701 DRB1*1317 DRB1*0809 DRB1*0701 DRB1*1317
DRB1*1317 DRB1*0422 DRB1*1117 DRB1*0701
Q u e s t i o n s : Which of the ve donors is the best closely, is there more of a chance of graft rejection or
match for this patient? Which mismatches are accept- GVHD?
able? Using the donor bone marrow that matches most
Case Study 15 3
A 19-year-old woman reported to a local clinic with 50
painful swelling in her face. Routine tests revealed M1 M2
40
dangerously high blood pressure that warranted hos- Counts 30
pitalization. Further tests were performed, which led 20
to a diagnosis of systemic lupus erythematosus. Due 10
to complications of this disease, her kidney function 0
0 200 400 600 800 1000
was compromised, and she would eventually suffer SERA
kidney failure. With an alternative of life-long dial- 50
ysis, a kidney transplant was recommended. Class I M1 M2
40
PRAs were assessed at 0% PRA for class I. An addi-
Counts
30
tional screen for class II PRA was performed by 20
ow cytometry. 10
Class I and class II HLA typing was performed by 0
0 200 400 600 800 1000
SSP-PCR. An autocytotoxic crossmatch was also SERA
performed, revealing T-cell and B-cell positive anti- 50
bodies, probably related to the lupus. The young M1 M2
40
womans mother volunteered to donate a kidney to
Counts
30
her daughter. Mother and daughter had matching 20
blood group antigens and HLA-DR antigens, which 10
are the most critical for successful organ transplant. 0
0 200 400 600 800 1000
The results from the typing tray are shown in the SERA
following gure: Flow cytometry analysis of HLA class II antigens in recipi-
ent serum. Top negative control; middle positive con-
trol; bottom patient serum.
(continued on following page)


(continued)
SSP-PCR results for HLA-A, -B, and -DR and their
serological equivalents are shown in the table.
Crossmatching of the daughters serum and
mothers cells was performed by cytotoxicity and ow
cytometry. Both test results were negative.
Q u e s t i o n s : Is the mother a good match for the
daughter? Based on the antibody and crossmatch-
ing studies, what is the risk of rejection? Before per-
forming the HLA studies, how many of the daughters
antigens would be expected to match those of her
mother?
SSP-PCR results from an HLA-A typing tray for the

daughter. Alleles were identied in lanes 7, 19, and 22.
Daughter Mother
SSP-PCR Serology SSP-PCR Serology

A*2419, A*3401 A24(9), 34(10) A*1104, A*2419 A11, A24(9)
B*0802, B*5603 B8, B22 B*0804, B*5603 B8, B22
DRB1*0422, DRB1*1411 DR4, DR14(6) DRB1*0422, DRB1*1317 DR4, DR13(6)
4. An HLA-A allele is a CTC to CTT (leu leu) change

STUDY QUESTIONS at the DNA level. How is this allele written?
a. HLA-A*02
1. Which of the following is a high resolution HLA typ- b. HLA-A*0201
ing result? c. HLA-A2
a. B27 d. HLA-A*02N
b. A*02020209
c. A*0212
5. A candidate for kidney transplant has a PRA of 75%.
d. A*2601/A*2605/A*26010/A*2615
How will this affect eligibility for immediate trans-
plant?
2. Which of the following is a likely haplotype from par-
ents with A25,Cw10,B27/A23,Cw5,B27 and A17,
Cw4,B10/A9,Cw7,B12 haplotypes? 6. An SSOP probe recognizes HLA-DRB*03010304.
a. A25,Cw10,B27 Another probe recognizes HLA-DRB*0301/0304, and
b. A25,Cw5,B27 a third probe hybridizes to HLA-DRB*03010303.
c. A23,Cw4,B12 Test specimen DNA hybridizes to all except the third
d. A17,Cw4,B27 probe in a reverse dot blot format. What is the HLA-
DRB type of the specimen?
3. Upon microscopic examination, over 90% of cells are
translucent after a CDC assay. How are these results 7. What is the relationship between alleles HLA-A10
scored according to the ASHI rules? and HLA-A26(10)?

8. A CDC assay yields an 8 score for sera with the fol- 8. Inoko H, Trowsdale J. Linkage of TNF genes to
lowing specicities: A2, A28 and A2, A28, B7, and a the HLA-B locus. Nucleic Acids Research 1987;15:
1 score for serum with an A2 specicity. What is the 895762.
HLA-A type? 9. Ruddy DA, Lee VK, Mintier GA, et al. A 1.1-Mb
transcript map of the hereditary hemochromatosis
9. HLA-DRB1*1501 differs from DRB1*0101 by a G locus. Genome Research 1997;7:44156.
to C base change. If the sequence surrounding the 10. Feder J, Gnirke A, Thomas W, et al. A novel MHC
base change is: GGGTGCGGTTGCTGGAAA- class Ilike gene is mutated in patients with heredi-
GAT (DRB1*0101) or GGGTGCGGTTCCTG- tary haemochromatosis. Nature Genetics 1996;13:
GAAAGAT (DRB1*1501), which of the following 399408.
would be the 3 end of a sequence-specic primer for 11. Powis S. Major histocompatibility complex class I
detection of DRB1*1501? molecules interact with both subunits of the trans-
a. ATCTTTCCAGGAACCC porter associated with antigen processing, TAP1
b. ATCTTTCCAGCAACCC and TAP2l. European Journal of Immunology
c. ATCTTTCCAGC 1997;27:274447.
d. ATCTTTCCAGG 12. van Endert P. Genes regulating MHC class I pro-
cessing of antigen. Current Opinion in Immunology
10. The results of an SSP-PCR reaction are the follow- 1999;11:8288.
ing: lane 1, one band; lane 2, two bands, lane 3 no 13. Dunn P, Day S, Williams S, et al. HLA-DQB1
bands. If the test includes an amplication control sequencingbased typing using newly identied
multiplexed with the allele-specic primers, what is conserved nucleotide sequences in introns 1 and 2.
the interpretation for each lane? Tissue Antigens 2005;66:99106.
14. Wake CT, Long EO, Mach B. Allelic polymorphism
References and complexity of the genes for HLA-DR beta-
1. Dausset J, Nenna A. Prsence dune leuco-agglutinine chains: Direct analysis by DNA-DNA hybridization.
dans le srum dun cas dagranulocytose chronique. Nature 1982;300:37274.
Comptes Rendues des Societe de Biologie 1952;146: 15. Owerbach D, Lernmark A, Rask L, et al. Detection
153941. of HLA-D/DRrelated DNA polymorphism in
2. Payne R. Fetomaternal leukocyte incompati- HLA-D homozygous typing cells. Proceedings
bility. Journal of Clinical Investigation 1958;37: of the National Academy of Sciences 1983;80:
175663. 375861.
3. Bain B, Vaz MR, Lowenstein L. The development 16. Marsh S, Bodmer JG, Albert ED, et al. Nomencla-
of large immature mononuclear cells in mixed lym- ture for factors of the HLA system, 2000. Tissue
phocyte cultures. Blood 1964;23:10816. Antigens 2001;57:26383.
4. Bach F, Hirschhorn K. Lymphocyte interaction: A 17. Hwang S, Cha CH, Kwon OJ, et al. Novel HLA-
potential histocompatibility test in vitro. Science Cw*06 allele, Cw*0612, identied by sequence-
1964;142:81314. based typing. Tissue Antigens 2005;66:33031.
5. Jones E, Goodfellow PN, Bodmer JG, et al. Serolo- 18. Longhi E, Frison S, Colombini I, et al. HLA-
gical identication of HLA-linked human Ia-type A*2626, a new allele identied through external
antigens. Nature 1975;256:65052. prociency-testing exercise. Tissue Antigens 2005;
6. Park M, Terasaki PI, Bernoco D, et al. Evidence 66:32526.
for a second B-cell locus separate from the DR 19. Marsh S, Albert ED, Bodmer WF, et al. Nomencla-
locus. Transplantation Proceedings 1978;10: ture for factors of the HLA system, 2004. Human
82328. Immunology 2005;66:571636.
7. Tosi R, Tanigaki N, Centis D, et al. Immunological 20. Schreuder G, Hurley CK, Marsh SG, et al. The
dissection of human Ia molecules. Journal of HLA dictionary 1999: A summary of HLA-A, -B,
Experimental Medicine 1978;148:15921611. -C, -DRB1/3/4/5, -DQB1 alleles and their associa-

tion with serologically dened HLA-A, -B, -C, allograft rejection. Journal of Proteome Research
-DR, and -DQ antigens. Human Immunology 1999; 2004;3:28288.
60:115781. 31. Bidwell J. DNA-RFLP analysis and genotyping
21. Schreuder G, Hurley CK, Marsh SG, et al. The of HLA-DR and DQ antigens. Immunology Today
HLA Dictionary 2001: A summary of HLA-A, -B, 1988;9:1823.
-C, -DRB1/3/4/5, -DQB1 alleles and their associa- 32. Bidwell J, Bidwell EA, Savage DA, et al. A DNA-
tion with serologically dened HLA-A, -B, -C, -DR RFLP typing system that positively identies sero-
and -DQ antigens. Tissue Antigens 2001;58:10940. logically well-dened and ill-dened HLA-DR and
22. Schreuder G, Hurley CK, Marsh SG, et al. The DQ alleles, including DRw10. Transplantation
HLA Dictionary 2004: A summary of HLA-A, -B, 1988;45:64046.
-C, -DRB1/3/4/5 and -DQB1 alleles and their asso- 33. Mytilineos J, Scherer S, Opelz G. Comparison of
ciation with serologically dened HLA-A, -B, -C, RFLP-DR beta and serological HLA-DR typing in
-DR and -DQ antigens. International Journal of 1500 individuals. Transplantation 1990;50:87073.
Immunogenetics 2005;32:1969. 34. Opelz G, Mytilineos J, Scherer S, et al. Analysis of
23. Schreuder G, Hurley CK, Marsh SG, et al. HLA HLA-DR matching in DNA-typed cadaver kidney
dictionary 2004: Aummary of HLA-A, -B, -C, transplants. Transplantation 1993;55:78285.
-DRB1/3/4/5, -DQB1 alleles and their association 35. Flomenberg N, Baxter-Lowe LA, Confer D, et al.
with serologically dened HLA-A, -B, -C, -DR, Impact of HLA class I and class II high-resolution
and -DQ antigens. Human Immunology 2005;66: matching on outcomes of unrelated donor bone
170210. marrow transplantation: HLA-C mismatching is
24. Mittal KK, Mickey MR, Singal DP, et al. Serotyp- associated with a strong adverse effect on transplan-
ing for homotransplantation: Renement of tation outcome. Blood 2004;104:1923.
microdroplet lymphocyte cytotoxicity test. Trans- 36. Olerup O, Zetterquist H, Ohlson L, et al. Genomic
plantation 1968;6:91327. HLA-DR and -DQ typing by Taq I RFLP analysis:
25. Laundy GJ, Bradley BA. The predictive value of An alternative to serologic tissue typing.
epitope analysis in highly sensitized patients await- Transplantation Proceedings 1990;22:144.
ing renal transplantation. Transplantation 1995;59: 37. Rose N, Hamilton RG, Barbara D. Manual of
120713. Clinical Laboratory Immunology, 6th ed.
26. Class F, Van Leeuwen A, Van Rood JJ. Hyperim- Washington, DC: ASM Press, 2002.
munized patients do not need to wait for an HLA- 38. Cao K, Chopek M, Fernandez-Vina MA. High and
identical donor. Tissue Antigens 1999;34:2329. intermediate resolution DNA typing systems for
27. Westwood S, Sutton JG, Werrett DJ. Analysis of the class I HLA-A, B, C genes by hybridization with
common genetic variants of the human Gc system sequence-specic oligonucleotide probes (SSOP).
in plasma and bloodstains by isoelectric focusing in Reviews in Immunogenetics 1999;1:177208.
immobilized pH gradients. Journal - Forensic 39. Bein G, Glaser R, Kirchner H. Rapid HLA-DRB1
Science Society (London) 1984;24:51928. genotyping by nested PCR amplication. Tissue
28. Baldwin G, Mickelson EM, Hansen JA, et al. Elec- Antigens 1992;39:6873.
trophoretic variation between class II molecules 40. Krausa P, Brywka M, Savage D, et al. Genetic poly-
expressed on HLA-DRw8 homozygous typing morphism within HLA-A*02: Signicant allelic
cells reveals multiple distinct haplotypes. variation revealed in different populations. Tissue
Immunogenetics 1985;21:4960. Antigens 1995;45:22331.
29. Kido A, Oya M, Komatsu N, et al. A stability study 41. Bunce M, ONeill CM, Barnardo MC, et al.
on Gc subtyping in bloodstains: Comparison by two Phototyping: Comprehensive DNA typing for HLA-
different techniques. Forensic Science International A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by
1984;26:3943. PCR with 144 primer mixes utilizing sequence-
30. Borozdenkova S, Westbrook JA, Patel V, et al. Use specic primers (PCR-SSP). Tissue Antigens 1995;
of proteomics to discover novel markers of cardiac 46:35567.

42. Clay T, Bidwell JL, Howard MR, et al. PCR nger- 53. Opelz G. Impact of HLA compatibility on survival
printing for selection of HLA-matched unrelated of kidney transplants from unrelated live donors.
marrow donors: Collaborating centres in the Transplantation 1997;64:147375.
IMUST study. Lancet 1991;337:104952. 54. Hosenpud J, Edwards EB, Lin HM, et al. Inuence
43. Crowe D. HLA typing using reference strand con- of HLA matching on thoracic transplant outcomes:
formation analysis (RSCA). ASHI Quarterly 2002;: An analysis from the UNOS/ISHLT thoracic reg-
14546. istry. Circulation 1996;94:17074.
44. Carrington M, Miller T, White M, et al. Typing of 55. Opelz G, Wujciak T. The inuence of HLA compat-
HLA-DQA1 and DQB1 using DNA single-strand ibility on graft survival after heart transplantation:
conformation polymorphism. Human Immunology The Collaborative Transplant Study. New England
1992;33:20812. Journal of Medicine 1994;330:81619.
45. Hayashi T, Seyama T, Ito T, et al. A simple and 56. Rocha V, Cornish J, Sievers EL, et al. Comparison
rapid method for HLA-DQA1 genotyping by of outcomes of unrelated bone marrow and umbili-
polymerase chain reactionsingle strand con- cal cord blood transplants in children with acute
formation polymorphism and restriction enzyme leukemia. Blood 2001;97:296271.
cleavage analysis. Electrophoresis 1992;13: 57. Erlich H, Opelz G, Hansen J. HLA DNA typing
87779. and transplantation. Immunity 2001;14:34756.
46. Lo Y, Patel P, Mehal WZ, et al. Analysis of complex 58. Miklos D, Kim HT, Miller KH, et al. Antibody
genetic systems by ARMS-SSCP: Application to responses to H-Y minor histocompatibility antigens
HLA genotyping. Nucleic Acids Research 1992;20: correlate with chronic graft-versus-host disease and
10051009. disease remission. Blood 2005;105:297378.
47. Bang-Ce Y, Xiaohe C, Ye F, et al. Simultaneous 59. Voogt P, Fibbe WE, Marijt WA, et al. Rejection of
genotyping of DRB1/3/4/5 loci by oligonucleotide bone-marrow graft by recipient-derived cytotoxic T
microarray. Journal of Molecular Diagnostics lymphocytes against minor histocompatibility anti-
2005;7:59299. gens. Lancet 1990;335:13134.
48. Entz P, Toliat MR, Hampe J, et al. New strategies 60. Goulmy E, Termijtelen A, Bradley BA, et al.
for efficient typing of HLA class-II loci DQB1 and Alloimmunity to human H-Y. Lancet 1976;2:1206.
DRB1 by using Pyrosequencing. Tissue Antigens 61. OKunewick J, Kociban DL, Machen LL, et al.
2005;65:6780. Effect of donor and recipient gender disparities on
49. Bunce M, Young NT, Welsh KI. Molecular HLA fatal graft-vs.-host disease in a mouse model for
typing: The brave new world. Transplantation major histocompatibility complexmatched unre-
1997;64:150513. lated donor bone marrow transplantation.
50. Arguello R, Avakian H, Goldman JM, et al. A novel Experimental Hematology 1993;21:157076.
method for simultaneous high resolution identica- 62. Wilke M, Pool J, den Haan JM, et al. Genomic
tion of HLA-A, HLA-B, and HLA-Cw alleles. identication of the minor histocompatibility anti-
Proceedings of the National Academy of Sciences gen HA-1 locus by allele-specic PCR. Tissue
1996;93:1096165. Antigens 1998;52:31217.
51. Bozon MV, Delgado JC, Selvakumar A, et al. Error 63. Bahram S, Inoko H, Shiina T, et al. MIC and other
rate for HLA-B antigen assignment by serology: NKG2D ligands: From none to too many. Current
Implications for prociency testing and utilization Opinion in Immunology 2005;17:505509.
of DNA-based typing methods. Tissue Antigens 64. Cudkowicz G, Bennett M. Peculiar immunobiology
1997;50:38794. of bone marrow allografts. I. Graft rejection by irra-
52. Opelz G, Mytilineos J, Scherer S, et al. Inu- diated responder mice. Journal of Experimental
ence of HLA matching and DNA typing on Medicine 1971;134:83102.
kidney and heart transplant survival in black 65. Tran T, Mytilineos J, Scherer S, et al. Analysis of
recipients. Transplantation Proceedings 1997; KIR ligand incompatibility in human renal trans-
29:333335. plantation. Transplantation 2005;80:112123.

66. Witt C, Dewing C, Sayer DC, et al. Population fre- 73. Rosenthal A, Shevach E. Function of macrophages
quencies and putative haplotypes of the killer cell in antigen recognition by guinea pig T lymphocytes.
immunoglobulin-like receptor sequences and evi- I. Requirement for histocompatible macrophages
dence for recombination. Transplantation 1999; and lymphocytes. Journal of Experimental Medicine
68:178489. 1973;138:1194212.
67. Dupont B, Hsu KC. Inhibitory killer Ig-like recep- 74. Kindred B, Shreffler DC. H-2 dependence of co-
tor genes and human leukocyte antigen class I operation between T and B cells in vivo. Journal
ligands in haematopoietic stem cell transplan- of Immunology 1972;109:94043.
tation. Current Opinion in Immunology 2004; 75. Ndungu T, Gaseitsiwe S, Sepako E, et al. Major
16:63443. histocompatibility complex class II (HLA-DRB and
68. Gao X, Bashirova A, Iversen AK, et al. AIDS -DQB) allele frequencies in Botswana: Association
restriction HLA allotypes target distinct intervals with human immunodeciency virus type 1 infec-
of HIV-1 pathogenesis. Nature Medicine 2005;11: tion. Clinical and Diagnostic Laboratory Immuno-
129092. logy 2005;12:102028.
69. Steck A, Bugawan TL, Valdes AM, et al. Associa- 76. Sahmoud T, Laurian Y, Gazengel C, et al. Progres-
tion of non-HLA genes with type 1 diabetes sion to AIDS in French haemophiliacs: Association
autoimmunity. Diabetes 2005;54:248286. with HLA-B35. AIDS 1993;7:497500.
70. Bover K. Homoisotransplantation van epidermis 77. Montag S, Frank M, Ulmer H, et al. Electronic
bei einigen Zwillingen. Beitrage zur klinischen nose detects major histocompatibility complex
Chirurgica 1927;141:44247. dependent prerenal and postrenal odor components.
71. Gorer P. The genetic and antigenic basis for tumor Proceedings of the National Academy of Sciences
transplantation. Journal of Pathology and Bacterio- 2001;98:924954.
logy 1937;44:69197. 78. Santos P, Schinemann JA, Gabardo J, et al. New
72. Snell G. Methods for the study of histocom- evidence that the MHC inuences odor perception
patibility genes. Journal of Genetics 1948;49: in humans: A study with 58 Southern Brazilian stu-
87108. dents. Hormones and Behavior 2005;47:38488.
Quality Assurance and

Quality Control in the
Molecular Laboratory
OUTLINE OBJECTIVES
SPECIMEN HANDLING Describe proper specimen accession for molecular testing.
Collection Tubes for Molecular
Testing Describe the optimal conditions for holding and storage
Precautions of specimens and nucleic acid.
Holding and Storage Requirements Explain the basic components of molecular test perfor-
TEST PERFORMANCE mance, including quality assurance and controls.
Controls Discuss instrument maintenance, repair, and calibration,
Quality Assurance
particularly for instruments used in molecular analysis.
INSTRUMENT MAINTENANCE
Calibrations Describe recommendations for preparation and use of
reagents in the molecular laboratory.
REAGENTS
Chemical Safety Explain documentation and reporting of results, including
Prociency Testing gene sequencing results.
DOCUMENTATION OF TEST RESULTS
Gene Sequencing Results
Reporting Results
403

Congress passed the Clinical Laboratory Improvement pedigree may also be supplied with the test specimen.
Amendments (CLIA) in 1988 to establish quality testing Forensic specimens may require a documented chain of
standards to ensure consistent patient test results. CLIA custody. Bar-coding of this information expedites speci-
species quality standards for prociency testing, patient men accession and decreases the chance for error.
test management, quality control, personnel qualica- The laboratory should have written procedures for
tions, and quality assurance for laboratories performing documentation of specimen accession. Accession books
moderate- and/or high-complexity tests, including molec- or electronic records are used to record the date of
ular testing. This chapter offers a brief overview of labo- receipt, laboratory identier, and pertinent patient infor-
ratory standards applied to molecular diagnostic tests. mation associated with the accession. If a specimen is
unacceptable, the disposal or retention of the specimen is
recorded in the patient report or laboratory quality assur-
Specimen Handling ance records. If not processed immediately, specimens
Molecular tests, like any clinical laboratory tests, require are maintained in secure areas with limited access under
optimal specimen handling and processing for accurate the appropriate conditions for the analyte being tested
and consistent test results. The success of a test proce- (Fig. 16-1).
dure is affected by the age, type, and condition of speci- Molecular amplication methods have enabled labora-
mens. Therefore, specimen collection, transport, and tory professionals to perform nucleic acid-based testing
handling in the laboratory require careful attention. on specimens with minimal cellular content, such as buc-
Preanalytical variables, both controllable and uncon- cal cell suspensions and cerebrospinal uids. These sam-
trollable, must be taken into account for proper interpre- ples are centrifuged to collect the cells before DNA or
tation of test results. Preanalytical error is the RNA is extracted. For routine specimens tested by ampli-
consequence of erroneous or misleading results caused cation methods, the entire specimen is often not used. In
by events that occur prior to sample analysis. To mini- this case, or if more than one test is to be performed on
mize preanalytical error and maximize control of prean- the same specimen, care must be taken to avoid cross-
alytical variables, the Clinical and Laboratory Standards contamination of specimens. This can most likely occur
Institute (CLSI, formerly known as the National
Committee for Clinical Laboratory Standards) provides
recommendations for collection of specimens under stan-
dardized conditions.13
Each laboratory will have requirements for specimen
handling, but general policies apply to all specimen col-
lection. The condition of the specimen and, if necessary,
the chain of custody is reviewed on receipt in the labora-
tory. If a specimen shows evidence of tampering or is
otherwise compromised, the technologist must notify the
supervisor. No specimen is accepted without proper
labeling and identication on the specimen tube or con-
tainer (placed by the person who collected the specimen),
nor if the labeling on the specimen does not match that on
the accompanying requisition. In addition to relevant
patient identication, the test requisition includes the
type of specimen material (e.g., blood or bone marrow),
ordered test, date and time of collection, and a contact
(pager or telephone number) of the ordering physician.
When required (for molecular genetics or parentage test- Figure 16-1 Biohazard stickers are required for cabinets,
ing), patient consent forms, ethnicity, photo identication refrigerators, or freezers that contain reagents or patient
of the individuals tested, and transfusion history or a specimens.

