RE various info

(not in RE-OU compilation - yet)

This document is a collection of various interesting postings since early 2007 at the EVGray yahoo group.
A previous compilation is found in RE-OU-v6.1.pdf
All info from Hector is indicated in blue.

1. Theory .............................................................................................................................................................................4
1.1. Formula...................................................................................................................................................................4
1.2. RF, RE, Resonance, Charge & transformation .......................................................................................................5
1.3. Summed on RE 2...................................................................................................................................................21
1.4. Magnetic field.......................................................................................................................................................22
1.5. Time......................................................................................................................................................................23
1.6. Dimensions ...........................................................................................................................................................24
1.7. A little bit on TESLA secrets and its HERZIAN conflicts ..... ...........................................................................25
1.8. On frequency ........................................................................................................................................................26
1.9. Stochastic wave amplification ..............................................................................................................................27
1.10. Impedance matching.............................................................................................................................................27
1.11. Does DC really exist ? ..........................................................................................................................................28
1.12. Transformation .....................................................................................................................................................28
1.13. Nodes: anti & otherwise .......................................................................................................................................28
1.14. Narrowband & Broadband....................................................................................................................................29
1.15. Mass & acoustic resonance...................................................................................................................................29
1.16. Iron thunderbolt ....................................................................................................................................................30
1.17. Spike!....................................................................................................................................................................32
1.18. Light .....................................................................................................................................................................36
1.19. E=MC2 ..................................................................................................................................................................36
1.20. Electron, waviton & mass.....................................................................................................................................37
1.21. Electron inertia memory .......................................................................................................................................38
1.22. Gravity..................................................................................................................................................................38
1.23. Hypersignal...........................................................................................................................................................38
1.24. Saturation..............................................................................................................................................................39
1.25. Lenz less ...............................................................................................................................................................40
1.26. Latching ................................................................................................................................................................40
1.27. Proof OU property ................................................................................................................................................41
1.28. Varactor ................................................................................................................................................................42
1.29. Capacitors .............................................................................................................................................................42
1.30. Quantal diode........................................................................................................................................................43
1.31. Super-cap & tunnel diode .....................................................................................................................................49
1.32. Battery ..................................................................................................................................................................50
1.33. Class C linear amplifier ........................................................................................................................................50
1.34. FM ........................................................................................................................................................................51
1.35. Seike book ............................................................................................................................................................52
1.36. Looping.................................................................................................................................................................53
1.37. Blackholes ............................................................................................................................................................54
1.38. Carbon rod generator system schematics..............................................................................................................54
1.39. Han Coler..............................................................................................................................................................54
1.40. Visual projecting the OU mechanics ....................................................................................................................55
1.41. Solenoid ................................................................................................................................................................56
1.42. Tesla coil ..............................................................................................................................................................56
1.43. Tesla amplifying transmitter.................................................................................................................................57
1.44. Tesla quote "tremendous advantage to break at the peak of the wave” ................................................................57
1.45. Dipole ...................................................................................................................................................................58
1.46. The Coulomb law misconception .........................................................................................................................58
1.47. Phil on conservation of energy .............................................................................................................................59
1.48. Flywheel ...............................................................................................................................................................60

1
2. RV related.....................................................................................................................................................................61
2.1. General RV ...........................................................................................................................................................61
2.2. PM-RV .................................................................................................................................................................75
2.3. Inverters ................................................................................................................................................................77
2.4. RV video...............................................................................................................................................................80
2.5. RV-alt ...................................................................................................................................................................81
2.6. The resonant generator .........................................................................................................................................83
2.7. 10KW Harbor-Freight genhead ............................................................................................................................83
2.8. Raivo quick RV overview ....................................................................................................................................85
2.9. Kone OU motor ....................................................................................................................................................86
2.10. Kone RV-Muller generator...................................................................................................................................87
2.11. RV-Muller ............................................................................................................................................................94
2.12. Hector’s RV looping.............................................................................................................................................96
2.13. 40-phase motor .....................................................................................................................................................99
2.14. RV replication by Austin Adee.............................................................................................................................99
3. TV related ...................................................................................................................................................................101
3.1. General ...............................................................................................................................................................101
3.2. Ferroresonant transformer ..................................................................................................................................105
3.3. 3PH transformer .................................................................................................................................................105
4. Extraction related.......................................................................................................................................................107
4.1. non-reflected to source .......................................................................................................................................107
4.2. Diode plug ..........................................................................................................................................................107
4.3. Kone recovery non-reflecting to source + (ZPE )...............................................................................................112
4.4. RV primemover extraction .................................................................................................................................114
5. Other Applications .....................................................................................................................................................116
5.1. General ...............................................................................................................................................................116
5.2. Joseph Newman device.......................................................................................................................................119
5.3. Electric car..........................................................................................................................................................119
5.4. Aircar ..................................................................................................................................................................119
5.5. Al Franceour .......................................................................................................................................................120
5.6. PMI pancake motor ............................................................................................................................................121
5.7. Raivo: zero lug gens & cores..............................................................................................................................122
5.8. Rain with his Bedini ...........................................................................................................................................123
5.9. William Barbat patent application ......................................................................................................................124
5.10. MRA & Piezo .....................................................................................................................................................125
5.11. Hendershot..........................................................................................................................................................128
5.12. EMF_Recycler2..................................................................................................................................................129
5.13. Suckamatron .......................................................................................................................................................131
5.14. Ecklin Brown......................................................................................................................................................132
5.15. Muller .................................................................................................................................................................133
5.16. Ping-pong looper ................................................................................................................................................134
5.17. Kone DC servo motor.........................................................................................................................................144
5.18. VTA....................................................................................................................................................................144
5.19. About Tunecharger .............................................................................................................................................146
5.20. Ferroresonant Electrolisys & sonofusion............................................................................................................146
5.21. Energy saving bulb .............................................................................................................................................147
5.22. Plasmatronics......................................................................................................................................................148
5.23. Lighthouse gen ...................................................................................................................................................148
6. Other info (related & not-related) ............................................................................................................................149
6.1. Other ...................................................................................................................................................................149
6.2. Quantum pendulum ............................................................................................................................................162
6.3. Lead-acid battery desulfator ...............................................................................................................................163
6.4. Firestorm spark plugs .........................................................................................................................................163
6.5. Cold fusion .........................................................................................................................................................164
6.6. Characteristic Impedance of a Transmission Line..............................................................................................164
6.7. LEDs...................................................................................................................................................................166

2
 6.8. to determine Inductance......................................................................................................................................166
6.9. Power Factor Correction.....................................................................................................................................167
6.10. “Lingam power” .................................................................................................................................................168
6.11. Info from ‘Lightwave’ ........................................................................................................................................169
6.12. tasmin .................................................................................................................................................................172
6.13. Healing water......................................................................................................................................................174
6.14. Neo Magnets.......................................................................................................................................................174
6.15. Chip security hacking .........................................................................................................................................174

3
1. Theory

1.1. Formula
The experimental data is REQUIRED to proof the OU states within the rotary machine fields.
Primemover Input: W = I x V x PF.
Alternator circulation (internal in ABC phases): W = (I1+I2+13)/3 x (V1+V2+V3)/3 x 1.732
MEASURED in A, B, C PHASES, phase angles are 120 deg and FORCE vector angles are 90 deg.
Electrically the phase angles vectoring force POWER factor energy to become logarithmic amplification factor of 1.618;
alike antenna multiplication factor in RF practice it’s 1.618 gain over isotropic virtual dipole (power line)
The formula talks for itself: resultant virtual power exceeds input with a REAL extractable joule potential.
A conversion back to normal phased power is multiplied by .8 for down conversion loss, efficiency to co-phased power, this
is still 138% OU by the book. In some Old RF books final RF power & amperage are multiplied by .8 to give true power -
relative to input power (non RF)
SEE Radio Amateur Books on RF power amplifiers, matching networks and antenna design. Match this Knowledge to
POWER engineering AND RADIANT energy "wet dreaming" becomes RADIO FREQUENCY Knowledge
Vectoring as described USING RF baluns and the non-reflective extraction system is easy.
The spike potential is in the energy component it can extract from a given zeropoint potential of DENSIFICATION in free
aether or matter contained medium.
Norman THEORY applies to the core part and to its component IRON that can be banged or PUMPED alike a LASER
medium to RELEASE a major quantity of energy from the medium than the one needed to excite it. We do not differ much
in the path (in fact is correlated) but needs to be better understood. The neutral spike is part of the game.
(Radiant energy manifestations) modality of RF radio frequency science ... (resonance or lets say Magneto-atomic
resonance.
The 3 phase formulas that I posted long ago give the answer .. One phase versus capacitor created 3 phases .....
just need to think a bit on RF and were RF is in relative phasor terms from one phase to 3 phase transition ... (so darned
simple )
Adding more teeth to formulae
Primemover Input: W = I x V x PF.
Alternator circulation (internal in ABC phases): W = (I1+I2+13)/3 x (V1+V2+V3)/3 x 1.732
Average Sinewave energy in pure resonance ,,
J = 1 ampere for 1 second
(Averaging energy 1 second in radians ).
(sampling rate sum of all samples / (sampling rate)= .5 Watts joule second
determines energy average in second time intervals for true average energy
This is for EACH sinewave half so energy is 2x.5
The Formulations I gave are for AVERAGING real power in the ENERGY contained within a sinewave half in order to
enable the possibility for easy looping in those that understand the Radiant energy charging of resonant LCs capacitors to
Joule component charge and the application Method of non reflectively discharging such potential at Overunity states ...
(Diode plugs) x2 ,2x2, 3x3 & all other configs
There is no book formulation to AVERAGE the joule component in a sinewave ... I give this solution for you people to Use
Joule discharge in one second time is NOT an square wave as Wrongly pictured in peoples mind , its a DECAY from a Max
value in time (that usually exceeds the one amp in the sample and about half sampling way is reduced well bellow the total
figure ...

4
Capacitor discharge is in logarithmic decay as well as its charging in incremental potential.
so in Scopes with AVERARE sampling rates and Computer Software defined structure the Joule true energy has to be
computed using average sampling rate sum divided by the sampling rate itself ...
I am inclined to a 12,000 cycles sampling rate to get a phi compatible 12,000 polygon 3d to 4d ready multiple application
formula.

This little pieces are the justification for the RV theoretics (base of the triad) Copy keep and publish in the compilations .
Time is a fundamental variable in ZPE equations and this was not properly defined in standard formulations ....
Stochastic resonance justifies part of the phenomena of transform but necessitates a bit of 4d fundamental transform
equations to present a clear picture of what I claim to be the mechanics of overunity ...
Using Parts in simple applicable format takes you people to the level required to understand it .
Those having software defined scopes can easy test this ... It sure washes off a lot of "bullshit" created bugs ...
In 4D a potential is defined as in 0 time as a TENSOR of Force
This is BASIC to understand the scalar wave theory in order to see the density and vacuum differentials of time space as
basic energy components (ZPE)aether Vacua is also Density point energy (DPE) Aether compression .
Basic quantal geometry justifies this ... but as TIME permits (all of you will get there )

Power factor : Is defined as Phase difference of Amperage and voltage in a power line; a power factor of 1 is 0 loss as per
book and Amperage & voltage are in phase ..
.5 power factor is amperage & voltage OUT of phase 90deg out seen to line as Total REFLECTED power due to reactive
value of the power line itself and its components (total line loss (reactive).
Its also quantifiable in averaged Joule second half wave intervals.
The aether tensor of space is seen as LOSS summed as resistance to line energy .. loss is applied as decay of .382 or 32.2%
within under OU System basic isotropic (no gain low Q system dipole resonator)
In a non reflective resonant system the Aether tension addition to system energy is seen as GAIN ... ( Reread MRA papers )
Mater also contains specific aether tensors within an AVERAGE ambient energy temperature in time & space.
(like Iron resonance with all other Iron in the universe ) Tap it you tap the energy off all black holes in the universe ..
RF energy goes down to Quantal time & space and it can be transformed & used ...
( I gave you the secret of Vrill ) use it well ...
This is copyright & open sourced for all to Use (appropriation not permitted)

Joule = 1 ampere for 1 second

Joule = 1 watt dissipated for one second.
Amp = Q (coulombs) / time in seconds.
1 farad contains 1 watt potential discharged 1 ampere (averaged on 1 second ,,,,

1.2. RF, RE, Resonance, Charge & transformation

Radiant Energy: Wherever there is a Charge Node (voltage potential ) Aka- Charged Capacitor .
Or a Coil charged under Inductance with an Amperage potential like Konehead Shorted Coil Experiment ..
Once this POTENTIAL of Nodes is set in Motion it CREATES RF

5
Radiant energy is Radio frequency , what RESEARCHERS must look On is HOW it is CREATED , polarity , Mode(Scalar
-fixed tensor ,dynamic) , Phasing , Coherence & others ....
And All Of this Can Be measured with RF power instrumentation and Sensors ...Most of them off the shelf ...
That Ends with RV ,MRA , EMA4, Meg, Mema m& BEDINI properly explained .
Bedini Is DC "RF" RV is AC "RF"

Bedini ... OU is in the capacitor ....

Bearden OU is in the Meg ! (VTA magneto Reactive imitation )
"Me" OU is in RF (radio frequency states )and in Transformation of energy from one mode to other modes resulting in
excess of power than the one needed to initiate such transformation, any mode any method .

Charge in a capacitor is based in an electron hole non hole. As charge is not used its frequency is 0, as is used it attains the
electron spin signature and Kelvin ambient noise from the medium it travels.
(that justifies stochastic resonance within some OU systems as (NEWMAN MOTOR ) & Bedini motors in some state are.
It’s a thing to say that DC as a linear tensor is a series of STEPPED AC signals within atomic matrix.
READ EV GRAY "stepped discharges" described in its patents.
The issue is we are DEALING in RF and DC is a extremely long sinewave that can be hypersignal modulated or
demodulated attaining any amount of POWER using the 0 point NODES as TAP points for this RF energy.
It is simple transformation kindergarten stuff and with the experiments already given anyone can do it already.
It’s only to take a bit of effort to attain it and benefit from its immediate power savings and as a RESEARCH tool use!
The water hammer and implosion turbines as a sample RV can be a starter then switch to cogeneration-generation modes as
unit goes self running on the water thermal noise implosion of its hydrites (sonofusion) attained in by mechanical means.

Amperage & voltage = egg & chicken debate =debunkers waste of time.
Radiant power is in the NODES, it can be amperage or voltage, the postings make that clear on ZPE (ZERO POINT
ENERGY).
The explanations on amperage NODE POWER being transferred to JOULE (volt ampere second) VOLTAGE potential
within a capacitor .
Voltage is the storage state (electron charge differential) we use normally, but as stated in transformation postulates
AMPERAGE as well as VOLTAGE are power "MEDIUMS"

have MAX voltage AND 0 current (Known as RADIATING element ) and the Current NODE known as ground plane
(NODE, ANTI-NODE).
A perfect RESONATING condition creates a STANDING wave where these NODES are fixed within given points...
In a LARGE wave imposed in a LARGE resonating ambient, such wave fixed within a given area points is called SCALAR
wave that impress energy TENSORS within the mentioned points... tap a natural one you harness endless power, (Using a
tuned receiver and non reflecting extraction method ) diode plug transverter technology.
The above means 90% of what is said about scalar waves & standing waves is pure bullshit ...
AND that whoever understands what I am saying can light bulbs with a single wire resonating it from a given mass (short
piece of wire) as if it were RF energy. GENERATOR (SOURCE)-WIRE TO LIGHTBULB TO PIECE OF WIRE WITH
GIVEN MASS.. = LIGHT !

Zeropoint

6
It’s also known as the stochastic wall where energy transfer occurs...
sintonize resonance to ZPE wall and the energy transfer is relative to media (noise ) ambient K temperature energy transfer )
.unit becomes virtual blackbody transponder where H = I²rT

Ronald: he took a trafo and put cap over secondary; then he pulsed the primary, and got instantly voltage over the cap
without any measurement of current through it
In RF nodes you have current and no voltage; voltage and no current .
Yes, at the nodes, but these nodes do appear at oscillation, but the pulse that hits the transformer is 264 times
shorter than a full wave oscillation, so where is there the RF action? Do you mean electron density wave as soon E
field hits the primary? Like in homopolar transformer?
RF is current out of phase with voltage 90°; and yes homopolar dynamics apply but in a VIRTUAL dipole
(angles and phasors are the rule here).
a pulse may be 264 times shorter but it can transvert to many voltage nodal harmonics within the
transformer itself ...current being manifested somewhere within the system... (warranted)
time is defined by the resonant aspect of the tank where in some conditions a pulselength and amplitude are the factors
determining the speed of the charge potential movement reflecting in within the electron linear cascade ,
As Tesla well stated the speed of such signal (being scalar in nature exceeds the speed of light (closing scissors effect)
where 2 inter-crossing vectors create a point of intersection moving faster that the signal it originates from.
result , relative time compresses, time runs faster inside LC components ...where local gravitic field tends to be produced at
increases ZPE conversion rates.

universal Phi is 3.141592742 (note for Earth use, Phi and PI are swapped)
Universal 4d projection constant is 1.618 (IN resonance energy expands into a logarithmic gain of 1.61803398 responding
to a 4d hypercube reflection in 3d matter .)
energy diminishes with the square of the distance as area travelled multiplies to the square x phi 3.141592742 (for a 12,000
polygon projection of the sphere to get correct spatial projection.
Time decay constant is .382 (standard system entropy)
This correlates with Phi and circuit Q (relative also to Kelvin ambient temperature of coil); loss to thermal gradient ...
IF system is looped electron acquires energy from heat , its spin and ethereal flux ...there, (ethereal) is where gravity
equation enters as electron goes soft Time where M=MC²/vT , T becomes retrograde creating -G (almost non
perceptible if system is entropic. ) .
TV: Once resonance is attained the only power needed to maintain it is the one lost in entropy.
In MRA as stochastic gain from medium is attained in a self support mode decay is no longer existent where H =I²rT
where in a logarithmic gain of 1.618; .382 is extractable as joule potential being non reflective to endotropic source .
See Genesis project papers and refer to Seike’s work for more tips.
RV can go in these modes in alternate time, so it may not give any warning except for the light glowing at its ends. (It’s the
anomalic part of RV technology) we need to take care and play safe. Probability is 1 in 10,000 it to happen by itself but
since you guys are hitting the parameters experimenting; >play safe and secure<
IN EM rotors overlapping AC signals USING AC rotor structure as in DC motors rotor windings (similar) a runaway
frequency Cyclo-conversion can occur see EV-Gray motor design , its OU principle also includes a CYCLOCONVERSION
incremental frequency harmonics effect .
But he does not mention it except on the stepped discharges its PULSE generators created.
Early on RV disclosure I spoke of Magnetic amplification Harmonics (and got burned for it ) as that time the tensor time
frequency parameters were hard to understand under non existent book rules and no lab models , with the models you had
replicated all this will be easy understood as collective experience adds on to it ..
Now it can be justified under standard "bended" in our favour book rules.

7
Look at the electric signal in a wire as water in a hose oscillating one way, then the other (forward - reverse) this motion
reflects to source (In case of water as mechanical hammering) in power as amperage increase.
LOOK at radiant energy as the same hose but being inflated full at the end with the bubble travelling along the hose
end to end and returning to tip to tip. That balloon is the electric RF voltage node field (at full resonance). If the hose
rests floating on a pool you can see as the travelling bubble generates waves in the pool.
(These do not reflect to source) as aether is displaced with no mass it reflects no power back but transmits power
from source as time space density differential.
That is the signal from the field as it passes the elektron signature to the aether in the form of wavicle 4D projection
(signature).
That is received at a resonating receptacle antenna, alike acoustic waves travelling across the air ....
Same rules apply from sound to RF "it’s the same", RESONANCE is the key to energy transformation.
When time is slowed down you can see the waves in the air travel as areas with low density and hi density, moving to
0 time the radion waves travelling the aether follow the same rule, they look like a white translucent wall travelling
in a planar path across space where the leading edge has a specific aether compression density value being major
than the medium density it travels.
That was the reason TESLA stated that RADION waves were capacitive in nature, NOTE that I am USING the TERM
RADION WAVES not RADIO WAVES as it is the correct term to use.
Use a virtual mental capacitor , erase the physical capacitor and stay with the mental CHARGE that permeates the now non
existent plates and electret, turn it inside out and kick it at light speed across a travelling medium within a pipe .."tube" ...
There is your radiant energy wave....

Definitive ... Tesla , Gray ,VTA , MEG ,RV , TV ALL depend in one simple concept RLC circuit.
R = LOAD L = inductor "coil" C = capacitor
In resonance: Current resides in the inductor, voltage in the capacitor; Opposing vectors manifest in RESISTOR in PHASE
AT 0 point energy . Resonance, Power factor = 0 so it becomes imaginary potential
We can assume entropy as energy loss in time as E-(R/2L)xT
Where in a rotary energy field where a negative inductor is created from ambient or artificial artefact the equation becomes
untrue, "imaginary".
AS: E = E x 1.618 = OU as inverse induction becomes a product of H=I²x Rt
Clearly is noticed current DUPLICATES I² as happens in CEMP naturally in a collapsing magnetic field within a core with
INSTANT temperature drop below ambient energy of physical component.
Such importance to determine TIME decay constant as to adjust transform RLC parameters into a NEGATIVE inductor
type resonant function to perpetuate the phenomena as a productive energy source
Tesla stated (TO adjust POWER source parameters to the needs of the load , that translates to simple tuning of things , you
tune to natures "powerhouse" you get abundant energy from it ...
Grey stated , Pulsed energy as in lightning Its CEMP'RECOVERED' and fed back too the battery...
ITS circuits PURE RESONANT made of CAPACITIVE, REACTIVE & resistive elements, where simply from magnets to
atomic resonance the same simple rules apply....RF- Power and Resonance..

Will the Smith Chart help in analysing RF/RE?

Does not help too much as to see RE you must create a 4D chart that shows Amp sine ,Volts sine in a timeline with phasor
angles interpolated to a compressor tensor within the whole variables then justify it in a 5d mathematical set of 15nth order
equations ... Seike’s Formulas apply (In fact are only ones that COMPLETE the theoretical frame ( but he never applied
them) (did not know how) .

8
(Its easier to built an RV ) Its Seike applied to real world ..
Until standard math mistakes are corrected .....
Like square root of 1 is not "one" division by 0 , floating decimal point error in digital math processors ... the Phi tensor in
space 3.141592742 becomes 3.5050505050 due to gravitic influence in space time curvature . (1 can be squared lower as a
complex unit factoring it as a whole number).
Its impossible to do precision time-travelling using this Stone age error riddled digital computing pieces of junk ! that
cannot properly square 1 to 4 d 5d 6d or 7d hyper-spatial matrix .
Resonant quantum analogue computers are better ....
But like a few hundred years in the future away! (~_~) frustrating!
But if RE has to be understood Understanding the Bose-Einstein condensates is place to start ...
Matters attains the fluidity state of Aether and its density states where signals passing across those density states are slowed
relatively in time ( light slowed to a walking pace speed ) and in others Vaccua state Light exits the medium before the
signals enters it .
Ands its just Kids stuff (You ain’t got an apes Idea of the truth yet) ( I said a lot related to this within the lines of my past
postings.) Enjoy, cut, paste, tie strings ...

RF tends to flow in surface of conductor (skin effect ) multi strand filament conductors make better path for RF (radiant
energy) lowering heat losses and raising current load capacity of the coils ...

In a perfect LC (atom) particle, G (gravity) flows toward centre of particle, where C light as spherical waviton takes energy
from Quantal fabric (space time tensor) thru aether flow in spiral toward centre where Mass M = equals C divided by the
square root of time ...
Matter is nothing more than modes of light in spherical standing wave feeding from time space tensor differential as G
force.
as gravity increases time accelerates, as gravity decreases time slows down ...
At 0 G on earth surface time equals 0 matter Mass = C entering 4th dimensional state as hypercube transform ...
(Red shift is a gravity illusion ) black holes are transformation engines (The mother of creation resides inside them ) .

• You can Have an RF signal at 0 cycles per second as you can have a MINUS 0 cycle per second one being
RETROGRADE in TIME & Space.. Infinity - (negative time signal) -ZERO – Infinity + (Positive time
signal)
• RF electron pressure Voltage is 90 degrees off phase with the electron density (current) as NODE & anti node ..
• the frequency of DC-electricity: Its a linear tensor a half sine of extreme long duration... if you see battery as a
capacitor discharging into a load..
• what a semi-resonant mode is? condition where phase angle becomes a variable within an operating system ...
can be full resonant or semi resonant relative to other part of circuit (Relative)
• resonance is the highest state of energy where the elements of a circuit relate to power with the minimal loss...
• Gave the 1.618 gain figure as basic and the .382 extraction limit in hyper Q modes ...READ Norman WOOTAN MRA
.anyway you need this:http://www.ibiblio.org/obp/electricCircuits/index.htm. Idea is to extract energy without
destroying the overunity transform gain effect whatever in may be the parameters involved (Variables).
• Unloaded RV is a HI impedance 3 PHASE rotary mechanical AMPLITRON
device (as comparative simile) in broadband resonance.
as it is loaded tendency is to go into LOW impedance resonance still being AMPLITRON alike ....in low impedance
narrow banded higher Q resonance.

9
• Understanding of how a rotating field is created with a single phase in a 3 phase configuration. On a 460VAC
wired 3ph motor running on a 120VAC 60CPS
Simple A,B,C phases A,B gets line voltage & amperage Phase C is connected across a CAPACITOR WHERE
AMPERAGE IS INSTANT MAXIMAL at C
a b IS SEEN AS inductive LOAD WHERE AMPERAGE IS SEEN AS MINIMAL THE DIFERENCE IN
PHASE ANGLE CREATED AS THE CAPACITOR CHARGES RELATIVE TO INDUCTIVE COMPONENT
BEING SATURATED to maximal current and capacitor charged to maximal voltage and minimal current
creates the phase shift required as to create virtual 3 phases rotation within the circuit.
As rotation is acquired tendency is to over accelerate due to the rotating field component leading the line one, so
an starting capacitance value is switched off and a running value remains to keep the system Virtual phases
operating in hi impedance ..
• VIRTUAL power means RF where POWER factor equals 0 yes (0) power factor where in power engineering the meter
is supposed to read o and the generator is supposed to explode in flames because the power represents a total loss...
But as you see is not reflected to source... and does not go up in flames as is COLD electric circulating power
(Pure radiant energy) generator does not heat up or burn .
"ZERO" POWER factor seen from the Radiant energy perspective is used to increase energy, where in
standard engineering must be 1 to optimize efficiency and increase energy..
(RV alternator GENERATES pure radiant energy ... RF ; EXTREME LOW FREQUENCY RF limited to short
distance 4.5 FT field and safe under US part15 of federal communication rules & regulations, motor housing
restrict signal to minimal radiation safe levels acting as a filter and in some cases as faraday cage.)

Applied to ZPE energy modes to optimize (Resonance)= 0 PF.

ZERO point Energy Equals ZERO power factor ....

As circuit is loaded then it reflects opposely to standard power, With power factor increased radiant energy is
lost OU transformation and magnetic amplification is lost.

It may be virtual energy but it lights 1000W bulbs and runs motors with near 0 power loss...
Apply radio engineering method and practice..
• I think people must start looking at RESONANCE more deeply and wave dynamics in the materials they work with .
A pure resonant transformer exhibits an acoustic signal as core material acts as a crystal within a set of harmonics
within the material itself ...(Jinis test)
I say best is to pulse a material into saturation and see wherever they are resonant signals within the decay pulse
signal one
those FUNDAMENTALS are the basic frequency where OU must be LOOK into as are the natural frequency of
the material themselves.
Then design COIL and capacitor value to resonate within those CORE sweet frequency ... (hyper Q)
EVERY motor has a sweet point where energy adds to energy ...

Resonance is given in 3 aspects as this physical dimension has 3 dimensions 3 basic particles 3 primary colours 3
primary musical tones 3 primary states of matter
SO resonance can be as in a long cord "Reactive" , can be as in a flat surface "Capacitive" and can be in a given
volumen of MASS "ACUSTIC" Compound resonance (tensor), (density)Or state of density ..
Is an aspect of electricity and power engineering quite NEW not known in university circles yet (Belongs to area 51
dungeons) if I have to be more specific.
In resonance the nodes can be resonated on Equal mass relative to the intended design , if you need to RADIATE
from an ACTIVE end the NON radiating ANTY-node can be specific mass resonant in current node as to permit
RADIATING element to transmit energy to SPACE "E" field.
A light bulb having specific voltage drop can become a virtual segment of transmission element in resonance
(resistive resonant element) PURE LOAD ...if 2 masses in conjunction form specific node-anode at same AMPERE
load value of bulb, it will light with no voltage from ELF RF = (RADIANT SCALAR STANDING WAVE source)
current.
Using that method you can get power anywhere from natural standing RF waves..

10
Remember 60CPS AC wavelength is somewhat like 50 million meters SO we play with ULTRASHORT segments in
uL (Pico landa)where MASS in more important than length aspects (Electro-acoustics "RF" mix)
In reality is simple, is not that complex to replicate what I describe.
IRON can be POWER source TRANSDUCER to transfer energy from the atom to the electric field if it’s treated like
a CRISTAL mass of specific electro-acoustic resonant value.
From specific mass of iron you can tap hyperwave at 1.5 CPS provided by a supernova standing wave signal
resonating within the earth orbital path. Scalar wave = RF standing wave but very large wavelength and very LOW
frequency that exert a given energy component in matter as if it were a series resistor.
Iron is a series resistor within a LOT of scalar waves (hypersignals) (MEGAMETRIC ELF RF standing wave radio
signals..) = (scalar waves)
Give IRON a specific value and you can tap any energetic scalar wave signal and "transvert" it into usable power...
VTA is nothing more than a LINEAR amplifier working energy out of a MAGNET combined polarized micro-
atomic scalar waves that form what we call MAGNETIC flow (vitrons ) "marnetic" energy affixed to a greater
MEGA-kilometric ELF standing wave within a mega-metric magnetic field. (like fish in the water we don’t see it )
Note VTA changed output relative to MOON phases & daytime (sun) & others. READ Sweet Papers.

I still insist that cold electricity is within normal RF engineering practice as resonant states indeed are where the energy can
be maintained in the highest potential with lower energy loss, being in fact (COLD ) energy and in some applications can in
fact create superconductivity at room temperature within RF cooled down circuits .... search RF , laser cooling , stochastic
resonance thermal transformations , thermodynamic transformation....

OU not explained by the Laws of Conservation? Is explained and supported by STOCHASTIC resonance method and
properly applied thermodynamic transform law.
It only needs a little arrow pointing "endo-energetic" input into the equation (so darn simple ! ) alike endothermic chemical
reactions the end product of stored chemical energy exceeded that of the chemical reaction itself (gain from ambient heat).

Gain from ambient as the magnetic fields was left out and RF transforms mechanics were left out ..
and called exotic RADIANT energy and made into a circus .
but is nothing more than advanced RADIO frequency engineering ...
from dc to infinite from a quarter wave to a full wave dc pulse to dc current law is the same ...
A battery charge, use ,and discharge if seen from an AC perspective is only a very long AC wave, correct its power factor
using magnetic amplification as condenser and you have OU ..
Bedini corrected his battery power factor but hydrometer proved he did not charged them, he forgot to magnetically amplify
the current ... and vector it as a tensor in a T bridge loop ...

NON -Radiant power (DC or AC) Current is in phase with the VOLTAGE ... (standard practice)
Radiant energy = RF = current 90DEG off phase with voltage – RESONANCE
Conventional electrical theory only includes half of the story. You need RF engineering to complete the picture.
"The typical Hertzian, electromagnetic field of Transverse Waves is the gross by-product of a much more powerful, but
hidden, energy envelope which is manifested as Longitudinal Standing Waves in a scalar nodal matrix, not propagated in
the up and down, ocean wave fashion of Transverse Waves."
RF nodes in radio antenna engineering practice (standard)
"Tesla experimented with impulse current and oscillating current. our electricity is direct current and alternating current.
The Four Quadrant Theory of Electricity is IMPULSE CURRENT, OSCILLATING CURRENT, DIRECT CURRENT,

11
ALTERNATING CURRENT. alternating current + direct current are transverse electromagnetic impulse and oscillating
current are longitudinal di-electric"
Same as I stated RF versus non RF power ....RESONANCE non-resonance differentiates them
Non-resonant field travels internally in a wire along with the current (in phase)
resonant field travels outside the wire pressed by the internal current pressure inside the wire ...(off phase)
field forms a magnetic balloon where in standing wave it inflates & deflates imparting the 4d wavicle energy
projection to the aether in contact with the physical resonating element ..
energy diminishes with the square of the distance as area travelled multiplies to the square x phi 3.141592742 (for a
12,000 polygon projection of the sphere to get correct spatial projection.
How is the DC in RV modified into oscillating or impulse currents?
The coil shorting experiment Kone did And my posting about the CURRENT NODE in shorted L (COIL ) and its opening
to discharge its current potential as a VOLTAGE value in a CAPACITOR C to attain a JOULE potential with a magnetic
multiplication factor gain (RF) of 1.618 over theoretical antenna dipole element.
The ROTOVERTER demonstrates H is right, it’s a motor working in semi resonant modes using ZPE (RF) Radio
engineering principles. That leads to the science of energy transformation & power management, practical no bullshit ZPE
RF energy applications.
I explained a bulb in an RF current node has near no voltage so its resistance voltage drop if read by a meter as in my early
RLC RESONANT RF circuits a 236 volt 4.8Amp bulb will read 19.8 volts being able to work underwater with RF current
of 4.8 amperes what I define as AMPERE load in a resonant LC
That was the EV Gray "COLD" electricity "magic" underwater working light bulb .... In a sense a COMMON RF effect
used in somewhat in deceitful manner to make people think and bow to the new totem God.
fact: Overunity is produced as a working device acquires energy from other source ,other than the source initiating it .. Be it
magnetic, thermal, atomic, aether (whatever universally applies)

- IF FORCED to work on other NON natural mode it will heat UP and result in IRON loss phenomena...
- in a self inductive STAR reactor an ELECTRUM conductor is exited at superconductivity attains perpetual energy
transferring the quantum energy to physical one...

Stochastic resonance first proof of overunity transform engine where ambient noise in a crystal matrix amplifies a weak
signal travelling across it. (Other systems also apply) looped stochastic resonators are on NASA top secret equipment stock!
Used in gravity wave detectors, sub-space communications R&D & other uses .
http://mathworld.wolfram.com/StochasticResonance.html
http://www.ecogito.net/projects/download/Stochastic_resonance.pdf
Hector first referral was the Navy R&D in radio frequency filters where such phenomena manifested as a transformation of
crystal Thermal noise into signal electrical amplification.
ALL NAVY data WAS REMOVED from the internet after Hector published it as PROOF of and justification of some
OVERUNITY mechanics in electrical circuits.
But all sources can’t be silenced and they can lend their revelations
http://www.iop.org/EJ/abstract/0256-307X/20/2/309/
Input signal + ambient noise (thermal or electron spin ) = OU output
Where ((PI+SRA)=PO)/PI= Overunity
FACT no dis-info OU overunity is TRANSFORMATION of energy as HECTOR stated from the start
( PI = (power in)+ SRA (Stochastic resonance amplification) = PO = (Power Output) )/PI = overunity
More revelations: http://citeseer.ist.psu.edu/context/388295/0
Copy the info as the feudal lords "agents" will start erasing the data given here.

12
 Beyond the Fokker-Planck equation: Pathwise control of noisy.. - Berglund, Gentz (2001) (Correct)
.... considered either potentials that are piecewise constant in time [BSV] or two level systems with discrete space [ET, McNW]
Continuous time equations have been mainly investigated through the Fokker Planck equation, using methods from spectral
theory [Fox, JH1] or linear response theory [JH2]. The main contribution of these approaches is an estimation of the signal to noise
ratio (SNR) of the power spectrum, as a function of the noise intensity. The SNR is one of the possible quantitative measures of the signal
s periodicity, and behaves roughly like e H # 2 # 4 , which is ....

P. Jung, P. Hanggi, Amplification of small signals via stochastic resonance, Phys. Rev. A 44, 8032--8042 (1991).

Noise Induced Order: Stochastic Resonance - Schimansky-Geier, Freund.. (1997) (Correct)

....Bulsara at al. 1994; Jung, 1994, 1995] There exist different measures to quantify stochastic resonance. The most widely used is the
signal to noise ratio (SNR) vs. noise intensity relation [Fauve Heslot, 1983] Another measure for SR, the spectral power
amplification (SPA) was introduced in [Jung Hanggi, 1991] as the ratio of ensemble averaged response at the signal frequency and
the amplitude of the signal. Another alternative employs residence time distributions introduced in [Gammaitoni et al. 1989, 1991; Zhou
at al. 1990; Zhou Moss, 1990] Focussing on the height of the first peak (at the ....

....as bona fide resonance of the forced system [Gammaitoni et al. 1995] These measures reflect different features of the SR phenomenon.
On the one hand, in the limit of weak periodic bias SR can be described correctly in terms of linear response theory (LRT)
Dykman et al. 1990; Jung, 1993; Jung Hanggi, 1991]. This theory predicts that SPA and SNR are monotonous functions with respect to
the driving frequency. On the other hand, the measures based on residence time distributions underline the similarity between SR and
synchronization phenomena observed in deterministic oscillatory systems. Recently ....

Jung, P. & Hanggi, P. [1991] "Amplification of small signals via stochastic resonance," Phys.Rev.A 44, 8032--8042.

Adaptive Stochastic Resonance - Mitaim, Kosko (1998) (1 citation) (Correct)

....gain, and ffl complexity for first order Markov stochastic automata [160, 247] Other forms of SR measures also occur in the SR
literature. They include the other signal tonoise ratios [64, 123, 131, 148, 152] the amplification characteristic of a system like those
found in electronic devices [9, 40, 94, 95, 126], susceptibility [65, 66, 177, 233] crisis measure in chaos [33] and prediction error of
spike rates [35] The number of SR performance measures will likely grow as researchers explore how noise and signals drive
other systems in the vast function space of nonlinear dynamical systems. 4 ....

P. Jung and P. Hanggi, "Amplification of Small Signals via Stochastic Resonance," Physical Review A, vol. 44, no. 12, pp. 8032--8042,
December 1991.

Low Power Detection using Stochastic Resonance - Nafie, Tewfik (Correct)

....the optimal matched filter [2] and results to the contrary showing it decreases processing gain [3] there is still a lack in applications that
can utilize some appealing characteristics of SR. SR is essentially a nonlinear device which encounters increase in the output SNR
with increasing noise [4], and the output SNR reaches a peak, resonates at a certain input noise level. Fig. 1 shows a very simple
stochastic resonator, a Schmitt trigger [5] This device can be modeled as a Markov chain with 2 states, and the probabilities of transition
can be easily calculated [6] In this paper we ....

P. Jung and P. Hanggi, "Amplification of small signals via stochastic Resonance," Physical review A, Vol. 44, No. 12, pp. 8032-8042,
Dec. 1991

http://www.rasertech.com/tech_overview.html
A Mormon attempt at taking advantage of rotoverter technology "Symetron" (SIMILAR but not equal ) but anyway you
name it is RV in a "distorted" form . Plain RV theft
http://www.geocities.com/robertjackson58/robspatents.html
Another public intellectual property theft & de-accreditation !
http://www.phact.org/e/z/JackCarey-sept.htm
Jack Carey, [email protected] 810-618-9234 claims that Wayne Cochran (Mormon) ? acquired Hectors technology in
1982-1987 R&D period ? died of cancer ? due to UV RF exposure using RESONANT florescent Tubes ? (ZEUS)?
(A lot to investigate and & confirm or deny)
Invented a Rotary Transformer Phase Converter that converts single phase power to three phase and will power 5 HP motor
on air compressor while using only 400 watts input. Claims that 110 VAC 9 amps input power to RTPC powers 5 HP?
motor on air compressor, 2.5 HP motor on drill press and arc welder set for 100 amps all at full load.
Sounds familiar ? (interesting) the conspiracy "facts" go on .
Nothing in the PATENT office existed similar to RV before its public disclosure.

13
Over 230 different claims to it had appeared in the last 8 years and keep on growing.

IF relation is compared to an RF radio antenna the extra power respond to what RF is called antenna multiplication
factor.
ANTENNA POWER GAIN! where RV windings are a 3 element circular array or AMPLITRON (in case of
primemover) and a MAGNETRON in case of ALTERNATOR ... (similes )
As in case of Antenna each element gains are 1.618 over isotropic (this means over dipole used as reference) x Phi
3.141592742 for the 3Phase factor spatial transform field ovoid.
Debunkers may state yes but antennas concentrate power in one direction and that is the reason for the gain. That statement
is cut of by omni directional antennas that radiate 360deg and still show gain using RESONATORS in series.
IS proven that such gains are real as radio receivers read the signal intensity far away from the source and a Radio signal of
1 WATT being transmitted by an antenna having 8.5 DB gain puts to the air equivalent of 85Watts of RF energy being
multiplication factor of antenna . (This is Tesla’s amplifying transmitter secret). Nothing else.
IF signal is extracted non reflective to source and to such percent it exceeds the amount used to set in motion the aether
stochastic resonance gain from the standing wave of space time hypersignal the transformation supplies all the free energy
needed for self sustaining autonomous operation with energy to spare for other uses.
Of test done this condition was verified using BAZUCA antenna resonators years ago KP4QC was one of the first persons
to test my theory building quadrapolar antenna resonator .
The resulting final power exceeded the input by 12 magnitude. (Antenna multiplication Factor)
The radiant wave of such magnitude trapped in its NODAL forms.
That is 0 point Current value into a capacitor Voltage-charge transformation.
With a JOULE potential we have 2X vectors from a single signal half sinewaves + - HERE we separate split the absolute
current NODES from 0 Voltage maximal current to a 0 current JOULE potential charge in a condenser (max voltage). No
power factor can make this signal imaginary as it’s a REAL VOLTAGE value at an N farad (electron density accumulation.
POWER becomes REAL defined by Volt Farad Second JOULE power.
SO scope picture don’t end there, the transformation needs to be justified by Seike aether density formulations as to
understand the mechanics particular to the electro-thermal transform on 3rd dimensional and 4rt dimension projection from
standard electron spin to its gravitic time space transform engine within the particle itself ... REMEMBER SOFT
ELECTRONS I posted so much about if RV is FORCED to draw energy from time space itself.
Inverter microwave ovens (sharp) (hi voltage diode plug
H transistor network (Powermate) (modified sinewave inverters )
XT & AT computer power supply (look into the RF type resonator) modify its power factor PING ! it squeals like a pig &
goes OU .
May I sin if I tell you all inverter first stages can be made OU ? Make them squeal like pigs !