Quality Assurance and Quality Control in the Molecular Laboratory Chapter 16 405
from pipetting carryover. Moreover, an aliquot removed PCR) amplication, however, are routinely performed
from a specimen is never returned to the original tube or on paraffin-embedded tissue samples. Methods such as
vessel. Southern or Northern blot, requiring large fragments
Hemoglobin inhibits enzyme activity. Specimens of DNA, are less likely to work consistently with xed
received in the laboratory should therefore be inspected tissues.
for visual signs of hemolysis. Hemoglobin and coagu-
lants are removed effectively in most DNA and RNA iso-
Collection Tubes for Molecular Testing
lation procedures; however, if white blood cell lysis has
also occurred, DNA or RNA yield will be reduced. This Phlebotomy collection tubes are available with a number
could result in false-negative results in qualitative testing of different additives designed for various types of clini-
or inaccurate measurements in quantitative analyses. cal tests. A selection of collection tubes commonly used
Buffers such as BloodDirect (Novagen) and Extract-N- for molecular biology studies is listed in Table 16.1. Some
Amp (Sigma) or resins such as Chelex have been anticoagulants used in blood and bone marrow collection
designed to sequester anticoagulants or hemoglobin for may adversely affect analytical results. Heparin has been
more rapid nucleic acid isolation without the inhibitory shown to inhibit enzymes used in molecular analysis,
effects of these substances. such as reverse transcriptases and DNA polymerases in
Solid tissues are best analyzed from fresh or frozen vitro.4 The inuence of this inhibition on molecular analy-
samples (Fig. 16-2), especially for Southern blot or long- sis is commonly accepted; however, heparinized samples
range polymerase chain reaction (PCR) methods that have been processed successfully in many laboratories.
require relatively high-quality (long, intact) DNA. The various experiences with heparin may reect levels of
Surgical specimens designated for molecular studies, if resistance of enzymes from different sources. The assay
not processed immediately, should be snap-frozen in liq- design also has an effect. For instance, the inhibition of
uid nitrogen. This process both preserves nucleic acid and DNA polymerases compromises amplication of larger
preserves gene expression patterns that may change upon PCR products more than short ones. Due to the possible
tissue storage. Snap freezing is routinely performed in the effects of heparin, trisodium EDTA (lavender top) or acid
surgical pathology laboratory as it is a common process citrate dextrose (yellow top) tubes are recommended for
for preserving tissue morphology for microscopic exami- most nucleic acid assays involving enzymatic treatment of
nation. Fixed, paraffin-embedded tissues generally yield the sample nucleic acid (Fig. 16-3).5 High levels of dis-
lower quality DNA and RNA, depending on the type odium EDTA (royal blue capped tubes used for trace ele-
of xative used, the amount of time of exposure of the tis- ment studies) may also inhibit enzyme activity and should
sue to the xative, and how the specimen was handled be avoided. One of the advantages of signal amplication
prior to xation. PCR and reverse transcription PCR (RT- methods such as bDNA technology is their decreased sus-
Figure 16-2 Tissue is received in the laboratory in

fresh (left) or frozen (right) form. Fresh tissue may be
supplied as a specimen on gauze or other substrate or
in saline. The vial shown on the right contains tissue
that was ash-frozen in isopentane. The vial is held
immersed in liquid nitrogen, nitrogen vapors, or in a
70C freezer.

black tiger pattern over the appropriate anticoagulant

Table 16.1 A Selection of Collection Tubes
color designation. Tubes such as the Tempus RNA Blood
Additive Color Nucleic Acid Testing tube (Applied Biosystems) or the PAXgene Blood RNA
None Red Chemistry, serum, viral tube (PreAnalytix) are designed to stabilize RNA. These
antibody studies tubes contain proprietary RNA stabilization agents that
Sodium heparin Green Immunology, virology maintain the integrity of the RNA from collection through
(freeze-dried) studies isolation.68 Separated white blood cells from standard
Sodium heparin Brown Cytogenetic studies, collection tubes can also be lysed in Trizol or TriReagent
molecular studies (Sigma) and the lysate stored at 70C to stabilize RNA
Tripotassium EDTA Lavender Virology, molecular for several days. Stabilization of transcripts has become
(7.5%15% solution) biology studies increasingly important, with more and more methods
Acid citrate dextrose Yellow Molecular biology involving RNA transcript levels for measurement of gene
solution studies expression. For example, quantitative RT-PCR analyses
rely on transcript number to monitor the level of tumor
cells or microorganisms. Serial analysis requires that the
ceptibility to chemical effects of anticoagulants. When a specimens received in the laboratory at different times be
specimen is received in the laboratory, the anticoagulant is handled as consistently as possible. Immediate stabiliza-
not usually noted in the accompanying documentation; tion of the RNA is tantamount to having comparable
the technologist should be aware of the type of collection results.9 As an alternative to standard collection tubes,
tube used, especially if a specimen is received in heparin methods involving impregnated paper matrices have been
or other additive that may affect the test results. proposed for nucleic acid analysis.10,11
In addition to the standard collection tubes, special col-
lection tubes are designed particularly for stabilization of Precautions
nucleic acids for molecular testing. These include the
plasma preparation tubes (Vacutainer PPT, Becton Standard precautions are recommended by the Centers
Dickinson), which contain, in addition to the standard for Disease Control and Prevention for handling poten-
coagulants, a polymer gel that separates granulocytes and tially infectious specimens. All specimens are potentially
some lymphocytes from erythrocytes upon centrifuga- infectious, so they should all be handled with standard
tion. This type of tube is used for HIV and HCV analysis. precautions using proper personal protective equipment
The PPT tube is also used for separation of white cells for (PPE) to prevent disease transmission. Transmission-
genetics and chimerism testing. The tube stoppers have a based precautions including respirators are used with
airborne or contact-transmissible agents. Contact pre-
cautions are designed for direct patient care where there
is the potential for direct exposure to infectious agents on
or from the patient. In general, standard precautions
including gloves and gowns as PPE are used by the
molecular laboratory technologist who has no direct con-
tact with patients. Eye protection or masks are required in
cases where frozen tissue is being processed or where
spraying or splashing of sample may occur.
Gloves are highly recommended not only as part of
standard precautions but also to protect nucleic acids
from nuclease degradation (Fig. 16-4). Gloves are
Figure 16-3 For molecular analysis, blood or bone marrow
specimens collected in EDTA or ACD tubes are preferred.
absolutely required for handling of RNA (Fig. 16-5).
Some methods are performed on serum collected in tubes DNA is less susceptible to degradation from contaminat-
without coagulant. ing DNases; however, repeated handling of samples with-

are treated with RNase or RNA samples are treated with

DNase that no inappropriate enzyme exposure occur.
Holding and Storage Requirements

Methods such as interphase and metaphase uorescent in
situ hybridization (FISH) and karyotyping require intact
cellular structures or culture of cells so that only fresh
specimens are acceptable. Many molecular methods,
however, do not require integrity of tissue of cellular
structure, only that the nucleic acid remains intact. In
either case, circumstances may arise that require holding
of specimens before analysis. DNA and RNA are stable
Figure 16-4 Handling specimens with gloves is recom-
mended to protect the technologist and to protect the when samples are collected and held under the proper
sample nucleic acids from nucleases and other con- conditions.12,13 For example, multiple tests may be per-
taminants. formed on snap-frozen specimens held at 70C.
Although most amplication methods are capable of suc-
cessful analysis of limiting and challenging specimens,
out gloves will adversely affect the integrity of the DNA Southern or Northern blot methods will not work consis-
over time. Standards and controls that are handled repeat- tently on improperly handled specimens or nucleic acids
edly are the most likely to be affected. Originally, having stored under less than optimal conditions. The College of
separate areas for DNA and RNA isolation was recom- American Pathologists (CAP), which provides accredita-
mended. Some laboratories, however, isolate DNA and tion standards that are followed by CAP-accredited lab-
RNA on the same bench space. This requires mainte- oratories to improve the quality of their testing, has
nance of RNase-free conditions (see Chapter 4) for all published recommendations for sample and isolated
nucleic acid isolation. In a common isolation arrange- nucleic acid storage (Table 16.2).
ment such as this, care must be taken that if DNA samples For long-term storage, isolated nucleic acid is pre-
ferred. Conditions for storage of isolated nucleic acid
have been recommended (Table 16.3). Cryotubes and
specially designed labels are available for long-term
nucleic acid storage at ultralow temperatures (Fig. 16-6).
The general rules for holding specimens for processing
differ depending on the analyte and its stability in the
cell. Written procedures indicate the proper handling of
specimens for optimal performance of that procedure.
Blood and bone marrow specimens sent to outside labo-
ratories for molecular analysis can be shipped overnight
at room temperature or with ice packs. Tissue is best
shipped frozen on dry ice.
Isolated DNA of sufficient purity can be stored at room
temperature for several months or at least 1 year in the
refrigerator. Puried DNA can be stored at freezer tem-
peratures (20C to 70C) in tightly sealed tubes for
up to 10 years or longer. Freezer temperatures are pre-
ferred for long-term storage; however, a clean DNA
Figure 16-5 Gloves are required for working with RNA. preparation in frequent use is better stored in the refrig-

Table 16.2 Specimen Storage Requirements for Nucleic Acid Extraction33

Nucleic Acid Sample Temperature Time
DNA Whole blood, buffy coat, 2225C 24 hours
bone marrow, uids 28C 72 hours*
20C At least 1 year*
70C More than 1 year*
Tissue 2225C Not recommended
28C Up to 24 hours
20C At least 2 weeks
70C At least 2 years
Microorganisms 2225C 24 hours
in culture 28C 72 hours
20C 24 weeks
70C More than 1 year
Cell lysates in GITC 2225C 12 weeks
RNA Whole blood, buffy coat, 2225C Not recommended
bone marrow, uids 28C 24 hours*
20C 24 weeks*
70C More than 1 year*
Fluids collected in specialty 2225C 5 days
RNA protection tubes 28C 7 days
20C 24 weeks
70C At least 7 months
Tissue 2225C Not recommended
28C Not recommended
20C Not recommended
70C At least 2 years
140C (nitrogen vapor) At least 2 years
Cell lysates in GITC 2225C 12 weeks
Cell lysates in RNA storage 2225C 1 week
solution (Ambion) 28C 1 month
Microorganisms in culture 2225C 24 hours
28C 72 hours
20C 24 weeks
*Separation of white blood cells is recommended to avoid hemoglobin released upon hemolysis of red blood
cells.
Tissue types differ in stability and nuclease content.
Nucleic acid from cultured organisms is best isolated immediately on harvesting fresh cultures.
RNA status depends on the type of cell or tissue and the gene under study.34
Depending on gene expression, adequate RNA may be isolated within a few hours. Storage of cell lysates in a stabi-
lizing buffer is best for maintaining RNA.
GITC guanidine isothiocyanate

Table 16.3 Nucleic Acid Storage Requirements33

Nucleic Acid Matrix Temperature Time
DNA TE* buffer or DNase-free water 2225C Up to 4 months
Freeze-dried or dried on collection paper35 2225C More than 15 years
TE buffer or DNase-free water 28C 13 years
TE buffer or DNase-free water 20C At least 7 years
TE buffer or DNase-free water 70C More than 7 years
RNA TE buffer or RNase-free (DEPC-treated) water 2225C Not recommended
TE buffer or RNase-free (DEPC-treated) water 28C Not recommended
TE buffer or RNase-free (DEPC-treated) water 20C Up to 1 month
RNA storage solution (Ambion) 20C More than 1 month
Ethanol 20C More than 6 months
TE buffer or RNase-free (DEPC-treated) water 70C Up to 30 days
Ethanol 70C More than 6 months
*10 mM Tris, 1 mM EDTA, pH 8.0
1 year for Southern blot
DEPC diethyl pyrocarbonate
1 mM sodium citrate, pH 6.4
erator so as to avoid DNA damage caused by multiple rocarbonate-treated water is stable for at least 1 month.
cycles of freezing/thawing. Shearing of DNA by freeze/ As with DNA, the long-term survival of the RNA depends
thawing cycles can also occur in a frost-free freezer. As on the quality of the initial isolation and handling of the
previously stated, PCR and methods that do not require specimen.
large intact fragments of DNA are more forgiving with
regard to the condition of the DNA.
Storage of isolated RNA at room temperature or refrig-
Test Performance
erator temperature is not recommended in the absence of Many tests in the molecular laboratory are individually
stabilization. RNA suspended in ethanol can be stored at designed or are adaptations based on published methods.
20C for several months. Long-term storage is best in Development of new tests in the clinical laboratory re-
ethanol at 70C, although RNA suspended in diethylpy- quires validation of the performance of the method and
Figure 16-6 Cryotubes with tight-tting lids are

recommended for long-term freezer storage of DNA
and RNA.

Table 16.4 Measurements of Test Performance

Criteria Denition Example
Analytic sensitivity Lower limit of detection of the The t(14;18) translocation test can detect 1 translocated cell in
analyte 10,000 normal cells, an analytic sensitivity of 0.01%.
Clinical sensitivity Ability of test result to predict a 95 of 100 patients with a gene mutation have a disease state, a clin-
clinical condition ical sensitivity of 95%.
Analytic specicity Ability to detect only the analyte The Invader assay for factor V Leiden successfully detected muta-
and not nonspecic targets tions in 18 positive specimens while yielding negative results for
30 normal specimens (no false positives).
Clinical specicity Disease-associated results only 1 of 100 normal specimens displayed a gene mutation (1 false posi-
in patients who actually have tive), a clinical specicity of 99%.
the disease conditions
Precision Reproducibility of test results A quantitative method yields 99 results in agreement out of 100
runs, a precision of 99%.
Analyte measurement The range within which a speci- A qPCR HSV assay yields reproducible linear results from 10 to
range men may be measured 107 copies of HSV per 20 L of CSF. Specimens within this
directly (without dilution or range are measured directly.
concentration)
Analytic accuracy Production of correct results 99 of 100 specimens with mutations in the HCM gene are detected
by sequencing with no mutations detected in normal specimens.
reagents in accurately detecting or measuring the ana- established procedures that may have been performed on
lyte.14 Test performance is assessed by several criteria these specimens or with the clinical diagnosis.1517 A stan-
(Table 16.4). These criteria are expressed as formulas. dard form may be designed for preparation of reaction
The clinical sensitivity of an assay equals: mixes by the test parameters determined in the validation
TP process (Fig. 16-7).
100 Predeveloped and FDA-approved molecular methods
TPFN
are increasingly available. When these methods are
The clinical specicity of an assay equals: incorporated, the test performance is veried by using the
TN purchased reagent sets to test validation specimens. This
100
TNFP verication establishes that the results of the commercial
The accuracy of an assay equals: test performed in the individual laboratory are as pre-
dicted by the developer. If the commercial test is modi-
TN TP
100 ed, validation is required to show equal or superior
TNTPFN FP performance of the modied procedure.18
TNtrue negative, TPtrue positive, FNfalse nega- Once a procedure has been established, the method is
tive, FPfalse positive. documented in the laboratory according to CLSI guide-
These criteria are documented as part of the test vali- lines.19 The procedure description should include detailed
dation process. information; for instance, primer and probe sequences,
Test validation is performed on specimens of the types their purication conditions, and labeling. A copy of the
that will be encountered in the routine use of the test, such standard form used to set up reaction mixes is included in
as frozen tissue, paraffin-embedded tissue, body uids, the procedure description. A clear description of formulas
and cultured cells. The number of specimens tested varies and reporting units are required for quantitative results.
with the procedure and the availability of test material. Interpretation of qualitative data, acceptable ranges such
Archived specimens are often used for this purpose. The as band patterns, product sizes, melting temperatures,
results from the new test are compared with those of and reasons for rejecting results are required informa-

PCR WORKSHEET (Ig heavy chain gene rearrangement)
Run #_______ Tech____________ Date_______
Tube Specimen/ l l
Patient name g/l
# treatment DNA* H2O*
1
2
3
4
5
6
7 Positive control
8 Sensitivity control
9 Negative control
10 Reagent blank
* Dilute sample to 1g/l in a volume of 15l.

PCR reaction mixture for test primers
(#rxns)
DNAse-free water 28.8l x____ = ____l
8 M forward primer 2.5l x____ = ____l
8 M reverse primer 2.5l x____ = ____l
1 mM dNTP 5.0l x____ = ____l
10x PCR buffer 5.0l x____ = ____l
750 M (NH4)2SO4 1.0l x____ = ____l
Taq polymerase 0.2l x____ = ____l
Place 45l of mixture into PCR tubes. Add 5l (5 g) template to each PCR tube.
PCR mixture for globin control primers
DNAse water 30.8l x____ = ____l
2 M globin forward primer 1.25l x____ = ____l
Figure 16-7 Example of a worksheet 2 M globin reverse primer 1.25l x____ = ____l
used to prepare PCR reaction mixes. A sin-
gle reaction mix is made for multiple sam- 1 mM dNTPs 5.0l x____ = ____l
ples by multiplying the number of reactions 5.0l x____ = ____l
10x PCR buffer
by the volume of each reaction compo-
nent and adding that amount to the master 50mM MgCl2 1.5l x____ = ____l
mix. Information regarding reagent lot num-
bers, PCR programs, and specimen dilutions Taq polymerase 0.2l x____ = ____l
may be included on the worksheet or docu-
mented separately. Place 45l of mixture into the PCR tubes. Add 5l template to each PCR tube.

tion. Methods used to score FISH or array results relative be loaded into the software. Alternatively, results can be
to internal control loci are also part of the written proce- calculated manually by linear regression of the test
dure. It is useful to incorporate pictures of gel patterns or results, using standard curve data in spreadsheet software.
instrument output data showing positive, negative, het- In methods requiring detection of a target-specic
erozygous, or other reportable results. product, or relative amounts of target, internal controls
In the course of validation, the accuracy of a test will are run in the same reaction mix as the test specimen. For
determine its correlation with disease, as performed in example, housekeeping genes are used as internal
the testing laboratory. The indications for ordering the controls in methods quantifying infectious agents or
test are determined, based on the clinical utility as deter- detecting tumor cells by tumor-specic translocations.
mined by the validation process, and documented in the Centromere-specic probes serve as internal controls in
procedure manual. For forensic testing, all aspects of the FISH analyses as do housekeeping gene probes on
test from validation to test reporting should adhere to microarrays. The presence of an internal control supplies
guidelines established by the DNA Advisory Board a base for normalization of results. In PCR the internal
Standards and the Scientic Working Group on DNA control distinguishes false-negative results from failed
Analysis Methods.20 amplications (see Chapter 7). Internal controls that are
The procedure manual or standard operating procedure amplied in the same tube with sample templates are
is maintained in the laboratory and reviewed at least designed to not interfere or inhibit target amplication,
annually. If a test is discontinued, the written procedure, which could yield a false-negative result. Failed internal
noted with the dates of initial use and retirement, is kept controls are documented and call for repeat of the assay.
for at least 2 years. Some laboratory professionals main- The controls and standard curve should cover the crit-
tain retired procedures for longer periods. ical detection levels or results of the method. Control
results are continually monitored to spot trends or spikes
outside of tolerance limits. Coefficients of variance or
Controls
standard deviations of quantitative control levels should
Controls are samples of known type or amount that are also be calculated at regular intervals. Laboratory profes-
treated like and run with patient specimens.21 Interpreta- sionals may establish criteria for control tolerance limits
tion of test results always includes inspection of controls and document actions to be taken in the event of an unac-
and standards to verify acceptable test performance. With ceptable control result.
qualitative tests, a positive, negative and, in some cases, Controls are best prepared in larger quantities, aliquot-
a sensitivity control are required. The sensitivity control ted, and stored in conditions where they are most stable.
denes the lower limit of detection for more meaningful Just as with new lots of other reagents, new aliquots
interpretation of negative results. These controls are are tested with old aliquots to verify consistent control
sometimes called amplication controls when used with results.
PCR techniques. Specically, however, an amplication
control is a target that should always amplify. The ampli-
Quality Assurance
cation control is used to distinguish true negative ampli-
cation results from false negatives resulting from Periodic review and documentation of test results are
amplication failure. In quantitative methods, high posi- required for all clinical testing, including molecular tests.
tive, low positive, and negative controls are included with Review might be, for example, in the form of rates of pos-
each run. The high and low levels should be similar to itive and negative results compared with expected rates
critical points in the assay, such as the lowest detectable from independent sources, such as published results, over
level of analyte. time. This type of monitoring reveals trends or shifts in
Real-time PCR methods that automatically determine rates of positive or negative results. Critical values that
analyte levels require measurement of a standard curve require physician notication are established by valida-
or dilution series of analyte levels encompassing the lev- tion and conrmed by monitoring.
els expected from the patient specimens. On instruments, As with other types of quantitative testing, molecular
the standard curve must be run simultaneously with the quantitative methods should have a dened dynamic
specimens. In others, previously determined curves may range, sensitivity level, and accuracy.22,23 For instance, a

to provide support from trained service technicians.

Strain A Strain B Laboratory professionals maintain a schedule and instruc-
tions for all routine maintenance, such as checking tem-
dF/dt
perature settings, timers, and background levels. Parts are
replaced as required or specied by the instrument man-
ufacturer. Maintenance schedules should reect the
amount of use of the instrument. Most routine mainte-
nance and minor troubleshooting, such as replacing bulbs
40 80 or batteries, may be performed by the technologist with
Temperature (C)
the aid of clear instructions from the manufacturer or as
Figure 16-8 Tm ranges dened for two strains (A and B)
of a theoretical microorganism are nonoverlapping. The prepared by laboratory management. These instructions
melt curve shown would indicate that the test specimen must be readily available to the technologist in the event
contains strain A. of instrument malfunction. Technologists should be
aware of the limits of user-recommended repairs and
when service calls are indicated (Fig. 16-9). Laboratory
test that determines viral types by melt curves must professionals must document all maintenance, service
include a dened narrow temperature range for the Tm of calls, calibrations, and parts replacements.
each viral type (Fig. 16-8). These values are established Refrigerators and freezers used to store patient material
during the test validation and should be reviewed period- and reagents are monitored at least daily (Fig. 16-10).
ically. Test performance is monitored by inclusion of Maximum/minimum thermometers register the highest
high, low, sensitivity, and negative standards in each run. and lowest temperature reached between monitoring
Band patterns, melt curves, and peak characteristics points. During a busy shift, refrigerators and freezers may
should be dened with regard to how the results of the be opened frequently, causing the temperature to increase
test are to be interpreted. temporarily. This must be taken into account while mon-
Assay levels that distinguish positive from negative itoring. Out-of-range temperatures (e.g., more than 2C
results (cut-off values) must be well dened and veried of the set temperature) are recorded. Conrmatory tem-
at regular intervals. In assays such as single-strand con- perature checks at different times during the shift are
formation polymorphism (see Chapter 9), in which con- required before further action is taken. Heat blocks, incu-
trol patterns are not identical from run to run, normal bators, ovens, and water baths are also monitored for tem-
controls for each scanned region are included in every perature stability and accuracy. U.S. National Institute of
run. Quantitative results should be within the linear range
of the assay. The linear range is established by measuring
dilutions or known concentrations of standard and estab-
lishing a direct correlation (standard curve) between test
output and standard input. The technologist may observe
that raw data are consistent with the nal interpretation of
the results. For example, if a viral load is interpreted as
negative, the raw data should be below the cut-off value
established for the test. Calculations and comparisons
with standards used to verify test results should be de-
scribed in the laboratory procedure manual.
Instrument Maintenance
Instruments used in the molecular laboratory must be Figure 16-9 Routine maintenance, such as capillary
replacement and instrument cleaning, is performed by the
monitored and maintained for consistent performance and laboratory technologist. Dangerous or complex maintenance,
accurate test results. Manufacturers supply recommenda- such as repair or replacement of a laser source, is performed
tions for routine maintenance. Service contracts are used by the service representatives.

Figure 16-11 Block thermal cyclers may be monitored

using a thermometer with a exible probe. More thorough
monitoring is performed with temperature probes and soft-
ware that follows the ramping temperatures as well as the
holding temperatures.
checked each time. In some laboratories, test reactions

Figure 16-10 Certied chamber thermometers are used for
monitoring temperatures in incubators, refrigerators, ovens, are run in different wells to demonstrate successful ampli-
and freezers. The thermometers are supplied in plastic resin cation at each position on the block. More thorough
bottles containing liquid glycol. and accurate temperature measurements are achieved
with computer systems (e.g., Driftcon), with xed or ex-
ible probes designed to measure temperature in all wells
Standards and Technology (NIST)certied standard throughout a PCR program, including ramping of the
thermometers are used for this type of monitoring. temperature up and down, overshooting set temperatures,
Thermometers veried by a NIST thermometer are also and temperature drift during the hold phase of each
acceptable for this purpose. Specialized dry bath ther- step. Nonblock thermal cyclers, such as air-heated or
mometers, which are encased in a 1.5-mL microfuge tube modular instruments, are tested with probes modied to
of mineral oil, are best for monitoring heat blocks. All t as the capillaries or tubes used in these instruments.
storage and incubation equipment is kept clean and free Real-time thermal cyclers require additional maintenance
of contaminated specimens and expired reagents. If out- of the detection system. Manufacturers supply materials
of-date reagents are used for research or other purposes, for spectral calibrations. Background measurements are
they should be well marked and/or maintained in a sepa- made using water or buffer samples. Each laboratory
rate area from the clinical test reagents. will establish the type and frequency of scheduled main-
Standard thermal cyclers, although they have no auto- tenance.
mated moving parts, decline in temperature control over Centrifuges and microcentrifuges are monitored at
time. This is especially true of block cyclers where hot least annually using a tachometer. In some institutions,
and cold spots develop within the sample block. For this technologists perform this calibration. Alternatively,
reason, thermal cyclers are checked periodically for an institutional engineering department may do it. The
proper temperature control. Thermometers with exible actual speed of rotation is determined and recorded along
probes (type K thermocouples) are convenient for check- with the set speed or setting number on the centrifuge.
ing representative wells in a block thermal cycler (Fig. This information is then posted on the instrument
16-11). Approaches differ whether each well should be (Fig. 16-12).
checked with each routine measurement or whether rep- Automatic pipettors used for dispensing specic quan-
resentative wells should be checked, with different wells tities of reagents should be checked for accuracy before

Figure 16-12 Centrifuge speeds are checked at least

annually, and the results of actual and set speeds are posted
on the instrument.
use and at 6-month intervals or as required according to

use. Gravimetric methods, where measured samples of
water are pipetted to a balance, have been used for many
years.24 The weights are converted to volumes. The mean
of several measurements from the same pipet reveals
its accuracy. The standard deviation or coefficient of Figure 16-13 Gel electrophoresis equipment must be
maintained free of precipitate and properly handled to
variance is calculated to determine the degree of repro- avoid shock exposure.
ducibility (imprecision) of the pipet. Commercial pipet
monitoring systems along with software are also avail-
able.25 Alternatively, some laboratory professionals pre- equipment is maintained with fresh xing and developing
fer to hire service providers who clean and check pipets solutions free of debris or sediment. Digital cameras are
on a per-pipet charge. rapidly replacing Polaroid cameras for documenting gel
Electrophoresis power supplies are tested at least annu- data. Cameras should be rmly mounted and adjusted for
ally to ensure delivery of accurate voltage and current. optimal recording of gel data, free of shadows, dust, and
Personnel should be trained in safe operation. Leads and other photographic artifacts (Fig. 16-14).
connectors to gel baths should be free of precipitate (Fig. Periodically, background measurements are required
16-13). This can be avoided by not leaving buffer in gel on such instruments as uorometric detectors (includ-
baths after electrophoresis runs. Capillary systems require ing real-time thermal cyclers), luminometers, and densit-
cleaning of buffer and polymer delivery channels as well ometers. Instrument manufacturers provide guidelines
as replacing polymer at least twice per month. Capillaries for acceptable background levels. Laboratory profession-
should be replaced according to their suggested life span als may use these measurements or establish their own
in number of uses. Temperature-controlled electrophore- acceptable background levels. Corrective action, such as
sis equipment, such as capillary systems and those used cleaning or lter adjustment, is documented in the
for constant temperature gel electrophoresis, is monitored laboratory maintenance records. Ultraviolet (UV) illumi-
for accurate temperature settings as recommended by the nators should be kept free of dust and properly shielded
manufacturer. while in use. The technologists should keep track of
Photographic equipment is frequently used in molecu- the life span of the UV light source and replace it ac-
lar laboratory procedures. Autoradiograms resulting from cordingly.
radioactive or chemiluminescent methods are developed Spectrophotometers used to measure DNA, RNA, pro-
in automated equipment or manually. The processing tein concentrations, and colorimetric assays and turbidity

Figure 16-14 Cameras should be mounted securely for gel

photography. A digital camera, shown here, is mounted on a Figure 16-15 Laminar ow hoods are used to protect
photographic hood. A mask shields the ultraviolet light source against biological hazards and to help maintain a sterile
except for the area where the gel is illuminated. environment.
must be checked annually or as recommended by the Calibrations

manufacturer. Maintenance includes scanning through
the range of wavelengths used (e.g., 200800 nm) with Calibration is tting an instrument or test system output
supplied materials or lters. Operation manuals will with the actual concentration of a reference analyte by
include instructions for calibration and maintenance. testing and making appropriate adjustments. In calibra-
Fume hoods and laminar ow (biological safety) tion verication, materials of known concentration
hoods (Fig. 16-15) are monitored annually for proper air throughout the reportable range are tested as patient
ow. Fume hood testing requires special equipment and samples to ensure the test system is accurate. If calibra-
is likely to be performed by building engineers. Laminar tion verication fails, recalibration is required. CLIA-88
ow hoods are tested for proper lter performance and Regulations, 42CFR493.1255(b)(3), recommend perfor-
air displacement. This testing is performed at least annu- mance of calibration verication at least every 6 months
ally or upon installation or movement of the hood. or when major components, instrument software, or lots
Professional service technicians or the hood manufactur- of reagents of the test system are altered. Recalibration is
ers usually provide this type of certication. also required if prociency or other quality control test-
For all detection systems, regular monitoring of func- ing fails or in the event of major instrument malfunction
tional characteristics will reveal any drift or trends that and repair. Manufacturers of test systems may also pro-
might affect test results. Tolerance limits should be estab- vide calibration schedules and instructions on how to per-
lished to warrant intervention by maintenance or recali- form calibrations. Laboratory professionals must verify
bration of the instrument. Scheduled and unscheduled calibration of systems performed by the manufacturer.
maintenance is documented and kept in the laboratory A variety of materials may be used for calibration,
records. These records should be readily available to the including previously tested specimens, reference stan-
technologists using the equipment. dards, and prociency testing material. There must be

independent assessment of the actual measurement of the

calibration material. Once established, calibrator results
should always be specied ranges of values. Calibration
materials should cover at least three levels of measure-
ment: low, medium, and high points. Analytes used for
calibration should be in the same matrix (e.g., plasma or
urine) as the patient specimens.26 Calibrators are prepared
and used separately from quality control standards (e.g.,
positive, negative, sensitivity controls) for routine runs.
Reagents
When reagents are replaced in a test method, the new lot
is ideally tested on a previously positive and negative
specimen as well as the run controls. Instructions on the
preparation of reagents and the quantities used in each Figure 16-16 Primers are often purchased from DNA syn-
assay are included in the written laboratory protocol for thesis facilities. On receipt in freeze-dried form, the primers
each procedure. Lot numbers and working stocks of are easily resuspended in nuclease-free water or buffer to
make a stock solution. The stock solution is then diluted into
probes and primers used in amplication methods are
working stocks.
documented and matched to test performance in the runs
in which they were used. The sequences of primers and
probes are also documented, as any sequence errors made the sequences and binding sites of primers and the
during ordering or synthesis of the primers will adversely expected size of the amplicons, are documented as part of
affect amplication specicity or even result in amplica- the written laboratory protocol. Polymorphisms or
tion failure. Probes used for linkage analysis and array translocation breakpoints that affect primer binding
technology are periodically updated as new markers are should be noted in terms of the expected frequency in the
discovered so that probe sequences used for a given test population or in the number of successful amplications.
should be recorded. For hybridization procedures, labeled probe solutions
Primers are a critical component of PCR procedures. are treated as working stock and veried by parallel
Primers are most conveniently supplied in lyophilized analysis with old lots. FISH probes are validated and ver-
(freeze-dried) form from the DNA synthesis facility (Fig. ied according to recommended procedures.18 The qual-
16-16). The supplier will also provide information on the ity of new microarray lots is veried by the manufacturer
quality, method of purication, molecular weight, and or by hybridizing labeled nucleotides that bind to all
number of micrograms of dried primers. This informa- probes on a representative array from the lot. RNA
tion is used to rehydrate the primers to a stock solution probes are maintained under RNase-free conditions to
concentration required for the PCR protocol. The resus- protect their integrity.
pended primers are then diluted into working stocks. It is important to document descriptive information on
Probes used for real-time PCR are supplied in solu- probes used in the laboratory. This information includes
tion; for example, a 100-M stock solution that is diluted the type of probe (genomic, cDNA, oligonucleotide,
to 4- or 5-M working stock before use in the procedure. plasmid, or riboprobe) and the species of origin of the
When new working stocks are prepared (diluted from the probe sequence. The sequence of the probe, a GenBank
probe stocks or resuspended primers), they are treated as number or other identication of the target sequence or
new reagent lots. Master mixes of primers, probe, buffer, gene region recognized by the probe, and a restriction
nucleotides, and enzyme may be prepared or purchased enzyme map of that region are also important informa-
and used as working stock. tion. Any known polymorphisms, sites resistant to
As is required for all reagents, instructions on prepara- endonuclease digestion, and cross-hybridizing bands
tion of primers, probes, and working stocks, along with should be noted. Recombination frequencies and map

positions must be documented for linkage procedures.