Cornu spiral stuff (relation of optical wave passing a slit) relative to RF wave passing LC circuit ..
The spiral is incremental wave amplification within stochastic wall energy transfer of ambient energy .... EASER
wave is visualized in 4D hypercircle 360X360 degrees angle and amplitude (RADIUS of wave relative central
ZEROPOINT as a variable) relative to effect of stochastic wave influence.
AS experiments progress this will be easy understood ...
wave is not flat it has a fan shape to it as current is integrated to it, phase determines circular shape (as particle
waviton ) or as WAVE .
That is why the electron can act as a particle and a wave because is composed of other form of electricity you don’t
still know, related to magnetic lines components of 4d matter structure . Electron can be a travelling as flat 1d signal

14
0 feet to infinite in diameter or as a--b line (linear particle ) (its own diameter) or less (self spaghetti-fication... (into a
chord)
that is the mechanics of wormholes with hyperlight speed , you come out the other side before you enter the portal ...
or in fact you can be copied at the other side instantly ..stretching the electron into a near infinite long chord ..
The electron is spheroid standing wave its surface formed of chord waves where in centre stands 4 vitrons in
pyramidal setup ,as electron becomes soft (PM only driven motors ) they decay into ...as micro milimetric waves-
particles , one photon and 3 vitrons
In a sense matter is standing wave transform engine within the aether sea, gravity being the aether pressure flowing
to vacuum created by the transformation of AETHER flux to magnetic one within the anomaly of material hologram
created by morphogenetic hypersignal projection (God mind )
I hope you can digest this ... as are some basics to apply RFRV to create any type of matter you want ... by simply
interacting micro-millimetric frequency into the desired matrix coordinates...
"lampool"

In physics, any atomic electron that has acquired sufficient energy by recoiling from a charged particle passing
through matter to force, in turn, some dozens of electrons out of other atoms along its own trajectory.
“Any atomic electron that has acquired sufficient energy”: That means at specific ELECTRON volt potential (EV)
“by recoiling from a charged particle passing through matter to force, in turn, some dozens of electrons out of other atoms
along its own trajectory”: That is stochastic amplification of electron flow ...
It happens at natural fundamental resonance inside electrical conductors? (Yes ) causes noise in power lines and OU.
It happens inside cores in transformers? Yes and is the cause (one of many) of iron loss.
Can the energy be tapped to produce OU?: EASER Electron Amplification by Secondary Emission of Radiation.
Yes its one of the mechanics I had disclosed 9 years ago and is listed in the compilations awaiting someone to understand
them. OU is the result of transformation mechanics ... Bad thing no one looked into X ray laser "EASER" design.
another look must be taken on the Einstein-Bose condensates the laser cooling systems, the self cooling laser rods and other
Darpa, Nasa released public info on the subject. Hope this is understood (already told )
Why you think Bruce A P was first to POST RV info ? Simple answer (Its related phenomena) Bruce information has
relevance to RV one and OU mechanics.
Tip ..Electrons giving energy to a flow go into low orbit being the end result an ambient temperature drop ...Reported
phenomena in electrical OU machines as (VTA) self cooling ... cold freezing electricity .

There is no CEMFP as in resonance it becomes linear forwarded vector (logarithmic power amplification into
capacitor as JOULE potential ..x1.61803398).
Is not divisible by 2 because it is ac - + diode plugged LC so 2 systems potential sum up x2 as Coil dumps full potential to
cap.
in a hyper Q mode a non reflective driver can resonate a coil to cop 24 of the input power easy ,(non reflective and properly
synchronized ..
in MEMA mode a 75KW transformer was driven with 3 watts from a D 1.5 DCV battery boosted to 380VDC using flash
camera circuit and 2 radio shack party strobes ...! to a total of no load hyper Q resonant Iron thundervolt mode to 150KW
(cold) in 3 Phases .
the strobe pulses fed the energy to self sustain the reaction being the iron electron spin temperature the energy source , the
last hi voltage adjust tap was Wye reversed to use as power feedback loop. 3PH
its ok to make improvements or aclarate technical points ,but its essential it is done in application as FULL dual plug once
its understood within HALF of its true dimension. this is key to the reactor core fundamentals I disclosed earlier
Solid state ZPE "ZEUS" reactors like the ones lighting the Zeus 3PH lamps with 1.5VDC triple aaa battery .

15
plugs & pulse circuits can be tailored to fire gigawatt pulses that bring out the stochastic transform mechanics within iron
core laminates . "Iron Thundervolt technology "

The Super luminal is EASY, 2 waves conjugated at an angle create a faster wave at junction point (waviton) conjugating
LASER waves into wavitons create faster than light hyper-signal (this is kid stuff) can be made in any well equipped lab .

The effect is where acoustics meet the electrical; all waves respond to acoustical mechanics as well as electrical ones.
Remember this when you make OU coils "squeal" like pigs! check Jinis page experiment interpret the scope
readings there is more to those readings than what you may think possible, its direct look into ZPE guts! some
"octaves" up.
Tip (the big power spike in centre with the big power "surge" !
That is when radiant wave RF meets acoustical realm ,then we have to work in IRON CORE crystal lattice matrix as
well as its electrical character because HERE is where the extra energy is acquired by means of transformation from
the ambient, The iron becomes a TRANSPONDER -"transformer" element of the ZPE available components
specific to the area is located on, electron spin energy, electro-atomic ambient noise ,aether density in the medium,
gravitic compression signature and other components in the ambient dirac sea of energy including ambient thermal
ones.
Radiant energy is CREATED in pure AC mode within the RV alternator electro-mechanical > AMPLITRON < (read radar
theoretics ,(amplitrons & magnetron theory ) "its simple ...

Shorting coil makes the magnetic field to effect the coil as a PURE Current NODE in a VIRTUAL LC setup where C
equals infinite capacitance as it equals a short ...
so at max current potential as the short is opened the full stored current "node" potential discharges as a voltage one
upon field collapse , if this is driven into a capacitor with the optimal resonant value its potential will be maxed from
the RADIANT energy mode to an USABLE farad-voltage charge within a given JOULE real world value (not
Virtual anymore) but real charge potential power at "N" farads "X" volts
Read compilations ....
In AC diode plug circuits this POTENTIAL can be extracted non reflective discharging the charged capacitors at is blank
sine intervals wile its twin pair charges up ....
This is applicable in 3PHASE 6x6 plug circuits where the combined collected isolated output tensor tendency is to be pure
DC signal (3PH bridged rectification with 2x - + sine-waves overlap )

Its radiant energy taken from the magnet into 0 point node at zero voltage max current where IRON saturates and tends to
ring like a bell (there is where energy is gain and transformed from the medium (thermal, stochastic, electron spin, aether
ambient noise) whatever and added to LC coil energy component .
VTA modulate & latch magnetic fields = infinite energy transform
Magnet = Energizer bunny .... (old magnets not containing k40)capable of latching like ceramic 8 & 5 ones and IBM
memory cores ones .

Radiant Energy is RF, does it cause RF interference with communications equipment?

No as is a filtered non interfering signal falls under part 95 law as no antenna is provided for radiation broadcasting and any
interference is limited to less than 33 feet ( cathode ray modulation) of electron beams ) and radiation by means of power
lines is limited to POWER factor correction VAR effect ... HAVING EXTRA FILTERING EFFECT... I WAS VERRY
CAREFULL IN CHOOSING ITS standard off shelve parts to comply to every UL/CSA & OSHA federal regulations on
safety , any standard actual home generator produces ten times the EM FIELD RV does due to a lower impedance and
waste of energy 1800W goes to excite rotor where in RV is sustained with 80W -100w

16
In Wire length (input line and wire size you can have 2 different current values if voltage node slips out of motor into input
wires. Either can be near 0 and one can be 10 times the current ...
Solution, Use Iso trafo & Measure in the power line side ...that filters out the RF node effects ..

To get minimal sustaining input the following needs to be done.

Keep optimal Wireturn parameter to core & capacitor relation That is, try to create best and highest hyper Q LC tank
Oscillation parameters.
Have a variable frequency Variable amplitude (voltage) and pulse-length adjustable source.
Intent is to adjust frequency as Voltage is lowered to maintain synchronization and proper co-phasing.

Any wave can have a POWER component or a RADIATING component all depends on how nodes are configured, phase,
polarity , spatial projection and relative media it travels on and type of energy as source of emission ..

Turning things "on" by turning them "off" Charging current node to virtual infinity in short ( Infinite capacitor)
Then turn it to JOULE potential and discharge non reflective to source ...
That’s the simple secret to create OU

In OU test light bulb amperage must be equal to LC amperage and be in series with LC (LRC ) The light bulb is filament
one not the GAS operated paralleled one in BAP page That is harmonically semi rectified driven (another effect) read
chorus motors patents..
That LRC done right can operate light underwater as Voltage drop is 10% or less of line C voltage ...
As gray did ( he was Using RF nodes ) nothing else
RF = radiant energy = resonance = OU = (TRANSFORMATION )
Fact .. Theoretical cop 1.618 real test 1.33 gain 1000W light bulb at Unity PF

A dc pulse is FED as to saturate a COIL with a given LOW impedance at a minimal VOLTAGE drop at where at
collapse of that impedance the Current tensor transfers as a LONGER wave higher Voltage energy potential to a
capacitor.
Saturation determined by input voltage, pulselength and COIL impedance JOULE potential.
Where Output also is determined by Collapse duration, Capacitor Farad ,and R load combined also as JOULE
second potential where efficiency is defined as .
Power in = T x I x V / power out T x V x I where POWER factor becomes irrelevant .. = efficiency (COP)
In AC and DC Time "T" can also be defined by peak to peak value or RMS value depending in APLICATION ......
I express it in TIME as to define a TRUE WATT hour Integral to the equation (Bullshit remover) True in scope
MEASURMENTS average powerbase ....
A big problem I see in ZPE R&D is people inability to properly integrate Time constants to frequency and power
equations specially working in PULSELENGHT formulations ... Study Seikes Work ...

There is specific nodal distance radiated power becomes non reflective , same Collectors can be used in Ferroresonant
sources Transformers , al old dry 3 phase transformer can be made to resonate in 3 paralleled LCs to radiate field to space
and induce ZPE energy into properly tuned receptor array ..

17
Radiant energy does not heat steel but E field induction does ..Like in smelter HF induction coil heating ...
A simile in transformer use ...: The problem arises as loading phases A&C of a 3 phase transformer and using centre b phase
as AC input the loading causes the field to project out of the sidelodes to EXTERNAL part of transformer as induction E
field but NOT, I repeat NOT RF radiant energy ,that causes the metal harness & transformer box to vibrate and heat up until
things start to smoke, You have to be aware of the nature of the problem else unit will remain quite under OU not even able
to compete with standard motors.
If you work in pure radiant energy taping the radiating fields is non reflecting but those E-fields do reflect being tapped as
impedance changes in origin (source LC components ) your solutions are Ok but he needs first to solve the Field problem,
go to pure resonant states

Saturation ZPE & resonance

Key point , a pulse can saturate a coil to maximal magnetic force .
In a given transformer laminate the best ampere turn to core match is essential , that is Pulse and COIL ampere turn must be
optimal as to transfer MAGNETIC SATURATING potential into CORE fundamental natural resonance ..

In hi Q states the energy required to sustain a resonance condition is minimal ,as RF rule if dipole is tuned you have no
reflected power its say SWR = 1:1 SWR is (Sine Wave Reflected)
Newman Motor Was OU and used a ROTOR magnet where being MODULATED as spinning element it became
MARNETIC amplifier (NOTE I use MARNETIC not MAGNETIC )
Passive field is MAGNETIC (MAG Passive Static)
An ACTIVE field in a WORKING PM engine is MARNETIC (MAR Active - Movement/in motion)
"magnetic (Static ) -> Marnetic (dynamic movement )"
In Kone’s Coil Shorting magnet being ATRACTED to IRON core energy accumulated in pure current node as released it
becomes pure Voltage potential (voltage node transferred to capacitor joule potential , the problem here is (Sinewave
Power) /2 as t=T/2 T= (frequency as time ) so e Energy is miscalculated to be OU as 1/2 of it is really engaged ..

http://en.wikipedia.org/wiki/RLC_circuit

The theory is simple radiant energy is RADIO frequency (RF) Stochastic resonance theory proves energy can be gained by
a signal from the ambient noise exceeding the power input ..(one of 32 methods).
Gain can be achieved in hyper-resonance in crystals as well as IRON material read MRA Norman Wootan work.
Control amplitude, frequency and pulse-length and Overunity transform states are obtained in standard machinery
(resonance ), tuning and Power management using RV & transverter circuitry with the OPEN sourced CIRCUITS
developed like deliverance, Phil’s inverter circuits Kone’s diode recovery applications and you have looped systems as a
result of taking Energy savings ZPE science to real models ..
Any generator can be made overunity ,if you design it as to transfer magnetic energy in semi resonant modes to charge
potential.
Induction -> + RF resonance - > + vectoring to joule charge potential equals energy amplification and overunity .
Using standard book rules and thermo-dynamically justified standard transformation mechanics (nothing new) was there all
the time.

Fact all air conditioners are OU (find out why ? ) in British thermal units BTU , there is the answer; Apply that to electric
power ... (you get it)?

Raivo

18
- Energy is transformed from other sources (thermodynamic origin, electron spin...) or stochastic resonance - it is as easy as
that -simple science - no voodoo
- OU is transformation - not perpetual motion (you maybe hate perpetual motion, but you know that heat pump is OU
device)
I've met normal scientists who have claimed some anomalies but do not know much how to explain it. Example: water had
anomaly when you "fire it" (with ultrasound), it may produce physical power million times more. Again - when (resonant)
parameters match.
It is well known Easer (Lasing) phenomenon - term by Hector. The same is BEMF, when certain parameters match it will
produce more output in LC charging curve. Note that energy is not gained from the same source (perpetual motion). It is
transformed by stochastic resonance. (In resonance the energy transfer is the most effective - resonating to material
parameters - you may hear the trafo increased sound, temperature drop, whatever)
Dig inside free-energy and EVGray group there is info about CIG (Capacitor Interrupt Generator made public by Hector,
which uses near same principles). It can be done with or without electrets. This is practical and can be replicated.
Methernitha has been made intentionally with so many whistles. First, start with Rotoverter, if you touch it you'll only
understand ;) (Or put a question out into EVGray list, they are happy to help you)
One thing to obtain OU is resonance. For example in LC's (part of RV alternator, part of Testatika and so on). As Hector
say's...simply relate it to RF and standing waves! Didn't understand yet?
Hit a high Q resonant LC 1 time with a specific amount of energy (consider it lossless). You get an oscillation with
amplitude = 1. Hit it a second time AT THE RIGHT MOMENT, CONSTRUCTIVE, with the same amount, you get an
amplitude of 2, then 3, 4, 5, 6 and so on. In LC, your voltage goes as well x2, x3, x4 and so on.
But the energy within C in LC rises with E = 1/2 C * (V*V). Square of Voltage! Get some energy from cap at the right time
(in SQUARE) and replenish at the right time with your energy source (RV-prime mover, Testatica electret segment disc or
whatever) LINEAR!
It's just wave dynamics related to resonant LC. Nothing more. And yes, there is an energy source which delivers the extra
amount of energy.
But as you can see, for the first wave dynamics understanding is enough to replicate the effects.
Want to know, why Hector always advises to use RV instead of other things? Because it's so damned simple and the
cheapest way to do it.
I don't understand why people always searching for unexplainable mystical effects instead of taking simple known facts.
Sometimes I think it's cushier than to take a formula and calculate something or to build a device.

It’s drifting resonance as unit accelerates leading and then goes lagging.... a bit more or less cap solves the problem
Better shorter wiring will also help...
interesting experiment is put 3 wire turns around 2 inch plastic pipe in line of the vectoring capacitor (running) and use Nb
magnet to series mag tune the cap ... as and OLD type radio Plunger Core tuner .
Remember this same effect you get on an OU system generating LOW cycle per second hyper waves. Similar to 2 VFO
tuned frequency beating in resonance; ED got same effect on loop trials.

Another thing that creates this is the utility power source specially if there are fluctuations on impedance within the
UTILITY lines themselves creating phase angle variations "drift" of current and voltage (Becomes Virtual Impedance
variations relative to RV ...
Using 2 current meters you will see phases current will drift also within 3 phases one going down while other goes up
..Using POWER FACTOR METER you will notice a POWER factor fluctuation in proportion to the current one in the line
input.
Its part of many little bitchy things we must learn.
Use motor with Inverter to see if it reacts in same way or if problem goes away...

19
Another AD on
Initial SERIES loading also causes oscillation on reactive values
A light bulb resistance on a line becomes a variable as its resistance varies with HEAT as power intensifies or decreases
creating alike of tunnel diode oscillator.
Same on variable loading to RV alternator LCs. be it hi amperage DC motor or the like.... RV alternator excites and as
motor goes to maximal speed it dies then re excites again then dies using RV to diode plug to DC motor connection ... diode
bridge will do same.
If you mechanically LOAD the DC motor to a given POINT it will stay ON as impedance is balanced with RV alternator
LC as to maintain self excitation...
Understanding why this happens is part of understanding the mechanics of OU energy transform. Every part relates to
others every value parameter is affected by others ...tuning essential .know how vital.

The only fuel we need is the "ambient noise one" ...

thermally is about 90W per sq centimeter in the air ....
like 24KW emitted from our physical body in all of its energy spectra ...
and about 3 trillion watts SQCM at the aether quantal tensor region ....
to name only 3 sources.....

http://peswiki.com/index.php/Directory:OC_MPMM_Magnet_Motor
Extract ....When the operator holds two of the three secondary magnets (which are apparently interfering)
the operator holds ! ( Operator energy )
What ever happened with the no operator holding ones ?
Reread my old postings , and get alnico 12 ...

Link to article with pictures on waves .. http://sciencenow.sciencemag.org/cgi/content/full/2008/229/1?rss=1

Seems It fits RE=RF RV theory quite well ... Reread my postings ..
Aether density zones aether Vacuum zones
Wave compression in time & space (I described here the same things this "NEW" experiments demonstrated )
Gustavo: What I could understand from this article is that optical parametric amplifier controlled by laser, is a media where
you can modify (increment) the relative permittivity and the permeability. So the velocity of EM waves are reduced.
I think that if we can find a material where you can change the permeability with very low energy, you could use it as a
switch to control the magnetic flux from a magnet and redirect to a coil to produce EMF. (energy)
Perhaps, the concept velocity, is not correct and we have to talk about compression. Something similar when we perceive
different realities when we are in different gravity fields.
That is what I had being explaining for the last 10 years ...
Think what VTA does , It warps the magnetic field with low energy to permit a mayor inductive movement to take place
(magnetic line shift from saturated states to 0 flux (Vacuum ).
Field Collapse is energy Source ( Coil returning to non-saturated states)
BUT BEARDEN distorted the original revelation ....
class C magnetic flux modulation exited electrical amplifier to be a bit more revealing ....
Magnets are Energizer Bunnies waiting to be sexually exited !
( As their fields "discharge" they do MULTIPLY the energy )

20
Magnet flux is SHORTED or interrupted to 0 or de-phased whatever SATURATED coil is in its INFLUENCE discharges
from SATURATED to NON saturated or semi saturated modulated states.
Its a SOLID STATE Brown-Ecklin generator ... (same mechanics but INVERTED ) as we are SATURATED then
MODULATED to NON saturated RELEASING ENERGY as TRANSFORM ... (FREE energy )
This is the ORIGINAL magneto-transistor I described in JLN forums in 1999
Give Credit To SWEET Floyd , but spit in his grave for not telling !

http://news.nationalgeographic.com/news/2005/01/0114_050114_solarplastic.html
If you read it mentions NANOANTENNAS !
Read my OLD postings on RF and solar energy ..
Light is RADIANT energy = RF
You can get energy from ambient heat and have self cooling array converters ..
free energy & free cooling ,,,,

1.3. Summed on RE 2
We have a coil with an Iron Core ..
We have a Pure DC power source ..
At turn on the Voltage is Maximal of power source
The COIL initial AMPERAGE is 0 amps
That Means as connected the STATE of current and VOLTAGE relation are 90degrees apart in a SINGLE turn on
SWITCHING .
Such STATE is in RF condition and it RADIATES into space as the MAGNETIC field is increased and decays & stops as
coil reaches maximal amperage value and phase relation is 0 (co-phased) as DC potential of current and voltage .
Such RADIATION mode is in CURRENT node of a virtual dipole , the magnetic field created by the current expands the
AETHER creating one of the (TESLAWAVE) component (electric explosion).
Gustavo: What is the density of the aether ?
Can be determined by the energy needed to displace it creating a magnetic field in a superconductive element with
a virtual infinite impedance (Zero resistance in relative time at starting an electric flux)
Aether DENSITY is relative to GRAVITY and gravitic "Charge"
Because, if a magnetic field can expand it, it seems that aether has the "same density" or a "similar density" than
the magnetic field.
Not necessarily such as density can be relative to Mass charge & potential (Impedance related )
The stick stirring the water in a pool can be denser than the water..
and the air creating WAVES in the sea can be much less denser than the medium it creates waves on , on Aether
same rules apply (acoustics)
Autotogoegocratic self sustaining hologram (In a sense) ..

And aether to magnetics is as AIR to water .

(Density answer are within the lines in my post)

What is the time that the aether take to recover its initial state ? When for example, the magnetic field collapse?

21
 Is superluminal (c^10 or 10x C, depending on external factors)
give it a few kilometres more or less as Doppler shift correction in time space curvature relative to the place you
are located .
Its 8 octaves per dimension to add to that ..
With this time, we can find the aether resonance frequency ?
With proper devices its child play , you can convert mater to energy and energy to mater using aether condensation
technology ..
Quantum mechanics is starting to explain Aether as infinite non-solid "solid" we may say a hyperparticle that
contains within a filled bubble all that exists .. the macro within the micro and its reverse .
(Relative to the observant point of reference ...)
Within normal physics equations the way to find aether density can be easy calculated ( starting by the Ambient
temperature decay in free space) Aether will influence such decay . (Tip)
With better toys I can teach more , the universe is also based in transformation and in a sense Runs on RV’d 3
phases ...
Tesla got that one quite right !
At switch off we have the coil with 0 current state that transforms a free collapsing MAGNETIC FIELD component to A
VOLTAGE NODE component ONE .. Aether collapses toward coil inward (electric implosion)
From 0 amperes Voltage logarithmically increases to the square joule energy contained within the coil multiplied by 1.618
,here the inter-coil capacitance the wire measure at coil ends influences in the RESONANT characteristics of this OPEN
LC its ends becoming CHARGED within a current node under a voltage potential ..
Explains all phenomena described in books about Spikes & RE
Proof ? a capacitor placed at coil end across a diode will acquire a joule potential until such flow reaches equilibrium ..
Capacitor acquires max voltage of its theoretical half wave RMS value Resonant state ..(equilibrium..)