For inherited disease tests, chromosomal location of the
target gene and known mutant alleles and their fre-
quencies in various ethnic groups might be cited in pub-
lished reports. Labeling methods and standards for
adequacy of hybridization are included in the test proce-
dure manual.
In multiplex reactions, primer and/or probe competi-
tion for substrates may affect results. Multiple uo-
rochrome signals in uorescence assays may also cross
into each others detection ranges. For gel or capillary
sizing, products of multiplex reactions should be reason-
ably different so that banding patterns do not complicate
interpretation. For example, multiplex STR analysis by
PCR includes 13 sets of primers that produce 13 ampli-
cons labeled with three different uorochromes (see
Chapter 11). The range of sizes of each amplied STR
locus is designed not to overlap others labeled with the
Figure 16-17 Flammable and explosive materials are
same uorochrome. The instrument that detects the uo-
stored in designated protective cabinets or explosion-proof
rescence is also calibrated to subtract any overlap of refrigerators.
detection of one uorochrome with another.
Analyte-specic reagents (ASR) are probes, primers,
port and handling of dangerous chemicals, such as con-
antibodies, and other test components that detect a spe-
centrated acids and phenol.
cic target, such as a cell surface protein or DNA muta-
Radioactive chemicals are used in some molecular
tion. ASRs comprise the active part of home brew tests.
methods (Table 16.5). Although methods involving radi-
ASRs are usually purchased from an outside manufac-
ation are increasingly being replaced by nonradioactive
turer. ASRs are classied as I, II, or III. Most ASRs used
alternatives, some laboratory procedures still use these
in the molecular laboratory are class I. Several molecular
agents. The Nuclear Regulatory Commission requires
tests are available as ASRs in infectious disease, tissue
that laboratory personnel working with radioactive
typing, and other areas of molecular diagnostics. Ap-
proved molecular methods include tests that utilize FISH,
Hybrid Capture, PCR, and microarray technologies.
Class II and III ASRs include those used by blood banks
Flammability
to screen for infectious diseases and those used in diag- 04
nosis of certain contagious diseases such as tuberculosis. Health
Class I ASRs are not subject to special controls by the Instability
hazard
U.S. Food and Drug Administration. The test perform- 04
04
ance of class I ASRs is established during test validation. Special
hazards
O, W
Chemical Safety
Volatile and ammable reagents are stored in properly Figure 16-18 NFPA hazard labels have three parts, labeled
vented and explosion-proof cabinets or refrigeration units with numbers 0 to 4, depending on the amount of hazard,
(Fig. 16-17). The National Fire Protection Association from none (0) to severe (4). The fourth section has two cate-
gories. O indicates a strong oxidizer, which greatly increases
(NFPA) has developed a series of warning labels for uni- the rate of combustion. The stricken W symbol indicates dan-
versal use on all chemical containers (Fig. 16-18).27 gerous reactivity with water, which would prohibit the use of
Secondary or reinforced containers are required for trans- water to extinguish a re in the presence of this chemical.

Table 16.5 Examples of Radionuclides Used in Laboratory Methods

Radioisotope Half-Life* Radiation (MeV) Travel in Air Critical Organs
32
P 14.29 days , 1.709 20 feet Bone, whole body
33
P 25.3 days , 0.249 20 feet Bone, whole body
3
H 12.35 years , 0.019 0.65 inches Body water
14
C 5730 years , 0.156 10 inches Whole body, fat
35
S 87.39 days , 0.167 11 inches Whole body, testes
125
I 60.14 days X,, 0.035 3 feet Thyroid
*Time for half of the radiation emission to dissipate
Million electron volts
reagents maintain a radiation safety manual providing Laboratory personnel working with radioactive mate-
procedures for the safe handling of radioactive sub- rial should receive special training for safe handling,
stances in both routine and emergency situations. The decontamination, and disposal of radiation. Laboratory
Occupational Safety and Health Administration (OSHA) instructions for working with radiation should include
has also developed regulations regarding ionizing and inspection and monitoring of shipments as required by
nonionizing radiation. the U.S. Department of Transportation. Work spaces are
Radioactive reagents and methods are performed in decontaminated daily and checked at least monthly by
designated areas. Working surfaces are protected with swipe testing or by Geiger counter. Technologists wear
absorbent paper, drip trays, or other protective contain- gloves, lab coat, and safety glasses when handling
ers. Potentially volatile radioactive materials are handled radioactive solutions. Radiation badges are worn when
under a fume hood. Radioactive waste is discarded in handling 1.0 mCi or more. Exposure increases with de-
appropriate containers, separate from normal trash, creasing distance from the radioactive reagent (see Table
according to regulations. Some isotopes with short half- 16.5), so exposure at close distance, such as working over
lives may be stored over approximately seven half-lives, open containers, should be avoided. For isotopes such as
checked for residual emissions, and then discarded with 32P, acrylic shielding is required for work, storage, and
regular waste. Containers and equipment used in these waste areas (Fig. 16-20).
areas should be labeled with Caution Radioactive Mate-
rial signs (Fig. 16-19). Signs should be posted on the Prociency Testing
rooms where radioactive materials are used. OSHA has
specications for accident prevention signs and tags for Prociency testing refers to the analysis of external spec-
radiation and other occupational hazards. imens from a reference source supplied to independent
laboratories.28 Prociency testing is performed to assess
the skills (competency) of laboratory personnel perform-
ing molecular assays as well as the performance of the
assay itself. Availability of comprehensive test specimens
in the rapidly expanding area of molecular diagnostics is
sometimes problematic. The CAP supplies specimens for
molecular oncology, engraftment, and microsatellite
instability testing among others (www.cap.org). A num-
ber of analytes, however, are not available, especially for
tests that are offered in a small number of laboratories. If
prociency specimens are not commercially available,
Figure 16-19 Rooms, cabinets, and equipment con- laboratories can exchange blinded split specimens; alter-
taining radioactive chemicals are identied with radiation natively, blinded specimens measured or documented by
safety labels. independent means such as chart review can be tested

A record of the assay conditions and reagent lot num-

bers is kept with patient results. Identication of the tech-
nologist performing the assay may also be included.
Documentation of quality and quantity of the isolated
DNA or RNA is also required, especially if designated
amounts of nucleic acids are used for an assay. Quantity
and quality are documented in the form of spectropho-
tometry or uorometry data or quantity or gel photo-
graphs of high molecular weight DNA or ribosomal RNA
quality (see Chapter 4). The quality of RNA analyzed by
Northern blot or RT-PCR may be assessed by monitoring
a housekeeping gene, ribosomal RNA expression, or
other calibrator.
If DNA is cut with restriction enzymes for Southern
blot or PCR-restriction fragment length polymorphism,
complete cutting by the restriction enzyme is veried on
control targets and documented by photography of the
cut DNA on the gel after electrophoresis. DNA digested
with DNase for array analysis is also documented in this
way to conrm proper fragment sizes. If specimen
nucleic acid is labeled for hybridization arrays, labeling
Figure 16-20 Acrylic shielding is required for working with
gamma emitters, such as 32P and 33P. efficiency is assessed by measurement of the specic
activity (signal per ng nucleic acid). For Southern blots,
patient identication, gel lane (well) number, and probe
within the laboratory.29,30 If at all possible, interlaboratory target and type are also documented. It is also recom-
testing is preferable. mended that the test documentation should include pre-
Prociency testing is performed at least twice a year, hybridization and hybridization conditions and probe and
with the prociency samples tested within routine patient hybridization buffer lot numbers.
runs. The specic procedures should be dened and doc- In situ results, such as FISH, are correlated with histo-
umented in the laboratory. Errors or incorrect responses logical ndings (stained sections) of tissue morphology.
for prociency specimens are documented along with the This is required when the molecular target detection
corrective action taken, if necessary. is signicant in specic cells; for example, with p53
detection in tumor cells. Documentation includes images
of at least one normal cell with at least two abnormal
Documentation of Test Results cell results. These images are cross-referenced or
Test results in the form of electropherograms, gel images, retained together with photographs, lms, and autora-
and autoradiograms should be of sufficiently high quality diographs generated from additional testing of the same
that results are unequivocal. This includes clear bands or specimen. All these records are labeled with patient
peaks without high background, cross hybridization, dis- identication, sample numbers, run identiers, and the
tortions, and other artifacts. Controls should also be clear date of assay.
and consistent and reect the expected size or level. All of the raw data are retained with the nal report
Molecular weight ladders on gels, autoradiograms, or and clinical interpretation of the test results. Careful doc-
electropherograms should cover the expected range of umentation is important because molecular diagnostic
band or peak sizes produced from the specimen. For results may differ from results from other laboratories or
example, if primers used to detect a t(14;18) transloca- from the clinical diagnosis. Such discrepancies occur
tion test by PCR yield amplicons expected to range most often with amplication methods because of their
150500 bp, the molecular weight ladder used must high sensitivity. If a molecular result is questioned, inves-
range from less than 150 bp to more than 500 bp. tigation of the discrepancy includes review of the raw

data. Results of this investigation along with any correc- organism tested, the analytical interpretation of the raw
tive action taken are noted in the laboratory records. data, and the clinical interpretation of the analytical result.
This interpretation includes the penetrance of mutations;
that is, the probability of having a mutation but not getting
Gene Sequencing Results
the associated disease.
Direct sequencing is increasingly used in clinical applica- The likelihood of false-positive or false-negative
tions to detect gene mutations or to type microorganisms. results are also included in a report. Mutation detection is
Sequence data must be of adequate quality with accept- not guaranteed, especially in large genes with hundreds
ably low baseline, especially if heterozygous target states of possible mutations that may or may not effectively
are to be detected. Each nucleotide peak or band should compromise gene function. The mutation detection rate
be unequivocal. Sequencing should be performed on both for this type of gene and the residual risk of undetected
complementary strands of the template to confirm mutations are therefore included in the test report.
sequenced mutation or type. Repeated sequencing across Negative results from tests for specic point or chromo-
the same area, or resequencing, for known sequence somal mutations are reported in terms of the sensitivity of
changes is sometimes performed only on one template the test, e.g., less than 0.01% chance of mutation, or,
strand; however, sequencing of both strands is best. alternatively, negative accompanied with the sensitivity
Criteria for acceptance of sequencing data include levels of the test. For parentage reports, the combined
correct assignment of the nucleotide sequence in a paternity index, the probability of paternity as a percent-
dened region surrounding the critical area, not including age, prior probability of paternity used in calculations,
the amplication primer binding sites. Furthermore, a and the population used for comparison are reported.
specied level of band or peak quality (intensity or uo- The laboratory director, pathologist, or other clinical
rescence levels, respectively) with reasonably low back- expert reviews the analytical interpretation, determines
ground is assigned. Dened limits of uorescence ratios the clinical interpretation, and veries the nal results
are set to identify true heterozygous base positions. with an actual or electronic signature on the test report.
Ideally, a heterozygous position will have equal uores- An internal laboratory summary sheet is often useful for
cence contribution from the two genotypes, and the peak compiling pertinent information (Fig. 16-21). Test results
height will be approximately half that of a homozygous should not be released before they are reviewed by the
genotype at that position. Results are expressed in the director. Molecular diagnostic tests, in particular, may
standard nomenclature for DNA or protein sequences have technical complexities that inuence the meaning of
(see Chapter 9). the test result. These results are best communicated with
The utility of sequence data requires published normal the clinical signicance of the laboratory ndings.
or type-specic sequences. In the case of gene mutations, When class I ASRs are used in an analytical method,
electronic or published databases of known mutations the following disclaimer is included in the test report:
and polymorphisms are available for frequently tested The FDA has determined that such clearance or approval
genes. These records, especially Internet databases, are is not necessary. This test is used for clinical purposes. It
updated regularly. Newly discovered mutations are clas- should not be regarded as investigational or for research.
sied according to the type of mutation; the laboratory This laboratory is certied under the Clinical Labora-
director or consultant uses published guidelines to deter- tory Improvement Amendments of 1988 (CLIA-88) as
mine if the mutation is clinically signicant.31 For exam- qualied to perform high complexity clinical laboratory
ple, a silent mutation will not affect protein function, testing.32
whereas a frameshift mutation will. The disclaimer is not required for tests using reagents
that are sold together with other materials or an instru-
ment as a kit nor for reagents sold with instructions
Reporting Results
for use.
Test results are reported in terms that are unambiguous to Condentiality of molecular test results is essential.
readers who may not be familiar with molecular methods All results, and particularly molecular genetic results,
or terminology. The test report must clearly convey the may affect insurability, employment, or other family
method or manufactured kit used, the locus, mutation or members. Results are released only to the ordering physi-

Cytometry Accession #
Figure 16-21 Example of a patient result summary sheet used for documentation of test results
of a BCR/ABL analysis by RT-PCR. Information included will differ depending on the disease and
the type of test.

cian or other authorized personnel such as genetic coun- of these tests will be better able to respond to these prob-
selors or nurse coordinators. Technologists should refer lems. In addition, with the quickened evolution of the
requests for patient data to supervisors. Data sent by fac- sciences, a knowledgeable technologist can better recog-
simile must be accompanied by a disclaimer such as: nize signicant discoveries that offer potential for test
The documents accompanying this telecopy transmis- improvement.
sion contain condential information belonging to the
sender that is legally privileged. This information is
intended only for the use of the individual or entity
named above. The authorized recipient of this informa- STUDY QUESTIONS
tion is prohibited from disclosing this information to any
other party and is required to destroy the information What actions should be taken in the following situations?
after its stated need has been fullled. If you are not the
1. An unlabeled collection tube with a requisition for a
intended recipient, you are hereby notied that any dis-
factor V Leiden test is received in the laboratory.
closure, copying, distributing, or action taken in reliance
on the contents of these documents is strictly prohibited. 2. After PCR, the amplication control has failed to
If you have received this telecopy in error, please notify yield a product.
the sender immediately to arrange for return or destruc-
tion of these documents. 3. An isolated DNA sample is to be stored for at least
Test results are not released to employers, insurers, or 6 months.
other family members without the patients expressed
consent. Any data discussed in a public forum are pre- 4. A bone marrow specimen arrives at the end of a shift
sented such that no patient or pedigree is identiable by and will not be processed for the Bcl2 translocation
the patient or the general audience. Written consent from until the next day.
the patient may be required under some circumstances.
Each institution will have a department that oversees the 5. The temperature of a refrigerator set at 8C (2C)
lawful use of condential information. reads 14C.
Technologists working in the area of molecular pathol-
ogy will encounter tests in which the nal details are 6. A PCR test for the BCR/ABL translocation was neg-
determined empirically. As a result, a test procedure may ative for the patient sample and for the sensitivity
differ from one laboratory to another. Even after the test control.
procedure is established, troubleshooting is sometimes
7. A fragile X test result has been properly reviewed
required as the procedure is put to use on a routine basis.
and reported.
Some reactions that work well for short-term research
may prove to be less consistent and reproducible than is 8. A bottle of reagent alcohol with a 3 in the red dia-
required in the clinical laboratory setting. mond on its label is to be stored.
Biotechnology is fast developing standard reagent sets
and instrumentation for the most popular tests, but these 9. The expiration date on a reagent has passed.
also differ from one supplier to another. Furthermore, due
to market demands, test reagent kits may be modied or 10. Test results are to be faxed to the ordering physician.
discontinued. If replacement reagents are available, they
may not be identical to those previously used. Ongoing References
tests then have to be optimized. This can be a concern 1. Calam R, Bessman JD, Ernst DJ, et al. Procedures
where turnaround times are critical. for the Handling and Processing of Blood
It then becomes the responsibility of the technologist Specimens: Approved Guideline, 3rd ed. St. John
to perform and monitor tests on a regular basis to main- Hospital, 2004.
tain consistency and accuracy of results. The technologist 2. Rabinovitch A, Sarewitz SJ, Woodcock SM, et al.
who understands the biochemistry and molecular biology Routine Urinalysis and Collection, Transportation,

and Preservation of Urine Specimens: Approved pathology investigation. Archives of Pathology and
Guideline, 2nd ed. Specialty Laboratories, 2001. Laboratory Medicine 1996;120:59196.
3. Arkin C, Bessman JD, Calam RR, et al. Tubes and 14. Statement AFMP. Recommendations for in-house
Additives for Venous Blood Specimen Collection: development and operation of molecular diagnostic
Approved Standard, 5th ed. Lahey Clinic/Maine tests. American Journal of Clinical Pathology
Medical Center Research Institute, 2003. 1999;111:44963.
4. Ghadessy F, Ong JL, Holliger P. Directed evolution 15. Hirsh B, Brothman AR, Jacky PB, et al. Section E6
of polymerase function by compartmentalized self- of the ACMG technical standards and guidelines:
replication. Proceedings of the National Academy Chromosome studies for acquired abnormalities.
of Sciences 2001;98:455257. Genetics in Medicine 2005;7:50913.
5. Lam N, Rainer TH, Chiu RWK, et al. EDTA is a 16. Potter N, Spector EB, Prior TW. Technical stan-
better anticoagulant than heparin or citrate for dards and guidelines for Huntington disease testing.
delayed blood processing for plasma DNA analysis. Genetics in Medicine 2004;6:6165.
Clinical Chemistry 2004;50:25657. 17. Ambros I, Benard J, Boavida M, et al. Quality
6. Tanner M, Berk LS, Felten DL, et al. Substantial assessment of genetic markers used for therapy
changes in gene expression level due to the storage stratication. Journal of Clinical Oncology
temperature and storage duration of human whole 2003;21:207784.
blood. Clinical and Laboratory Haematology 18. Enns R. Fluorescence in situ hybridization (FISH)
2002;24:33741. methods for medical genetics: Approved guideline.
7. Chai V, Vassilakos A, Lee Y, et al. Optimization of National Committee for Clinical Laboratory
the PAXgene blood RNA extraction system for gene Standards, 2004.
expression analysis of clinical samples. Journal of 19. Berte L. Clinical Laboratory Technical Procedure
Clinical Laboratory Analysis 2005;19:18288. Manual, 4th ed. GP2-A4, 2002.
8. Elbeik T, Nassos P, Kipnis P, et al. Evaluation of 20. Board DA. Standards and guidelines. Forensic
the VACUTAINER PPT Plasma Preparation Tube Science Communications 2001;3(4).
for use with the Bayer VERSANT assay for quan- 21. Ye J, Ingels SC, Parvin CA. Performance evaluation
tication of human immunodeciency virus type and planning for patient-/client-based quality con-
1 RNA. Journal of Clinical Microbiology 2005;43: trol procedures. American Journal of Clinical
376971. Pathology 2000;113:24048.
9. Rainen L, Oelmueller U, Jurgensen S, et al. 22. Madej R. Using standards and controls in molecular
Stabilization of mRNA expression in whole blood assays for infectious diseases. Molecular
samples. Clinical Chemistry 2002;48:188390. Diagnostics 2001;6:33545.
10. Rahman M, Goegebuer T, De Leener K, et al. 23. Tse C, Brault D, Gligorov J, et al. Evaluation of
Chromatography paper strip method for collection, the quantitative analytical methods real-time PCR
transportation, and storage of rotavirus RNA in for HER-2 gene quantication and ELISA of
stool samples. Journal of Clinical Microbiology serum HER-2 protein and comparison with
2004;42:16051608. uorescence in situ hybridization and immuno-
11. Zhong K, Salas CJ, Shafer R, et al. Comparison histochemistry for determining HER-2 status in
of IsoCode STIX and FTA Gene Guard collection breast cancer patients. Clinical Chemistry
matrices as whole-blood storage and processing 2005;51:10931101.
devices for diagnosis of malaria by PCR. Journal 24. Stevenson G, Smetters GW, Copper JA. A gravi-
of Clinical Microbiology 2001;39:119596. metric method for the calibration of hemoglobin
12. Farkas D, Drevon A, Kiechle FL, et al. Specimen micropipets. American Journal of Clinical Patho-
stability for DNA-based diagnostic testing. logy 1951;31:48991.
Diagnostic Molecular Pathology 1996;5: 22735. 25. Bray W. Software for the gravimetric calibration
13. Farkas D, Kaul KL, Wiedbrauk DL, et al. Specimen testing of pipets. American Clinical Laboratory
collection and storage for diagnostic molecular 995;14:1415.

26. Lasky F. Evaluation of Matrix Effects: Approved 31. den Dunnen J, Antonarakis SE. Mutation nomen-
Guideline, 2nd ed. Clinical and Laboratory Stan- clature extensions and suggestions to describe com-
dards Institute, 2005. plex mutations. Human Mutation 2000;15:712.
27. Association NFP. Fire Protection Guide to 32. Molecular Pathology Checklist. College of
Hazardous Materials, 13th ed., 2001. American Pathologists, 2005.
28. Clark G, Sarewitz SJ. Using prociency testing 33. Kiechle F, Chambers LM, Cox RS, et al. Patient
(PT) to improve the clinical laboratory: Approved preparation and specimen handling In: Reference
guideline. National Committee for Clinical Labo- guide for diagnostic molecular pathology and ow
ratory Standards, 1999. cytometry. Fascicle VII: College of American
29. Richards C, Grody WW. Alternative approaches to Pathologists, 1996.
prociency testing in molecular genetics. Clinical 34. Tuttle R, Waselenko JK, Yosseffi P, et al. Preserva-
Chemistry 2003;49:71718. tion of nucleic acids for polymerase chain reaction
30. Sarewitz S. Assessment of laboratory tests when after prolonged storage at room temperature.
prociency testing is not available: Approved guide- Diagnostic Molecular Pathology 1998;7:302309.
line. National Committee for Clinical Laboratory 35. Dutton G. Thinking outside the icebox on DNA
Standards, 2002. storage. The Scientist 2005;19:28.

17Buckingham (F)-Answer 2/6/07 12:17 PM Page 427
STUDY QUESTION ANSWERS Appendix

CHAPTER 1 A second cut of the plasmid with BamH1 yields two
pieces, 80 and x bp.
1. What is the function of DNA in the cell?
e. How many BamH1 sites are in the plasmid?
Storage of genetic information
2
f. What is x in base pairs (bp)?
2. Compare the structure of the nitrogen bases. How do
830 bp 80 bp = 750 bp
purines and pyrimidines differ?
Purines have a double ring; pyrimidines have a
2. How would you determine where the BamH1 sites are
single ring.
in relation to the HpaII sites?
Cut the plasmid with both enzymes at the
3. Write the complementary sequence to the following:
same time.
5AGGTCACGTCTAGCTAGCTAGA3
3TCCAGTGCAGATCGATCGATCT5
3. The plasmid has one EcoR1 site into which you want
to clone a blunt-ended fragment. What type of enzyme
4. Which of the ribose carbons participates in the phos-
could turn an EcoR1 sticky end into a blunt end?
phodiester bond?
5 to 3 single-strand exonuclease
5 carbon, 3 carbon
Recombination and DNA Transfer
5. Which of the ribose carbons carries the nitrogen base?
1. Compare how DNA moves from cell to cell by a) con-
1 carbon
jugation, b) transduction, and c) transformation.
a) Cell-to-cell contact
6. Why does DNA polymerase require a primer?
b) Viral or bacteriophage vectors
A 3 hydroxyl group from an existing nucleotide
c) Fragmented or plasmid DNA
must be present to form the phosphodiester bond.
Restriction Enzyme Analysis CHAPTER 2

RNA Secondary Structure
1. A plasmid was digested with the enzyme HpaII. On
agarose gel electrophoresis, three bands are observed: 1. Draw the secondary structure of the following RNA.
100, 230, and 500 bp. The complementary sequences (inverted repeat) are
a. How many HpaII sites are present in this underlined.
plasmid? 5CAUGUUCAGCUCAUGUGAACGCU3
3
b. What are the distances between each site?
100 bp, 230 bp, 500 bp
c. What is the size of the plasmid?
830 bp
d. Draw a picture of the plasmid with the HpaII 2. Underline the rest of the two inverted repeats in the
sites. following RNA, then draw the secondary structure.
HpaII 5CUGAACUUCAGUCAAGCAUGCACU-
100 bp GAUGCUU3
HpaII
500 bp
230 bp
HpaII
427

OK as set, same as Right Running head
428 Appendix Study Question Answers
The Lac Operon b. Histone acetylation close to the gene

Increase
1. Using the depiction of the Lac operon in Figures 2-9 c. siRNAs complementary to the gene transcript
and 2-10 indicate whether gene expression (transcrip- Decrease
tion) would be on or off under the following condi-
tions:
CHAPTER 3
(P promoter; O operator; R repressor)
a. P O R, no inducer present 1. Indicate whether the following peptides are hydro-
OFF philic or hydrophobic?
b. P O R, inducer present a. MLWILSS
ON Hydrophobic
c. P- O R, no inducer present b. VAIKVLIL
OFF Hydrophobic
d. P- O R, inducer present c. CSKEGCPN
OFF Hydrophilic
e. P O- R, no inducer present d. SSIQKNET
ON Hydrophilic
f. P O- R, inducer present e. YAQKFQGRT
ON Hydrophilic
g. P O R-, no inducer present f. AAPLIWWA
ON Hydrophobic
h. P O R-, inducer present g. SLKSSTGGQ
ON Hydrophilic
i. P- O- R, no inducer present
OFF 2. Is the following peptide positively or negatively
j. P- O- R, inducer present charged at neutral pH?
OFF GWWMNKCHAGHLNGVYYQGGTY
k. P- O R-, no inducer present Positive
OFF
l. P- O R-, inducer present 3. Consider an RNA template made from a 2:1 mixture
OFF of C:A. What would be the three amino acids most fre-
m. P O- R-, no inducer present quently incorporated into protein?
ON Proline, histidine, threonine
n. P O- R-, inducer present
ON 4. What is the peptide sequence encoded in
o. P- O- R-, no inducer present AUAUAUAUAUAUAUA?
OFF IYIYIYIYIY
p. P- O- R-, inducer present
OFF 5. Write the anticodons, 5 to 3, of the following amino
acids:
Epigenetics a. L
UAA, CAA, AAG, GAG, UAG, CAG
1. Indicate whether the following events would increase b. T
or decrease expression of a gene: AGU, GGU, UGU, CGU
a. Methylation of cytosine bases 5 to the gene c. M
Decrease CAU

Study Question Answers Appendix 429
d. H 1c. 860 g/mL 0.5 mL 430 g

AUG, GUG 1d. 440 g/mL 0.5 mL 220 g
e. R
ACG, GCG, UCG, CCG, UCU, CCU
3. Three DNA preparations have the following Abs260
f. I
and Abs280 readings:
AAU, GAU, UAU
Sample No. Abs260 Abs280
6. A protein contains the sequence LGEKKW- 1 0.419 0.230
CLRVNPKGLDESKDYLSLKSKYLLL. What is the
2 0.258 0.225
likely function of this protein?
3 0.398 0.174
This protein has a leucine zipper and it is likely to
be a transcription factor.
For each sample 1-3, based on the Abs260/Abs280 ratio, is
7. A histone-like protein contains the sequence: each preparation suitable for further use? If not, what is
PKKGSKKAVTKVQKKDGKKRKRSRK. What contaminating the DNA?
characteristic of this sequence makes it likely to asso- 1 Abs260/Abs280 0.419/0.230 1.82, suitable
ciate with DNA? 2 Abs260/Abs280 0.258/0.225 1.14, unsuitable,
This protein has a lot of lysines. The resulting protein contamination
positive charges would bind favorably to the 3 Abs260/Abs280 0.398/0.174 2.28, may be
negatively charged DNA. suitable, RNA contamination
CHAPTER 4
RNA Quantity/Quality
DNA Quantity/Quality
1. Calculate the DNA concentration in g/mL from the 1. Calculate the RNA concentration in g/mL from the
following information: following information:
a. Absorbance reading at 260 nm from a 1:100 a. Absorbance reading at 260 nm from a 1:100
dilution 0.307. dilution 0.307
0.307 Abs 50 (g/mL) 100 0.307 Abs 40 (g/mL) 100
1535 g/mL 1228 g/mL
b. Absorbance reading at 260 nm from a 1:50 b. Absorbance reading at 260 nm from a 1:50
0.307 Abs 50 (g/mL) 50 0.307 Abs 40 (g/mL) 50
767.5 g/mL 614 g/mL
c. Absorbance reading at 260 nm from a 1:100 c. Absorbance reading at 260 nm from a 1:100
0.172 Abs 50 (g/mL) 100 0.172 Abs 40 (g/mL) 100
860 g/mL 688 g/mL
d. Absorbance reading at 260 nm from a 1:100 d. Absorbance reading at 260 nm from a 1:100
0.088 Abs 50 (g/mL) 100 0.088 Abs 40 (g/mL) 100
440 g/mL 352 g/mL
2. If the volume of the above DNA solutions was 0.5 2. If the volume of the above RNA solutions was 0.5 mL,
mL, calculate the yield for a. to d. calculate the yield for a. to d.
1a. 1535 g/mL 0.5 mL 767.5 g 1a. 1228 g/mL 0.5 mL 614 g
1b. 767.5 g/mL 0.5 mL 383.75 g 1b. 614 g/mL 0.5 mL 307 g

1c. 688 g/mL 0.5 mL 344 g 5. A gel separation of RNA yields aberrantly migrating
1d. 352 g/mL 0.5 mL 176 g bands and smears. Suggest two possible explanations
for this observation.
3. An RNA preparation has the following absorbance Poor RNA sample quality.
readings: Inadequate denaturation of the RNA before
Abs260 0.208 loading.
Abs280 0.096
Is this RNA preparation satisfactory for use? 6. Why does DNA not resolve well in solution (without
Abs260/Abs280 0.208/0.096 2.17, suitable a gel matrix)?
The size and charge of DNA have opposing effects
on migration.
CHAPTER 5
1. You wish to perform a resolution of your restriction 7. Why is SyBr green less toxic than EtBr?
enzymedigested DNA fragments. The size of the SyBr green binds in the minor groove of DNA,
expected products ranges 500100 bp. You discover unlike EtBr, which intercalates between the bases.
two agarose gels polymerizing on the bench. One is Intercalation by EtBr is more likely to cause DNA
5% agarose. The other is 2% agarose. Which one mutations.
might you use to resolve your fragments?
2% CHAPTER 6
2. After completion of the run of fragments along with 1. Calculate the melting temperature of the following
the proper molecular weight standard on the agarose DNA fragments using the sequences only:
gel, suppose a. or b. was observed. What might be a. AGTCTGGGACGGCGCGGCAATCGCA
explanations for these? (Assume you have included a TCAGACCCTG CCGCG CCGTTAGCGT
molecular weight marker in your run.) 84C
a. The gel is blank (no bands, no molecular weight b. TCAAAAATCGAATATTTGCTTATCTA
standard). AGTTTTTAGCTTATAAACGAATAGAT
Samples were not loaded properly. 64C
Electrodes were switched. c. AGCTAAGCATCGAATTGGCCATCGTGTG
Gel was not stained properly. TCGATTCGTAGCTTAACCGGTAGCACAC
b. Only the molecular weight standard is visible. 84C
Samples were not loaded properly. d. CATCGCGATCTGCAATTACGACGATAA
Samples were diluted, degraded, or otherwise GTAGCGCTAGACGTTAATGCTGCTATT
compromised. 78C
Gel was not stained evenly.
Suppose you were to use single strands of these frag-
3. How does PFGE separate larger fragments more effi- ments as probes for a Southern blot.
ciently than standard electrophoresis? 2. If the fragments were dissolved in a solution of 50%
Repeated reorientation forces larger fragments formamide, is the stringency of hybridization higher
through the gel matrix more effectively. or lower than if there were no formamide?
Higher
4. A 6% solution of 19:1 acrylamide is mixed, de-
aerated, and poured between glass plates for gel for- 3. If a high concentration of NaCl were added to the
mation. After an hour, the solution is still liquid. What hybridization solution, how would the stringency be
might be one explanation for the gel not polymerizing? affected?
No catalyst was added. The stringency would go lower.

4. Does heating of the solution from 65C to 75C dur- is supplied as 5 units/l, how much enzyme would
ing hybridization raise or lower stringency? you add to the reaction?
Raise b. 1 l of a 1:10 dilution of Taq
5. At the end of the procedure, what would the autoradi- 2. Primer dimers result from:
ogram show if the stringency was too high? d. 3 complementarity in the primer sequences
No bands
3. Which control is run to detect contamination?
6. In an array CGH experiment, three test samples were d. Reagent blank
hybridized to three microarray chips. Each chip was
spotted with 8 gene probes (genes A-H). Below are 4. Nonspecic extra PCR products can result from:
results of this assay expressed as the ratio of test DNA a. Mispriming
to reference DNA. Are any of the eight genes consis-
tently deleted or amplied in the test samples? If so, 5. Using which of the following is an appropriate way
which ones? to avoid PCR contamination?
c. A separate area for PCR reaction setup
Gene Sample 1 Sample 2 Sample 3
A 1.06 0.99 1.01 6. How many copies of a target are made after 30 cycles
of PCR?
B 0.45 0.55 0.43 b. 230
C 1.01 1.05 1.06
7. What are the three steps of a standard PCR cycle?
D 0.98 1.00 0.97
Denaturation, annealing, extension
E 1.55 1.47 1.62
F 0.98 1.06 1.01 8. Which of the following is a method for purifying

PCR product?
G 1.00 0.99 0.99
c. Put the reaction mix through a spin column.
H 1.08 1.09 0.90
9. In contrast to standard PCR, real-time PCR is:
Gene B is deleted in all three samples. Gene E is a. Quantitative
amplied in all three samples.
10. In real-time PCR, uorescence is not generated by
d. Tth polymerase
CHAPTER 7
1. The nal concentration of Taq polymerase is to be 11. Complete the following table comparing various
0.01 unit/L in a 50-L PCR reaction. If the enzyme methods of nucleic amplication:
PCR LCR bDNA TMA Q Replicase Hybrid Capture
Type of amplication Target Probe Signal Target Probe Signal

Target nucleic acid DNA DNA DNA or RNA RNA DNA or RNA DNA
Type of amplicon DNA DNA Chemiluminescent signal RNA RNA Chemiluminescent signal
Major enzyme(s) DNA polymerase Ligase Alkaline phosphatase RNA polymerase Q replicase Alkaline phosphatase

12. Examine the following sequence. You are devis- Two normal chromosomes happened to fall on top
ing a test to detect a mutation at the underlined of one another, resulting in an articial compos-
position. ite signal. A low occurrence of this is accepted as
5 TATTTAGTTA TGGCCTATAC ACTATTTGTG background in interphase FISH.
AGCAAAGGTG ATCGTTTTCT GTTTGAGATT
TTTATCTCTT GATTCTTCAA AAGCATTCTG 2. Is 47; XYY a normal karyotype?
AGAAGGTGAG ATAAGCCCTG AGTCTCAGCT No. 46, XY is normal. This is XYY Syndrome.
ACCTAAGAAA AACCTGGATG TCACTGGCCA
CTGAGGAGCT TTGTTTCAAC CAAGTCATGT 3. What are the genetic abnormalities of the following
GCATTTCCAC GTCAACAGAA TTGTTTATTG genotypes?
TGACAGTTAT ATCTGTTGTC CCTTTGACCT 47,XY, 18
TGTTTCTTGA AGGTTTCCTC GTCCCTGGGC Trisomy 18 (Edwards syndrome)
AATTCCGCAT TTAATTCATG GTATTCAGGA 46,XY, del(16)p(14)
TTACATGCAT GTTTGGTTAA ACCCATGAGA Deletion in region 1, band 4 of the short arm of
TTCATTCAGT TAAAAATCCA GATGGCGAAT chromosome 16
3 iso(X)(q10)
Isochromosome comprised of the long arms of the
Design one set of primers (forward and reverse) to gen- X chromosome
erate an amplicon containing the underlined base. 46,XX, del(22)q(11.2)
The primers should be 20 bases long. Deletion in region 1, band 1, sub-band 2 of the long
The amplicon must be 100-150 bp in size. arm of chromosome 22 (diGeorges syndrome)
The primers must have similar melting tempera- 45,X
tures (Tm), /-2C. Monosomy X (Turners syndrome)
The primers should have no homology in the last
three 3 bases. 4. A chromosome with a centromere not located in the
Write the primer sequences 5 3 as you would if middle of the chromosome, but not completely at the
you were to order them from the DNA synthesis end, where one arm of the chromosome is longer than
facility. the other arm, is called:
There are multiple answers to this question. b. Acrocentric
Here is one example:
Forward: 5 GGAGCTTTGTTTCAACCAAG 3 5. A small portion of chromosome 2 has been found on
Reverse: 5 ATTAAATGCGGAATTGCCCA 3 the end of chromosome 15, and a small portion of
The product is 131 bp long. (The primer binding chromosome 15 has been found on the end of chro-
sites are italicized in the sequence.) mosome 2. This mutation is called a(n):
a. Reciprocal translocation
b. Write the Tm for each primer that you have designed. 6. Phytohemagglutinin is added to a cell culture when
Forward, 58C Reverse, 56C preparing cells for karyotyping. The function of the
Tm (4C GC) (2C AT) phytohemagglutinin is to:
d. Stimulate mitosis in the cells
CHAPTER 8
7. A CEP probe is used to visualize chromosome 21.
1. During interphase FISH analysis of a normal specimen Three uorescent signals are observed in the patients
for the t(9;22) translocation, one nucleus was observed cells when they are stained with this probe. These
with two normal signals (one red for chromosome results are interpreted as consistent with:
22 and one green for chromosome 9) and one com- b. Downs syndrome
posite red/green signal. Five hundred other nuclei
were normal. What is one explanation for this obser- 8. Cells were harvested from a patients blood, cultured
vation? to obtain chromosomes in metaphase, xed onto a

slide, treated with trypsin, and stained with Giemsa. MPSGX

The resulting banding pattern is called: C5X
a. G banding MPSGCWLVTGX
R7fs or R7LfsX5
CHAPTER 9 MPSGR
C5_W6del
1. Name three assays by which the Factor V Leiden
MPSGCWGCWR
R506Q mutation can be detected.
4_6dupGCW
Sequence specic PCR
PCR-RFLP
InvaderTM Assay CHAPTER 10
2. Exon 4 of the HFE gene from a patient suspected to 1. Read, 5 to 3, the rst 20 bases of the sequence in the
have hereditary hemachromatosis was amplied by gel on the right pictured in Figure 10-8.
PCR. The G to A mutation, frequently found in 5GGAGAGGGTCCTGGGAGGGT3
hemachromatosis, creates a single Rsa1 site in exon 4.
When the PCR products are digested with Rsa1, what 2. After an automated dye primer sequencing run, the
results (how many bands) would you expect to see if electropherogram displays consecutive peaks of the
the patient has the mutation? following colors:
two bands red, red, black, green, green, blue, black, red, green,
black, blue, blue, blue
3. Which of the following methods would be practical to If the computer software displays the uors from
use to screen a large gene for mutations? ddATP as green, ddCTP as blue, ddGTP as black, and
SSCP, DGGE ddTTP as red, what is the sequence of the region
4. What is the phenotypic consequence of changing a given?
codon sequence from TCT to TCC? 5TTGAACGTAGCCC3
None. This is a silent mutation.
3. After an automated dye terminator sequencing run,
5. A reference sequence, ATGCCCTCTGGC, is mutated the electropherogram displays bright (high, wide)
in malignant cells. The following mutations in this peaks of fluorescence, obliterating some of the
sequence have been described. Express these muta- sequencing peaks. What is the most likely cause of
tions using the accepted nomenclature: this observation? How might it be corrected?
ATGCGCTCTGGC These are dye blobs. They can be removed by
5CG careful cleanup of the sequencing ladder after the
ATGCCCTCGC sequencing reaction.
9_10delTG or 9_10del
ATAGCCCTCTGGC 4. In a manual sequencing reaction, the DNA ladder on
2_3insA the polyacrylamide gel is very bright and readable at
ATGTCTCCCGGC the bottom of the gel, but the larger (slower migrating)
4_9inv fragments higher up are very faint. What is the most
ATGATATTCTGGC likely cause of this observation? How might it be cor-
4_6delinsATAT or 4_6delCCCinsATAT rected?
The ddNTP concentration is too high.
6. A reference peptide, MPSGCWR, is subject to inher-
ited alterations. The following peptide sequences 5. In an analysis of the p53 gene for mutations, the fol-
have been reported. Express these mutations using the lowing sequences were produced. For each sequence,
accepted nomenclature: write the expected sequence of the opposite strand that
MPSTGCWR would conrm the presence of the mutations detected.
S3_G4insT Normal:

5TATCTGTTCACTTGTGCCCT3 for monitoring engraftment after transplant. There is less

(Homozygous substitution) chance of graft-versus-host-disease with this transplant;
5TATCTGTTCATTTGTGCCCT3 however, there is also no graft versus tumor effect that
5 AGGGCACAAATGAACAGATA3 can improve the chance of removing all of the tumor
(Heterozygous substitution) cells.
5TATCTGT(T/G)CACTTGTGCCCT3 Interpretation for Case Study 11-3:
5 AGGGCACAAGTG(A/C)ACAGATA3 The results show that the tissue was not of the same
(Heterozygous deletion) genetic origin as the patient. Apparently this micro-
5TATCTGTT(C/A)(A/C)(C/T)T(T/G)(G/T)(T/G) scopic fragment of tissue was introduced into one of the
(G/C)CC(C/T)(T/...3 patients sections during the xing and embedding
5 AGGGCACAAGT(GA)A(A/C)(C/A)(A/G)(G/A) process.
(A/T)(T/A)(A/...3 1. Consider the following STR analysis:
6. A sequence, TTGCTGCGCTAAA, may be methylated Locus Child Mother AF1 AF2

at one or more of the cytosine residues: After bisulte
D3S1358 15/15 15 15 15/16
sequencing, the following results are obtained:
Bisulte treated: TTGCTGTGCTAAA vWA 17/18 17 17/18 18
Untreated: TTGCTGCGCTAAA FGA 23/24 22/23 20 24
Write the sequences showing the methylated TH01 6/10 6/7 6/7 9/10
cytosines as CMe. TPOX 11/11 9/11 9/11 10/11
TTGCMeTGCGCMeTAAA CSF1PO 12/12 11/12 11/13 11/12
7. In a pyrosequencing readout, the graph shows peaks D5S818 10/12 10 11/12 12

of luminescence corresponding to the addition of the D13S317 9/10 10/11 10/11 9/11
following nucleotides:
dT peak, dC peak (double height), dT peak, dA peak a. Circle the childs alleles that are inherited from the
What is the sequence? father.
TCCTA Bold numbers
CHAPTER 11 b. Which alleged father (AF) is the biological parent?

AF2
Interpretation for Case Study 11-1:
The recipient peak pattern had converted almost 2. The following evidence was collected for a criminal
entirely to the donor peak pattern at 100 days. The per- investigation.
cent residual recipient cells is calculated by analysis of
the unshared alleles in this marker: Locus Victim Evidence Suspect
%R [Runshared/(Runshared Dunshared)] 100 TPOX 11/12 12, 11/12 11

CSF1PO 10 10, 9/10 9/10
[3171/(40704 3171)] 100
7.2% D13S317 8/10 10, 8/10 9/12
At 1 year, no recipient peaks are detectable at the D5S818 9/11 10/11, 9/11 11
level of detection (0.5%1%) of the instrument. The TH01 6/10 6/10, 8/10 5/11
patient is, therefore, reported to have more than 99% FGA 20 20, 20/22 20
donor cells and less than 1% recipient cells in the test vWA 15/17 18, 15/17 15/18
specimen.
D3S1358 14 15/17, 14 11/12
These results indicate that the two brothers are iden-
tical twins. This means that STR analysis cannot be used The suspect is heterozygous at the amelogenin locus.

a. Is the suspect male or female? peaks prior to a bone marrow transplant. The follow-
Male ing results were observed:
b. In the evidence column, circle the alleles belonging to Locus Donor Alleles Recipient Alleles
the victim. LPL 7, 10 7, 9
Bold numbers
F13B 8, 14 8
c. Should the suspect be held or released? FESFPS 10 7

Released F13A01 5, 11 5, 11
3. A child and an alleged father (AF) share alleles with

Which loci are informative?
the following paternity index:
F13B is donor informative. FESFPS and LPL
Paternity Index are informative.
Locus Child AF for shared allele
D5S818 9,10 9 0.853 6. An engraftment analysis was performed by capillary
D8S1179 11 11,12 2.718 gel electrophoresis and uorescence detection. The
D16S539 13,14 10,14 1.782
uorescence as measured by the instrument under
the FESFPS donor peak was 28,118 units and that
under the FESFPS recipient peak was 72,691. What
a. What is the combined paternity index from these three is the percent donor in this specimen?
loci? 28118/(28118 72691) 28% donor
0.853 2.718 1.782 4.131
7. The T-cell fraction from the blood sample in
b. With 50% prior odds, what is the probability of pater-
Question 6 was separated and measured for donor
nity from these three loci?
cells. Analysis of the FESFPS locus in the T-cell
(4.131 0.5)/[(4.131 0.5) 0.5)] 0.80 or
fraction yielded 15,362 uorescence units under the
80%
donor peak and 97,885 under the recipient peak.
4. Consider the following theoretical allele frequencies What does this result predict with regard to T-cell
for the loci indicated: mediated events such as graft-versus-host disease
(GVHD) or graft-versus-tumor (GVT)?
Locus Alleles Allele Frequency 15362/(15362 97885) 13.6% donor cells;
CSF1PO 14, 14 0.332 GVDH or GVT is unlikely
D13S317 9, 10 0.210, 0.595
8. If a child had a Y haplotype including DYS393 allele
TPOX 8, 11 0.489, 0.237 12, DYS439 allele 11, DYS445 allele 8, and
DYS447 allele 22, what are the predicted Y alleles
a. What is the overall allele frequency, using the product for these loci of the natural father?
rule? DYS393 allele 12, DYS439 allele 11, DYS445
0.332 0.332 0.21 0.595 0.489 0.237 allele 8, and DYS447 allele 22
1.596 10-3
9. Which would be used for a surname test, Y-STR,
b. What is the probability that this DNA found at the two mitochondrial typing or autosomal STR?
sources came from the same person? Y-STR
1/1.596 10-3 626.5
10. An ancient bone fragment was found and claimed to
5. STR at several loci were screened by capillary elec- belong to an ancestor of a famous family. Living
trophoresis and uorescent detection for informative members of the family donated DNA for conrma-

tion of the relationship. What type of analysis would gene. All ve isolates shared the type IV mecA gene,
likely be used for this test? Why? associated with MRSA. PVL, also found in these iso-
Mitochondrial DNA typing might be indicated, lates, is thought to be responsible for tissue necrosis in
because (1) the small circular, naturally ampli- MRSA infections.
ed mitochondrial DNA is more likely to be Further investigation into the cases revealed that all the
attained from the old sample and (2) lineage students had participated in a wrestling meet at one of the
across several generations can be determined high schools. Passage of the organism during this event
using the maternal inheritance of mitochondrial was the likely source of the infection. The meet location
type. was thoroughly cleaned according to CDC recommenda-
tions, and students were encouraged to always wash their
11. What are two biological exceptions to positive iden- hands and maintain good hygiene.
tication by autosomal STR? Interpretation for Case Study 12-3:
Identical twins and clones have identical nuclear The fact that the patients viral loads were gradually
DNA proles. increasing was a sign that the virus was developing resist-
ance to the antiviral drugs. Slight variations of viral quan-
CHAPTER 12 tity within 0.3 log10 units are considered normal. This
Interpretation for Case Study 12-1: patient, however, was seeing signicant increases in viral
Norovirus cannot be cultured. Laboratory tests include replication over the last 6 months.
electron microscopy, serology, and RT-PCR. Electron This patients virus has a mutation in the reverse
microscopy and immune electron microscopy require transcriptase gene that has made the virus resistant to
specialized equipment and technical expertise. Detection AZT. The patients drug treatment needs to be changed
of serum antibodies to the virus is not always straightfor- immediately, with AZT being replaced by another reverse
ward, as most of the adult (but not child) population has transcriptase inhibitor that would be unaffected by
serum antibodies to this virus. Furthermore, it can take this mutation, such as didanosine or lamivudine. Viral
several days after exposure to develop detectable IgM load measurements should be taken regularly to make
antibodies. RT-PCR, therefore, is the method of choice sure that the change in drug therapy causes a decrease
for detection of this RNA virus. The gene target is the in the viral load over the next few months. Genotyping
viral RNA polymerase. Using this target, a broad spec- should be performed again if the viral load starts to
trum of noroviral types can be detected. The results indi- trend up.
cated that the virus was present in salad lettuce served at
1. Which of the following genes would be analyzed to
the hotel. Lettuce sampled directly from the distributor
determine whether an isolate of Staphylococcus
did not carry virus, indicating that the contamination
aureus is resistant to oxacillin?
occurred at the hotel. This assumption was supported by
a. mecA
the discovery of viral RNA in hotel employees who had
prepared the food. Direct sequencing of the RT-PCR 2. Which of the following is a genotypic method used to
products revealed identical sequences for all positive compare two isolates in an epidemiological investiga-
specimens, conrming that the guests, workers, and food tion?
source shared the same viral strain. c. Ribotyping
Results from the culture of the isolates were consistent 3. For which of the following organisms does caution
with MRSA. The results from the PFGE analysis indi- need to be exercised when evaluating positive PCR
cated that all except one of the isolates from the students results because the organism can be found as normal
were the same strain. One isolate exhibited two differ- ora in some patient populations?
ences from the others, indicating that it was closely b. Streptococcus pneumoniae
related to these S. aureus isolates. Resistance to
oxacillin/methicillin results from the expression of an 4. Which of the following controls are critical for ensur-
altered penicillin-binding protein encoded by the mecA ing that amplication is occurring in a patient sample

and that the lack of PCR product is not due to the 5. The factor V Leiden mutation can be detected by:
presence of inhibitors? d. All of the above methods
d. Amplication control
6. The most frequently occurring mutation in the HFE
5. A PCR assay performed to detect Bordetella pertus- gene results in the replacement of cysteine (C) with
sis on sputum obtained from a 14-year-old girl who tyrosine (Y) at position 282. How is this expressed
has had a chronic cough had two bands, one consis- according to the recommended nomenclature?
tent with the internal control and the other consistent C282Y
with the size expected for amplication of the B. per-
tussis target. How should these results be inter- 7. MELAS is a disease condition that results from an
preted? A to G mutation at position 3243 of the mitochon-
b. The girl has clinically-signicant B. pertussis drial genome. This change creates a single ApaI
infection restriction site in a PCR product, including the
mutation site. What would you expect from a PCR-
6. Which of the following is a disadvantage of molecu- RFLP analysis for this mutation on a patient with
lar-based testing? MELAS?
a. Results stay positive longer after treatment b. A single PCR product that cuts into two frag-
than do cultures ments upon digestion with ApaI
7. A molecular-based typing method that has high
8. A father affected with a single gene disorder and
typing capacity, reproducibility, and discriminatory
an unaffected mother have four children (three boys
power, moderate ease of performance, and good to
and a girl), two of whom (one boy and the girl) are
moderate ease of interpretation is:
affected. Draw the pedigree diagram for this family.
c. PCR-RFLP
8. A patient has antibodies against HCV and a viral

load of 100,000 copies/mL. What is the next test that
should be performed on this patients isolate?
d. Inno-LiPA HCV genotyping
CHAPTER 13
1. Which of the following is not a triplet repeat expan- D16S539, an STR, was analyzed in the family. The
sion disorder? results showed that the father had the 6,8 alleles, and
c. Factor V Leiden the mother had the 5,7 alleles. The affected children
had the 5,6 and 6, 7 alleles, and the unaffected chil-
2. A gene was mapped to region 3, band 1, sub-band dren had the 5,8 and 7,8 alleles.
1 of the long arm of chromosome 2. How would you a. If D16S539 is located on chromosome 16, where
express this location from an idiogram? is the gene for this disorder likely to be located?
2q31.1 Chromosome 16
b. To which allele of D16S539 is the gene linked?
3. Which of the following can be detected by PCR? The 6 allele
c. Mitochondrial point mutations How might a DNA analysis be performed for the
presence of the disorder?
4. A patient was tested for Huntingtons disease. PCR a. Analyze D16S539 for the 6 allele by PCR.
followed by PAGE revealed 25 CAG units.
c. This patient is normal at the Huntingtin 9. Exon 4 of the HFE gene from a patient suspected to
locus. have hereditary hemachromatosis was amplied by