1.4. Magnetic field

Magnetic field as in microwave surface current tends to go to the surface as charges repel from center as a magnet ROD in
sense is linear monopole from a side angle cut view ..
The same parameter goes as in MONOPOLE sphere a tube being 1/5 thick as its radius, being hollow center in nature ...
(This better described that in Phil patent ) as to avoid the repulsion in center of core lowering Lenz effect and increasing
saturation capacity of such core ...
Seek my postings on monopoles ... and the one I suggested using COMPUTER tubular ferrite noise filter baluns. Kone long
ago used this as cores and they got the proper ratio .. near 1/5 radius thickness..
if you see a Permanent Magnet motor rotor it already got slot spaces as to create similar effect ( Raivo got the pics on my
multiphase miniature motors and the 40 phases ones where this can be noticed.
When I tell you that you can get OU from ANY well designed standard generator is that I am right ... the CORE loss issues
are lack of information ..Actual laminate cores go as to .003% loss, My experiments were designed to show people how to
get OU from ANY standard alternator motor-generator ,, to create RADIANT energy as to permit its study
The Multi phase generator is next step ,coupled with resonance and vectoring power management technology Here is that
Electronics come to play , switching things on by turning them off, shorting to create virtual infinite capacity as to charge L
in pure maximal saturation current nodes .. to vector discharge as PURE VOLTAGE vector into condenser (capacitor ) to
attain logarithmic magnetic amplification gain.. This also based in OFF the shelve components ) with a bit of simple labour
intensive part manufacturing ..

Magnetic Field is a flux

I tried to patent a monopolar magnet years ago , it consisted of Half spheres magnetized in & out surface being its diameter
1/5 of its radius ...

22
On 2 spheres being of inverter polarity 2 halves NS-NS and 2 halves SN-SN
one made outer N pole the other OUTER s pole
Flux cut-off ! the OUTER poles did not attract at all !
Other phenomena occurred ....
Until I can repeat and show ... I tell the rest ..
ITS RELATED TO RUSSIAN TIME MACHINES !

Time accelerates in one diminishes in the other ,

Aether flows inward in one outward in the other alike spherical condensers ...
So there is a correlation with electricity & MAGNETISM just being another FORM of electricity ...
magnetic - marnetic - vitronic ...
VTA just modulates this flux as class c amplifier modulates an 800VDC power source to amplify RF (see linear amplifier
theory , grounded grid pentode class c amplifiers design and theory ...
Magnetic FLUX can be modulated as a DC flux & used to amplify a signal. VTA does that ..
Free energy from the Atom electron spin generators (ambient noise & thermal ambient radiation ...) not to speak of the
atomic AETHER flux transform within the atom itself ..
And Phenomena is to R&D in RF power engineering ; As ejaculation is to sex ..

1.5. Time
TIME related formulations in RF are the key ...
Let me put it in a clear way A pulse-length determines the its specific FREQUENCY
Landa = 300,000 divided by frequency where TIME determines specific MEASUREMENT of a compression of
energy (amplitude within a given timeframe )
sample a pulse-length of 300 millions of a second will have an exact measurement of ONE meter wavelength
There is where everybody is confused , IN DC we can have single pulses with pulse-length determined character so
its a WAVE in a timeframe landa value . And nobody has explained this correctly over the past 100 years..(except
my person). I have explained it over 7 years long period in about a hundred different ways .. (all mean the same)
PINGING coils ( make coils squeal like pigs ) & others poor man thyratron postings (Photo flash used as thyratron
) postings ....pulse-length = frequency = landa length equivalent ..

Easy tested :
An specific pulse-length with specific amplitude (voltage) driven into a resonant tank (LC) at specific leading phase-
angle will cause coil to drive into over-unity states ..effect being accumulative ..

Pulselenght = resonant parameter within the fluidic equation...

Pulselenght & amplitude = FREQUENCY and is not quite relative to speed, it can surpass speed of light.

power is being vectored to RF states where loss is driven forward in time as logarithmic magnetic amplification factor
where energy is stochastically transferred from the ambient into the machine looped energy component ...
Capacitor charges at the rate where ...
I (current) to the square relative to discharge of RF signal in as a RF pressure vector in capacitor where such vector charges
capacitor as if it were an LC component IN an RF frequency tank ,

23
Signal is time compressed in RF component as pulselength is reduced and delayed relative to normal time space component.
A capacitor as rule charges 4 times faster in RF resonant mode vectoring that standard DC electric power states
IN RF ac radiant energy is always in "turn on states" Tesla attributes to IT. IN RV is at each half cycle within an AC wave.
Energy is gained in partial time reversal within unit itself .. time goes much faster inside the capacitor than in relative outer
space ... (its the stochastic energy wall )

again Joule - ampere and relative time are the answer here ...RF engineering gives all the answers ....
speed of charge is relative to cycle per second ampere joule component within a virtual RF tank ...

Gene: dynasphere
Its treated as though its a living extension or consciousness to some degree as intent and feeling seems to have effect on it or
vice versa, it affects those in its reach in some manner.
If device uses TIME as energy source in its transform mental energy is increased by amplification inversely
proportional to time decay and squarely proportional to matter Oscillating to C (frequency of LIGHT). Time
shortens and at light speed = 0 so static matter hitting oscillatory C frequency expand to 4rth dimensional state
becoming non perceptible in this 3d one
AS time regresses mental energy is multiplied (see RV anomalic phenomena postings) SEE operator effects
commentary on time energy anomaly machines (degaussing of the matrix) turning it ideoplastic or subjected to
mental energy influence at trans-dimensional C tensors.
That is why NASA pilots trying to pilot primitive draconian ships were literally "eaten" by their own fears (EGO) as they
hit C rotation-state their own negative ,mental creations self destructed them and their "acquired" test ships.
Its kid stuff but it will take a few millennia to be totally understood by the actual scientific community.
Some toys are not meant for this earth yet.
As the diamond water ships & other toys found in ancient caves left by the visitors, these were meant to be found by a more
evolve humanity, not government warmongers .

1.6. Dimensions
Ken: String theory states that there are 11 dimensions.
4096 dimensions governed by same number of LAWS . Divisor is number 3 inter-dimensional complementation 7 man
BASIC numbers within this LAWS 1,3,6,7,8,12,24,32,48
7 galactic sectors compounded of 7000 galactic streams with 7,000 galactic strings each composed of 7000 galaxy with
7,000 planetary strings each with 7000 planetary systems having life .. 7 colours , 7 musical tones 7 particles 7 human
orifices (but most humans prefer to be assholes) ....

First Planar
Second Planar and width
Third Planar width and HEIGHT
4D Planar width and HEIGHT projected in TIME hypercube
5D Planar width and HEIGHT projected in TIME hypercube
and within the mathematical crystal of unified form (pure mathematics domain )
6D Spiritual Domain (existence is a continuous sphere in-out infinite .
7D "the absolute" Contains all other within the ONE here lies the inpass ring at the center of the universe ..
Where this corroborates ? human chromosomes ( Where I think Lately I got from 48 to 60 with a few interesting biological
changes. I think I can put on a Devil Mask & angel wings and sit on a throne and let people come and kiss my ass .. Read
Masonic Prophesy & folklore.

24
1.7. A little bit on TESLA secrets and its HERZIAN conflicts .....
RF is created as Current & voltage are 90degrees off phase. Resonance RF = RE.
In an Antenna a NODE and Anti-node are created. One is pure current (electron density) (Aether compression). The other is
pure voltage (electron pressure) (aether flux).
Voltage is pressure, apparently Weak & current is density apparently strong and they have specific energy VALUES within
Aether manifestation .
Looked from 4D perspective such phase relation is locked within an SPIRAL flow in time (justifiable by optical slit
experiments as a Cornu spiral )
A corpuscle of light can be a particle (dense current node) photon or a wave
voltage aether pressure photon manifestation... (aetheric)
Where E=mc2 proves me right (speed of light) photon is 4d manifested in voltage node, 3d particle as 90degrees are bellow
light speed phase (current node) ..
in particle dynamics can also be reversed (matter anti-matter).
(Applied to spikes) especially to spikes!
Hertzian wave is VOLTAGE node excitation of aether medium to wavemotion alike stirring water in a pool .
Tesla wave is alike tapping a long metal bar at an end and creating a density acoustic travelling wave within this LONG bar.
It’s the CURRENT node created in a TESLA transmitter where the AIR capacity concentrated the Electron pressure
component into a Pressure current one (series resonance of Earth capacitor with Air capacitor)
resulting WAVES are TESLA WAVES ...
On a normal transmitter (AM station) we have AIR impedance (antenna) radiating in parallel resonance with EARTH
impedance (ground). This is Hertzian wave....
I hope this Clears up 100 years of bullshit created by Tesla and Marconi bird brained students...

in DC PULSES same RF LAW and RULE apply and that the RE initiated at Turn on in any DC circuit Has RF nodes
manifesting along the circuit and that this causes radiating into the medium (RF transmission of energy )
Its very simple the signal is split in 4 segments when dealing with DC pulses but LAWS are same as for AC ... (resonance)
Read my old postings where I state that a battery being discharged is a very long wave half sinewave ... (think Why ? ) and
knowledge starts to flow .
Ken: It looks like a half sine wave if time speeds up. I wonder if it would be transmitting.
That’s the fun every time a reactive DC circuit is turned ON it transmits until current and voltage are in phase.
There Is the RADIANT energy that people cant grasp ! Its RF (Radio Frequency )
Take a Fourier analysis
And to add more .. When that same circuit is TURNED off, the magnetic collapse produced by 0 current draw
transmits another RF signal with a VOLTAGE spike or transient that can burn relays and fry switches in a display
of plasma driven fireworks ...Specially on large impedance large iron core trafos!
Reread my postings on NEWMAN MOTOR spark gap arcing; my comments on BEDINI spark gap "theoretic"; on
the GUN diode alike effect oscillations within an spark gap discharge dynamics.
A tensor (scalar) can be detected using a diode and a capacitor polarized in the direction of its differential state ,,,
One of the demos I want to give is run an RV on purely RF (radiant energy) and feed another motor using single wire & air
capacity at each end ...
That Ends with Peter Lindemann Theory and demonstrates Hector FACTS are real ...
That is Why many are afraid I get funding , it ruins their religions and dogmas ...

25
Tesla said that RE is Longitudinal Waves of compressed ELECTRO-STATIC potential.
Tesla did not know what he was working with neither you read my postings right ... Reread a good book on acoustics &
physics then read my postings tie the strings and do the lab testings ...
Raivo got a TESLACOIL modification I did .. ( It works) original does not perform as well .. Why ?
Tesla RESISTED Hertz wave theory instead of looking at the CORELATIONS of SUCH .... HIS capacitive AETHER
coupling to REACTIVE hertz one.
you can tap an steel rebar rod at its end or wave it across its length; its wave propagation you get ...; acoustics LAWS apply
to Radio Frequency also; treat the 2 as one enlightment is the final result...
or TESLA found the relation ? ( HE bitchfighted Hertzian theory to death ) instead of striking a guitar string end and hitting
a drum to find its audio wave correlation ...
Tesla played drums (LW ELF RE) , Marconi played violin (Hertz wave); They fought over how to play music .....
I can play all instruments (So what ? ) Is RV a trombone ? or a flute ?

1.8. On frequency
Basically a repetition ..
In a motor as frequency increases relative to its impedance so does its HP output as ROTATION RPM is part of the
horsepower equation (reread Kone’s Torque RV experiment) .
In a power transformer Ampere turn relation we NOTICE a VOLTAGE increase at the transformer secondary winding as
FREQUENCY increases .. Somewhat of voltage increases to the square of the frequency (relative) , until damping or cut-off
frequency conflict arises ... detuning off the transformer transforming range of natural frequencies , operation range within
given input & output impedances relative to operating frequency .
Gustavo: In my min TV tests: With polyester cap (at secondary side) and in stable ferro-resonant state I could
achieve COP=2,1, and in an unstable ferro-resonant state I could achieve COP>= 6.
Using the formula Power OnCap = 2 * ( 0,5 * C * Vpeak * Vpeak) * Freq
I said stable ferro-resonant state because when I power the circuit off and then power the circuit on, the ferro-
resonant state is still "resonating". But in the unstable state, when I power the circuit on there is no resonance and I
have to decrement the frequency until the circuit enter into stable resonance and then increment the frequency little
by little just before the system stop its resonance.
Unstable broadband with harmonics to stable resonance until cut-off frequency is reached ... Repeating old thing...
(Tesla’s Point of Breakdown) ..
From DC we see power draw as pure ampere load, so as long as we maintain this we get NO power usage increase on the
source as long as we don’t increase its AMPERE draw ..
So we get to FREQUENCY drives and INVERTERS fed from a battery DC source , driving a MOTOR also from DC
section of the inverter we again see that POWER draw depends on the average current draw from this DC section, sinewave
inverters have 145VDC on its hi voltage side that are switched in an H transistor configuration to produce the modified
sinewave (averaged equals 120VAC from standard power line RMS value , or 3 phase 6 IGBT from a 280VDC for (240)
AC drive 510 to 560VDC for 460-480 AC drives ...
AC drive example : 460V drive
= 650 VDC nominal bus
(so 70% PW for 460V)
750V VDC brake (+15%)
810V VDC trip (+25%)
So if we increase frequency and consequently increase speed we increase motor HP with no power increase as we
MANTAIN same ampere Draw average from this DC source (145VDC) HV MS inverter side or whatever DC HV value we
have .
Here is where Pulsing and controlling pulse length becomes tool to OBTAIN over unity transform , as system can be
parameter tuned to acquire energy at a given frequency from its own medium ...

26
( Million dollar tip )
***************************************************
Tendency is power factor becomes a ROTARY driving force at hi impedance due to its logarithmic voltage increase as
CURRENT becomes off phase with VOLTAGE this being of less loss being reflected to SOURCE being source lower
impedance relatively to draw .
ON POWER SOURCE CAPACITORS ...
Relative Charge Joule value in ampere farads is greater than the Increased voltage POWER FACTOR GAINED amperage
draw within the working UNIT impedance value .
Got OU ? there is OU ... Power Factor magnetic Amplification Factor .
loss becomes forward gain ...
***
( Lab Proof ) RV run capacitor phase current & voltages) power exceed input power draw. ( Power factor ) semi resonant
OU state .
***
Such gain is lost at LOWER impedance relative to AC line voltages increase .
***
At Motor loading such power factor transfers to line as LOAD..
Read as capacitor phase current & voltage decreases as line source power line increases (reflected power loss due to
detuning of system natural rotary field impedance (tuned) to DETUNED states.
Also read as a Phase angle change in the 3 phase motor rotary field from a LEADING phasor to a lagging 3PH one .
***************************************************
Tuning system to its optimal self resonant frequency at specific loads.
( Reread Kone’s RV torque experiments) as there is a KEY in there .
Reread 1 phase to 3 phase energy formulas parameters apply to your own working RV sets ... (There is OU) ..(Vector cap &
virtual phases being logarithmically power increased in power factor vectoring of LC component .
What is left is learning to USE this NATURAL RE-ZPE rotary POWER FACTOR as GAIN .
Frequency management is part of the RV Horsepower game.
Its time to learn how the toy works in academic digestible terms ..
Bring on the Peptobismol and Kapeoctate ! or else ...

1.9. Stochastic wave amplification

Placing pendulum east to west so it winds in a logarithmic surface path going west, as pendulum returns east it gains
movement from earth rotation draining energy from it .
This is known as stochastic wave amplification .Its lethal to planet, if used massively it will STOP earth rotation within a
given time relative to mass energy extraction from earth rotation energy (spin).

1.10. Impedance matching

If you are able to match and use the ferros LC crosscurrents into battery feeding ferros with bandpass coupling capacitors
from tripleflux ones you got something to awe at ....
I have stated that a battery is nothing more than a BIG farad litic with limited discharge capacity but it does not mean it can
not be charged like one with a DC tensor or vector from a Hi Q low impedance Hi current resonant LC .
The issue is Impedance matching (Amplitude) being most significant aspect on OU management of resonant elements
relative to battery amperage under OU states,,

27
1.11. Does DC really exist ?
IF we se beyond the normal perspective of the flux and enter atomic dynamics, DC is a series of added half wave electron
jumps across atomic orbits that sum up on what we call DC current.
This current carries the atomic noise of all the components it crosses and we can identify extracting the evoked potential
spectra all the elements this current comes in contact with.
( An extended vision is required to tap natures secrets )
I just added a bit more to what "DC" is , that is true secret of ZPE bridging RF , DC and AC power engineering into one
concept of power management and transformation. (over-unity)

LOOK at DC as "very long wave" AC signal half sinewave "SCALAR" in nature .

treat it as RF and there is where over-unity resides in form of transformation of existent energy within systems themselves .

DC is a very long ac signal half a cycle being say what it takes to discharge a battery and the other what time it takes
to recharge it forming a LONG sinewave within the parameter of a working apparatus...+ - "waves"
once you understand the above you can begin to see DC in another form when pulses are used .Modulation,
resonance & other apparently unrelated AC-DC parameters that in reality EXIST and governs functions within the
2 (AC-DC)
A rectifier only divides ac component in 2 half waves ..
DC is co-phased AC into a charge averaged energy component (RMS) remember to look it from 4rth dimension
reference points not fixed limited 3D ones..

1.12. Transformation
You've mentioned several times there are 8 transformation elements, but we only know 2 (ambient heat and electronic spin),
and are only able to apply the first in practice, if I understand well. Any hints on how we could go beyond that?
RESONANCE and transformation using bipolarity ,,,, Like a hurricane transforms Heat to Motion ..
Nature is an EXPERT in transformation learn from it ....

1.13. Nodes: anti & otherwise

Sep 27, 2003 : Nodes: anti and otherwise, ie.a 90 degree sniff!
RV concept was first postulated in EARLY 1969 internal corporate memos as to increase eff% of hysteresis type motors
using semi resonant LC tanks. (Docummation corporation) where I worked as instrument Technician, and Adapted it to
ROTARY CONVERSION UNITS IN TEST FIXTURES ,I let it die out as I quit company and destroyed all my paper work
(Including an m300 cardreader serial # 50 that used half the wiring and half the power than a conventional one and had
passed all the phoenix mill specifications at that time.
Why I quit? because a greedy idiot wanted all the credit from my work, HE design it ? He set me up in a trap, I took the
docs and quit .....( After A week they fired the engineer and 5 more from the main office because they were not able to
reverse engineer my prototypes ) they wanted me back ( I just say NO )with middle finger in erection mode...
Back to RV...: In same terms RV INPUT REQUIREMENT Can be termed ANTY-resonant as internal 3 phase generation
semi-resonant , and RV alternator output FULL resonant .....
It is nice when you take a concept hide it within another and sell it as something NEW but in reality Anti-resonance LC is a
NULL filter Anti resonance is a doctorated BULL s**t! A fancy name and way of using RV effect , I posted
PREVIOUSLY that if you RE-WIRE a common 120vac motor to 460V and use 120 VAC CPS the 90 deg STARTING
WINDING being tuned for best angle phase shading using OIL capacitors you get RV EFFECT, also if you run 120Vmotor
at 24VAC using right values of capacitors for starting and running you get RV effect, USE a PM rotor you get Overunity.

28
ANTY-RESONANCE is what you get in your home outlets all the time I dare anyone to proof me wrong! ,I just say what I
say in a single 4 word sentence: “Current-voltage phase relation” .
Anyway its the SAME old NEWMAN MOTOR concept also ,it is just Newman did not know how to apply it to AC motors
and I did , SO AC RV IDEA remained Mine and I gave it as public domain ,the concept or RV alternator is old as to use any
motor as a generator putting a capacitor in any ABC phases ,but using RESONANCE LRC concept in series is NEW (Mine)
made Public domain ALSO as is also E GRAY RADIANT ENERGY SECRET as I lit a 1,000W lightbulb underwater as he
did,, filament voltage drop within the water 19.0volts AC ,put in normal line power it just EXPLODES .. tripleflux capacitor
,and triple flux FL ZEUS lamp is also concepts I gave as free domain.
MY GOD! HOW MANY TIMES I HAVE TO say RADIANT ENERGY AND RF RADIO FREQUENCY ARE THE
SAME! How much difference in RESEARCH it will make if many understand this FACT and start giving proper credit to
the statements I give for public domain. I might say nothing if they say BASED IN RV EFFECT we manufactured this
motor and so and so and we sell it to you cheap....(no patent)
I just say go ahead and Buy one .... I have 230- more non-disclosed inventions to put out that will make RV concept look
like a toy... one magnetless homopolar generator ....
As I say RV was meant as a POWERSOURCE for the NOW FREE DOMAIN ECKLIN - BROWN GENERATOR , AND I
might feel honoured if ALF uses it to drive his disc interrupt generator and sells the units for profit ...as Any other inventor
can . Free energy is free why put a dammed leash on it ? we need abundance not scarcity....
I think we have being suckered in the wrong path, divided in disunity so we cannot obtain UNITY, this patent (1978)is quite
EXPIRED (public domain ) but it mistakes an infinite impedance as anti- resonance where in ac no such thing exist in
relative receding time within a rotating inductor (SEE Seike work in 3PH rotary equations "they fully agree with RV
concept" . AS UNIVERSITY DOCTORS THAT WITNESSED MY WORKING PROTOTYPES ,,, but FEAR the system
wrath if they 'TALK' so RV is now UNIVERSITY "UNDERGROUND" TALK being teached in secret.....like Galileo
Heliocentric theory.....
some day it will be known quite far,,,, I REPEAT: OVERUNITY IS TRANSFORMATION ....
RADIANT ENERGY IS subjected to RF (radio frequency rules) THEY ARE THE SAME! SEE also (stochastic resonance)
A magnet is just a long lasting vitrionic energy source modulate it as class c linear amplifier it becomes a generator
,modulate it in push and pull mode (YOU HAVE REPLICATED A working MEG) LOOP IT you got a VTA .....
Interpret my words (Even if you think I sound like and arrogant SOB) You will get wisdom....