PCR. The G to A mutation, frequently found in of the following observations when the gel is exposed
hemachromatosis, creates an Rsa1 site in exon 4. to UV light? (Assume that positive and amplica-
When the PCR products are digested with Rsa1, tion controls and a reagent blank control are included
which of the following results would you expect to in the run.)
see if the patient has the mutation? a. The gel is blank (no bands, no molecular weight
c. The patients PCR product will yield extra standard).
bands upon Rsa1 digestion. Ethidium bromide or Sybr green staining was
omitted.
10. Most people with the C282Y or H63D HFE gene b. Only the molecular weight standard is visible.
mutations develop hemachromatosis symptoms. This Reverse transcriptase or PCR reaction did not
is because of: work.
c. High penetrance c. The molecular weight standard is visible. There
are bands in every lane at 200 bp, even in the
reagent blank lane.
CHAPTER 14 PCR contamination is present.
1. What are the two important checkpoints in the cell
7. What is observed on a Southern blot for gene
division cycle that are crossed when the regulation of
rearrangement in the case of a positive result?
the cell division cycle is affected?
b. Germline bands plus rearranged bands
G1 to S and G2 to M
8. Cyclin D1 promotes passage of cells through the G1
2. An EWS-FLI-1 mutation was detected in a solid to S checkpoint. What test detects translocation of
tumor by RT-PCR. Which of the following does this this gene to chromosome 14?
result support? c. t(11;14) translocation analysis (BCL1/IGH)
b. Ewings sarcoma
9. Why is the Southern blot procedure superior to the
3. Mutation detection, even by sequencing, is not den- PCR procedure for detecting clonality in some cases?
itive with a negative result. Why? b. The PCR procedure cannot detect certain
Mutations may exist outside the sequenced area. gene rearrangements that are detectable by
Southern blot.
4. A PCR test for the bcl-2 translocation is per-
formed on a patient with suspected follicular lym- 10. Interpret the following results from a translocation
phoma. The results show a bright band at about 300 assay.
bp for this patient. How would you interpret these Are the samples positive, negative, or indetermi-
results? nate?
If 300 bp is within the expected size limits for Sample 1: Negative
translocation breakpoints, the patient is positive Sample 2: Indeterminate, did not amplify
for the t(14;18) or bcl-2 translocation. Sample 3: Positive
5. Which of the following misinterpretations would

CHAPTER 15
result from PCR contamination?
a. False positive for the t(15;17) translocation Interpretation for Case Study 15-1:
This patient most likely has celiac disease. Although
6. After amplication of the t(12;21) breakpoint by RT- the presence of these alleles cannot always be diagnostic
PCR, the PCR products along with the proper molec- of the disease, their absence excludes celiac disease as a
ular weight standard were loaded and resolved on an likely diagnosis. The heterozygous DQB1 locus is asso-
agarose gel. What might be the explanation for each ciated with less severe symptoms than if the *0201 allele

is homozygous. A more comprehensive test list would 3. Upon microscopic examination, over 90% of cells
include detection of total IgA antibodies, autoantibodies, are translucent after a CDC assay. How are these
reticulin and transglutaminase, and gliadin IgG and IgA results scored according to the ASHI rules?
antibodies. The SBT test was useful in this case because 90%100% viability (unstained cells) is scored
the serological results were not clear. as 1 or negative.
Donor 3 was selected as compatible, with two mis- 4. An HLA-A allele is a CTC to CTT (leu leu)
matches, one at HLA-A and one at HLA-B. These mis- change at the DNA level. How is this allele written?
matches are in the graft-versus-host direction; that is, the b. HLA-A*0201
graft would recognize the host as foreign more effec-
tively than the host immune system will recognize the 5. A candidate for kidney transplant has a PRA of 75%.
graft. After the transplant, the patient remained in a state How will this affect eligibility for immediate trans-
of split chimerism for a year. At that time, 71% of mono- plant?
cytes, 62% of granulocytes, and 99% of lymphocytes Because this patient has antibodies likely to
were donor-derived. Throughout this time, the tumor react to 75% of the population, eligibility will be
gene rearrangement was not detectable by PCR, and the negatively affected.
patient remained in remission more than a year post
6. An SSOP probe recognizes HLA-DRB*0301-0304.
transplant.
Another probe recognizes HLA-DRB*0301/0304,
and a third probe hybridizes to HLA-DRB*0301-
The alleles detected by SSP-PCR are identied using a
0303. Test specimen DNA hybridizes to all except
worksheet that converts the lane numbers to allele speci-
the third probe in a reverse dot blot format. What is
city. Using this worksheet, primers in lanes 7 and 19
the HLA-DRB type of the specimen?
amplify the A*2419, and those in lane 22 amplify the
The HLA type is HLA-DRB*0304
A*3401 allele. The donor organ is a good match for this
recipient. Mother and daughter are expected to match at 7. What is the relationship between alleles HLA-A10
least half of the HLA alleles. The presence of serum anti- and HLA-A26(10)?
gens was determined to predict the risk of rejection. HLA-A10 is the parent allele of HLA-A26(10)
Although antihuman antibodies were detected using ow
cytometry and bead array technology, crossmatching 8. A CDC assay yields an 8 score for sera with the
results indicated that the antibodies were a consequence following specicities: A2, A28 and A2, A28, B7,
of the lupus and were not directed at the donor antigens. and a 1 score for serum with an A2 specicity. What
Even though the patient has lupus, the risk of rejection is is the HLA-A type?
low as established by the antigen and antibody studies. The HLA-A type is A28
Following the transplant, the recipient will have to take
immunosuppressive medication. Follow-up serum anti- 9. HLA-DRB1*1501 differs from DRB1*0101 by a G
body tests may be performed to monitor the state of the to C base change. If the sequence surrounding the
transplant. base change is: GGGTGCGGTTGCTGGAAA
GAT (DRB1*0101) or GGGTGCGGTTCCTG
1. Which of the following is a high-resolution HLA GAAAGAT (DRB1*1501), which of the follow-
typing result? ing would be the 3 end of a sequence-specic primer
c. A*0212 for detection of DRB1*1501?
d. ATCTTTCCAGG
2. Which of the following is a likely haplotype from
parents with A25,Cw10,B27/A23,Cw5,B27 and A17, 10. The results of an SSP-PCR reaction are the follow-
Cw4,B10/A9,Cw7,B12 haplotypes? ing: lane 1, one band; lane 2, two bands, lane 3 no
a. A25,Cw10, B27 bands. If the test includes an amplication control

multiplexed with the allele-specic primers, what is 5. The temperature of a refrigerator set at 8C (2C)
the interpretation for each lane? reads 14C.
The test specimen does not contain the allele rec- Recheck the temperature after a few hours. If it
ognized by the primers in lane 1. Only the does not return to range, notify the supervisor.
amplication control is visible.
The test specimen contains the allele recognized
6. A PCR test for the BCR/ABL translocation was neg-
by the primers in lane 2. Both the amplication
ative for the patient sample and for the sensitivity
control and the allele-specic product are visible.
control.
The PCR reaction did not work for the reaction
Repeat the PCR with the addition of a new sen-
run in lane 3.
sitivity control.
CHAPTER 16
7. A fragile X test result has been properly reviewed
What actions should be taken in the following situations? and reported.
File the test results, documents, and associated
1. An unlabeled collection tube with a requisition autoradiographs together in the laboratory
for a factor V Leiden test is received in the labo- archives.
ratory.
Notify the supervisor and reject the specimen.
8. A bottle of reagent alcohol with a 3 in the red dia-
2. After PCR, the amplication control has failed to mond on its label is to be stored.
yield a product. Place the alcohol bottle in a safety storage
Check the original DNA or RNA preparation. cabinet for ammable liquids.
If it is adequate, repeat the amplication. If not,
reisolate the nucleic acid. 9. The expiration date on a reagent has passed.
Discard the reagent. If it can be used for
3. An isolated DNA sample is to be stored for at least research or other nonclinical purposes, label
6 months. and store it in a separate area away from patient
Store at -70C in a tightly sealed tube. testing reagents.
4. A bone marrow specimen arrives at the end of a shift
and will not be processed for the Bcl2 translocation 10. Test results are to be faxed to the ordering physician.
until the next day. Fax the results with a cover sheet containing the
Place the specimen in the refrigerator. proper disclaimer.
18Buckingham (F)-Index 2/14/07 1:10 PM Page 441
Index
Numbers followed by b represent boxes, numbers followed by f represent gures, and numbers followed by t represent tables.
A Alkaline lysis secondary, 5253, 53b, 54f

A site in solid-phase DNA isolation, 70b tertiary, 5354
ribosomal, 5859, 60f Alkaline phosphatase synthesis of, 49
ABO blood group in hybridization technologies, 110, transfer RNA in charging of, 57
in human identication, 229230 110f111f, 112t Amino terminal
Absorptivity constants Alleles in amino acid structure, 51
in spectrophotometry, 76 dened, 228 Aminoacyl transfer RNA synthetases
AccuProbe Allele-specic oligomer hybridization in amino acid charging, 57, 58f
in chlamydial detection, 277 in gene mutation detection, 179f, 179180 Amplicons
in fungi detection, 299300 Allelic discrimination with uorogenic in polymerase chain reaction, 122, 126f
in mycobacterial detection, 272 probes in dideoxy DNA sequencing, 208b
in Neisseria gonorrhoeae detection, 277 in gene mutation detection, 185186, 187f Amplicor MTD test
ACGT sequencing Allelic exclusion in mycobacterial detection, 272
in DNA structure, 24, 7, 7f dened, 348 Amplicor reverse transcriptase-polymerase
Acrocentric chromosomes Allelic frequencies chain reaction
morphology of, 159, 159f in paternity testing, 238240, 239b240b, in HIV viral load detection, 296, 296t
Acrylamide 239f, 239t240t Amplication
in polyacrylamide structure, 84, 84b, 84f Allelic ladders nucleic acid, 121149. See also specic
Acute lymphoblastic leukemia dened, 232 techniques
translocation in, 358f361f, 358361, 361b Alloantibodies probe, 144f147f, 144147
Acyclovir in transplant screening, 386 signal, 147f149f, 147149
as modied nucleoside, 6, 6f Allogenic bone marrow transplantation target, 122144. See also Polymerase
Adaptors dened, 245 chain reaction
in restriction enzyme function, 14b Alpha helices transcription-based, 142144, 143f
Additives in amino acid structure, 5253, 54f in polymerase chain reaction, 122123
in electrophoresis buffer systems, 88, 88f Alpha phosphate artifacts in, 237b
Adenine in RNA synthesis, 29 Amplication controls
as DNA nitrogen base, 23, 3f Alpha satellite in polymerase chain reaction, 132
Adenosine monophosphate in chromosomal function, 159, 159f in quality assurance procedures, 267,
dened, 3 Altered processivity 412
Adenosine triphosphate in clinical polymerase applications, 12 Amplied fragment length polymorphism
dened, 3 Alternate splicing assay
Adler Northern blot in analysis of, 101 in molecular epidemiology, 287, 288f289f
on DNA polymerization, 9b Alternative RNA splicing Analyte-specic reagents
Affinity maturation, 350b overview of, 33 quality assurance in, 418
Affymetrix Alu elements Ancestral haplotype
in microarray technology, 115, 115f in short interspersed nucleotide sequences, in single nucleotide polymorphisms, 253
Agarose gel 226 Anderson sequence
in electrophoresis, 75, 76f, 8184 -Amanitin of mitochondrial genome, 254
DNA resolution with, 82, 82f in RNA polymerases, 37b Aneuploidy
gel concentrations in, 82, 82t Ambiguity dened, 157, 334
polyacrylamide gel versus, 85 in HLA nomenclature, 383 detection in karyotyping of, 161162,
pulsed eld, 8284, 83b, 83f Amelogenin locus 162f163f
technique for, 8889, 89b in gender identication, 234235, 235f incidence of, 311
physical properties of, 81, 81f American Society for Histocompatibility and Angelmans syndrome, 325326
laboratory modications of, 82b Immunogenetics Ankylosing spondylitis
in polymerase chain reaction, 131, 131f cytotoxicity guidelines of, 386t HLA association in, 395
Alanine Amino acids Annealing
structure of, 50f classication of, 49, 49t, 51t in polymerase chain reaction, 123124,
transfer RNA of, 35f in gene mutation nomenclature, 194 125f126f
Alcohol structure of, 49, 50f52f Antibiotics
in DNA isolation, 68, 68b quaternary, 54 peptide, 52b
441

442 Index
Antibody diversity Autologous bone marrow transplantation Band compression

gene rearrangement and, 350b dened, 245 in DNA sequencing, 212b
Anticodon Automated cell sorters Banding patterns
of transfer RNA, 35, 35f in T-cell separation, 249b clonality detected by, 355
in protein synthesis, 58b Automated uorescent DNA sequencing Base excision sequence scanning
Anti-human antibodies approaches to, 210212, 211f in gene mutation detection, 190191,
in transplant screening, 386 dyes used in, 210, 210b, 210f 191f
Antimicrobial agents, 280284 electrophoresis and interpretation of, 212b, Base pairing
classication of, 280, 280t 212213, 213f215 chromosome size and, 156t
overview of, 280b overview of, 210 in DNA alternatives, 4b
resistance to, 280282, 281t282t, 282f sequencing ladder preparation in, 212 in DNA structure, 4, 4b
molecular detection of, 282284, 283b software applications in, 213, 215t216t Basic Local Alignment Search Tool
sites of action of, 280, 281f Automatic pipettors in Human Genome Project, 220
Antiparallel orientation maintenance of, 414415 Basic zipper
of nucleotide sequences, 7, 7f Autophagy in amino acid structure, 53b
Antiretroviral agents dened, 315 B-cell leukemia and lymphoma
as modied nucleosides, 6, 6f Autosomal-dominant mutation transmission, translocation in, 356f358f, 356358
viral load and, 295296 313, 313b, 314f BCR gene
Antisense strand Autosomal-recessive mutation transmission, in leukemia, 358f359f, 358361, 361b
in RNA polymerization, 2829, 29f 313, 314f Bead arrays
Antiviral agents Avery in gene mutation detection, 184185, 186f
as modied nucleosides, 6, 6f on transformation, 21, 22f in transplant screening, 386, 387f
Apoptosis Avian myelocytomatosis viral oncogene Beer-Lambert law
in chromosomal structure, 158, 159f homolog, 343, 363 in spectrophotometry, 76
dened, 158, 333 Azidothymidine Benign polymorphisms
oncogenes and, 333 as modied nucleoside, 6, 6f clinical uses of, 311
tumor suppressor genes and, 334 Benzer
Arbitrarily primed polymerase chain reaction B genetic mutations studied by, 54
in molecular epidemiology, 286287, B cells Bessman
287f clonality detection in, 353 on DNA polymerization, 9b
Arg operon gene rearrangement in, 347349, 348b Beta-pleated sheets
function of, 40, 41f Bacteria. See also specic bacteria in amino acid structure, 5253, 54f
Arginine drug-resistant. See Drug resistant bacteria Bidirectional dideoxy DNA ngerprinting
structure of, 50f recombination in, 1822 in gene mutation detection, 188
Array-based hybridization conjugation and, 19f20f, 1920, 20b Bilateral symmetry
dot/slot blot techniques in, 112113, 113f transformation and, 2122, 22b, 22f of restriction enzymes, 13
in gene mutation detection, 183185, 184f restriction modication in, 5b Binding sites
genomic array technology in, 113117 simultaneous transcription and translation DNA dened, 7b
macroarrays in, 113114 in, 61 Bins and binning
microarrays in, 114b, 114f116f, Bacterial targets, 268280 in genotyping, 237, 237b
114117 molecular detection of, 269270, 270f Bioinformatics
limitations of, 116117 respiratory tract pathogens as, 270276, DNA sequencing terminology in, 218t
Artifacts 271t mixed base nomenclature in, 219, 219t
in polymerase chain reaction, 237b sequence selection in, 268269, 269f overview of, 218
Asexual reproduction tests approved for, 269t Biotin labeling
recombination in, 1822, 19f22f, 20b, 22b urogenital tract pathogens as, 276280, in hybridization techniques, 106, 109110,
Aspergillus 277t 110f
DNA metabolizing enzyme from, 15 Bacteriocins Bisulte DNA sequencing, 216218, 218f
Asparagine colicinogenic factors and, 23 BK virus
structure of, 50f Bacteriophages detection of, 295t
Aspartic acid in transduction, 21, 21f Bleach
structure of, 50f Balanced polymorphism in polymerase chain reaction, 132
Ataxia telangiectasia mutated gene, 342 sickle cell anemia as, 156 Blot techniques
Attenuation Balanced translocations in hybridization. See also specic tech-
in transcription regulation, 40 detection in karyotyping of, 162163, 164f niques
Autoimmune diseases Baltimore array-based, 112113, 113f
MHC associations in, 394395 in Human Genome Project, 219 Northern, 101102, 102b

Index 443
Southern, 96101 c-abl gene polymerase, 122144. See also Polymerase

Western, 102, 102b in leukemia, 358f359f, 358361, 361b chain reaction
Blunt ends Caenorhabditis elegans Chanchroid, 279
in restriction enzyme function, 1314, RNA in, 34b, 35, 44 Chaperones
14b Calibrations molecular
Bone marrow transplantation verication of, 416417 in protein synthesis, 60, 61f
DNA polymorphisms in testing for, Cambridge Reference Sequence RNA, 38b
245f248f, 245249, 246b249b of mitochondrial genome, 254 Chargaff
DNA typing in monitoring of, 246249 Cameras DNA observations of, 8b
lack of pre-engraftment information in, maintenance of, 415, 416f Chase
248b Cancer. See also Molecular oncology; specic on transformation, 22
types of, 245 types of cancer Chelex
Bordetella pertussis classication of, 333 in DNA isolation, 71
detection of, 271t, 272274 molecular basis of, 333334, 334f Chemical cleavage of mismatches
Botstein Capillary electrophoresis, 8586, 86f in gene mutation detection, 192193
in Human Genome Project, 219 Capillary transfer Chemical safety, 418f420f, 418419, 419t
Bover in Southern blot, 100, 100b, 100f Chemical sequencing
on transplant rejection, 377 Capping DNA, 204f205f, 204205, 205b, 205t
Bovine serum albumin in messenger RNA processing, 32, 32b Chemiluminescent detection systems
in polymerase chain reaction, 130 Carbon in hybridization technologies, 110, 111f,
BOX elements as DNA component, 2 112t
dened, 288 Carboxy terminal Chimera
Branched DNA amplication, 147f, 147148 in amino acid structure, 51 dened, 246
in hepatitis C virus detection, 298 Carcinomas Chimerism
in HIV detection, 296, 296t as epithelial tumors, 333 full, 246
BRCA1 gene CCND1 gene mixed, 246, 249
detection of, 342 in lymphoma and leukemia, 362 mosaicism versus, 246b, 311
mapping of, 229b Celera split, 247b
mutations in, 175, 179, 342 in Human Genome Project, 220f, 220221 Chip
BRCA2 gene Cell division cycle in microarrays, 114115, 115f
detection of, 342 oncogenes and, 333 Chlamydia trachomatis
mutations in, 175, 179, 342 schematic of, 334f detection of, 276278, 277t
Break-apart probes tumor suppressor genes and, 333334 high-volume, 264
in FISH chromosome analysis, 167, 167f Cell lysis strand displacement amplication in,
Breast cancer in nucleic acid extraction, 66 145
gene mutations in, 175, 179, 229b, 335f, Cellulose transcription-based amplication in, 144
335336, 342 in hybridization techniques, 99, 99b Chlamydophila pneumoniae
Brenner Centers for Disease and Prevention detection of, 271t, 274
paternity index formula of, 240b standard precautions recommended by, Chelating resin
Bromophenol blue 265b, 406 in DNA isolation, 71
in electrophoresis, 90, 91t Centrifugation Chloroform
5-Bromouridine in DNA isolation, 68 in nucleic acid isolation, 68, 73
as modied nucleoside, 6 Centrifuges Chromatin
Brown maintenance of, 414, 415f in transcription regulation, 42
arrayer described by, 114b Centromeres Chromogenic detection systems
Buffers in chromosomal structure, 157, 159, 159f, in hybridization technologies, 110b,
in electrophoresis, 8688, 87b, 88f 160t 110111, 112t
in hybridization techniques, 108 staining of, 160, 160f Chromogenic in situ hybridization
in polymerase chain reaction, 129130 Centromeric probes in breast cancer, 336
Burkitts lymphoma in FISH chromosome analysis, 167, Chromosomal mutations, 161170
translocation in, 363, 363b, 363f 169f abbreviations used in, 165t
bZip Cephalosporins dened, 156
in amino acid structure, 53b history of, 280b detection of
CFTR gene uorescence in site hybridization in,
C mutations in, 175 166f170f, 166169
C banding Chain reaction karyotyping in, 161163, 162f165f,
in chromosome visualization, 160, 160f ligase, 144, 144f 165, 165t

444 Index
Chromosomal mutations (Continued) Coccidioides Conjugation

diseases associated with, 364t, 365 as laboratory hazard, 264 in DNA recombination, 19f20f, 1920,
leukemia and lymphoma as, 364t CODIS loci, 235b 20b
gene mutations versus, 156157 Codons Consensus primer
overview and examples of, 312, 313t in genetic code, 56, 56f in immunoglobulin heavy chain gene
in solid tumors, 339t, 339341, 340f Colicinogenic factors rearrangement, 353
structure-altering, 163, 165, 165f bacteriocin resistance of, 23 Conservative gene mutations, 174, 174t
Chromosomal painting College of American Pathologists Constant gradient gel electrophoresis,
in uorescence in situ hybridization, 168, specimen storage recommendations of, 407, 178179
168f 408t Constitutive transcription
Chromosomal translocations. See Collins of messenger RNA, 31
Translocations in Human Genome Project, 220 Contact precautions
Chromosome spread Combinatorial control for specimen handling, 265b, 406
in karyotyping, 162 in eukaryotic genes, 42b Contamination control
Chromosomes, 155170 Combined sibling index, 241 in polymerase chain reaction, 131133,
analysis of, 159161, 160f161f, 161b Combs 133b
classication by size and centromeres of, in electrophoresis, 8990, 90f in quality assurance, 267
160t Comparative genome hybridization, 116, Continuous allele system
in Human Genome Project, 221, 221t 116f restriction fragment length polymorphism
mutations of, 156, 161170. See also in chromosome analysis, 169, 169f170f as, 230
Chromosomal mutations Complementarity determining regions Contour-clamped homogeneous electric eld
overview of, 156t, 156157 in immunoglobulin heavy chain gene electrophoresis, 83, 83f
size of human, 156t rearrangement, 352 Controls
structure of, 155159, 157b159b, Complementary DNA in quality assurance procedures, 266268,
158f159f, 160t of messenger RNA 412
interspecies differences in, 22 reverse transcription in, 31b Corepressor
morphologic types in, 159, 159b, 159f, in reverse transcriptase polymerase chain in transcription regulation, 40
160t reaction, 135 Corey and Pauling
Chronic myelogenous leukemia Complementary nucleotides protein structure described by, 52, 54f
translocation in, 358f361f, 358361, 361b in DNA structure, 4, 7, 7f Coronavirus
Cirrhosis Complement-dependent cytotoxicity detection of, 294t
from hepatitis C, 298 in HLA testing, 385f, 385387, 386t, CpG islands
Cis factors 387f DNA, 43, 43f
in RNA synthesis, 39f, 3940 Complete penetrance Crick
Citrate dextrose dened, 314 on DNA double helix, 23, 4b, 8b
in specimen collection tubes, 405, 406t Computational biology as genetic code breaker, 5556
Class-switch recombination, 348b bioinformatics as, 218 Cross-hybridization
Cleavage Concatamers in hybridization technologies, 109b
in gene mutation detection, 189193, dened, 16 Crossing over
190f193f Condensin complex recombination and, 18, 18f
Cleavage-based amplication, 148149 in chromosomal function, 158b Crossmatching
Cleavase Conditioning HLA typing, 385, 385f, 387, 387b, 387f
in Invader assay, 191, 193f in bone marrow transplantation, 245 Cross-reactive epitope groups
Clinical Laboratory Improvement Condentiality in HLA typing, 386
Amendments of molecular test results, 421, 423 Cruciform structure
quality assurance and, 404 Conformation-sensitive gel electrophoresis of transfer RNA, 35, 35f
Clonality detection in gene mutation detection, 183 Crude lysis
in gene rearrangements, 356f363f, Conformer in DNA isolation, 71, 71f
356365, 361b363b, 364t in single-strand conformation polymor- Culture
c-myc gene phism, 175176, 177f in chlamydial detection, 276277
in Burkitts lymphoma, 363 Congenital central hypoventilation syndrome of Neisseria gonorrhoeae, 276277
coa typing Hirschsprungs disease, 324, 343 Cut-off values
in molecular epidemiology, 289 Congenital diseases in quality assurance procedures, 413
Cobas Amplicor inherited diseases versus, 311 Cyanine dye
in chlamydial detection, 277 Conjugated proteins in comparative genome hybridization,
in Neisseria gonorrhoeae detection, 278 dened, 54 169

Index 445
Cycle sequencing genomic, 178 Dideoxynucleotide

in dideoxy DNA sequencing, 210 single-strand conformation polymorphism in dideoxy DNA sequencing, 206210,
Cycles versus, 178b 207f208f
in polymerase chain reaction, 123, 125t temporal temperature gradient versus, Dideoxynucleotides
Cycling probe amplication, 149, 149f 178179 in polymerase chain reaction, 123b
Cysteine Denaturing high-performance liquid chro- Digital cameras
structure of, 50f matography maintenance of, 415, 416f
Cystic brosis in gene mutation detection, 183 Digoxygenin labeling
gene mutations in, 175, 318319 Dengue virus in hybridization techniques, 106, 109110,
Cytochrome P-450 RNA polymerases in, 37 110f
variants of, 319 Deoxyadenosine monophosphate Dihydrouridine
Cytomegalovirus structure of, 5f in transfer RNA, 35
detection of, 293t Deoxycytidine monophosphate Dimer
Cytosine structure of, 5f dened, 54
as DNA nitrogen base, 23, 3f Deoxyguanosine monophosphate Dipeptides
Cytosine arabinoside structure of, 4f5f dened, 49
as modied nucleoside, 6 Deoxyinosine triphosphate Diploid organisms
Cytosine methyltransferases in dideoxy DNA sequencing, 208b humans as, 156157
in DNA metabolism, 16b Deoxynucleoside Discriminatory capacity
Cytotoxicity structure of, 6f in Y-short tandem repeat matching,
complement-dependent Deoxynucleotide 242243
in HLA testing, 385f, 385387, 386t, in dideoxy DNA sequencing, 206210, Discriminatory power
387f 207f208f in genotype test evaluation, 290
Deoxyribonuclease I Dispersive DNA replication
D in DNA metabolism, 15 historical highlights of, 8b
D loop Deoxyribonucleic acid. See DNA Dissociation constant
in transfer RNA structure, 35, 35f Deoxyribonucleotide bases in acid-base buffer equilibrium, 8687
DAPI staining in polymerase chain reaction, 128b, Dithiothreitol
in chromosome visualization, 161 128129 in polymerase chain reaction, 130
DEAD-box helicases Deoxyribose Dmnt1
RNA, 38b in DNA structure, 23, 4f in DNA methylation, 16b
Deaeration Deoxythymidine monophosphate DNA, 124
in polyacrylamide gel electrophoresis, 85 structure of, 5f ACGT sequences in, 24, 7, 7f
Deaza guanosine triphosphate Deoxyuridine triphosphate-uracil-N- A-form, 4b
in dideoxy DNA sequencing, 208b glycosylate analysis of
in polymerase chain reaction, 128b, 129 in polymerase chain reaction, 132133 electrophoresis in, 7576, 76f,
Deletion Depurination 8192. See also Electrophoresis
chromosomal in Southern blot, 9798, 98f uorometry in, 7778
FISH in detection of, 166, 166f Derivative chromosomes probes in, 103, 105107, 106f
karyotyping in detection of, 163, 165f karyotyping in detection of, 165, 165f restriction enzyme mapping in,
DeLici DExDH-box helicases 95f96f, 9596
in Human Genome Project, 219 RNA, 38b Southern blot in, 96101, 97t, 98f,
Denaturation Dideoxy DNA ngerprinting. See also 99b100b, 100f101f
in FISH chromosome analysis, 168 Dideoxy DNA sequencing spectrophotometry in, 77
in Northern blot, 101, 101b in gene mutation detection, 186188, 187f B-form, 4b
in polymerase chain reaction, 123, Dideoxy DNA sequencing, 205210 in chromosomal structure, 157b158b,
125f126f cycle sequencing in, 210 157158, 158f159f
in Southern blot, 98 dideoxynucleotide and deoxynucleotide in, dened, 2
Denaturing agents 206210, 207f208f discovery of
action on DNA of, 7b internal labeling in, 206 history of, 2b, 23, 8b
in electrophoresis buffer systems, 88 M13 bacteriophage in, 205206, 206b, 206f hydrated versus dehydrated forms,
Denaturing gradient gel electrophoresis manganese in, 208b 4b
constant gradient gel electrophoresis ver- PCR products in, 208b isolation of, 6672
sus, 178179 sequencing ladder in, 209, 209f alcohol use in, 68b
in gene mutation detection, 177179, 178b, Dideoxynucleoside choice of procedure in, 66b
178f structure of, 6f crude lysis in, 71, 71f

446 Index
DNA (Continued) DNA sequencing, 203222 Dulbecco

inorganic methods in, 6869, 69f automated uorescent, 210b, 210f211f, in Human Genome Project, 219
mitochondrial, 7172, 72b 210213, 212b, 213f215f, 215t Duplications
organic methods in, 6768, 68f bioinformatics and, 218t219t, 218219 gene mutation nomenclature for, 194
precipitation in, 69b bisulte, 216218, 218f Dye blobs
sample preparation in, 6667, 67t dened, 204 in automated uorescent DNA sequencing,
solid-phase, 6970, 70b, 70f direct, 204214 213
storage materials in, 69b chemical, 204f205f, 204205, 205b, Dye primer method
metabolism of 205t in automated uorescent DNA sequencing,
enzymes in, 12b16b, 1216, 13f dideoxy, 205210, 206b, 206f209f, 210211, 211f
methylation of, 16b, 43f, 4344 208b Dye terminator method
mitochondrial indirect versus, 204 in automated uorescent DNA sequencing,
isolation of, 7172, 72b Maxam-Gilbert, 204f205f, 204205, 210, 211f, 212
plasmids of, 2224, 23b24b, 23f 205b, 205t in gene mutation detection, 188, 188f
recombination in Sanger, 205210, 206b, 206f209f, 208b
in asexual reproduction, 1822, 19f22f, Human Genome Project and, 219222, E
20b, 22b 220f, 220t221t E site
in sexual reproduction, 17b, 1718, overview of, 204 ribosomal, 59
18f19f in p53 detection, 341, 341t EDTA
replication of, 6f, 612, 8b12b, 9f12f, pyrosequencing in, 214, 216, 216b, 217f in DNA isolation, 6768, 69b
10t. See also DNA replication DNA template. See also DNA sequencing in electrophoresis, 87
in RNA polymerization, 2829, 29f creation of radioactive, 204b in specimen collection tubes, 405, 406f,
sequencing in, 24, 7, 7b. See also DNA dened, 204 406t
sequencing in polymerase chain reaction, 122, 128 Electroendosmosis
specimen storage requirements for, 407, DNA viruses in electrophoresis, 82b
408t409t, 409, 409f genomes of, 292t Electropherograms
storage function of, 2, 28 DNA-based tissue typing, 376396. See also in automated uorescent DNA sequencing,
structure of, 13, 3f, 4b, 67, 7b specic techniques 212213, 213f215f
synthesis of DNA/RNA hybrid capture assays, 148, 148f in Y-short tandem repeat testing,
antiparallel orientation in, 7, 7f DNase 242f
Z-form, 4b in RNA isolation, 73 Electrophoresis, 8092
DNA IQ system Documentation of test results agarose gels in, 81f83f, 8184, 82b83b,
in solid-phase DNA isolation, 70 quality assurance in, 420421, 422f, 423 82t
DNA ligase Donor loci alternating eld, 83f, 8384
in DNA metabolism, 14 in bone marrow transplantation, 246, 246f in automated uorescent DNA sequencing,
DNA polymerase Dot blot techniques 212213, 213f215f
in polymerase chain reaction, 129 allele-specic oligomer hybridization as, buffer systems in, 8688, 87b, 88f
DNA polymorphisms. See also Mutations; 179, 179f bufferless systems in, 90b91b
Polymorphisms Dot/slot blot techniques capillary, 8586, 86f
in engraftment testing, 245f248f, in array-based hybridization, 112113, 113f conformation-sensitive gel, 183
245249, 246b249b Double helix constant gradient gel, 178179
human identication and, 225256. See as DNA structure, 23, 3f, 4b, 68, 7b8b contour-clamped homogeneous electric
also specic techniques Double-strand DNA break eld, 83, 83f
mitochondrial, 253256, 254f, 255b helicase function and, 16 denaturing gradient gel, 177179, 178b,
DNA replication, 612 Downs syndrome 178f
in dideoxy DNA sequencing, 207, 207f aneuploidy in, 157 detection systems in, 9192
dispersive, 8b Drug resistance equipment in, 8890, 89b90b, 89f90f
historical highlights in, 8b antiretroviral, 297298, 298b maintenance of, 415, 415f
polymerases in, 812, 9b12b, 10f12f, 10t gene mutations in eld inversion gel, 83, 83b, 83f
replication fork in, 8, 9f antibiotics and, 281282, 282f, 282t gel loading in, 9091, 91b, 91t
semiconservative, 7 antiretroviral agents and, 297298, 298b in HLA testing, 388
DNA resequencing, 222 plasmids in, 2223 in molecular epidemiology, 285f, 285286,
DNA sequences in tuberculosis, 283 286t
association with gene mutations of, Drug-resistant bacteria, 280282, 281t282t, in nucleic acid analysis, 75f76f, 7576
174175 282f nucleic acid-specic dyes and additives in,
chromosomal arrangement and, 156 detection of, 282284, 283b 88, 9192
DNA structure and, 24, 7, 7b cycling probe method in, 149 overview of, 81, 81b, 81f

Index 447
polyacrylamide gels in, 83t, 84b, 84f, Epitopes Factor V Leiden mutation
8485 dened, 102 detection of, 316317, 317f
in polymerase chain reaction, 131, 134, Epstein-Barr virus cleavage-based methods in, 148,
134f association with Burkitts lymphoma of, 189190, 190f
pulsed eld, 8284, 83b, 83f 363b False-positive and false-negative test results
in short tandem repeat genotyping, 232, detection of, 293t prevention of, 267
233f, 237 rst complete genome sequencing in, 219, FAM dye
silver stain in, 92 220t in allelic discrimination, 186, 187f
in single-strand conformation polymor- ErbB growth factor receptor family Family studies
phism, 175, 177f structure of, 336f linkage analysis in, 250f251f, 250251
in Southern blot, 100, 101f Escherichia coli Y-short tandem repeats in, 241245, 242f,
temporal temperature gradient gel, 178179 DNA metabolizing enzymes from, 1415 243b, 243t244t
tracking dyes in, 90, 91t in DNA polymerization, 9b, 10, 10t Federal Bureau of Investigation
in Western blot, 102 M13 bacteriophage and, 205, 206f CODIS of, 235b, 236b
Encephalopathy in polymerase chain reaction discovery, Fertility factor
prion-induced, 54 122, 129 in bacterial conjugation, 1920, 20f
End-labeling protein synthesis in, 61 Feulgen staining
of DNA probes, 106 recombination in, 20b in chromosome visualization, 160
Endonucleases ribosomes in, 57 Ficoll
in DNA metabolism, 12b, 1213 Ethanol in DNA isolation, 66
in restriction enzyme mapping, 84 in DNA isolation, 68, 68b Fidelity
Endpoint analysis Ethidium bromide in polymerase biotechnology, 12, 129
in quantitative polymerase chain reaction, in electrophoresis, 75, 76f, 91 Field inversion gel electrophoresis, 83, 83b,
137 in quantitative polymerase chain reaction, 83f
Engraftment testing 138, 139b, 139f Fields
DNA polymorphisms in, 245f248f, Ethnicity on proteome, 114b
245249, 246b249b genotype matching and, 235, 235t, 238 FISH. See Fluorescence in situ hybridization
Enhanceosome Ethylenediaminetetraacetic acid. See EDTA Fixed bins
in transcription regulation, 42 Euchromatin in genotyping, 237b
Enhancers in transcription regulation, 43b Flammable agents
in gene expression, 42 Eukaryotes storage of, 418, 418f
Enterobacterial repetitive intergenic consensus ribosomes in, 58 Flemming
sequences, 287288, 289f290f transcription regulation in, 4042, 41f, 42b Walther
Enteroviruses Euploidy writings on nucleus of, 2
detection of, 295t dened, 157 Floating bins
Enzyme adaptation European Molecular Laboratory databases in genotyping, 237b
dened, 39b of mitochondrial DNA, 254 FlowMetrix bead array system
Enzyme immunoassay Ewings sarcoma in gene mutation detection, 184185
for human immunodeciency virus, 295 translocations in, 339t, 339340, 340f Fluorescence
in Treponema pallidum detection, 278 Exons in quantitative polymerase chain reaction,
Enzyme mapping in messenger RNA splicing, 3233, 33f 137141, 138b139b, 138f142f
restriction, 95f96f, 9596 Exonucleases Fluorescence in situ hybridization
Enzymes. See also Polymerases; specic in DNA metabolism, 1415 in breast cancer, 336
enzymes DNA polymerases as, 1011, 11f in chromosomal mutation detection,
in DNA metabolism, 12b16b, 1216, 13f Expression arrays 166f170f, 166169
Epidemic in microarray technology, 116, 116f Fluorescent labeling
dened, 284 Extended haplotype in electrophoresis, 7576
Epidemiology, 284291 components of, 243b in microarray technology, 115
overview of, 284 Extraction methods Fluorescent polarization-template-directed
typing methods in, 284t, 284291, 285f, nucleic acid, 6678. See also specic meth- dye terminator incorporation, 188, 188f
286t, 287f290f, 290t291t ods dideoxynucleotides in, 123b
Epidermal growth factor receptor Eye protection Fluorescent resonance energy transfer
in solid tumors, 336f337f, 336337 for specimen handling, 406 in cleavage-based amplication, 148
Epigenetic alterations in high resolution melt curve analysis,
types of, 311 F 180181, 181f
Epigenetic regulation F factor in quantitative polymerase chain reaction,
of transcription, 42f43f, 4244, 43b in conjugation, 20f, 2021 140141, 142f

448 Index
Fluorescent spectroscopy constant gradient, 178179 Genes

in nucleic acid isolation, 7778 denaturing gradient, 177179, 178b, 178f dened, 54
Fluorometry in HLA testing, 388 expression of. See Gene expression
in nucleic acid analysis, 7778 loading in, 9091, 91b, 91t mutations of, 173195. See also Gene
FMR protein, 324b in microsatellite instability, 345, 346f mutations
Forensic testing polyacrylamide, 83t, 84b, 84f, 8485 number of human, 221
capillary electrophoresis in, 86 pulsed eld, 83, 83b, 83f overview of, 5457
CODIS loci in, 235b, 236b temporal temperature gradient, 178179 recombinant DNA technology and, 18
mitochondrial DNA polymorphisms in, 254 Gel mobility shift assay structural and regulatory sequences of,
restriction fragment length polymorphism in solution hybridization, 117118, 118f 5455, 55f
in, 230, 230b, 231f GenBank tumor suppressor, 333334
validation in, 412 mitochondrial DNA data in, 254 Genetic code
Y-short tandem repeats in, 241 Gender identication biotechnological implications of, 5657
Formaldehyde short tandem repeats in, 234235, 235f breaking of, 5556
in Northern blot, 101, 102b Gene expression dened, 55
Formamide dened, 28 historical highlights of, 55b
in hybridization techniques, 108 importance of, 29 natural versus computer-generated, 57b
Fragile X syndrome, 322b, 322f323f, microarray analysis of, 116, 116f schematic of, 56f
322323 RNA transcription regulation and, 3844, Genetic concordance
Huntingtons disease versus, 324 39b, 39f43f, 42b43b dened, 236
Fragment analysis Gene mutations, 173195 Genetic counseling
in bone marrow transplantation, 247248 in cancer, 334335 in Huntingtons disease, 324
Frameshift gene mutations, 174, 174b, 174t chromosomal mutations versus, 156157 limitations of, 326
nomenclature for, 194 detection of, 174194. See also specic Genetic mapping
Framework regions techniques with restriction fragment length polymor-
in immunoglobulin heavy chain gene cleavage methods in, 189193, phisms, 228229, 229b
rearrangement, 352353 190f193f Genetic proling
Franklin combined methods in, 193 with restriction fragment length polymor-
DNA studies by, 3 hybridization-based methods in, phisms, 230, 230b
Freezers 175185, 177f184f, 178b, 180b Genomes
maintenance of, 413414, 414f overview of, 174175, 176t, 193 characteristics of human, 156
Full sibling test, 241 sequencing-based methods in, mitochondrial, 253254, 254f
Fume hoods 185f189f, 185189 mutations of
maintenance of, 416 in drug resistance clinical examples of, 312t
Fungi antibiotic, 281282, 282f, 282t dened, 157
detection and identication of, 299300 antiretroviral, 297298, 298b nomenclature for, 194
Fusion gene early studies of, 54 proteome production by, 51
in translocation, 358 nomenclature of, 194195 viral, 292t
overview of, 174 Genomic array technology
G in solid tumors, 335f339f, 335346, macroarrays in, 113114
G1 and G2 checkpoints 338t339f, 339b, 341t, 343b, microarrays in, 114b, 114f116f, 114117
in cell division cycle, 334, 334f 344f346f, 344t Genomic denaturing gradient gel elec-
G banding types of, 174, 174t trophoresis, 178
in chromosome visualization, 160f161f, Gene rearrangements Genomic imprinting, 325326
160161, 161b detection of clonality in, 350355, examples of, 320b
Gain of function mutations, 313 351b352b, 351f355f, 351t Genomics
oncogene, 334 overview of, 347, 347f dened, 114b
Gamow translocations in malignancy as, 356f363f, Genotype
as RNA Tie Club founder, 55b 356365, 361b363b, 364t dened, 156
GC clamps V(D)J recombination as, 347350, 348b, Genotyping, 225256. See also specic tech-
in denaturing gradient gel electrophoresis, 348f351f, 350b niques
177 Gene Recognition and Assembly Internet of hepatitis C virus, 298299
Gel electrophoresis, 8185 Link of human immunodeciency virus,
agarose, 75, 76f, 81f83f, 8184, 82b83b, in Human Genome Project, 220 297298, 298b
82t Gene sequencing rationale for, 156
conformation-sensitive, 183 test result documentation in, 421 GenProbe

Index 449
in chlamydial detection, 278 Hairpin structures Herceptin

in mycobacterial detection, 272 in micro RNA, 35 in breast cancer, 335
in Neisseria gonorrhoeae detection, 278 Half sibling test, 241 Hereditary nonpolyposis colorectal cancer
Germline Haploid complement gene mutations in, 343, 345346
immunoglobulin heavy chain, 347 dened, 157 HER2/neu
Giemsa stain Haploid gene set in breast cancer, 335f, 335336
in chromosome visualization, 160 in human inheritance, 156 Herpes simplex virus
Gilbert Haplotype detection of, 293t
in Human Genome Project, 219 dened, 241, 380, 380f Hershey
Gloves extended, 243b on transformation, 22
for specimen handling, 406407, 407f minimal, 243b Heteresis
Glutamic acid Haplotype diversity recombination and, 18
structure of, 50f in Y-short tandem repeat matching, 242 Heterochromatin
Glutamine HapMap Project, 222, 252253, 253f in chromosomal structure, 158
structure of, 50f Hapten chromosome visualization and, 161b
Glycine dened, 104 in transcription regulation, 43b
structure of, 50f Hardy Weinberg equilibrium Heteroduplex analysis
Glycoproteins overview of, 238b in gene mutation detection, 183, 183f
as conjugated proteins, 54 Harvey rat sarcoma viral oncogene homolog, in HLA testing, 392
Gonadal mosaicism, 319, 320f 337 Heteroduplex analysis with single-strand spe-
Gonorrhea, 276 Hayes cic nucleases
Gorer on recombination, 19 in gene mutation detection, 190, 190f
genetic studies of, 377 Heavy strand Heterologous controls
G-proteins of mitochondrial genome, 253254, 254f in quality assurance, 267
ras genes related to, 338 Helicases Heteronuclear RNA
Graft failure in DNA metabolism, 1516, 16b splicing of, 32
DNA evidence of, 246, 247f in DNA replication, 9b Heterophage
Graft-versus-host disease RNA, 38, 38b dened, 315
in bone marrow transplantation, 245 Hemachromatosis, 317318, 318f Heteroplasmy
HLA antigens in, 377 Hematological malignancies. See also in mitochondrial DNA polymorphisms, 255
Graft-versus-tumor effect Leukemia; Lymphoma Heterozygosity
in bone marrow transplantation, 245 classication of, 333 dened, 228
Gram staining gene rearrangements in, 346365 Hierarchical shotgun sequencing
of Neisseria gonorrhoeae, 276 Hematopoietic stem cells in Human Genome Project, 220f, 220221
Griffith in bone marrow transplantation, 245 High density oligonucleotide arrays
on transformation, 2122, 22f Hemoglobin in gene mutation detection, 183184
Grooves as conjugated protein, 54 in microarray technology, 115
in DNA structure, 7b Henderson-Hasselbach equation High performance liquid chromatography
Guanine acid-base status predicted by, 87 capillary electrophoresis versus, 85
as DNA nitrogen base, 23, 3f ionization status predicted by, 87b denaturing, 183
Guanosine monophosphate Heparin High resolution banding
structure of, 4f5f in specimen collection tubes, 405, 406t staining of, 160
Guanosine triphosphatase Hepatitis B virus High resolution melt curve analysis
ras activity of, 338b detection of, 293t in gene mutation detection, 180
Guanosine triphosphatase activating proteins, NA amplication in, 148 Highly active antiretroviral therapy
338 Hepatitis C virus in HIV infection, 295
Guanosine triphosphate detection of, 264, 294t, 298299 Hirschsprungs disease, 324, 343
in messenger RNA splicing, 32b NA amplication in, 148 Histidine
Guanylyl transferase transcription-based amplication in, 143 structure of, 50f
in messenger RNA capping, 32b Western blot in, 102b synthetic pathway of, 49
Gyrases genotyping of, 298299 Histones
in DNA metabolism, 16, 16b RNA polymerases in, 37 in chromosomal structure, 157, 157b, 158f
Hepatocellular carcinoma historical highlights on, 157b
H from hepatitis C, 298 in transcription
Haemophilus ducreyi HercepTest DNA release and, 28b
detection of, 277t, 279 in breast cancer, 335336 modication and, 42, 43b

450 Index
Histoplasma Human leukocyte antigens Illumina bead array technology

as laboratory hazard, 264 clinical applications of, 226 in gene mutation detection, 185
HIV. See Human immunodeciency virus combined test results in, 392393, 393t Immunoglobulin heavy chain
HLA. See Human leukocyte antigens DNA-based typing of, 388392, 389f392f gene rearrangements in, 347348, 348f,
Hodgkins disease in human identication, 230 351f353f, 351353
non-Hodgkins lymphoma versus, 333 hybrid vigor and Immunoglobulin light chain
Hoechst dye olfactory sensation in, 395 gene rearrangements in, 348349, 349f,
in uorometry, 7778 polymorphisms of, 379384 353354, 354f
Hogness and White nomenclature in, 380384, 381t382t, Immunohistochemistry
R loop mapping of, 31b 383b in breast cancer, 335336
Holley overview of, 379f380f, 379380 in p53 detection, 341, 341t
yeast transfer RNA discovered by, 36b serologic testing of, 384388, 385f, 386t, Imprinting
Holocentric chromosomes, 159b 387b, 387f DNA
Holoenzyme test discrepancies in, 393 methylation as source of, 16b
in DNA replication, 9 in transplantation, 377 genomic, 320b, 325326
in RNA polymerase, 36f, 37 Human papillomavirus In vitro synthesized protein
Homogeneous MassExtend detection of, 293t in gene mutation detection, 188189, 189f
dened, 123b hybrid capture assays in, 148 In vitro transcription/translation
in gene mutation detection, 188, 188f Huntingtin gene in gene mutation detection, 188189, 189f
Homologous extrinsic controls in Huntingtons disease, 323324, 324b, Inducible transcription
in quality assurance, 267 324f RNA, 31
Homozygosity Huntingtons disease, 323324, 324f Induction
dened, 228 Hybrid capture assays, 148, 148f in gene expression, 39b, 40f
Hood Hybridization technologies Inuenza viruses
in Human Genome Project, 219 allele-specic oligomer, 179f, 179180 detection of, 294t
Hormones comparative genome, 116, 116f, 169, Informative loci
peptide, 52b 169f170f in bone marrow transplantation, 246, 246f,
Horseradish peroxidase detection systems in, 109b110b, 248, 248f, 250f
in hybridization technologies, 110, 112t 109f111f, 109111, 112t Inheritance
Hot-start polymerase chain reaction, 133134 uorescence in situ, 166f170f, 166169 gene as unit of, 54
Housekeeping genes interpretation of results in, 111112, probability in, 156
as internal controls, 412 112f Inherited diseases
Human epidermal growth factor receptor 2 Northern blot in, 97t, 101102, 102b congenital diseases versus, 311
in breast cancer, 335336 probes in, 104109. See also Probes molecular basis of, 311
Human Genome Organization quality assurance procedures in, 417418 molecular detection of, 310326. See also
history and goals of, 235 solution hybridization as, 117f118f, specic diseases
Human Genome Project, 219222 117118 limitations of, 326
diagnostic signicance of, 221222 Southern blot in, 96101, 97t, 98f, Initiation
history of, 219221, 220f, 220t221t 99b100b, 100f101f transcription, 39
laboratory effects of, 222 Western blot in, 97t, 102, 102b, 107b Initiation complex
Human Haplotype Mapping Project Hybridomas ribosomal, 58
goal of, 222, 253 dened, 105 Inorganic isolation methods
overview of, 252253, 253f Hydrochloric acid DNA, 6869, 69f
Human identication in Southern blot, 98f, 99b Insertions
DNA polymorphisms and, 225256. See Hydrogen bonding gene mutation nomenclature for, 194
also specic techniques in DNA structure, 3f, 4 Instrument maintenance
RLFP in, 229230, 230b231b, as molecular diagnostics basis, 4 calibration verication in, 416417
230f231f Hydrolysis laboratory personnel in, 413, 413f
Human immunodeciency virus in nucleotide-nucleoside conversion, 3 quality assurance in, 413f416f, 413417
antiretroviral therapy and, 295296 Hypervariable regions of specic instruments, 413416,
detection of, 264, 293t of mitochondrial genome, 254, 254f 414f416f
NA amplication in, 148 Insulin
transcription-based amplication in, I amino acid sequence of, 52b
143144 Iatrogenic infections Intercalating agents
of viral load, 295297, 296t dened, 284 dened, 7b
Western blot in, 102b Idiopathic congenital central hypoventilation Interference
genotyping of, 297298, 298b syndrome, 324, 325f RNA, 34, 34b, 44