1.14. Narrowband & Broadband

It seems the term narrowband Q and Broadband Q and its relation to ZPE is lost in the gentile mind ...
Reread all postings on RV relation to MRA and the effect of series resistance on LC loading ....
( relation is reversed to ohm law in relation that lower resistance < 0 implies overunity in node tensor potential relative to its
power vectors, one region is dense state where the other is vacuum , in scalar potential its 1.618 as per basic logarithmic
gain ...
(this also verified by VTA Grey experiments as to be the ZPE basic amplification factor (1.618)
If people cant understand MRA they will not understand ZPE at all ...
Idea is to sustain gain and split the EXESS non reflecting to the reactor core using 2x2 capacitors and balanced H gating. (I
posted method a zillion times) But what the use ? .....

1.15. Mass & acoustic resonance

Phil: Winding 2 coils on the one core is the easiest way of having the true centre of the wire resistance exactly in the centre
of the core.
The easiest way too do this is: Start your wind at one end of the core, then wind back and forth too the middle of the core
until your preferred diameter is obtained. It's easier with a thin plastic washer with a slit for your next winding being glued
half way along the core. Then continue winding with the same wire (No joins) by running the finished wire of the first coil
down the washer slit and continue too wind in the "same" direction as your first coil on the other side of your core. Make
sure it has the same amount of turns and layers as the first coil.

29
Now you have a kick ass coil that is tuned and balanced on your core. As I mentioned before if you want too increase the
power of this coil much higher again, then run an outer cast sleeve or soft steel wire over the length of the coil where all 4
poles are now operating properly. This prevents all the losses and also increases the field strength where splatter pickup
coils are now not needed, as we have no splatter wastage. The coil in this configuration is extremely powerful and efficient
where expect too have near twice the output. The same coil is also ideal in a generator configuration.
Re: “Winding 2 coils on the one core is the easiest way of having the true centre of the wire resistance exactly in the centre
of the core.”
Error , measure same length of wire as to parallel wound 2 wires to form dual coil ... (that is where the term bifilar or multi
filar wire is born ...as same turns will equal same wire length in same AMPERE turn ratio...
Remember I used to DESIGN and test the dam thing for military 35 years ago ... (I know )
same AMPERE turn for same length wire in equal CORE density area within a looped closed field core (transformer). for
exact parameter in resonant LC multi tanks design . That is applicable also to open pole LC design.
The circular mils of wire and length determine mass effective in ZPE state , in dissimilar length but same Ampere turn ratio
the mass imbalance will create cross flux in parallel windings , that is a voltage differential will be present, in pulse mode,
that differential can amount to hundred volts or more as coil discharges from Ampere node to voltage one in radiant energy
state .. (RF)
Define the magneto-acoustic NODES within iron rod in linear configuration attached to end effector (or affector) as rotating
magnetic mass , distance and position is critical for a perfect parallel coil emplacement as field will not be same along
length of a given core , in a system where TUNING parameters are critical in rotary angle of PHASE understanding this
details adds to critical adjust made possible to mitigate entropy.
Same aspects apply to 3 phase transformers used to make Magnetless Meg ... ( Try it ) you will be amazed at the power you
can get rotating in a 3 phase transformer tuned to 120deg resonant rotary field , it naturally contains your circuit parameters
in rotary lccl c relation, reversing a coil it can go cw or ccw ...

1.16. Iron thunderbolt

cavetronics: what happens when you take a transformer and at every laminate in the core you put a full wave bridge with
cap on each laminate in the transformers core? bridging each laminate to the next one
You get Iron Thunderbolt power from the hall effect currents that permeate core laminate at 90 degrees from the known
power. You are tapping "kemio" power or known as marneto-atomic induction amplification. (since RV is already looped, I
can enter in the other 9 types of electricity that exist in creation)
Going back to IRON reactor cores , the answers are in MRA .. and in the Resonant plug extraction systems plus the coil
bangers and all other good things posted in this forum ...
Get inspired to hack transformer laminates as well as to hack already done stuff
Laminates can be spaced using common paper 3 mills (0.076 mm) to separate and that increases the amperage 10 fold, some
iron laminates will be removed and core will go to higher frequency resonance but if same quantity and mass can be fit in
the spacing eliminating the interplate shuntings and tapping the iron internal currents it will be naturally overunity ...
Iron loss will have to be dealt with as KEMIO radiation disintegrates matter when iron is driven over the edge ..
(Homemade blackholes at atomic level )

Normal power , RESONANT states (Iron thundervolt) Norman WOOTAN MRA (I am not the only one telling you) OU
comes from energy transformation , resonant states are mechanic to achieve those states of transformation ,that those states
are present in all machines from MEG to VTA, Bedini, Muller ,Coler , Tesla , and that I am the first Idiot able to simplify it
and give it public (and be eaten alive by intellectual property leeches and sharks) ...Also to speak of people like NORMAN
Wootan that has GIVEN ALSO the true BASIS for OU energy transform but had being "rejected" suppresses and
misunderstood ....
READ US navy Stochastic resonance research (where OU is real and tangible truth ) not theoretic; RF amplification by
means of ambient noise.

30
MRA must be "revived" applying the MOWER basics (OLD RV RF basics to GINIS TRANSFORMER OU verification ....
made into an IRON thunderbolt "MRA" "transformers will loose weight" when looped .in some iron disappears as if
evaporated from cores...

IRON is a CRYSTAL where as in HYPERQ modes goes OVERUNITY as it becomes an ambient HEAT energy (noise
energy transponder device)

On “Negative electricity” (Norm) …(see also Spike)…

Seike refers to this Energy as Tachion energy ..
John Searl as Pair Anihilation
In Antarean Sience this is know as Kapa & Kemio
Basically is the disintegration of the electron quad composition in 3 vitrons and 1 photon (green spectra ) energy level and
subsequent disintegration of nuclear pairs in aniquilation as Proton decays to electron with mutual pair atom stil with active
proton so collapse into mater-anti mater mutual disintegration is verifiable under proper conditions ...
Its "Iron thundervolt" technology
Well tamed can be quite cheap & productive
Iron as fuel will last nearly forever (earth is 23% iron )
but also CARBON as core material has some interesting applications with Pulsed energy were tendency is to jump to other
mater element state and then returning to its natural isotope one releasing 12 times the input energy (average) as EMP .
(Interesting )
One thing to deepen on is the Iron core weight loss that occurs in the core at hi energy pulsing and how silicon iron metal
turns to CARBON within the laminates ..(core burnout).
There is a lot about this subject published already, is up to us to tie the loose strings
There is a point where Iron can resonate without going nuclear pumping energy from blackholes aether fluxes within time
space matrix ...
We have one at scalar 1.5 CPS frequency affecting our zone and is held as a fixed tensor relative to gravitic flux so its
relative speed in our timeframe equals 0 from were we can pump energy from it alike class C linear amplifier mode ....(
same as VTA ) but no magnets)
just aether space density energy tensor ..
Gene: A scalar generator at 1.5cps... so you use a laminated core wound with a magnetic cancelling coil layout and run it at
this 1.5cps to generate a local relative "zero" as a reference... then your other systems resonate within the local reach of the
volume from the scalar generator at different ratio's/potentials relative to that of the generator?
It sounds like all your systems then are running an AC mode, is that right? At least in terms of resonating... The culled
energy then is removed via the DC tangents (diode plugs or other designs) from the AC resonant state. I guess this is due
to the effect that AC has when in a resonant state of not using hardly any current?
Its interesting also what you note about Carbon as a core, it makes sense as its at the octave peak and can be pushed/pulled
to either side of that peak via positive EMF I suspect. What potential is applied to the Carbon core to cause it to release
12times the energy used to pressurize the Carbon? I guess the potential must be measured in voltage as well as in the
magnetic field density applied or induced into the Carbon eh?
Or use its electron Noise harmonics at 1.5 to 1.6Mhz electron spin frequency created within the IRON core ambient noise
figures ..
Gene: So is it a decades offset of frequency in the iron? From your brief comment it seems you imply that the 1.5cps
frequency affects an ambient noise electron spin in anything within the electric fields range from this "time source" to the
mhz range of the same frequency... so from 1.5cps to 1.5mega-cps in the iron lattice... I take it this is effectively pre-
loading the iron so that any further agitation causes the iron to "give up" some of the increased "spin energy" to the
electrical interaction (or coils pumping the iron) .... correct?

31
Yes that’s the implication, that the flux of energy within the IRON is modulated as class C amplifier to cede part of this
AMBIENT flux potential in transponder mode, where one energy mode potential is transferred to other mode one .......
Reread Stochastic resonance basics
That is PART of the Picture As Also the ATOM dynamics as TRANSFORM engine must be looked on ( its natural atomic
force resonant states ) From ambient noise to Quantal sub-particle energy potential .... all of it can be extracted .
Seike called it (the Sea of Dirac Energy ); I call in overall sum of energetic states within a known medium .. where the only
thing needed to tap it are the basic transformation engines.. (Part of those I already gave )
(Save and Keep the Notes ! )

1.17. Spike!
Lets say you have a perfect power source and a perfect pure impedance.
at switch on the initial spike consists of a MAXIMAL current 0 voltage node in a quarter wave of a HALF sinewave
component ... at maximal current then circuit is opened we get a VOLTAGE spike of maximal potential within the inverted
square energy of the amperage potential multiplied by 1.618 in the WAVELENGHT of such impedance in free radiating
space ..( we get amplification from space gravitic tensor to start with....)
couple it to a capacitor and the spike will charge the capacitor to an specific potential (voltage ) with a Joule component in
FARADS mF in case of low farad value hi voltage caps ...
We get Energy from AETHER density in capacitor media ...
this all within a HALF wave of AN RF signal ...
again to be understood researchers can’t escape from the fact that I am right and radiant ENERGY in its many forma RF
and RF rules apply With the consequential FACT that magnetic amplification , and stochastic resonance are part of the
transform mechanics we see in actual machines using this STATES of energy .
Spikes are a FORM of RF energy release and since I disclosed LIGHT was also RF the forum leeches took a giant step in
solar cell development using quantal diodes I well described before (CARBON nanotube ones were manufactured ) in this
forum ..
The Electret Permanent Charge Capacitors also were DESCRIPTED in detail The NEW thermodynamic transform Was
also Explained (water Engines ) and implosion mechanics ...
Fact is the WATER engine is already tested by a member of this group and it worked as PREDICTED in my postings ..
transforming Gaining energy from the MEDIUM
It’s the correct justification and revelation to re-vindicate all those inventors that worked on this systems (like Leroy
Rogers) and died or where lifetime screwed for it...
Gaining energy from the MEDIUM endothermal system and transforming HEAT energetic component to mechanical
energy one .

On spikes dump into choke then have it bounce into a capacitor as to lower spike into a wider lower voltage pulse ...
Remember an spike is just a signal and as a signal it can be impedance matched as you like from hi impedance infinite) to
0 impedance (superconducting) treat the darn thing as RF signal you will definitely understand its easy ....step up - step
down ...

High narrow spikes: On spikes dump into choke then have it bounce into a capacitor as to lower spike into a wider
lower voltage pulse.
Remember a spike is just a signal and as a signal it can be impedance matched as you like from hi impedance
(infinite) to 0 impedance (superconducting) treat the darn thing as RF signal you will definitely understand it’s easy
....step up - step down ...
Switch the ground of coil with diode crowbar inverted across transistor ... In other words use positive biasing (isolate), load
can be fired isolated too & referenced to a virtual ground (separate capacitor stage).

32
the idea is to forward & mix vectors if they counteract each other inside the transistor its blue smoke in OU quantity.
Use positive biasing ....and doubler reactive-choke pump (13 ways to do it one must work ...)
as long you don’t exceed the reversal voltage in any 9 possible modes you are OK .. (no blue smoke ). Use diodes rated for
max joule potential current (repetitive); as if non-repetitive will not give time to refresh from cycle and POFF! (will switch
on reversal and burn) diodes do have their "reactive" parameters too and usually are quite destructive ....

Charge to saturation of a coil and or core , sudden release of the magnetic charge of the CORE material with an RF spike
being produced as material lines of force goes from alignment state to random states as power is turned off ...
this Spike frequency and duration is determined by ,Mass of the core and speed of its atoms cascading to non saturated
states , the lowest magnetization a material haves (remanance0 the stronger the spike , MU metal & hi quality transformer
laminate are such .
The Wire Windings length ,wire size AMPERE turn ratio proportional to logarithmic wavelength of the spike plus the
interwinding capacitance are ESSENTIAL for designing coils for ZPE use ...

this Spike frequency and duration is determined by ,Mass of the core and speed of its atoms cascading to non saturated
states , the lowest magnetization a material haves (remanance0 the stronger the spike , MU-metal & hi quality transformer
laminate are such"
Gustavo: I extracted a part of this book "Physics of Ferromagnetism, Autor Soshin Chikazumi"
“The origin of this phenomenon is considered to be the building up of an electromagnetic standing wave inside the core.
The velocity of an electromagnetic wave is reduced by a factor (Eplsilon * Mu)^(-1) as compared with that in vacuum,
where Epsilon and Mu are the relative permittivity and relative permeability, respectively.
Hence the wavelength in the material is given by
Lamda = c / [ f *sqrt(Epsilon*Mu)]
Where c is the velocity of light in vacuum and f is the frequency. For Mn-Zn ferrite, Mu aprox.1000 and, Epsilon aprox
50000; if we assume f=1,5 Mhz, the wavelength Lamda is found to be 2,6cm. If, therefore, the dimension of the core is an
integer multiple of the wavelength Lamda, the electromagnetic wave will resonate within the core, giving rise to a standing
wave....."
If this is what you mean, I hope that I can hit a sub-harmonic resonance frequency, because related to this info, my MnZn
core seems to have a resonance in the Mhz zone, and I am working near 10 Khz. Perhaps this is why a can get a COP more
than 2 in my toroid ferrite core.
If you see it from a linear projection of series resonance there is a phaseshifting of a travelling wave along the core where
we have delay interpreted as phaseshifting from a 4d perspective projection from horizontal wave travel to vertical shift of
phase along the measure of the rod (corelenght). Signal is delayed along its atoms phaseshifting in the vertical 4D plane ...
(all this can be quantified and measured).
This DELAY can be seen as a COMPRESSION wave travelling along the CORE length (whatever is linear or circular
rotation)
Every wave has its CREST and its PITS (full ) (empty)
(Density) (Vacuum) Wherever we Push it or wiggle it RF is RF from whatever point we measure or VIEW it . (4D
perspective )
Law is same from the Macro (Galactic Waves) to aetheric myriads corpuscules ones (quantum level).
Universe is ruled by basic 4096 physical laws (Humanity started to work within the 48 running its basic physical domains )
(Its Magnetoatomic dynamics we are dealing in ) Understand this and you understand how to transform ANY kind of
energy to other kind or states ...(Stochastic resonance ) turn to Travelling wave amplifier.
Read Travelling wave amplifiers theory (radar electronics) plus class C amplification , apply thought to magnetic flow and
magnetoatomic electron phase-shifting ...
Matter as is can be used as amplifiers transponding ambient energy to electrical one ... (quantal diode revisited)

33
Bearden or Anyone else before my person had NOT explained this Before to anyone in the ZPE free energy community, in
Fact in an Ego bash to the wall statement, I am the First one to TRULY explain TESLAS mystery in NEW Quantum
mechanics relation (following Standard book rules twisted to accept thermodynamics transformation and OVERUNITY
reality.
RE = RF Overunity Equals transformation, Ending over 100 years of pure bullshit ....
All my Statements are being LAB proven and all my present statements will be proper right in a near future (wherever
Bullshit pseudo science fanatics (including academic doctorated assholes) like it or not)
Keep the notes..
Lamda = c / [ f *sqrt(Epsilon*Mu)] (series resonant antenna ),
Element delay , multiplication factor , stochastic ambient noise in DB , thermal transient angle transfer to electrical charge
electron spin .in ferroxplana (ferric strontium titanate ) polarized crystal latice is REVELANT to this EFFECTS ,
Compression wave at quantum level makes atoms to COLD fuse so BEWARE of GUNNING opposed charges (spikes)
within CORE matrix .
If that EFFECT is WANTED then USE carbon , FUSION, the DEFUSION will return carbon to ORIGINAL state but
RELEASING ATOMIC energy pulse EMP from energy quantal transform ... (EV Gray tube piece ).hEHEHE!
as starts . (triad base) OPPS ! be carefull a bomb made with this knowledge can blast a galactic chord goodbye ...
SO don’t apply to atomic bombs ....OK ! don’t resonate plutonium U239 or americium 241 to quantum level (forget about
caesium 137 and don’t ever think on strontium 90 .....
Potassium "K40" is OK just be sure to be 100 miles away when it goes off ...
So play safe use ferroxplana or iron cores to play ...Or carbon if going with nuclear fusion toys .
Its hard to wake up to the fact you blew away 7 dimensions in 3 trillion light-years radius in an instant hyperluminical blast
Yuo do? its too late ! Oops where is my freaking body & soul ? gone! not even a fart left behind!
(be careful ) remember those intergalactic "empty spaces' within the universe ,some mark the spot where Murphy’s law
went mega stupid ..
There is more danger of creating a BLACK holes using hyper cryogenic cold states in Quantum matter than in a collapsing
stars ...
So Caltec forum leeches "take note of this warning" My posting are intended to Educate .....And free people from its
primitive enslavement states ! (before you disintegrate yourselves up it equivocal attempts).

Marcel asked: "Where does the energy come from?

Norm answered: Did you read my "Neutral Spike" post? Think about the vast reservoir of
energy in the earth ground side of the circuit.
Message 4126 DATE/TIME: 01/07/94 23:54
From : NORMAN WOOTAN
To : ALL
Subject: Neutral Spike
Folder : A, "Public Mail"
OK folks let's start some real controversy for I have a theory that has been bothering me
for a long time and is based on real world experience and not just idle thinking. In my day-
to-day work I deal with rather large electric motors of the type that utilize large start
and run capacitors such as is found in air conditioning equipment etc. On many occasions I
have witnessed these motors release extremely high voltage and high amperage pulses or
spikes whenever we try to start this type of motor in a locked or semi-locked rotor
condition. What I am going to describe is the controversial point and that is the fact that
the observed high voltage spike that is very destructive to all electronic equipment is
actually coming from the neutral side of the line or the earth ground bonding. I have seen
motors nearby that are turned off actually run backwards. Since these motors were of shaded
pole design this suggest that a very unusual form of electricity is responsible for this

34
phenomenon, that is "negative electricity". The shaded pole motor can only run one direction
based on it's design unless you provide extra shading windings to provide for reversal or
some other phenomenon such as negative current could run it backwards.
Another clue as to the presence of negative electricity is the fact that large switches and
contactors have their contacts either completely destroyed or welded together by large
currents at high voltage carried over relatively small wires. What is going on here has been
eluded to by many researchers in the past such as Tesla when he said that the key to free
energy was in IRON for it was a unique element that has 2 free electrons in the M shell of
the atom that can be bounced free for use only to be replenished from the ether. He stated
that a free energy device would be based on a fine grade of steel to take advantage of this
unique feature of iron. Dr. Tewari, in his book "Beyond Mater" brings out the same fact and
is the heart of the famed "N Machine". The best source of an insight as to how this works is
found in Dr. Harold Aspden's presentation to the IANS Conference of 1993 titled "The World's
Energy Future". In this paper Aspden outlines what occurs when you bring an iron mass to
magnetic saturation and allow it to relax. A release of ZPE or ZERO POINT ENERGY comes out
of the iron. Yule Brown says it best, "We should think everything backwards in this field of
free energy". The backwards thinking comes into play in the fact that when the free
electrons in the M shell of the iron atoms are freed they flow out of the iron itself
therefore are present in the neutral or earth bond side of the circuit and not in the hot or
supply side of the conventional circuit. When you excite atoms to a high electron state and
allow them to return to ground state they release photons of energy but retain their
original energy levels with no degradation therefore the energy that was lost by photon
emission has been replaced from space vacuum or ZPE. The key to releasing the 2 free
electrons in each iron atom is in the degree of magnetic saturation that occurs in our
device design. I have read several papers in the Keely files that incorporate magnetic
saturation of iron in the basic design of the device such as the Gray Motor that used
bucking opposing magnetic fields to pop the iron electrons free. The error most researchers
are making is that they are looking for the energy manifestation to occur in the conductors
associated with the design but should be looking at the ground or earth bond side of the
circuit. All electric motors have a bonding or ground wire attached to the iron stator which
in most cases is the neutral side of the input line. I hope that this input to the free
energy puzzle will prompt some massage of gray matter and maybe we can build the future
machine we have all been looking for. Norm
===============================================================================
Message 4128 DATE/TIME: 01/08/94 09:02
From : NORMAN WOOTAN
To : ALL
Subject: Neutral Spike
Folder : A, "Public Mail"
Now for some additional notes on the subject of neutral spikes or ZPE occurrences let's look
at the all too familiar Tesla coil that is so popular because of the splendid fireworks
display they produce. Tesla said that in order to do effective work a large coil should not
produce sparking or a corona discharge about the elevated capacitance. ????????
Your immediate response is, have is the work taped and where is it occurring? Well Mr. Tesla
clearly stated that the whole purpose of designing a device that would operate at full free
resonance at the earth natural frequency of 7.83 HZ (he used 8 HZ in his day) was to produce
a power wave that would pump electrons directly in and out of the earth via a deep grounding
system that was firmly attached to the earth. I have talked to many Tesla coil builders and
have found not one who was interested in exploring the ZPE pumping of electrons directly in
and out of a deep earth ground such as Tesla had planed to use at Wardencliff, Long Island.
If you read carefully such documents as D.C. Cox "Modern Resonance Transformer Design" you
will find clearly stated that a deep or good earth ground is necessary and this conductor
must be a cable of substantial size for a considerable current of earth pumped electrons
does occur when the coil is operating at full free resonance. He states that if an attempt
is made to earth ground a coil with zip cord it will result in a burned up ground wire. Well
I might be dense or otherwise afflicted but this sure sounds like ZPE tapping to me. Why
can't Tesla coil builders out there explore this phenomenon to determine the over-unity
aspects of a Tesla coil that is operated at full resonance and better yet modulate one to
get an earth resonant power wave of approximately 7.83 HZ. I say approximately for I don't
think anyone has successfully nailed down the exact earth resonant frequency as of yet. This
figure is close enough for government work at this time or until someone comes up with a