Index 451
Internal controls Jeffreys Leading strand

in quality assurance procedures, 267, DNA ngerprinting developed by, 230, in DNA replication, 8, 9f
412 230b, 236b Leder
Internal labeling as genetic code breaker, 5556
in dideoxy DNA sequencing, 206 K Lederberg
Internal size standards Kappa deleting element on recombination, 19, 20b
dened, 232 in immunoglobulin light chain, 348349, Legionella pneumophila
Internal transcribed spacer elements 349f detection of, 271t, 274
in molecular epidemiology, 288 Karyotype Legionnaires disease, 274
International Genome Database dened, 161 Lehman
purpose of, 235b normal, 162, 162f on DNA polymerization, 9b
International Society for Forensic Genetics Karyotyping Length heteroplasmy
short tandem repeat nomenclature of, in chromosomal mutation detection, in mitochondrial DNA polymorphisms, 255
232234, 234t 161163, 162f165f, 165, 165t Leucine
International Union of Biochemistry and dened, 161 structure of, 50f
Molecular Biology Khorana Leucine zipper
mixed base nomenclature of, 219, 219t as genetic code breaker, 5556 in amino acid structure, 53b
Interphase chromosomes on terminal transferase, 15b Leukemia
structure of, 158 Killer cell immunoglobulin-like receptors, acute lymphoblastic
Interphase uorescence in situ hybridization 394, 394f, 395t translocation in, 358f361f, 358361,
in chromosomal mutations, 166f167f, Kinetochore 361b
166168 in chromosomal function, 159, 159f B-cell
Interspersed repetitive elements King translocation in, 356f358f, 356358
in molecular epidemiology, 287288, BRCA1 gene mapped by, 229b chromosomal mutations in, 264t
289f290f Kinship index, 241 chronic myelogenous
Introns Kinship testing translocation in, 358f361f, 358361,
dened, 32 Y-short tandem repeats in, 241245, 242f, 361b
in messenger RNA splicing, 32b33b, 243b, 243t244t dened, 333
3233, 33f Kirsten rat sarcoma viral oncogene homolog, myelocytic
Invader assay 337339, 338b, 338f339f, 338t translocation in, 361362, 362b, 362f
in gene mutation detection, 191, 193f Klenow fragment Li-Fraumeni syndrome
Inversion in DNA polymerization, 10 molecular diagnosis of, 341342
karyotyping in detection of chromosomal, Kohler and Milstein Ligase
163, 165, 165f hybridomas described by, 105 DNA, 11, 14
nomenclature for nucleotide, 94 Kornberg and Kornberg RNA, 14b
Inversion probe assay on DNA polymerization, 9b Ligase chain reaction, 144, 144f
in gene mutation detection, 181183, K-ras Light strand
182f cellular membrane interactions of, 339b of mitochondrial genome, 253254, 254f
Ionization mutations in cancer of, 337339, 338b, Likelihood ratio
of amino acids, 49, 51f 338f339f, 338t in genotyping, 238
in electrophoresis buffer systems, 87, 87b Limiting mobility
Isochromosomes L in electrophoresis, 82
karyotyping in detection of, 165, 165f Labeling Lineage studies
Isoelectric focusing gel of hybridization probes, 105106, mitochondrial DNA polymorphisms in, 256
in Western blot, 102 106f Linear range
Isoleucine Laboratory procedures manual in quality assurance procedures, 413
structure of, 50f annual review of, 412 Linkage analysis
Isopropanol Lac operon short tandem repeats in, 249251,
in DNA isolation, 68, 68b structure and function of, 3940, 40f41f 250f251f
Isothermal amplication -Lactamase Linkage disequilibrium
strand displacement as, 144145, 145f in antibiotic resistance, 281, 283 dened, 253
Lagging strand Linkage equilibrium
J in DNA replication, 8, 9f product rule and, 238
Jacob Lambda repressor Linker region
Monod and structure of, 53b in chromosomal structure, 158
on operon expression, 39, 39b Lariat structure Lipoproteins
on transduction, 2021 in RNA splicing, 32, 33f as conjugated proteins, 54

452 Index
Locked nucleic acids Major histocompatibility complex Metaphase chromosomes

probes for, 103104, 105f analysis of, 384393 structure of, 157, 157b, 158f
Locus combined results in, 392393, 393t Metaphase uorescence in situ hybridization
dened, 228 DNA-based, 388392, 389f392f in chromosomal mutations, 168f170f,
Locus genotype HLA test discrepancies in, 393 168169
short tandem repeat, 232, 232f, 236 serologic, 384388, 385f, 386t, 387b, Metapneumovirus
Long interspersed nucleotide sequences 387f detection of, 294t
dened, 226 test method coordination in, 393 Metastasis
Loss of function mutations, 313 antigen fragments in, 379b dened, 333
tumor suppressor gene, 334 disease association with, 394395, 395b Methicillin resistance
Loss of heterozygosity genes of, 377b, 377378, 378t cycling probe method in detection of, 149
in cancer, 346 history of, 377 Methicillin-resistant Staphylococcus aureus,
Luminescence locus of, 377379, 378f 28b, 283
in pyrosequencing, 214, 217f overview of, 377 Methionine
Lymphoma structure of, 379f structure of, 50f
B-cell summary of laboratory testing in, 395, 396t Methylation
translocation in, 356f358f, 356358 Mal operon DNA
Burkitts function of, 40, 41f in gene expression regulation, 43f, 4344
translocation in, 363, 363b, 363f Manganese imprinting from, 16b, 43
chromosomal mutations in, 264t in dideoxy DNA sequencing, 208b Methylmercuric hydroxide
dened, 333 Mantle cell lymphoma in electrophoresis buffer systems, 88
mantle cell translocation in, 362f, 362363 Methyltransferases
translocation in, 362f, 362363 Markers in DNA metabolism, 16, 16b
non-Hodgkins, 333 polymorphisms as, 228 MHC. See Major histocompatibility complex
Lynch syndrome Master mix Micro RNA
gene mutations in, 343 in polymerase chain reaction preparations, solution hybridization in analysis of, 117
Lyon hypothesis, 311b 130 structure and function of, 3536
Lysine Maternal inheritance Microarrays
structure of, 50f mitochondrial genome and, 254 dened, 114
Lysis Maxam-Gilbert chemical sequencing in genomic array technology, 114b,
crude, 71, 71f DNA, 204f205f, 204205, 205b, 205t 114f116f, 114117
in DNA isolation, 71, 71f McCarty limitations of, 116117
in nucleic acid extraction, 66 on transformation, 21, 22f Microbiology
proteolytic, 71 Measles virus molecular detection of microorganisms in,
in RNA isolation, 73, 73f detection of, 294t 264. See also Microorganisms; spe-
Lysosomal storage diseases, 315316, 316t Mendelian genetics cic organisms
Lysosome overview of, 17b, 1718 Micrococcal nuclease
structure of, 315f Melt curve analysis in DNA metabolism, 15
in bacteria detection, 269, 270f Microdeletion
M in gene mutation detection, 180b, karyotyping in detecting chromosomal, 163
M13 bacteriophage 180f181f, 180181 Microelectronic arrays
in dideoxy DNA sequencing, 205206, Melting temperature in gene mutation detection, 184
206b, 206f in hybridization techniques, 107f, 107108 in microarray technology, 115, 115f
MacLeod Membranes -2Microglobulin
on transformation, 21, 22f in Southern blot, 99, 99b human leukocyte antigens and, 378, 379f
Macroarrays Meselson and Stahl Microorganisms
dened, 113 on DNA replication, 8b, 66 detection and identication of, 263300.
in genomic array technology, 113114 Messenger RNA See also specic microorganisms
Magnesium in gene expression, 28 antimicrobial agents in, 280b, 280t281t,
in polymerase chain reaction, 129130 isolation of, 7475, 75f 280284
Major breakpoint region overview of, 3031 bacterial targets in, 268f, 268280, 269t
translocation in, 356 processing of, 31f, 3133, 32b33b, 33f fungi in, 299300
Major groove Metacentric chromosomes molecular epidemiology in, 284t,
in DNA structure, 7b morphology of, 159, 159f 284291, 285f
Major histocompatibility antigens Metalloproteins overview of, 264
nonconventional, 393394 as conjugated proteins, 54 parasites in, 300

Index 453
quality control in, 266268 Mixed leukocyte culture Multiple endocrine neoplasia syndromes, 343
sample preparation in, 266 in HLA testing, 388 Multiple locus probe-restriction fragment
specimen collection in, 264266, 265b, Molecular beacons length polymorphism system, 230
265t in quantitative polymerase chain reaction, Multiplex assays
viruses in, 291299, 292t296t, 298b 140, 140f141f for bacterial pneumonia, 275
in DNA isolation, 6667 Molecular biology Multiplex inversion probe
Microsatellites denitions and applications of, 2 in gene mutation detection, 182183
instability of Molecular chaperones Multiplex polymerase chain reaction,
in cancer, 343346, 344f346f, 344t in protein synthesis, 60, 61f 134135
short tandem repeats as, 231 Molecular epidemiology, 284291 allele-specic
Microvariant alleles dened, 284 in gene mutation detection, 185, 186f
short tandem repeats and, 231, 236, 236f typing in, 284t, 284289, 285f, 286t, for urogenital pathogens, 280
Miescher 287f290f, 290t Mumps virus
DNA discovered by, 2, 2b, 66 comparison of methods in, 289291, detection of, 294t
Milstein and Kohler 291t Mung bean nuclease
hybridomas described by, 105 Molecular inversion probe in DNA metabolism, 15
Minimal haplotype in gene mutation detection, 181183, 182f Mutations. See also Polymorphisms; specic
components of, 243b Molecular laboratory mutations
Minisatellites quality assurance and quality control in, chromosomal, 156, 161170. See also
dened, 230 403423. See also Quality assurance Chromosomal mutations
Minitransplant procedures Molecular oncology, 332365. See also spe- dened, 156
bone marrow, 245 cic mutations and types of cancer DNA polymerase function and, 1011
Minor cluster region analysis targets in, 334346 gain of function, 313
translocation in, 356 loss of heterozygosity as, 346 gene, 173195. See also Gene mutations
Minor groove microsatellite instability as, 343346, genome, 157
in DNA structure, 7b 344f346f, 344t clinical examples of, 312t
Minor histocompatibility antigens, 393 mutations in solid tumors as, 335f340f, loss of function, 313
Mismatch repair 335343, 341t mitochondrial, 319321, 320f321f, 321t
dened, 343 overview of, 334335 nuclear gene, 321, 322t
Mismatch repair system in leukemia and lymphoma, 346365. See oncogene, 334
genes of, 343344, 344f, 344t also Leukemia; Lymphoma range of, 311
Mismatches Monoclonal antibodies silent, 174, 174t, 383
in DNA structure, 4 epidermal growth factor receptor inhibited in solid tumors, 335f340f, 335343, 341t
Mispriming by, 337 Mycobacterium tuberculosis
in polymerase chain reaction, 127, 127f polyclonal antibodies versus, 105 detection of, 264, 271t, 271272, 286
prevention in, 133134 Monoclonality strand displacement amplication in,
Mitochondria characteristics of, 350 145
transfer RNA in, 35b Monod and Jacob transcription-based amplication in,
Mitochondrial DNA on operon expression, 39 143144
isolation of, 7172, 72b Monomer multidrug-resistant, 283
polymorphisms of, 253256, 254f, 255b dened, 54 Mycoplasma genitalium
in forensics, 254 Monosomy detection of, 277t, 279280
in human identication, 255 dened, 311 Mycoplasma hominis
in lineage studies, 256 MOPS buffer detection of, 277t, 279280
nomenclature of, 255b in RNA electrophoresis, 88 Mycoplasma pneumoniae
in public databases, 254 Mosaicism detection of, 271t, 274275
Mitochondrial genes chimerism versus, 246b, 311 Myeloablative bone marrow transplantation,
mutations in, 319321, 320f321f, 321t gonadal, 319, 320f 245
Mitochondrial genome overview and examples of, 311312, 312t Myelocytic leukemia
structure of, 253254, 254f MRSA translocation in, 361362, 362b, 362f
Mitogen history and updated meaning of, 283, 283b
in karyotyping, 162 Mullis N
Mitogen stimulation polymerase chain reaction conceived by, National DNA Database
in carcinogenesis, 337, 337f 122, 123b124b overview of, 236b
Mixed chimerism Multilocus sequence typing National Fire Protection Association
in bone marrow transplantation, 246, 249 in molecular epidemiology, 289 hazard labels designed by, 418, 418f

454 Index
National Institutes of Health Nosocomial infections Office of Human Genome Research

in Human Genome Project, 220f, 220221 dened, 284 in Human Genome Project, 220
National Marrow Donor Program Nuclear gene mutations Okazaki fragments
on HLA nomenclature, 383b disorders caused by, 321, 322t in DNA replication, 8, 9f
Negative template control Nuclear Regulatory Commission Oligoclone
in polymerase chain reaction, 132 laboratory regulations of, 418419 monoclonal tumor cell population versus,
in quality assurance, 267 Nuclease Bal31 351b
Neisseria gonorrhoeae in DNA metabolism, 14 Oligodeoxynucleotides
detection of, 264, 276278, 277t Nucleic acid sequence-based amplication, in polymerase chain reaction, 124,
Neoplasms 142144 124f
classication of, 333 in HIV viral load detection, 296, 296t OliGreen
dened, 333 Nucleic acids. See also DNA; RNA in uorometry, 78
Nested polymerase chain reaction, 136f, amplication of, 121149. See also specic Olimer
136137 techniques dened, 54
Neuroblastoma ras, 337 analysis and characterization of, 94118. Oncogenes
Nick See also specic techniques in cell cycle, 333
dened, 11 dened, 6 mutations in, 334
Nick translation electrophoresis of, 8092 Oncology
in DNA polymerization, 11, 12b extraction methods of, 78. See also specic dened, 333
in DNA probe labeling, 106 techniques molecular, 332365. See also Molecular
Nirenberg measurement of, 7578 oncology; specic mutations and types
as genetic code breaker, 5556 electrophoresis in, 75f76f, 7576 of cancer
Nitrocellulose uorometry in, 7778 Open reading frame
in Southern blot, 99, 99b spectrophotometry in, 7677, 77b dened, 32
Nitrogen potential clinical applications of, 2 Operator
as DNA component, 2, 2b replication of, 6, 6f in gene expression, 39, 40f
Nitrogen bases resolution and detection of, 8092. See also Operon
in DNA structure, 25, 3f5f, 4b specic techniques dened, 39
modied, 4b5b, 46, 6f specimen storage requirements for, 407, Organic isolation methods
purine, 3 408t409t, 409, 409f DNA, 6768, 68b, 68f
pyrimidine, 3 Nuclein RNA, 73, 73f
n-myc gene, 343, 343b as Mieschers term for DNA, 2, 2b Orthophosphate
Nonconservative gene mutations, 174, 174t Nucleosides in DNA replication, 8
Non-Hodgkins lymphoma conversion from nucleotides to, 3 Overhangs
classication of, 333b dened, 3 in restriction enzyme function, 13,
Hodgkins disease versus, 333 in DNA structure, 3, 4f, 6, 6f 13f
Noninformative loci modied Oxford sequence
in bone marrow transplantation, 246, 246f clinical applications of, 6, 6f of mitochondrial genome, 254
Nonisotopic RNase cleavage assay Nucleosomes Oxygen
in gene mutation detection, 191, 192f in chromosomal structure, 157158, 158f as DNA component, 2
Nonmyeloablative bone marrow transplanta- in transcription regulation, 42, 42f
tion, 245 Nucleolus
Nonprotein prosthetic group RNA synthesis in, 28 P
in conjugated proteins, 54 Nucleotides P site
Nonsense codons complementary, 4 ribosomal, 5859, 60f
in genetic code, 56 conversion to nucleosides of, 3 Paired box-Forkhead
in protein synthesis, 61 dened, 2 in rhabdomyosarcoma, 340341
Nonsense gene mutations, 174, 174t in DNA structure, 26, 4b5b, 4f5f Palindromic
Nonsense-mediated decay monophosphate dened, 13
in translation, 61 carbon position numbering in, 4, 5f Panel reactive antibodies
NOR staining Null allele in transplant screening, 386
in chromosome visualization, 161 in HLA nomenclature, 383 Parainuenza viruses
Northern blot detection of, 294t
interpretation of results in, 112, 112f O Parasites
in RNA analysis, 97t, 101102, 102b Occupational Safety and Health detection and identication of, 300
Norwalk virus Administration Parentage testing
detection of, 294t radiation exposure regulated by, 419 capillary electrophoresis in, 86

Index 455
restriction fragment length polymorphisms Photographic equipment Polycistronic

in, 22, 229f maintenance of, 415, 416f dened, 30
short tandem repeats in, 238240, Photolithography Polyclonal antibodies
239b240b, 239f, 239t in microarray technology, 115, 115f dened, 105
Parvovirus B19 PHOX2b gene in Western blot, 104105
detection of, 293t in idiopathic congenital central hypoventi- Polyclonality
Paternal lineage testing lation syndrome, 324, 325f characteristics of, 350
Y-short tandem repeats in, 241, 244245 pI value Polymerase chain reaction, 122142
Paternity dened, 49 in allele-specic oligomer hybridization,
probability equation for, 240 PicoGreen 179180
Paternity index in uorometry, 78 amplication refractory mutation system,
formulas for, 240, 240b Piperidine 185
Paternity testing in DNA sequencing, 204205 in antibiotic resistance detection, 283
genetic concordance and, 236 pK value artifacts in, 237b
restriction fragment length polymorphisms dened, 49 in bone marrow graft transplantation,
in, 229, 229f Plasma cell neoplasms 245249, 247f
short tandem repeats in, 238240, in cancer classication, 333 in Bordetella detection, 273274
239b240b, 239f, 239t, 244 Plasma preparation tubes clonality detected by, 352b, 352355,
Pauling and Corey in specimen collection, 406 353f355f
protein structure described by, 52, 54f Plasmid ngerprinting, 285 components of, 124t, 125132
PCR. See Polymerase chain reaction Plasmids buffers as, 129130
Pedigree analysis of controls as 131132
dened, 312, 313f in molecular epidemiology, 285 deoxyribonucleotide bases as, 128b,
Penetrance classication of, 23 128129
dened, 314 dened, 22 DNA template as, 128
Penicillin in electrophoresis, 75, 75f primers as, 126128, 127b, 127f128f
resistance to, 281, 283 restriction enzyme mapping of, 96, 96f thermal cyclers as, 130131, 131f
Peptide bonds structure and function of, 2224, 23b24b, contamination control in, 132133, 133b
of amino acids, 49, 52f 23f cycles in, 123, 125t
Peptide nucleic acids PML/RARA fusion gene in dideoxy DNA sequencing, 208b
probes for, 103104, 104f in leukemia, 361, 362b in DNA pyrosequencing, 216b
Peptides Pneumonia in Haemophilus ducreyi detection, 279
biological activity of, 52b chlamydial, 274 history of, 122, 123b124b
Peptidyl transferase mycoplasmal, 274 hot-start, 133134
in protein synthesis, 5859 streptococcal, 275 in Legionella detection, 274
Personal protective equipment Point heteroplasmy in melt curve analysis, 180, 180b, 180f
for specimen handling, 406407, 407f in mitochondrial DNA polymorphisms, mispriming prevention in, 133134
pH 255 in mitochondrial DNA polymorphisms, 255
amino acid ionization and, 49, 51f Point mutations modications of, 134142
pH drift consequences of, 174 arbitrarily primed PCR as, 141142,
in electrophoresis buffer systems, 88 dened, 174 142f
Phenol PolyA RNA multiplex PCR as, 134135
in nucleic acid isolation, 68, 73 isolation of, 7475, 75f nested PCR as, 136f, 136137
as spectrophotometry contaminant, 76 Polyacrylamide gel quantitative PCR as, 137b139b,
Phenotype in DNA sequencing, 204205, 205b, 205f, 137141, 138f142f
dened, 156 209, 209f real-time PCR as, 137b139b, 137141,
Phenylalanine in electrophoresis 138f142f
structure of, 50f DNA resolution with, 84, 84f reverse transcriptase PCR as, 135136
Philadelphia chromosome technique for, 8485, 89f90f, 8990 in molecular epidemiology, 286287,
in leukemia, 358 in single-strand conformation polymor- 287f
Phosphodiester bond phism, 175 in Mycoplasma detection, 274275
in DNA replication, 8 structure of, 84, 84f in mycoplasmal detection, 279
in DNA structure, 2 in Western blot, 102 in parasite detection, 300
Phosphorus Polyadenylate polymerase procedure for, 122125, 124f126
as DNA component, 2, 2b in messenger RNA processing, 31 product cleanup in, 134135ff
radioactive labeling with Polyadenylation quality assurance procedures in, 417, 417f
in hybridization, 105 in messenger RNA processing, 31, 32b sequence-specic, 185, 185f

456 Index
Polymerase chain reaction (Continued) Positive controls length in, 108109

in short tandem repeats, 231241, 232b, in quality assurance, 266 other nucleic acid types, 104, 104b,
232f233f, 234t235t, 235b236b Post-transcriptional processing 104f105f
in Streptococcus pneumoniae detection, of messenger RNA, 30, 31f protein, 104105, 107b
275276 PowerPlex system RNA, 103104, 104b
tetra primer, 185 in bone marrow transplantation, 247 in Southern blot, 97
in translocations, 356365, 357f358f, Prader-Willi syndrome, 325 quality assurance in, 417418
360f361f Precautions in restriction fragment length polymor-
in Treponema pallidum detection, 279 for specimen handling, 265b, 406407, phism, 230, 231b
two-step, 125 407f Procedure manual
in ureaplasmal detection, 279 Precipitation annual review of, 412
worksheet for, 411f in DNA isolation, 68, 69b Product rule
Polymerase chain reaction-restriction frag- Prehybridization in genotyping, 238
ment length polymorphism, 189190, in Southern blot, 100101 Prociency testing
190f Preribosomal RNA, 30 in quality assurance, 419420
Polymerases Primary resistance mutations in HIV genotyping, 298
DNA in antiretroviral drug resistance, 297 in HIV viral load determinations, 297
in biotechnology, 12 Primary structure Proles
in DNA replication, 812, 9b12b, amino acid, 5152 genetic, 236
10f12f Primase matching of, 237238, 238b
classication by sequence homology in DNA replication, 8, 9b, 10f Prokaryotes
of, 10t Primer dimers ribosomes in, 5758
in polymerase chain reaction, 129 in polymerase chain reaction, 127, 128f transcription regulation in, 40, 41f
nomenclature of, 129b Primers Proline
RNA, 2829, 29f, 36f, 3637, 37b, 37t for bacterial target sequences, 268, 268f structure of, 49, 50f
Polymerization in denaturing gradient gel electrophoresis, Promoter
in DNA replication, 6f, 812 178b dened, 28
RNA, 2829, 29f M13 universal, 206b in gene sequences, 55f
Polymorphisms. See also Mutations in polymerase chain reaction, 126128, Proofreading
balanced, 156, 311 127f128f exonuclease function and, 11
benign, 311 for clonality detection, 352b, 352353, Protein gel electrophoresis
dened, 156 353f in HLA testing, 388
in engraftment testing, 245f248f, commercially available, 127b Protein truncation test
245249, 246b249b extension of, 125, 125f126f in gene mutation detection, 188189,
HLA, 379f380f, 379384, 381t382t, reverse transcriptase, 135 189f
383b quality assurance in, 417f, 417418 Proteins, 4861
mitochondrial DNA, 253256, 254f, Prions amino acids as, 4954. See also Amino
255b proteins denatured by, 54 acids
single nucleotide, 226. See also Single Probability of paternity analysis of, 94118
nucleotide polymorphisms equation for, 240 microarrays in, 113
types of, 226 Probe amplication probes in, 104f105f, 104105, 107b
laboratory methods for, 226, 226t nucleic acid, 144f147f, 144147 Western blot in, 97t, 102, 102b, 107b
Polypeptides cycling, 149, 149t in chromosomal structure
proteins as, 51 Probes histone, 157, 157b, 158f
Polyploidy in allelic discrimination, 185186, 186f nonhistone, 158
dened, 311 for bacterial target sequences, 268, 268f conjugated, 54
Population databases in uorescent resonance energy transfer, brous, 54
of mitochondrial DNA polymorphisms, 181 globular, 54
255256 in high resolution melt curve analysis, overview of, 49
Population genotype matching 180181, 181f sequence of
short tandem repeats in, 235t, 235236 in hybridization DNA sequence and, 52b
Population migration tracking allele-specic oligomer, 179, 179f primary, 52b
mitochondrial DNA polymorphisms in, 256 design of, 106107 Sm, 34
Position effects DNA, 103, 106 solubility of, 54
chromosomal, 157 uorescence in situ, 166f, 166169, 169f structure of, 49, 50f, 5154, 52f, 53b, 54f
dened, 43b labeling of, 105106, 106f translation of, 5761

Index 457
amino acid charging in, 57 collection tubes and, 405406, 406f, 406t Reagent blank
transfer RNA in, 5760, 58b, 58f61f cross-contamination and, 404405 in polymerase chain reaction, 131132
Proteolytic lysis hemolysis and, 405 in quality assurance, 267
in DNA isolation, 71 holding and storage in, 407, 408t409t, Reagents. See also specic reagents
Proteome 409, 409f quality assurance in, 417f420f, 417420,
dened, 51 labeling in, 404, 404f 419t
early description of, 114b preanalytical variables and, 404 REAL classication
Proteomics precautions in, 406407, 407f of non-Hodgkins lymphoma, 333b
dened, 114b short tandem repeats in, 251252, 252f Real-time polymerase chain reaction,
Prothrombin mutations snap freezing in, 405, 405f 137b139b, 137141, 138f142f
PCR-RFLP in detection of, 190, 190f of solid tissues, 405, 405f thermal cycling in, 130
Pseudogenes in test performance, 409413 Rearranged During Transfection (RET) proto-
dened, 226 assessment criteria for, 410, 410t oncogene, 343
Pseudouridine controls in, 412 recBC nuclease
in transfer RNA, 35 documentation in, 410, 412 in DNA metabolism, 15
Psoralens overview of, 409410 Receptor tyrosine kinases
clinical applications of, 133b periodic review of, 365, 412413, 413f in molecular oncology, 335f, 363365
in polymerase chain reaction, 132 validation and, 410, 411f, 412 Recessive diseases
Pulsed eld electrophoresis, 8284, 83b, 83f in test result documentation, 420421, gene mutation nomenclature in, 194
in molecular epidemiology, 285f, 285286, 422f, 423 Recipient loci
286t Quantitative polymerase chain reaction, in bone marrow transplantation, 246, 246f
Purine 137b139b, 137141, 138f142f Reciprocal translocations
dened, 3 in bacteria detection, 269270 detection of
Pyrimidine Quaternary structure karyotyping in, 162163, 164f
dened, 3 amino acid, 54 Recognition sites
Pyrimidine dimer, 11b Quencher DNA dened, 7b
PyroMark KRAS kit, 339 in quantitative polymerase chain reaction, restriction enzyme binding to, 13b, 95
Pyrophosphate 139, 139b, 139f Recombinant DNA technology
in DNA pyrosequencing, 214, 217f Quinacrine dened, 18
Pyrophosphate exchange in chromosome visualization, 160 plasmids in, 2324, 24b
in DNA polymerization, 910 Recombination
Pyrophosphorolysis R in asexual reproduction, 1822, 19f22f,
in DNA polymerization, 910 R banding 20b, 22b
Pyrosequencing in chromosome visualization, 160, 160f dened, 17
DNA, 214, 216, 216b, 217f R factors historical highlights of, 17b, 20b
plasmids as, 23, 23b in sexually reproducing organisms, 17b,
Q R loop mapping 1718, 19f18f
Q banding history of, 31b Recombination activating genes, 348b
in chromosome visualization, 160, 160f, Radionuclides Red blood cells
161b safety and, 418419, 419t, 420f in DNA isolation, 66
Q replicase Ramp Redundant tilting
in probe amplication, 145147, 146f dened, 130 in high-density oligonucleotide arrays, 184
Qiagen BioRobot system Random amplied polymorphic DNA assay Refrigerators
in solid-phase DNA isolation, 70 in molecular epidemiology, 286287, maintenance of, 413414, 414f
Quality assurance, 403423 287f Regulatory transcription
Clinical Laboratory Improvement Random coils RNA, 31
Amendments and, 404 in amino acid structure, 52 Release factors
in instrument maintenance, 413f416f, Random priming in protein synthesis, 61
413417 in DNA probe labeling, 106 Repair endonucleases
calibrations and, 416417 Randomly amplied polymorphic DNA in DNA metabolism, 12b
overview of, 266268 in quantitative polymerase chain reaction, Repair polymerases
in reagents, 417f420f, 417420, 419t 141142, 142f in DNA replication, 11b
chemical safety and, 418f420f, Rapid plasma reagin Repetitive extragenic palindromic sequence,
418419, 419t in Treponema pallidum detection, 278 288, 289f290f
prociency testing in, 419420 Rapid polymerase chain reaction Replication errors
in specimen handling, 404409 thermal cycling in, 130 in microsatellite instability, 344345, 345f

458 Index
Replication fork Restriction map dened, 28

DNA, 8, 9f enzyme, 9596, 96f, 226227 degradation of
Replisome of germline immunoglobulin heavy chain reverse transcriptase polymerase chain
in DNA replication, 9b gene, 351f reaction and, 136
Reporting of test results Restriction modication as DNA precursor, 28b
quality assurance in, 421, 422f, 423 dened, 5b heteronuclear, 32
Repressor RET proto-oncogene, 343 isolation of, 7275
in transcription regulation, 39, 40f Retroviruses extraction of total RNA in, 7274,
Reproducibility reverse transcription in, 28b 73f74f, 74t
in genotype test evaluation, 290 Reverse dot blot of messenger RNA, 7475, 75f
Reptation in genomic array technology, 113 RNases and, 72, 72b
in electrophoresis, 82 Reverse dot blot techniques of total RNA, 72
Resequencing allele-specic oligomer hybridization as, laboratory precautions in handling,
DNA, 222 179180 406407, 407f
in gene sequencing test results, 421 Reverse transcriptase-polymerase chain reac- messenger, 3031. See also Messenger
Resistance factor tion, 135136 RNA
episomal nature of, 23 in Ewings sarcoma, 340, 340f micro, 3536
Resistance transfer factors in HIV viral load detection, 296, overview of, 28
plasmids as, 23, 23b 296t polymerases of
Resolution Reverse transcription eukaryotic, 37, 37b, 37t
in HLA nomenclature, 383 complementary DNA version of messenger prokaryotic, 36f, 3637
Respiratory syncytial virus RNA by, 31b RNA-dependent, 37
detection of, 294t in retroviruses, 28b, 292 in transcription, 2829, 29f
Respiratory tract pathogens. See also specic RFLP. See Restriction fragment length preribosomal, 30
pathogens polymorphisms ribosomal, 30, 30b, 30f
detection and identication of, 270276, Rhabdomyosarcoma isolation of, 72
271t translocations in, 340341 small interfering, 34, 34b
overview of, 270 Ribonucleases small intermediate, 34
Restriction enzymes in RNA metabolism, 37 small modulatory, 36
in DNA metabolism, 12b14b, 1214, 13f used in laboratory procedures, 38t small nuclear, 32b, 34, 34t
endonucleases as, 84 Ribonucleic acid. See RNA small nucleolar, 36
mapping of, 95f96f, 9596, 226228 Ribose small temporal, 36
DNA, 95f96f, 9596, 226228 in RNA structure, 28 specimen storage requirements for, 407,
plasmid, 96, 96f Ribosomal binding site 408t409t, 409
nomenclature and classication of, 13 in protein translation, 58, 60f stabilization of
in Southern blot, 97, 98f Ribosomal RNA specimen collection tubes and, 406
Restriction fragment length polymorphisms isolation of, 72 structure of, 28
in bone marrow graft transplantation, structure and function of, 30, 30b, 30f tiny noncoding, 36
246 Ribosomes transcription in, 2829, 29f
dened, 96 dened, 57 transfer, 3435, 35b36b, 35f
in enzyme mapping, 96, 226227 in protein translation, 5760, 59f60f uracil in, 28, 28f
in gene mutation detection, 189190, 190f, Ring chromosomes RNA chaperones, 38b
226 karyotyping in detection of, 165, 165f RNA induced silencing complex
genetic mapping with, 228229, 229b RNA, 2744 in RNA interference, 44
human identication with, 229230, analysis of RNA integrity control
230b231b, 230f231f electrophoresis in, 7576, 76f, 8192. in translocation detection, 360
inheritance patterns of, 227229, 228f229f See also Electrophoresis RNA interference, 34, 34b, 44
in molecular epidemiology, 286 uorometry in, 78 laboratory uses of, 44b
overview of typing with, 226228, probes in, 103104, 104b, 106 potential clinical uses of, 44
227f228f solution hybridization in, 117, 117f RNA ligase
parentage testing with, 229, 229f spectrophotometry in, 77 functions of, 14b
polymerase chain reaction, 189190, transcription-based amplication in, RNA Tie Club, 55b
190f 143144 RNA viruses
probes in, 230, 231b classication of, 28, 30 genomes of, 292t
Standard Reference Material DNA Proling crystallographic study of synthesis of, transcription-based amplication in detec-
Standard, 228 38b tion of, 143

Index 459
RNase Sensitivity control Shrimp alkaline phosphatase (SAP)

in RNA isolation, 72, 72b in quality assurance, 266267 in polymerase chain reaction, 134
RNase H Sequence complexity Sibling index, 241
in DNA replication, 9b in hybridization techniques, 108, 108b, Sibling testing
RNase protection 108f short tandem repeats in, 240241
in solution hybridization, 117 Sequence-based typing Sickle cell anemia
Robertsonian translocations HLA, 390391, 391f392f amino acid substitution in, 5152
karyotyping in detection of, 163, 164f Sequence-specic oligonucleotide probe as balanced polymorphism, 156
Roche MagnaPure system hybridization Side chains
in solid-phase DNA isolation, 70 in HLA testing, 388390, 389f amino acid, 49, 49t
Rotating gel electrophoresis, 83, 83f Sequence-specic polymerase chain reaction Sigma factor
Rotavirus in gene mutation detection, 185, 185f186f in RNA polymerase, 37
detection of, 294t in HLA testing, 390, 390f391f Signal amplication
Rubella virus Sequencing nucleic acid, 147f149f, 147149
detection of, 294t in DNA structure, 24, 7, 7b Signal-to-noise ratio
Sequencing ladder in hybridization technologies, 111
S in automated uorescent DNA sequencing, Silencers
S1 nuclease 212 in gene expression, 42
in DNA metabolism, 15 in dideoxy DNA sequencing, 209, 209f Silent mutations
Saccharomyces cerevisiae SEQUENOM MassExtend gene, 174, 174t
RNA polymerase in, 37b in gene mutation detection, 188, 188f in HLA nomenclature, 383
Salting out Serine Silica
in DNA isolation, 69, 69f structure of, 50f in capillary electrophoresis, 85
Sample preparation Serologic testing Silver stain
in DNA isolation, 6667, 67t HLA typing as, 384388, 385f, 386t, 387b, in electrophoresis, 92
overview of, 266 387f Single locus probe-restriction fragment
Sanger for Treponema pallidum, 278 length polymorphism system, 230,
insulin amino acid sequence described by, Sex-linked disorders, 313314, 314f 231f
52b Sexual reproduction Single nucleotide polymorphisms
Sanger DNA sequencing, 205210, 206b, recombination in, 17b, 1718, 18f19f classication of, 252, 252t
206f209f, 208b. See also Dideoxy DNA Sharks tooth combs dened, 226
sequencing in electrophoresis, 90, 90f in Human Haplotype Mapping Project,
Sarcomas Short interspersed nucleotide sequences 252253, 253f
tissue of origin of, 333 dened, 226 overview of, 252
Scientic Working Group for DNA Methods Short tandem repeats Single strand conformation polymorphism
mitochondrial DNA database of, 255 in bone marrow graft transplantation, in HLA testing, 392
Scorpion primers 246 Single-gene disorders, 312326
in quantitative polymerase chain reaction, dened, 226 cystic brosis as, 175, 318319
140, 141f in linkage analysis, 249251, 250f251f cytochrome P-450 variants as, 319
Secondary resistance mutations polymerase chain reaction in, 231241 factor V Leiden as, 148, 189190, 190f,
in antiretroviral drug resistance, 297 analysis of test results in, 235t, 235237, 316317, 317f, 317t
Secondary structure 236b genomic imprinting in, 325326
amino acid, 53, 53b, 54f in gender identication, 234235, 235b, hemachromatosis as, 317318, 318f
Sedimentation coefficient 235f inheritance patterns in, 312314, 313b,
of ribosomal RNA, 30 nomenclature in, 232, 234, 234t 313f314f
Selenocysteine, 51b, 57b overview of, 231232, 232b, 232f233f nonclassical, 319321, 320b, 320f321f,
Selenoproteins, 51b, 57b in paternity test, 238240, 239b240b, 321t322t
Self-splicing 239f, 239t lysosomal storage diseases as, 315f,
RNA, 33 prole matching in, 237238, 238b 315316, 316t
Self-sustaining sequence replication, in sibling test, 240241 mitochondrial mutations in, 319321,
142143 subpopulation matching probability of, 320f321f, 321t
Semiconservative DNA replication, 7 235t, 235236 molecular basis of, 314, 315t
Seminested polymerase chain reaction, 136, in surgical specimen quality assurance, multifactorial inheritance in, 326
136f 251252, 252f nuclear gene mutations in, 321, 322t
Sense strand in Y-STR testing, 241245, 242f, 243b, trinucleotide repeat expansion, 322b,
in RNA polymerization, 2829, 29f 243t244t 322325, 323f325f, 324b, 325t

460 Index
Single-strand conformation polymorphism restriction fragment length polymorphisms Storage

in gene mutation detection, 175177, 177f detected by, 226t, 226228, of molecular laboratory specimens, 407,
Single-strand DNA break 228f 408t409t, 409, 409f
helicase function and, 16 in translocations, 356, 357f, 359, 359f STR. See Short tandem repeats
Sinsheimer spa typing Strand displacement amplication, 144145,
in Human Genome Project, 219 in molecular epidemiology, 289 145f146f
Slot blot techniques Specimen collection Streptococcus pneumoniae
in array-based hybridization, 112113, 113f for molecular testing, 264266, 265t, 405f, detection of, 271t, 275276
Sm proteins 405406, 406t Streptococcus pyogenes
in small nuclear RNA, 34 Spectral karyotyping detection of, 264
Small interfering RNA in FISH chromosome analysis, 168 Stringency
solution hybridization in analysis of, 117 Spectrophotometers in hybridization techniques, 107f, 107108
structure and function of, 34, 34b maintenance of, 415416 Stutter
Small intermediate RNA Spectrophotometry in polymerase chain reaction, 237b
structure and function of, 34 in nucleic acid analysis, 7677 Submarine gels
Small modulatory RNA, 36 advances in, 77b in electrophoresis, 88, 89f
Small nuclear RNA Spin columns Substituted nucleotides
isolation from cancer cells of, 34t in polymerase chain reaction, 134, clinical applications of, 6, 6f
in RNA splicing, 32b 135f discovery in nature of, 4b5b
structure and function of, 34 in solid-phase DNA isolation, 69 in DNA structure, 45
Small nucleolar RNA, 36 Spliceosome Substitutions
Small temporal RNA, 36 RNA, 34 in gene mutations, 174
SMC proteins Splicing nomenclature for, 194
in chromosomal function, 158b alternative RNA, 33 Substrate specicity
Smith in messenger RNA processing, 32b33b, in clinical polymerase applications, 12
in Human Genome Project, 219 3233, 33f Sugar-phosphate backbone
Snell of transfer RNA, 33b in DNA structure, 3f, 6
on histocompatibility, 377 Split chimerism, 247b Supercoil
SNP. See Single nucleotide polymorphisms Stacking plasmid structure as, 22, 23f
SNP Consortium in denaturing gradient gel electrophoresis, Suppressor transfer RNA
as data resource, 252 177 dened, 58b
Sodium hypochlorite Stahl and Meselson Surname
in polymerase chain reaction, 132 on DNA replication, 8b, 66 in Y-short tandem repeats, 244
Software applications Staining Susceptibility testing
in automated uorescent DNA sequencing, in chromosome visualization, 159161, in drug resistance, 282
213, 215t216t 160f161f, 161b SyBr green
for genotyping, 232 Standard curve in electrophoresis, 75, 9192
Solid tumors. See also specic tumor types in quality assurance procedures, 412 in uorometry, 78
classication of, 333 Standard precautions in quantitative polymerase chain reaction,
mutations in, 335f340f, 335343, 341t for specimen handling, 265b, 406 138, 139b, 139f, 269
Solid-phase isolation Standard Reference Material DNA Proling Synovial sarcoma translocation, 340
DNA, 6970, 70b, 70f Standard Syphilis, 278
RNA, 73, 74f in restriction fragment length polymor-
Solution hybridization, 117f118f, 117118 phism, 228 T
Somatic hypermutation, 350b Standard tilting T cells
Southern blot, 96101 in high-density oligonucleotide arrays, 184, separation of, 249b
blotting technique in, 99b100b, 99101, 184f Tag single nucleotide polymorphisms, 253
100f101f Staphylococcus aureus Tailed primers
clonality detected by, 351352, 352f, 354, vancomycin-resistant, 282, 282f in polymerase chain reaction, 128f
355f Stem cells Tandem repeats
DNA preparation in, 9798, 98f, 99b in bone marrow transplantation, 245 dened, 226
dot/slot variations on, 112113, 113f Sticky ends in human identication, 230, 230f
interpretation of results in, 111112, 112f in restriction enzyme function, 13f, 1314, TaqMan
in molecular epidemiology, 286 14b in polymerase chain reaction, 139b, 139f,
restriction enzyme cutting and resolution Stoffel fragment 139140, 361
in, 97, 98f in polymerase chain reaction, 129 Target amplication

Index 461
nucleic acid, 122144. See also Polymerase Threshold cycle Transformation

chain reaction in quantitative polymerase chain reaction, in DNA recombination, 2122, 22b, 22f
dened, 122 137, 138b, 138f experimental versus natural DNA, 22b
transcription-based, 142144, 143f Thymine Transforming factor
Tatum as DNA nitrogen base, 23, 3f discovery of DNA, 22, 22f
on recombination, 20b Thymine dimer Translocations
T-cell lineages dened, 11b in cancer
in bone marrow transplantation, 249b Tiny noncoding RNA, 36 hematological, 356f363f, 356365,
T-cell receptor Tissue samples 361b363b, 364t
gene rearrangement in, 349350, 350b, in DNA isolation, 66 overview of, 334335
350f351f, 351t, 354355, 355f Tissue typing dened, 356
Telocentric chromosomes DNA-based, 376396. See also specic FISH in detection of, 166f167f, 166167
morphology of, 159, 159f techniques karyotyping in detection of, 162163, 164,
Telomeres Tissue-specic genes 165f
dened, 22, 167 in molecular oncology, 334 balanced, 162163, 164f
Telomeric probes Topoisomerases reciprocal, 162163, 164f
in FISH chromosome analysis, 167, 167f, in DNA metabolism, 16, 16b robertsonian, 163, 164f
169f t(8;14)(q24;q11) Transmembrane proteins
Template in Burkitts lymphoma, 363, 363f structure of, 49, 51f
in DNA replication, 7 t(9;22)(q34;q11) Transmission
in polymerase chain reaction, 122, 128 in leukemia, 358f361f, 358361, sex-linked, 313314, 314f
Temporal temperature gradient gel elec- 361b Transmission patterns
trophoresis, 178179 t(11;14)(q13;q32) autosomal-dominant, 313, 313b, 314f
Teratocarcinomas in lymphoma and leukemia, 362363 autosomal-recessive, 313, 314f
dened, 333 t(14;18)(q32;q21) dened, 312
Terminal transferase leukemia and lymphoma associated with, Transplantation
discovery of, 15b 356f358f, 356358 bone marrow, 245f248f, 245249,
in DNA polymerization, 11 t(15;17)(q22;q11.2-q12) 246b249b
Tertiary structure in leukemia, 361362, 362b crossmatching in, 387, 387b, 387f
amino acid, 5354 Trans factors DNA-based typing in, 388392,
Test results in RNA synthesis, 39f, 3940 389f392f
quality assurance in documenting, Transcription HLA antigens in, 377
420421, 422f, 423 constitutive, 31 laboratory testing for, 395, 396t
Tetramer inducible, 31 serological HLA analysis, 385f, 385388,
dened, 54 regulatory, 31 386t, 387b, 387f
The Institute for Genomic Research (TIGR) RNA, 2831, 29f Transport systems
in Human Genome Project, 220 regulation of, 3844, 39b, 39f43f, specimen, 265, 265t
Thermal cycler 42b43b Transverse alternating eld electrophoresis,
in dideoxy DNA sequencing, 210 Transcription factors 83f, 8384
Thermal cyclers therapeutic strategies using, 29 Trastuzumab
in allelic discrimination with uorogenic Transcription-based target amplication sys- in breast cancer, 335
probes, 185186 tems, 142144, 143f Treponema pallidum
in dideoxy DNA sequencing, 210 Transcription-mediated amplication, detection of, 277t, 278279
maintenance of, 414, 414f 142144 Trimer
in melt curve analysis, 181 Transduction dened, 54
in polymerase chain reaction, 130131, in DNA recombination, 2021, 21f Trimming
131f Transfer as synonym for deletion, 350
Therminator in Northern blot, 101b, 101102 Trinucleotide repeat expansion disorders,
in dideoxy DNA sequencing, 209210 in Southern blot, 99b100b, 99101, 322b, 322325, 323f325f, 324b,
Thermometers 100f101f 325t
in quality assurance protocols, 414, in Western blot, 102 Triploidy
414f Transfer RNA in Downs syndrome, 157
Thermosequenase in amino acid charging, 57 FISH in detection of, 166, 166f
in dideoxy DNA sequencing, 209210 splicing of, 33b Tris buffers
Threonine structure and function of, 3435, 35b36b, in electrophoresis, 87, 87b
structure of, 50f 35f in polymerase chain reaction, 130

462 Index
Trisomy V Watson
dened, 311 Vacuum transfer on DNA double helix, 23, 4b, 8b
examples of, 312t in Southern blot, 100, 101f in Human Genome Project, 220
Tropheryma whipplei Validation molecular biology dened by, 2
detection of, 264 of laboratory tests, 268, 410, 411f, 412 Wells
Tryptophan Valine in electrophoresis, 8990, 90f
structure of, 50f structure of, 50f West Nile virus
Tth polymerase Vancomycin resistance, 281283, 282f, detection of, 294t
in polymerase chain reaction, 129, 136 282t Western blot
Tuberculosis, 271 cycling probe method in detection of, for human immunodeciency virus, 295
multidrug-resistant, 283 149 interpretation of results in, 112, 112f
Tumor Variable expressivity in protein analysis, 97t, 102, 102b, 107b
dened, 333 dened, 314 White and Hogness
Tumor cells Variable loop R loop mapping of, 31b
single-strand conformation polymorphism in transfer RNA structure, 35, 35f White blood cells
in, 176177 Variable number tandem repeats in DNA isolation, 66
Tumor protein 53 dened, 226, 230 WHO Nomenclature Committee
in cancer, 341t, 341342 in human identication, 230 on HLA nomenclature, 383b
Tumor suppressor genes short tandem repeats versus, 231 Whole chromosome paints
in cell cycle, 333334 V(D)J recombination in uorescence in situ hybridization, 168,
mutations in, 334 gene rearrangements in, 347350, 348b, 168f
Tumors. See also specic tumor types 348f351f, 350b Whole genome shotgun sequencing
classication and nomenclature of, 333 Venereal Disease Research Laboratory in Human Genome Project, 220f, 221
Tumor-specic genes in Treponema pallidum detection, 278 Whooping cough, 272273
in molecular oncology, 334 Venter Wobble
Typing capacity in Human Genome Project, 220 in genetic code, 56
in genotype test evaluation, 290 VIC dye Wollman
Tyrosine in allelic discrimination, 186, 187f on transduction, 2021
structure of, 50f Viral load
Tyrosine kinase inhibitors in HIV infection, 295297, 296t X
in cancer therapy, 337 Viruses. See also specic viruses X-linked disorders, 313314, 314f
detection of, 291299 Xylene
U amplication tests for, 293t295t in DNA isolation, 66
Ultraviolet light hepatitis C, 264, 294t, 298299 Xylene cyanol green
clinical applications of, 133b human immunodeciency, 264, 292, in electrophoresis, 90, 91t
in polymerase chain reaction, 132 293t, 295297, 296t
pyrimidine dimer formation and, 133b overview of, 291292, 299 Y
in spectrophotometry, 7677, 77b DNA, 292t Y chromosome
Ultraviolet light illuminators genomes of, 292t Y-short tandem repeats and, 241242
maintenance of, 415 genotyping of, 297298, 298b Yeast
Unwindases restriction modication in, 5b transfer RNA of, 36b
RNA, 38b RNA Y-short tandem repeats
Uracil genomes of, 292t in kinship testing, 241245, 242f, 243b,
in RNA structure, 28, 28f reverse transcription in, 28b 243t244t
Ureaplasma urealyticum transduction in, 2021, 21f loci of, 243t244t
detection of, 277t, 279280 V-myc avian myelocytomatosis viral-related
Urethritis oncogene, 343 Z
chlamydial, 276 VNTR. See Variable number tandem Zamecnik
mycoplasmal, 279 repeats ribosome studies of, 57
ureaplasmal, 279 Von Hippel-Lindau gene, 342343 Zimmerman
Urogenital tract pathogens. See also specic Von Hippel-Lindau syndrome, 342 on DNA polymerization, 9b
pathogens Zinc nger motif
detection and identication of, 276280, W in amino acid structure, 53b
277t Wada Zwitterions
overview of, 276 in Human Genome Project, 219 amino acids as, 49

Molecular Diagnostics-Fundamentals Methods and Clinical Applications

Uploaded by

Document Informationclick to expand document informationMolecular Diagnostics

Document Informationclick to expand document information

Copyright:

Available Formats

Molecular Diagnostics-Fundamentals Methods and Clinical Applications

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Molecular Diagnostics-Fundamentals Methods and Clinical Applications

Uploaded by

Copyright:

Available Formats

Copyright 2007 by F. A. Davis.

00Buckingham (F)-FM 2/14/07 1:09 PM Page i

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

This page has been left intentionally blank.

Copyright 2007 by F. A. Davis.

Lela Buckingham, PhD, CLSpMB, CLDir(NCA)

Maribeth L. Flaws, PhD, SM(ASCP)SI

Copyright 2007 by F. A. Davis.

F.A. Davis Company

Copyright 2007 by F. A. Davis Company

Acquisitions Editor: Christa Fratantoro

As new scientic information becomes available through basic and clinical

Library of Congress Cataloging-in-Publication Data

Authorization to photocopy items for internal or personal use, or the internal or

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

This page has been left intentionally blank.

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

resources, which include a Brownstone test generator, image

Lela Buckingham, PhD, CLSpMB, CLDir(NCA)

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

This page has been left intentionally blank.

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

This page has been left intentionally blank.

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

Chromosomal Morphology 159 Gender Identication 234

Copyright 2007 by F. A. Davis.

PATTERNS OF INHERITANCE IN SINGLE-GENE HLA POLYMORPHISMS 379

Copyright 2007 by F. A. Davis.

Fundamentals of Nucleic Acid

Chapter 1 Lela Buckingham

Copyright 2007 by F. A. Davis.

When James Watson coined the term molecular biol-

Copyright 2007 by F. A. Davis.

(A) Nitrogen bases

(B) Thymine Adenine Cytosine Guanine

Copyright 2007 by F. A. Davis.

nated C or N 1, 2, 3, etc. The carbons of the ribose sugar

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

Due to their specic effects on enzymes that metabo- Growing strand

Nucleic acid is a macromolecule made of nucleotides

Nitrogen base Nitrogen base HC CH2

way gives the DNA chain a polarity; that is, it has a 5

Copyright 2007 by F. A. Davis.

DNA Replication As Watson and Crick predicted, semiconservative

Copyright 2007 by F. A. Davis.

Historical Highlights Historical Highlights

Copyright 2007 by F. A. Davis.

Copyright 2007 by F. A. Davis.

Table 1.1 Examples of Polymerases Classied by Sequence Homology

Leading strand DNA