35
more precise figure. I belabor the point for out there lies those who will say, "You missed
the freq by .01 HZ", You know them as pain in the ass nit-pickers.
Keep the focus on the over-unity aspects and not on precise detail. I have tossed this out
on the table of debate so as to prompt input from the many out there who have taken the well
spent time to study the basic Tesla coil designs parameters and can give us back some
meaningful input. Let's hear or read some feed-back from the depths of this KeelyNet. Your
friend Norm.
===============================================================================
Message 4129 DATE/TIME: 01/08/94 10:40
From : JERRY DECKER (SYSOP) -- RECEIVED –
To : NORMAN WOOTAN
Subject: (R) Neutral Spike
Folder : A, "Public Mail"
Hi Norm! EXCELLENT cubed!!!
The grounding is similar to what the Rogers underground communication system says must
happen...that an energy is inside the planet and be modulated just like slapping the surface
of water, except in this instance it's more like a hydrophone (underwater speaker/microphone
for those who don't know what a hydrophone is).
Anyway, as I understood Tesla, he said the Earth could be pumped up like a large capacitor
and it was done at the resonant frequency (around 8HZ, depending on which version of the
Schumann peaks one wants to use) of the Earth. The waves of this energetically vibrating
planetary capacitor would thus form peaks and valleys. By tuning to this frequency and
adjusting so the phase was matched, one could thus tap the energy. I was always puzzled by
the Colorado Springs experiment where farmers and citizens for miles from the site
complained of drawing arcs from the ground to their feet as they walked. This is what made
me regard the Earth as power source experiments irrelevant, i.e. because with all the
electronics we have now, it just would destroy everything...
However, your premise that iron is the secret to tapping the negative force flow makes sense
in many ways which we can discuss in person. Interesting that some of the UFO reports said
Earth was considered a treasure house BECAUSE OF IRON...a rare element in the galaxy???
Perhaps Iron has the relaxation effect Bearden writes about, but I think you are more down
to earth with the 2 electron description...something we can measure and work with NOW, until
the optimum relaxation time material shows up through experiment or calculation.
You know, Moray's device also required a very long ANTENNA and the deeper the ground, the
more power he could tap...perhaps the earth has shells of varying power densities.
But your message is definitely worthy of conversion to a file....>>>
Jerry

1.18. Light
light is micro-millimetric RF as RF it can be made into AC power and rectified ... the solar energy from the sun has
amplitude modulation at broadband frequency ..
take a HI frequency RF bridge and hook it to a solar panel output - you will get a hell of a surprise as voltage output
doubles; Use fast switching diodes from switcher power supply in FWBR
solar cell I tested do haves amplitude modulation (it averages )

1.19. E=MC2
Relativity states that to accelerate an object to light speed you need all the energy of the universe ...
So an Object from REST goes To C acquires infinite mass ...
For an object to RADIATE energy it most resonate to that energy frequency like in RF radio antenna laws & rules ...

36
we take a flash light or a house light turn it on with a 1.5Vdc battery or 120VAC depending on bulb design ...
And we got light ! so we have AN SMALL AMOUNT OF ENERGY setting in motion an INFINITE amount one (At speed
of light).
Like in RV ... ( nobody else has noticed it ? )
(what IS Light? C=MxT²); Mass accelerated in time becomes energy.
Light is WAVES as well it can be matter ...because matter and Light are a manifest in a media not the media itself ..
particles are a VORTEX ,a transform engine within a substance medium, a WAVE is movement projected from such
VORTEX but as a FLOW it can interact to affect or become another transform engine ..
A wave can have density as well as mass as a coherent waviton it has no loss as an expanding signal it decays to the square
proportional to distance in mass and density ...
Read acoustics & waves same laws apply to light and RF .. just need to adjust for environment characteristics and physical
law..
Any wave carries a density zone that has MASS and that mass transfers itself to impart energy to the atom receiving it as in
case of a heat wave ....
A sea wave may not have mass on itself but if it crashes on you will be definitively crushed by its water mass (MEDIUM)
that the WAVE moves in time and space as a energetic compression in the medium (sea) water but carries a MASS within
its signal as compression, this Tesla defined as capacitive character of the wave.
We got that e=MC^2/T. It’s reversed E to mass conversion , divide LIGHT to the square of its time it condenses to specific
matter component. To add T is universal time constant (Read Seike )

IF system is looped electron acquires energy from heat , its spin and ethereal flux ...there, (ethereal) is where gravity
equation enters as electron goes soft Time where M=MC²/vT , T becomes retrograde creating -G (almost non perceptible
if system is entropic. ) .
M=matter Light can become electron proton or neutron cophase 3 rays in RBY and you get Hydrogen atom from light
M=MC²/vT (The ETS are pissed off at me for giving this out ....)

E=MC² M=C²/√T or (E=MC²) /√T = M

1.20. Electron, waviton & mass

Is electron's motion perpetual? No its energy decays but gains energy by aether flux on a rate of 300,000MEV PS That is
approximate to 64,000 Horse power potential. If it freezes turns to an standing wave in the aether then evaporates .. to
quantically reappear in a resonant point elsewhere.

Fun fact: It takes less energy to split hydrogen, than what you get when you combine hydrogen. You get 1.618 more heat
energy when you split and recombine water using resonance ..
Water is the receptacle (urn) of fire in fact a sun cannot ignite if it does not contain WATER , ( your science will discover
this soon as they look for Oxygen 14 in inter-stellar gas and where it comes from ..
To every particle as energy flows in aether gravitic constant to sustain mater hologram integral ... this is transferred to e-M
field where M = (E=MC^2) /√T where F=V/T (standing wave tensor resultant from square root of 1) black-holes being the
main aether engine radiation , what HAWKINGS CALLS HAWKING RADIATION IS THE sand carried in the aether
river within black hole transform engine ...jets emanating from its poles ...

within the charge differential field caused by electron spin x charge and gravitic n aether flux compression ..
(any dense mass concentration speeds up time ...
what you think happens as something hits critical mass ..

37
E² =(mc X C²) / √ T
as mass hits "0" time it becomes light ...
They are RELATIVE to TIME ... Law of Relativity is relative in its applications ///
its 4096 laws & formulas variants to start with .... (some years of brainstorming) I prefer to give the LAB tools first then
learning these becomes easy ..

On Wavitons yes they can be used to tap ZPE and ZPE manifests in 9 basic levels (ELEkTRON being current science one
Knows ) that relates to KNOWN uses of electron particle , until I can teach people how to create vitrons by transferring
electrons to 4d states and create static light (non moving photons ) using off shelve cheap stuff it will be a bit difficult to
jump to other RESONANT regions of ZPE (specially resonant plasma ones ).

1.21. Electron inertia memory

The problem With the OU back to same source is cross-vectoring, call it electron inertia memory, separating and delivering
as JOULE potential solves the problem as this inertial memory disappears as electrons are reduced to a pure capacitor
charge potential Volt Ampere second (Joule) I was thinking once on using chemical equilibrium assisted tripolar battery
using the negative electron memory as migration element to charge a third pole ,maybe a chemist with proper funding can
figure this one out, specially with new supercapacitor chemistry at hand, Power factor here makes battery memory think the
electrons going to it are far more powerful than they are so the chemistry reacts to it as charge .
Call that Suckering the battery ( In a sense ) with virtual OU power RF ( radiant energy ) 4 stage inverting can also do that
using a 3rd stage to valance the cross-vector impedance issues ..
Problem resides forward Power pulse is in different impedance match than the recovered CEMF so the 2 cannot co-exist in
same environment unless you use bandpass diode reactance network to correct imbalance or use core coil relation in
paralleled harmonics frequency differential, that is coil can say initialize at 60CPS but Back CEMP is backfed at 120CPS
doubling voltage and dividing time by 2 , but it has to be pulsed back to battery in a blank interval as the checksum of
vector crossing becomes negative if done simultaneous ...
Think in transverter as theoretical computable solution to the problem.

1.22. Gravity
Gravity is Natures First OU transfer Engine ,Aether flow Toward particle Event horizon produces Magnetic Force, Mater is
not Static but dynamic in nature ..
Time slows down away from a given centre of gravity and accelerates as it increments near centre , RED shift is due to
gravitic effect and not to Universal expansion.
gravity is result of Mater process to sustain its own existence
and can be considered as unipolar linear charge ...
RV taken to looped extremes distorted time and space, also created own centre of gravity ....(

1.23. Hypersignal
Is hypersignal those having my notes can go back to them the frequencies are well explained ....
3 cycles per second halved 1.5 (the pulley ratio is here) Then the Tensor Harmonics 3,9,18,32,64,128 and its fundamental
atomic elemental values related to the universal signal of SUPERNOVA detonation standing waves ... add the speed
constant of relative spatial movement and you got the exact coordinates to ride the waves... ( Iron Thunderbolt ),Vril , the
power of 10,000 suns put in a can .
Use it wisely ..
EB: So we are tuning into the harmonic waves that are produced from supernovas that are happening all the time in the
universe. These energy waves are reverberating throughout the universe all the time. Sounds like the idea of tapping into the
energy waves from radio station. Some people have been able to light up flashlight bulbs from tapping the radio waves from

38
a broadcasting station. Same basic concept, no? Is this the so called "background" radiation scientist say exists in open deep
space?
More like tensor, if you squeeze a piezo crystal it will generate a potential related to its Thermal noise and such Noise will
be compressed in time, tap the noise you tap the tensor associated to it, if tensor is modulated, energy is transferred from
tensor to electron spin by means of hyperspace signal, (aether is the medium).
Like taping a RADIO station we tan tap every signal in a given space (as all usable signals are RF (radiant) energy).
So free energy Comes from transformation of Ambient energy or standing wave tensors within a given space, an atom
energy if not recharged simply collapses the atom into a signal, and FROM A SIGNAL INTO DESINTEGRATION &
REINTEGRATION TO DIRAC SEA OF ENERGY (AETHER) the energy flux into atomic transform engine creates
gravity as a by-product of Aether flux transformation to Marnetic dynamic flux and MAGNETIC fields , we can Tap to all
fields & create anti gravitic effect by taking atom level to stationary Light speed signal tensor (time = 0) Mass=MC²/t/t
So red shift is not to apparent universal expansion constant but to a Doppler shift of receding signal traveling in a
contracting medium within a gravitic centre , universal movement is in reality spirals within spirals within a big toroidal egg
where at the centre we have an inpass ring (singularity) Blackhole "whatever"...
Getting back to basics Free energy is just tuning to nature energy channels for free ... Like in a crystal radio we are able to
simply transform it ...can be cyclo-converted amplified and multiplied (Read stochastic resonance...)

1.24. Saturation
Electrons, as they are polarized they tend to repel each other from the centre conductor ,this creates surface currents and
resistance... in multi filar conductors they tent to repel each other back to centre maintaining a more even current flow in
conductor ,,,
If someone wants to do an interesting test just rewire a 3 phase motor to 12-28VAC using this type of isolated fiber
multifilar wire bundles x 10 the mF to 1000 - 1500 MF for self excitation and VECTOR this properly to a battery, a
STANDARD HOME generator 2 bearing (harbor freight ones) can be REWIRED to 12-48 volt combinations to vector the
HI amperage directly to battery using reverse induction..
ALSO same system applies to PM generators as the CORE loss issues are IMPLANTED disinformation in order to dissuade
people in converting STANDARD of SLELVE items to OU devices.
EV Gray EMA motor can be done using any off the shelve inverter grade synchronous motor generator or PM generator
running in RV modes.
Just Avoid the Oversaturated cores...
If Baldor motor cores in a 20 HP motor only got .03 % loss and an UTILITY transformer CORE only got .001% loss them
What are we talking about ? You will never get that using nails or black sand.
Ferrite and ferroxplana are for HI frequency ,not so off the shelve ...I think is time to go back to MODERN low loss
laminates and apply what you have learned with the homemade cores, to lets say the 40 coils of a DC Baldor motor wired to
40 phases diode bridge to give 10 times the rated output . Using Stator as Rotor and rotor as Stator.

Magnet intensity is WAY to TUNE to laminate Impedance where OU states are found. Over-saturate like in the Wind
generators PMAs and you loose 500W on the spot...
Over-saturation Equals drag, laminate Equals stochastic transform where in resonance Heat= (IxI) rT creating OU transform
(Rotary condenser machines In RV mode are WAY OU)
Like RV you just need to try.... (Experimenting with Harbor freight 120/240VAC generators and jumping to 230/460 EM
EMA/RV run ones ...
99% of the standard power is 50-60CPS so we have to deal in POWER management in this REGIONS in order to be able to
recover energy from OU states (as RV alternator ones)
For The power Elite is priority no one finds to make MEGS out of 3PH transformers and RV out of 3 phase motors, and
rotary condensers out of generators and the...
Is easier to PM a standard generator that to built one from scratch as is more practical to try to address the losses in standard
art and take it to ZPE states.

39
I think RV demonstrates that well, a PM alternator taken to EXACT point of laminate saturation is what we need to have
this in STANDARD off the shelve mortals can replicate stuff...
Not everybody is prepared to take a flat motor rotor and modify it to UFO 2125 sonde technology 111 phases operation.
I can take one of those to 75KW using Nb70 mill grade PMs but only Gods of the Olympus will be able to replicate the
stuff, not so off the shelve to do stuff..
I think many tricks can be learned from using CAR DC motors and diode bridging the rotor commutator segments.
You can boost internal Ceramic magnet power by applying external Nb 50 2x2x.5 blocks and U framing them in steel with
adjustable gap to adjust field intensity...
Normal use is to use stator as rotor at hi RPM diode bridging all commutator segments as to get 100% power of all its
windings into a collector buss.
Think if Norman Wootan set up was OU using standard servo as generator think what the multiphasic generator will do if
taken to Radiant energy states USING PM magnets ... I think a car Air conditioner PM motor stator can be end belled to a
shaft and turned to 3450 RPM over a DC motor rotor ...As poor man experiment for low budget RVrs... As I can’t ask you
to burn $1,200 in Baldor PM DC motors...

1.25. Lenz less

Lenz less: The real issue is going to magnetic interrupt with the proper Core design ...
Ecklin brown data is the right path, MAGNETIC interrupt, as per explained in this 7 years idea is to saturate a core at
collapse where there in no Lenz component Extract it in OU level ..

Hartmann: I just verified the Anti-Lenz law pulse motor circuit from Garry Stanley. It works great!
Please have a look here at this principle diagram:
http://groups.yahoo.com/group/free-energy/files/anti-lenz/stanley_anti_lenz.gif

If seen as a MAGNETIC interrupt circuit then you see the light! If applications are made as to modulate circuit in rotary
dynamotor configuration with secondary Extract coils (to be used as pulse driven rotary dynamotor set) I see great
possibility of obtaining OU transform from magnetic flux.
Model can be made easily with proper funding, same principle can be found in ALF disc interrupt generator...

1.26. Latching
OK theoretical is 1.618 as Asley Grey Data in VTA he also hit 1.33 ratio .. in a perfect latching system the 1.618 figure
shows up as is logarithmic gain as reflected in theoretical RF antenna multiplication factor where RADIATING element
characteristic provides MAGNETIC amplification of signal from ambient energy magneto-thermal genesis effect.
In the system entropy there is a .382 energy requirement to sustain the system and this energy acts as a Varactor diode tuner
, that is why when you lower power to a certain point your energy increases in unit as it tunes to max latch attribute ..
There is a magic latching magnetic field intensity level ,that was why long ago I gave public the solution to use a shading
magnetic shunt in the magnets as to ADJUST gauss to proper LATCHING saturation level , too low latching does not
manifest too hi latching requires too much energy as it tends to lock to the saturated sidelode to switch over , that is why
most meg replications DO not Work , resonating meg is another history , there the power goes ballistic , but again the real
POWER output is defined by 1.618 overall over isotropic dipole gain and .382 power required to sustain power in looped
mode , the extraction solution I also gave long ago ,diode plug and the 2x2 configuration where 4 diodes split the resonant
waveform into 4 capacitors where 10% of energy can be extracted from active pair non reflective to system standing to a
virtual 0 point as target for resonant radiant wave ( check Resonant plug & opto isolated non reflective discharge circuits )
Phil can improve the switching in those as it requires bit of expertise in choice of parts and application..
We don’t have Electrum or the original VTA magnets but we do have the knowledge of the LATCHING that occurs in 3
Phase transformers if we DC magnetize the Center B phase and Multivibrate the A and C phase to semi-resonant state
producing LATCHING effects resulting in magnetic amplification(MEMA, Magnetless Electro Magnetic Amplifier)

40
I was working on Meg simils but Bearden beat to the street with the patent, so I gave what I got Free domain to Override
it,(MEA culpa)he wanted no comments from anyone on his theory as to him it was perfect and required no improvement as
he had this secret thingy to make it work so and so blah! blah! blah!, thing to make it Short I am still waiting to see it in
sears or pep boys ...
At least RV can be made by anyone, but MEG is a bit quite off the Shelve and labour intensive.
best off shelve option is to convert a 3 PH transformer cutting centre b phase from the laminate E shapes and inserting
magnets of proper intensity , multiple winding phases are best as to use parallel resonant flip flop configuration for self
excitation in one of the windings and use the others as MAIN reactor core resonator. as long as the LATCHING is properly
managed I see no problem of getting it to work except the exotic Philadelphia experiment phenomena the thing tends to
produce , if you create soft electrons you create time space anomaly, and that is basic to any class C modulation magnetic
linear amplifier .
Important point , take laminate to optimal LATCHING saturation ,Tune INPUT to proper excitation level that is .382 of
1.618 that gives you 1.236 x 1.14 ppv = 1.40904 Gain over isotropic dipole as basic .
The other VARIABLE is the LATCHING quality or ability of your Core to switch magnetically and its remanance field
intensity % permeability reacting to ac where a determining self resonant state must exist in order to attain energy transform
from the ambient, electron spin and thermal to the machine output exceeding input ..
Here is where Bearden theory Farted and died and my theory hits the mark .. MRA work nails the Coffin lid shut ..
A lot of bitchi tuning details but I still insist Bearden Work must be CONTINUED and perfected even if it had to be
improved on and taken to public domain as done now , Jinis transformer data is VITAL for meg work as is the in vitro
expertise required to Excite properly MEG type looped systems ..

the linear length of the core contains different field values along its length alike a POWER factor M field effect along the
line ,field response is proportional to the distance of effector (rotating magnet) so impedance is also relative TO IT AS
WELL AS LENZ EFFECT AND Cemf ...
Lab experiment: TAKE long LAMINATE CORE SPIN A MAGNET AT ONE END , ALONG THE LENGHT OF THAT
CORE YOU WILL FIND A molecular LATCHING POINT NODE WHERE power WILL BE MAXIMAL and CEMF will
be minimal as you slide a wire coil along it ...
same with SOLID iron rod ...
This applies to rotary RV condenser POWER factor tuning as well.
The ACUSTIC resonance of OBJECTS also is important on ZPE R&D making Cores ring , transformers squeal like pigs
and that sort of a thing ... Refer to Harmonics recording and post on those ..
A CORE can become an RF frequency crystal ... so many times I had made reference to Norman MRA and still apparently
no one gets the importance this relation has.

1.27. Proof OU property

you need 2 IDENTICAL capacitors and a dual coil wounded core .. First coil is tailored to SATURATE the core by
discharging the Charged capacitor to it ... ONE PULSE .... at X Volts N farads. Second coil is TAILORED to RECOVER
the Collapse charging capacitor in a logarithmic Semi resonant path ...
The resultant VOLT FARAD relation is Computed ... If SECOND identical capacitor has a HIGHER charge than the
IDENTICAL prime pulse one at SAME farads you have OU ... as simple as that ... CAPACITORS MUST BE OIL (NO
LITICS) (Tuning is a bitch!) Learn to TUNE ELECTROMAGNUM and you can make the REACTOR CORE WORK ...
This simple TEST is what you need. Sooner or later someone has to replicate this as is so DAM simple as the Battery
SHUNT to test DC OU ... (Used By Konzen) Only here you measure, Voltage potential in input capacitor - Discharge –
voltage potential in OUTPUT capacitor ...
Sorry but No one by the BOOK can tell me I am wrong here , just do the numbers.. 2 identical CAPACITORS .... the one in
the OUTPUT has 1.618 Joules potential more than the initial charge .. Get that you get OU ... HOW? "TUNING"

41
How is done? Discharge capacitor into coil as Current is maximal disconnect input capacitor at O V Connect Output
capacitor to SECOND coil ,as current reverses into second capacitor LOGARITMIC CURRENT DROP Occurs wile
LOGARITMIC VOLTAGE INCREASE OCCURS Cut of COIL as VOLTAGE is MAXIMAL and CURRENT = 0
THERE you have ZPE ZERO "POINT" ENERGY but in reality is 1-0:1-0 10-10 one Hi zero low... You have 2 Zeros and 2
ONES!
I just Explain what Tesla did not From An Aether String to a galactic cluster or KITCHEN sink you will get OU, what
changes is the gain or "Q" of object you use ...
First like RV "Refresh yourselves with the reading" you need to GET OU, Next is find what are you going to do with it
"applications" .

1.28. Varactor
Hector made reference to varactor tuning, VCOs Voltage controlled oscillators, amplitude (that is voltage) determines an
impedance relation of a signal on a given impedance value of a resonant load "LC".
Voltage then becomes a VARIABLE parameter in TUNING , there is where most scientists had fail in ZPE R&D as they
work on FIXED parameters while lab experience shows all variables within a ZPE system must be adjustable parameters in
order to REACH predetermined constants needed to acquire OVERUNITY transformation.
Check Varactor tuning theory (RF) VCOs & others.

Varactor effect drift

As a Core is maintained in Hi Q hypersaturated modes Input voltage variations produce frequency drift creating beat
harmonics increasing loading to source, synchronising hypersignal becomes an art as voltage is LOWERED frequency
needs to be compensated to keep proper rotary angle and mitigate parasitic beat harmonics, the cophasing of signals as
stated before is measured in angle of rotation relative to power input and LC minimal sustaining power required to maintain
resonance..

Schottky diodes should **always** be paralleled by a series R/C network. To start with, I suggest using a 1nF **ceramic**
capacitor is series with a 47 to 100 Ohm resistor. This series combination is then soldered in parallel to the Schottky. This
is called a "snubber network". Helps to keep short voltage peaks down that would fry the diode. The R + C leads as well as
lead length to Schottky should ***NOT*** be long, keep them short.

1.29. Capacitors
Capacitors: They are electrical Vector "Phaseshifters" being semi-resonant they are naturally overunity .. in 3 PH seen from
virtual aspect the phase angle is 90 deg and in full resonance from this virtual view point we assume logarithmic gain within
system of 1.618 that is reflected as VOLTAGE and amperage increase over the single phase line ...
Idiotically this is assumed to be part of VAR dynamics (power factor ) but on same plane within 3 phases is not , what
remains to see is wherever current as theoretically stated in LRC remains in same phase as voltage shift phases , thing to
note is that in standing wave current is not existent in a point and existent in others , can we assume that current is a tensor
and not a flux ? where tensor determines electron density within a conductor at x wavelength within specific nodes ? ...
Capacitor is ZPE source combined with proper inductive circuitry ..
That is a FACT ,as a shorted COIL saturated to maximal current opened in a Q matched diode link to a capacitor becomes a
ZPE engine ..
LC + magnetic field modulation = VTA ,MEG principle explained ...

LC discharges in capacitor From 0 point (V) full Current node .

Capacitor acquires charge in joules ... Vectored by diode ...

42
Best use power factor correcting caps, which are Polyester Kraft and Foil or a Polypropylene type.

Capacitors in resonance are OU due to stochastic wall charge remanance, used in electret combination in as per sample
Testatika device it can work as quantal vacuum diode rectifier, charge being pumped by molecular diode electron tunnelling
the tendency to remain charged becomes the energy source itself.
Search "Electrets" "Electrostatic charged materials"

On Tantalums reread my opinion on its use in ZPE circuits, they become atomically unstable ... (do strange stuff) including
shorting out and exploding like small dynamite sticks, internal humidity = cold fusion...

What would be the best sort of capacitor to use "capping" each coil?
Soldered ends low resistance low impedance component flash ones are OK just calculate joules at low volt charge add in
parallel as needed to increase uF.
NO tantalums in resonance

In BIG starting capacitors use breeder resistors (10 meg) As you can be unlucky,(in ac that is shit waiting to happen) of
having opposable charged capacitors switched against each other.
Other choice (I forgot to mention) is using damping toroid choke (series to cap). 5 turns of # 10 stranded wire on one inch
toroid like the ones used for noise filter being so LOW impedance affects little on RV performance. It may send a "n" scalar
pulse detectable 100 light years away but it will not burn the switch explosively ..

1.30. Quantal diode

Capture capacitor – quantal diode
It is overunity in the sense electret tends to remain CHARGED constantly AS A POLARIZED QUANTAL DIODE , Such
diode is manufactured by subjecting polymer to HI melting temperatures within 2 DC HI voltage plates; as the polymer is
cooled down fast the charge tends to remain LOCKED in the polymer becoming a free electron diode or static rectifier
accumulator.
(If there are no practical applications other than self-sticking paper covers (NASA holds the darn patent) I see no progress in
it... You can buy any of this at Office max (Self-sticking transparent paper covers) they are randomly charged so no use in
plate charging is possible unless you map and polarize all charged spots.... or you can prepare and treat electret as to do this
thing yourself)
just require a 40KV dc source, a controlled oven, plates conductive, plates glass polymer roll, and lots of luck and
expertise.... a normal oil capacitor can be treated in this way to a near melt point once treated must be used for DC only as it
becomes electro-statically polarized and semi rectifying, do not exceed breakdown voltage .... The effect is interesting but
as VTA it decays.

Take a dielectric ... "Can be even glass" heat it to near conductivity. Charge with 14KV dc. using 2 plates.
Let it COOL while holding the charge. This creates a permanent quantal isostatic charge (Electron Tunneling material ...)
as it cools to ambient temperature and PN charged regions are created in a permanent state, DO IT! Take a leap to the future
now.
The rest I leave to intelligent minds to figure out....
SSHHH don’t tell anyone I got it from a 2125 basic school level Knowledge transfer file ... (kindergarden experiments)

Operate a temperature controlled oven. That knows about thermoplastics and molding.with experience operating HV
regulated supply. AND Experience in practical R&D.

43
Concept is really very simple. AS NASA has a Patent on it ...
but it’s used as paperholders sold in office max. not true + - charged faces, but you can buy and test.
Using effect to charge large capacitors.
Use glass at 800 F charges to 14KV and let it cool under charge.
If that is not interesting I don’t know what it will be.
Please don’t use CONDUCTIVE metal composition glass, with your luck I bet your plumber friend buys the only stock of
23% lead glass on the hardware store to make the replication fail.
Happy cooking! “May the force be with you "
Avoid polymers with ANTY-static chemicals added
Use hi static acrylic for lower temperature plastic experiments some may not need to melt just heat to polarize.
Take it as a learn as you do stuff, Hutchinson Charged QUARTZ crystals into electron barrier tunnelling devices, it’s on his
first disclosures? What happened in the period he was arrested to the point his battery turned to a dead bunny energizer
imitation I don’t Know? (Have to do a search on that)

Charlie Brown (Inventor) Email: abundance@l...; Kilauea, Hawaii

He's using billions of nanometer scale diodes to extract energy. As we know, all matter at any room temperature consists of
vibrating particles. He claims that his device extracts energy from what is called Johnson noise. He expects mature
versions of the chip to yield thousands of watts per sq. inch inside a heat transfer system using circulating liquid.
http://www.diodearray.com Below is a quote from his "About Us" web page:
Charles M. Brown has invented, patented, and demonstrated at low power a chip which absorbs ambient heat and produces
electrical power. There is plenty of ambient heat everywhere on Earth. He expects mature versions of the chip to yield
thousands of watts per sq. inch inside a heat transfer system using circulating liquid.
The device consists of billions of nanometer scale diodes connected in uniform alignment parallel small arrays which are,
because the operating voltage is low, connected in series.
Heat induces a small random movement of mobile electrical charges inside materials. This effect is known as Johnson noise
after a telephone company engineer who studied the sources of static in radio telescopes.
Diodes are two terminal devices which conduct electricity well in one direction and block it from flowing the other way.
Random electrical movements emerge from a diode as a fluctuating forward current half the time. Once the current emerges
from its diode of origin it is blocked from retreat through its diode of origin and all parallel adjacent diodes and continues to
the electrical load of the circuit. It does impose a counter voltage which is the array operating voltage as it does this. This
counter voltage de-energizes the random electrical movements which still flow in this direction which is easier than the
blocked direction. This de-energization is simultaneously strictly equal local refrigeration and electric circuit power. The
fluctuating outputs of all diodes are aggregated without network loss to become useful amounts of coequal electrical power
and refrigeration.
Each diode is expected to yield a nanowatt @ 65 degrees F / 17 degrees C,
Full thermal bandwidth of ~ 1Thz, a rectification factor of 1/2, and a device efficiency of 50%. The yield is derived by
multiplying the above factors by Boltzman's constant ~1.38 x 10 ^-23.
Uniformly spaced carbon nanotube anodes define each diode. The rest of the diode is a shared cathode layer of N
conductive Si doped InSb abutting the anodes on one end and a shared ohmic contact metal layer on the other side.
The ability to fabricate this device is emerging gradually. Most Engineers and Physicist are not yet aware that this type of
device can exist. In 1993, a feasibility investigation prototype yielded ~50 nanowatts which is above the scientific criteria of
~2 nanowatts. Unfortunately, Mr. Brown has lost contact with that test lab. One protocol is for other researchers to
independently investigate Diode Arrays and report their results. Another possibility is for a development team to fabricate
prototypes that will lead to commercial products.
The promise is that the Diode Array will produce abundant, autonomous, cheap, clean, compact, reliable, safe, and quiet
energy. Furthermore, refrigeration will become an electrical power asset instead of expense.

At last it came out. All the Info on Electrets and quantal diodes had disappeared from ALL forums. Here is some:

44
From: "Marco Conti" <marco.XXXZZZYYY.com.au
1): What alternative can you see to glass (eg:mica sheets, ceramics) for dielectrics materials and to the process you told
about me? (for instance ceramics may have the vantage that can be stressed with HV whilst forming and probably at lower
temperatures in this case);
2) What amperage per cm^2 (or inch^2) of material is it needed to reach the results that you indicate?
3) What is the thickness and surface suggested for the material to be stressed with HV?
4) What have you done with yours (if you made it previously) polarized dielectrics? Electro statically charging capacitors?
If yes what is the Voltage out and amperage out of a glass square of 10 cm^2?
5) Is the simplest device made by two opposite static squares?

NASA used polymers , I did test with glass years ago but that was lost to Hurricane Georges destructive force (Funding did
not include Hurricane proof bunker .. )
Russians did testing with every semiconductor material known and went silent about it ..
Secret is to take material to highest temperature with no physical degradation then charge its faces to the strongest energy
level possible and keep that charge until it cools down to ambient temperature ..
tunnelling electron effect varies with material used, from polymer plastic to gallium arsenide
thickness and density affects level and strength of charge
At micron level a quantal diode is created where the electrons are transferred to negative region barrier working in a sense
as electron spin directional rectifier area of + barrier attracts electrons where they do a quantal jump to negative region
creating a charge differential at dielectric faces , linear tunnelling occurs..
Testatica Fundamental Secret is the charging of such plates within a rotor using highly static acrylic material with a hi
tendency to remain charged as the plates are rotated inside static air capacity plates it transfer its KILOVOLT Ev charge
to a HI voltage transformer where is stepped down to dual 220 ac ... Rotary Resonant Capacitor Interrupt Generator ..
The Static" Remanance " of the acrylic becomes energy source ..
Is NOT the FIRST time I post THIS and IS not So difficult to make ... The problem is that MANY REPLICATE , greed
takes over, then is lost again....
What it will take to finally find a few rich guys or the hypocrital GREEN peace snobs to put some real money into serious
SIMPLE R&D ... ?
I dont Know ?.... but what I see is millions are wasted in scams but us sincere inventors and engineers remain on survival
mode , the need to create a properly funded institution still remains ..
(definitely PES is not it .... ) I have 230 projects that need revival (ARK Research Remanents)
But where is the Proper Funding .. ? " frustrating " I had toss like 1% in the internet already and give others away ..

this part was with the Japan electret patent link that was posted in relation to Testatica secret disclosures ...
But this remained on the AIR as the Diodes .....
There is a Testatica group I read their postings & saw a bit of their data , I really don’t Know what is holding them down
from a working unit ...
It is overunity in the sense electret tends to remain CHARGED constantly AS A POLARIZED QUANTAL
DIODE , Such diode is manufactured by subjecting polymer to HI melting temperatures within 2 DC HI voltage
plates as the polymer is cooled down fast the charge tends to remain LOCKED in the polymer becoming a free
electron diode or static rectifier accumulator ...if there are not practical applications other than self-sticking paper
covers (NASA holds the darn patent ) I see no progress in it ... You can buy any of this at Office max (Self-sticking
transparent paper covers ) they are randomly charged so no use in plate charging is possible unless you map and
polarize all charged spots ....or you can prepare and treat electret as to do this thing yourself

45
 just require a 40KV dc source a controlled oven ,plates conductive ,plates glass polymer roll, and lots of luck and
expertise.... a normal oil capacitor can be treated in this way to a near melt point once treated must be used for DC
only as it becomes electro-statically polarized and semi rectifying, do not exceed breakdown voltage .... the effect
is interesting but as VTA it decays., with the current resources i just put R&D on the subject in hold...
It requires big money (A persistent problem in OU quantity)so it stops there...

making a capacitor by taking a tuna can, trimming the lid down so it was smaller then the opening. Attach wires to the can
and the lid, fill with wax (used to make denture mold carnuba wax). Melt the wax and let it cool slowly while high voltage
DC is kept on it.
To further improve it, you could add an additive in the wax that was a "non-radioactive by-product of tritium" used to make
things like glow in the dark watches. I can't remember what this "by-product" was.
Rain: the Carnauba wax is a classical electret material. Search for "carnauba wax electret".
One of the pages: http://ether.sciences.free.fr/electrets.htm
Interesting electret motors: http://f3wm.free.fr/sciences/jefimenko.html
It continually gives off electric charge, can be used with a voltage triggered capacitor discharge system or AC Testatica
rotor segment ...
Its called Radium, used on glo-in-the-dark clocks. Bruce Perreault talks all about the magic uses of Radium. I don't think
its a by-product of Tridium though.
Practice with the WAX or HEAT acrylic plastic to near melt and charge with 14KVDC up to 100KVDC and test ...
tritium is natural to waxes so no need to add ..
Metals can be charged with Hi current into "Special" property materials also ... Remember VTA ....

I filed US Patent 3,890,161 DIODE ARRAY very many very small diodes in uniform alignment parallel or parallel series
which is now public property. In 2001 composition was upgraded to the use of C60 buckyball anodes on N type InSb
common cathode (the anodes are the negative terminal for low voltage D.C. output). A prototype in 1993 adapted from a
satellite transponder chip showed feasibility by yielding 25 times 1/2 kTB showing that power can be produced by
aggregating rectified Johnson noise. www.nano-lab.com worked on the device for a year but quit because there was no
funding. Let's build them and have clean, safe, cheap, reliable, quiet, abundant power (with coproduced refrigeration).
I learned the scientific background for this invention by reading Isaac Asimov's View from a height in 1964 and electrical
engineering books and periodials from my father's home library.
A properly fabricated chip should have a power density of ~100 watts/ cm^2 @ 20 C, 10^11 buckyballs/cm^2, k = 1 THz,
diode efficiency 50% (Other than the halving due to rectification).
Au/N type GaAs diode array chips for checking my 1993 experimental results without being practical are available as draw
down stock from Virginia Diodes Inc.
ALOHA, Charles M. Brown; Kilauea. Kauai, Hawaii [[email protected]]
Same can be done for higher frequency in IR HEAT range as All light is converted and reradiated in this form its 1000W
per cubic centimetre using Stacker ten technology .
Can you put patent and industrial LI method in a page for downloading ?
That is an alternate method called thermovoltaics (TV). These escape the weak but wide generalization known as the second
law of thermodynamics (2LT). InSb is a good TV material. The DC output polarity of TV devices is opposite that of diode
arrays. A TV developer is Dr Gao Min, [email protected] BSc (Xian) PhD (Wales) MIEE CEng. Research
Associate (University of Wales Cardiff, UK phone: 44 01222 874000 ext. 5950 Fax: 44 01222 874716
The patent is at PTO being pre i976 it is in image not searchable text form. I want minimal industrial LI (licensing) so
civilization can use the tech easily without legal feifdoms. Applications development should be a craft without patents.
There are many ways to attribute tech cheaply and surely nowadays. I have little control over a vast tech revolution. News
of the diode array should be published widely. Publishing replaces patents.

46
 thermal noise: The noise generated by thermal agitation of electrons in a conductor. The noise power, P, in watts, is
given by P = kT f, where k is Boltzmann's constant in joules per Kelvin, T is the conductor temperature in Kelvin,
and f is the bandwidth in hertz.
Note 1: Thermal noise power, per hertz, is equal throughout the frequency spectrum, depending only on k and T.
Note 2: For the general case, the above definition may be held to apply to charge carriers in any type of conducting
medium.
Synonyme Johnson noise.
Diodes produce 1/f noise.
We are in near agreement: This is how I would put it extending from your text: thermal noise: The noise generated by
thermal agitation of electrons in a conductor. Synonym Johnson noise.
( I am used to using the letter B for bandwidth but I'll defer here).
Note 1: Thermal noise power, per hertz, is equal throughout the frequency spectrum, UP TO A photon energy imposed limit
found to be ~10^12 Hz using WWII radar equipment. depending only on k which is a natural constant , ~1.38 X 10^-23 and
T.
Diodes produce 1/f noise WHICH IS something else. I have little understanding of it.
Diodes block half the power, the half of the reverse polarity so the formula for their Johnson noise power is 1/2 kTf. There
are losses in real devices so I divide by half again. The power of an array of diodes in consistent alignment parallel is
additive so the total power of a group of diodes in consistent alignment parallel is 1/2 kTf times the efficiency times the
number of diodes involved. Nanometer scale diodes are so small that 1/2 kTf % can be multiplied by a large number. ~Six
hundred billion can fit with wide spacing per square inch. This small effect becomes useful as applied nanotechnology.
Heat is absorbed because the moving electrons are slowed down as they climb into the group established voltage. When the
electrons enter the metal of the circuit they become current delivered at the group established voltage. Current times voltage
is electrical power. The maximum electrical output is delivered if the load resistance is matched to the supply resistance.
The maximum cooling will occur under these conditions. The diode array can be shorted out, at which time little electrical
power will be delivered and little cooling will be produced. A properly designed diode array can withstand these conditions
indefinitely. Deliberate shorts for control purposes can be used to trim away the voltage of some or all of the sections of
diode array sections in series. The diode array can also be open circuited, another condition without electrical power or
cooling.
After reading a little scepticism on another forum, I think back to the days of the old furnaces and a thermopile via the
Seebeck effect (differential thermopile). Getting electricity from heat isn't new. http://www.patentstorm.us/class/136/224-
Thermopile.html
Maybe it's never been done with nano-diodes, but it's sure been done before using dissimilar metals.
The diode array doesn't need to work between two heat reservoirs, a hotter reservoir applied to the hot side and a cooler
reservoir applied to the cold side as a steam engine needs a boiler and condenser. Instead, it consumes the heat of a reservoir
pulling it towards absolute zero in temperature. Energy can not be created or destroyed it can only be changed in form. The
diode array absorbs heat by converting it into an equal amount of electrical power. This absorption of heat is refrigeration.
A new idea requires extremely skilled presentation. Please give me feedback so I can find a way to explain the concept in
your terms.
There is big difference its treating HEAT as RF and converting to DC using diode and resonant LC ...
Like a crystal radio set but 90% eff .

Johnson noise is of constant power. In a high resistance the square root of the voltage will be high also. Diodes change in
resistance so the resistance ratio is more important than any forward voltage limit. The voltage limit an effect of an internal
polarization caused by an equilibrium between the freedom of mobile charges to drift away and the electrostatic charge of
the fixed within the crystal solid dopant ions which produced the mobile charges. Johnson noise is a deviation from
equilibrium for the diode as a whole. Mobile electrons flowing towards the anode opposite the junction shrink the depletion
region so that MANY electrons can cross the depletion region. Mobile electrons in the N type semiconductor cathode
flowing away from the anode opposite the junction expand the depletion region so that FEW electrons can cross the
depletion region. This difference in behaviour is consistent and can be aggregated by combining the net output of all the
diodes in the group.

47
Everyone, A small thermocouple in still water won't make any power. A diode array will. It can run a submarine indefinitely
without a gross thermal signature at steady speed because hull friction heat matches the cooling taken by propulsion. The
diode array can take its heat first.

Michael Couch: The difference between the diode array and the Peltier device is that the unpowered diode array is
extracting heat from the ambient and turning this into electricity. Peltier devices, under electric power, absorb heat from the
ambient on the cold side and transmit it to the hot side where it is added back to the ambient.
Peltiers can also generate heat by heating one side while keeping the other side cool. They've used this in polar outpost to
run radios. Heat from the stove pipe provided the heat and you can guess where the cold came from

A lot of"""""""""diodes will overcome the load's back noise

Charlie: Battele (the backer of Xerography) rejected the diode array for that reason. I didn't react fast enough on the phone.
As the number of diodes increases, the matching resistance of the load decreases. The ever smaller load resistance produces
an ever smaller square root voltage. The diodes prevail and get colder as the load resistor gets overcome and hotter.
When the patent was issued in 1975, I commissioned an invention promoting company to mail out the news. Texas
Instruments and possibly International rectifier were two of the few to return a reply. I should try TI again.
There is no tuning involved, the Johnson Noise white noise must not be filtered.
I don't manage www.diodearray.com. A diode array can get cold fast in a high power application if the circulating fluid heat
importing system fails. When it gets cold, it stops. Power should be proportional to the square of the absolute temperature.

Charley that is why I designed cavity to be resonant on loading ! (Short)

You Either Know what you do or don’t do it at all ...
http://www.nuenergy.org/alt/energy_amplification.htm
That LC2D2 DIODE PLUG CIRCUIT IS THE base FOR UNIVERSAL RESONANT ENERGY TRANSFORM ! from
nanodelta match to moon size elf antenna its the same, If you got no model in hand its dropping loads on a fan from
synchronous orbit height it will be flamed before hitting lower atmospheric strata.
If it were not complex to machine and do this elements I might do it myself given the right x ray machining and doping
equipment , but that is not my line of expertise .... You Got too Early ? or what is this ? no practical info to BUILT it ... ? no
model? not even a crystal HEAT radio set ?

On the rectifying facts ....Insertions within line ...

> There are FUNDAMENTAL reasons why you can't rectify Johnson noise in a > diode. The Diode itself makes just as
much noise and so the energy > does not go anywhere. IT is the same asinine proposal as trying to > make a Stirling heat
engine work after the fire has gone out.
Idea is to create a SINK "read stochastic resonance " to create a
CAVITY, in Bruce theory to add linear ION energy and in my theory to
transform RF in DC vectors & cooling down due to ENERGY
transform .
> If you connect a resistor to the diode the diode will soon be sending as much energy to the resistor as the resistor send to
the diode.
That is why you need a CAVITY to create Nodes and Anti nodes ..

48
where energy is VECTORED as electron flow .. like a microwave signal is turned to electricity in a microwave diode meter
but on nanomilimeter HEAT RF waves... There are 2 applicable models in Bruce page , the ION gate and the Transverter
plug ... all it takes is to nanomachine scale them down to heat IR RF ambient range ...
> If the resistor cools down, the diode will heat it up. In no case can you extract energy output of this system without a
resistor at a LOWER temperature than the source.
Here you err, Thermodynamics and RF are different measure of theoretic application .... I am trying to separate FACT from
bullshit here, in simple terms , a crystal radio picks energy from the ambient diode plug it to resonance becomes OU ...
A nanomilimetric diode radio can do the same , put a million of them in a silicon wafer tuned to ambient heat in phased
array it will cool down as energy is transformed , becomes a blackbody relative to ambient energy .
> IN due time that will heat up too and energy transfer will stop.
You are mixing thermopile delta transforms theory with RF ...
In VLIR RF you have freewave capture (no thermal differential)
heat will flow to drain sink "resonant cavity" ...

1.31. Super-cap & tunnel diode

Hi impedance results in broadbanding...Low impedance narrowbands it ...
Voltage becomes relative to frequency and Q, higher frequency higher Q, higher voltage potential LC requires VALANCE
where (L=(V/I)) = C = (C=(V/I) = Rt where in anaentropic system H=I² Rt
The design of the resonant tank will also require caduceus windings, but not the first prototypes.
The goal of the eventual design will be to oscillate below the ~1 Volt dielectric breakdown of the electrolytic capacitor
(home-made super-cap), thus the Q and Q2 answers I assume will indicate affects of the circuit impedance which will affect
the operating voltage of the resonance. The goal is to use low voltage, high current, relatively.
You are going to Extract energy from the remanent LATCH electret effect within the dielectric electron tensor itself.
READ MRA as you need to USE Crystals as dielectrics will BURN ..
The reason the super-cap is home-made is because it is to be planar and perpendicularly aligned with the A-vector axis of
the caduceus windings of the tank inductor.
The point of the A-vector axis aligning perpendicular and through the super cap centre is to create metallic growth in the
electrolyte included in a chemical layer of the super-cap... which is a simple planar plate in early designs. This fractal,
metallic growth patterns on the super-cap surfaces will be a mapping of the dynamics of the hyper-dynamics of the scalar
medium, "aether" or whatnot, and also a literal hologram of the resonant qualities, which will record and enable re-creation
of whatever anomalous and useful warps occur. We hope to keep the time-dilation qualities to an absolute constant... 'don't
need no' Philadelphia Experiment like outcomes. And the black spots are annoying.
(Evans electro-capacitive effect)
Another overlapping design feature is to place a tunnelling diode junction on the surface of the super-cap plates. Two plates
act as back to back electrolytic caps, and the inductor circuit is not clear to me yet. I'm given information as I'm able to
grasp it... slowly, but consistently.
? Natural RF ?
The tunnelling diodes will then react with the scalar wavefronts that will be tuned for "bucking" oscillations at the proximity
of the tunnelling diode junctions which is also in series with the super-caps, one tunnelling diode on each capacitor plate,
and which is also at the centre "compression/rarefaction" plane" of the bucking oscillators (dual LC tanks coupled on the
reality of the scalar dynamics).
For Micro battery is Ok but to escalate to commercial scale ? is like fishing sturgeon on the Hudson river and getting quality
caviar ..
The tunnelling diodes, a solder/rust surface junction against the super-cap plates, are rings with five or six inches linearly of
tunnel-surface-area... unlike the small point contact of a cat's whisker type of typical commercial tunnelling diode. The
inline tunnelling diodes will be able to handle and appreciable amount of current... yet will also serve as a fuse to any

49
runaway sinusoidal ramping should the compression plane of the bucking scalar effects leak ZPE into the as a run-away
feedback.
*******
As I interpret you are running on Micromilimetric background noise used to feed tunnel diodes in order to subtract such
energy in linear stream ..
*******
This design then becomes the prototype to create a geometrical arrangement of planar super-cap plates, but that will be a
precision fabrication with a lot of specialized fabrication techniques. This is a hyperGeometry project once past the
prototypes, where the scalar phenomena will have a cosy cavity of octahedral resonant tank of the bucking scalar
phenomena -two pyramids base to base.
You are welcome but you are better creating micromilimetric silicon cavity and using IF Infrared ambient energy resonance
and rectify such to tunnel-Shottky diode bridge into a compensated linear load array to sum it to a DC stream .. .
Actual Lithography methods permits such technology to be made easy (already posted this long ago ) The microtubule
diodes went nowhere ( Heat rectifying nanotubes) so its more a POLITICAL and economical problem taping ZPE than a
technical one ...
( run an atom in 3 phases and in full RV mode ..) from where does it feeds ? Answer: (transformation)
you only need to think in symbols ! All RV technology is contained in a single geometric set of forms (starting with 3
triangle points ... a 4D graphyc projection shows the rest .
The more advance technology is, the more symbolic and simpler it becomes , fluidic mind a must , tantra as base for organic
mutation to 4d 5d 6d 7d projection .

1.32. Battery
A lead acid battery behaves like an inductor for the first charge time and then begins to behave like a capacitor once
charged. The clue is what happens in the middle. You now have an oversaturated inductor effect and a capacitor going
through its 90deg current stage.
This converts battery into a purely resistive element as having A DC value of positive and negative density one pole cools
and the other heats up .... Electronically this UNVALANCES battery chemistry and one side boils electrolyte off while the
other freezes at hi power, middle being room temperature .. that is Why in my past postings I always told battery was
destroyed by cross resonance vectors
Separating battery and treating as Capacitor only is more efficient using reactor core discharge pulse charging .. (after OU
collection and conversion. )
Other solution is Using CHARGED electret accumulator

Just be sure to keep voltage at 12.7-13.8 VDC as not to dry fry battery!

1.33. Class C linear amplifier

Class C amplifiers conduct less than 50% of the input signal and the distortion at the output is high, but high efficiencies (up
to 90%) are possible. Some applications (for example, megaphones) can tolerate the distortion. A much more common
application for Class C amplifiers is in RF transmitters, where the distortion can be vastly reduced by using tuned loads on
the amplifier stage. The signal is restored to near sinusoidal shape by a tuned circuit. The input signal is used to roughly
switch the amplifying device on and off, which causes pulses of current to flow through a tuned circuit.
The Class C amp has 2 modes of operation, tuned, and untuned. The diagram below shows a waveform from a simple class
C circuit without the tuned load. This is called untuned operation, and the analysis of the waveforms shows the massive
distortion that appears in the signal. When the proper load (e.g., a pure LC filter) is used, 2 things happen. The first is that
the output's bias level is "clamped", so that the output variation is centered at 1/2 of the supply voltage. This is why tuned
operation is sometimes called a "clamper". This action of elevating bias level allows the waveform to be restored to it's
proper shape, allowing a complete waveform to be re-established despite having only a one-polarity supply. This is directly
related to the second phenomena: the waveform on the center frequency becomes much less distorted. The distortion that is

50
present is dependent upon the bandwidth of the tuned load,
with the center frequency seeing very little distortion, but
greater attenuation the farther from the tuned frequency that
the signal gets.
The tuned circuit will only resonate at particular frequencies,
and so the unwanted frequencies are dramatically suppressed,
and the wanted full signal (sine wave) will be extracted by the
tuned load (e.g., a high-quality bell will ring at a particular
frequency when it is hit periodically with a hammer). Provided
the transmitter is not required to operate over a very wide band
of frequencies, this arrangement works extremely well. Other
residual harmonics can be removed using a filter.

Get VTA schematics ... (ask got them somewhere in the megasuckload pages...
you will see one method is modulating magnetic fields as class C linear amplifier

Lets say as sample you have a LINEAR class C grounded grid amplifier
YOU have a VOLTAGE Usually 800VDC that provides POWER to permit the VACCUM TUBE to amplify the signal,(
that is the prime power source to it) ... you have a CB or ham radio signal in it it gets boosted from say 5 W to 90W (18dBs
gain)
Suppose you use instead of 800VDC you use a MAGNETIC field and you MODULATE this field to create
AMPLIFICATION of ENERGY "Electrical" into MAGNETIC modulation that induces a MAYOR force (amplified power)
into electrical conversion again ...as sweet VTA , in a sense RV is a magnetic Rotary amplifier where in a sense acts as
amplitron tube where magnetic & resonance interact to amplify input power VECTOR.
This in specific tuned states ..."like the ones Kone replicated"
MAGNETISM is just another energy flow that can be tapped as we do with the electrical one where it DRAWS its power
from OTHER domain. Sample as Suckamatron does from AIR heat to electric power conversion, RV does from magnetic
one, resonant modes are the GATE permitting the gain from natural energy exchanges.
We then have to see how it affects the magnetic field source ENERGY level and the transform mechanics involved (In VTA
was manifested as TEMPERATURE decrease) down to cryogenic level (Absolute 0 ) Bose-Einstein condensate ) if taken to
extreme field drain..

1.34. FM
I was asked about FM wave modulation; answer is as follows (AS I don’t want this to be patented it must be made clear as
is integral part of disclosure).
FM is frequency modulation. IN Looped RV is manifested in the hyper wave form that is created within the states of
OU - non OU.
is simple, a tuned system has a basic fundamental set of frequencies that is tuned too, if a parameter changes so does
the frequency and this is in a fast changing system becomes FM* compound modulation.
In ZPE use this can be a source of surge energy damping as in motor starting systems where a motor driven flywheel
acts as energy accumulator the energy vector is transferred as a Phasor to power lines correcting the lagging power
produced as a sample in a motor starting event ((FM) frequency modulation *).
The applications range in the use as surge damper to prevent the spikes on utility power demand as well as a kinetic energy
accumulator to lower the surge in POWER inverters (solar systems like say start a REFRIGERATOR MOTOR that draws
5KW starting but uses.8KW . Running a 2000W inverter trips starting this load, but with a 3600 RPM synchronous RV
kinetic accumulator the spike can be lowered to a mere 1200W within the inverter power range (no tripping or alarms).
such effect Of phasor transferred energy (Rotation angle differences ) do have FM component to it as a change in
impedance and overall frequency shift of the involved circuits, on multiple phase circuits quadrature and hypercube

51
compound complex modulation occurs, here also is where stochastic resonance & broadband & narrowband multi-
resonance play part in ZPE circuitry, load being just a tensor to system entropy reflecting as " time decay" & broad-banding
as in radiant energy systems "detuning" & Q LC resonance factor reduction.
That is reason MRA detuned under OU and MEG Failed to perform .LOAD = DETUNING.
That is why the ENERGY must be extracted NON reflective to ZPE system (Main Reactor) be it MRA, MEG, VTA or
looped Transverter or RV systems
FM in a sense in power systems is manifested as Leading or lagging voltages or currents relative to a source or a
load.
In power engineering this is defined as angles of rotation (phasors).and is part of RV power management science.
This is Part of Electronic Turbine set of parameters that NASA intended to steal from H19, their heavier Electric motor I
can make light as a feather (their response to my offer was a theft in the night visit and sabotage mission)
(screw them !) I designed the electric turbine RV concept first and its power management of which Raivo have the inverter
drive pictures and the rest is as public TOYS that can be RV converted using the disclosed AMPLITUDE control (voltage)
frequency & pulse length regulation.
An inverter with adjustable 100 to 480VDC or more Hi voltage stage; Opto-isolated driven AC IGBTs stage, 1 or 3 Phases
or multi-phased to infinity, Frequency Controlled modified sine wave output from 0 to infinite and pulse-length regulated ...
All these Parameters can be computer regulated using speed tachometer sensors, current sensors, hall effect, opto-electronic,
shunt & others.
Any motor can be regulated to optimal power management and optimal output at a given speed & load.
Some of this Conditions result in OVERUNITY, where System gains energy from the ambient and results in an increase of
energy output that exceeds the input to machine (OVERUNITY) (Endotropic).
Here is where ZPE enters the building.
To be continued; copy & keep & pass on
Global warming already passed the thermal rundown stage; like an overcharged Nc battery earth is increasing its self
heating and is becoming self looping . The pestilent wave I predicted is already in .. from NY to Texas the earth big
methane fart can be smelled ..But that is nothing, as the eternal northern rains arise where there was snow there will be
fermentation, from NY rivers to the poles all will be thrown into the rotting bucket! Take a deep breath! don’t they smell
GOOD!
ARK Research 1980, 1999, 2007 C

1.35. Seike book

Seike book - printed in English (on even numbered pages) and Japanese (on odd) - is completely incomprehensible to the
lay-person, but for an engineer it contains replicable theories on mysterious Moebius-wound coils and other devices which
would provide you with free energy, antigravitation and eternal youth.
mathematical calculations are mixed with the relevant formulas, it takes a lot of patience to read his credulous treatment of
the claims of 'Professor' Despite this, Seike's writings have inspired many researchers to employ his ideas and circuitry.
Based on work of Prof. Shinichi Seike's Nuclear Electrical Resonance Theories, JL labs successfully tested his G Strain
energy absorber. The conclusion proved his theories on the Gstrain are correct. http://jnaudin.free.fr/seike/gseav3.htm
Other continuations of Seike's research can be found in The Rotoverter (RV) originally the intellectual property of Hector D
Perez Torres, publicly released open sourced.
Hector states, Seike formulations are 300 years ahead of this timeline, the background is contained in the ROTARY phase
kaweyama model. The RV is the physical demonstration of this principle and all Seike's work is related to it.
Seike could have used 3 PH motors to demonstrate this principle, However there are physical dangers involved when you
create hi power rotating self oscillating engines.
A NOTE :

52
In some Motors which are set in Wye and are feeding pure DC to L centre and capacitor (C) which are being negative fed to
a tripleflux Wye centre flux, will create a rotary field with infinite acceleration capacity.
The Konehead RV lawn mower demonstrated a tendency to accelerate towards infinity from creating its own incremental
harmonics in a self cyclo-converting effect. conditions to create this effect are critical in adjustment
SEIKE clearly explains self rotary effect ...(Easy) A,B,C is PHASES.
The RV needs to break the 24 LAW rule
Up to date 23 does not suffice to break the collective barrier to materialize it from 4rth dimension coordinates to physical
reality. AB,BA,CA Look for that in Seike formulations , your eyes will open as you realize its 3 phases.
The self spinning of delta Wye Seike model responds to a gravitic spiral flow component (as coreolis electrical force) being
constructed a Rotary Engine and made to accelerate over the Spin 4D vector G (gravity),it then enters a NEGATIVE state as
the rotary transform becomes a reverse flow in time relative to gravitic one.
Simple, More simple as you have RV "GATE" to enter the portal.
The RV is well justified in SEIKE'S rotary formulations, and is the theoretical complement to the RV. Seike failed to apply
such formulas to rotary machines, the RV well demonstrates that his formulations are a physical reality , including TIME
TRAVEL and Anomalic gravitic phenomena at hi energy, this is relative to a 1 meter wave-length in a RF rotary dipole
element triad. Just be careful with experimentation in RF rotary fields as you can end TELEPORTED with no return to
Other place other time.
The book of prof. S, Seike, Principles of Ultra Relativity, 5th ed. Put some insight into these concepts upon examination.
The RV's ability to save power comes in fact from a receding time variable, from the STATOR rotating field view the rotor
is a receding resistive force where the power used is measured in pressure and as angle of rotation variable in field
(inductance reluctance).
Like is physics initial acceleration from a mass at rest until it equals the force moving it, once is equal the only energy used
is the one raised by entropy losses. Extracting OU requires all this basics to be digested in models, else theory standard
deviates mind toward entropy again. It’s the Method what matters.
Book
Seiki S, The Principles of Ultra-Relativity, Ninomiya Press, PO Box 33, Uwajima City, Ehime (798),Japan, 10th edition,
Dec.1990.
http://www.megaupload.com/?d=4NZVDLHF

1.36. Looping
LOOPING is dam easy ... more easy than you think .
JUST match the impedances... convert those VOLTAGE & Amperage Ratios properly, and take care not to
overcharge & burn the battery.

Using the 220 AC from the RV alternator LC you can bridge in DIODE plug 480VDC or bridge mode 240 DC for a
constant 5 to 10 amperes and switch alternatively to inverter charger inverter charger as it reaches 13.8 V (using 2 batteries,
it will take a shorter time to charge in vectored 220 DC as internal resistance is reduced proportional to the voltage increase
...
You can initiate with bridge shorted with on switch that you turn "OFF” to charge battery "on”.
RV is the first device you turn on by turning a switch off...
Just watch out for the COLD fusion effects
This is a WAY to loop RV ... not the one I liked but is a way to do it fast and Dangerously “cheese" ... just design proper
cut-off as Batteries are not designed for radiant energy (just be careful) loop using intermittent battery exchange ... limit to
13.8 VDC too fast rise and your inverter silicon will go fusion-fission with the in vitro familiar blue toxic smoke: P
The cheese stuff is an orange salt that forms at poles usually transuranic in nature and "HOT" "buy Rad meter” as Pb 206
creates some problems of its own with the cold fusion stuff ...

53
For those loving danger and weapons of mass destruction sonofusion frequencies are 23 - 24.5 kHz 245- 348 CPS Sub
harmonics up to 2.45GHZ (microwave) frequency octaves.... passing signal across magnetron using the radiant DC vector
creates a fusion reactor using RV alternator , as RV alternator can hit 10KW energy level creating 100KW sonofusion level
.... Plug is vectored across magnetron at 800VDC level = is submerged in water (expendable) one shot long run
Usually pb 206 hydrates acquiring SI 20 atom and jumps to U234+1 then acquires another IS20 cluster becoming
americium 241+10 (251) witch decays again to produce k40 and PB205 so for those wanting to built their own K40 mini
nukes this will be very interesting K 40 is ultra stable until hit with proton initiator discharge the darn thing goes nuclear, a
cigarette pack size can carry a 20KT punch .MMM interesting to initiate the Hera of the home made nukes!
OPPS! Its public! AWW too late who gives a fuck!

1.37. Blackholes
Black holes are a great source of energy , they are called "IRON" suns , lets assume in a simile IRON resonates quantaly to
this IRON suns , Then let state that Iron in proper resonance to BLACK hole hyperspace signal can tap to its infinite
singularity power source engine.
keep this notes and date as I don’t want Hawkings, Saffati or any diplomatic idiot to make this open source revelation his
intellectual property.
This Hypersignals (specially nearby supernovas) can be tapped, used modulated into sine integral instant communications
loop (apart from being sub-space noise power sources & hyperwave tensors )

1.38. Carbon rod generator system schematics

Super HI Q hypersignal LCs in transverter systems
OR Tesla coil spark gap EXITERS banging the carbon rod at its end
that is resonant made 10KV trafo using homemade aluminium foil or plate capacitors glass plate glass plate glass 8 x 11
metal plates
that slide on each side of 1/8 glass panes 17x24 that can tune to full 50 cps or 60 CPS resonance where a GAP discharges
the capacitor at top potential into the CARBON rod to excite the atoms in tune with the Black matter of the universe (black
holes) in the carbon-iron-boron
boron iron carbon thermomagnetonuclear transmutation transition ..
Tesla coil method can discharge megajoules in the carbon rods ! equalling 10 million electron volt pulses (minimal)

ok the fastest carbon rod source are carbon centre from batteries , 2 batteries provide 2 metal caps & 2 carbon rods use one
rod keep one spare the other cap at 2 ends ...
aaa ,aa , c & d battery carbon innards are ok .. cheap china carbon zinc batteries are nice to operate on and are cheap 4 D
for a buck each ...like this Maxwell super shit and mustang (or I may say ) dead horse ones.....
Once capped the tube (inert gas filled or evacuated can be built and capped carbon unit used as "Insert " a xenon flash can
be used with the carbon in series to bang it .... or the Tesla coil carbon banger !
If EMP collected exceeds power required to bang it , you have it made !
Carbon-iron-boron Quantal blackhole banger reactor ....

1.39. Han Coler

I think that this is the basis for Han Coler's stuf (although the Iron that Hans worked with was magnetized) yet, there is a lot
to be said about Iron.
In Tom Beardon's MEG, he specifies something like 96% Iron to 4 % aluminium, because Iron has the slowest reaction time
to voltage/current activation. Also, I think Tom got his ideas about the MEG from Joe Flynn.

54
Iron (FE) atomic structure:
> Atomic No. 26.
> 1rst shell = 2 (complete),
> 2nd shell = 8 (complete).
> 3rd shell = 14 (4 short of completion) for inert-ness)
> 4th shell = 2 (30 short of completion for inert-ness)
> Total Missing necessary for completeness = 34 electrons in shells #'s 3 &4.
Copper (CU) atomic structure:
> Atomic No 29
> 1rst shell 2 (complete),
> 2nd shell 8 (complete),
> 3rd shell 18 (complete),
> 4th shell 1 (31 short of completion for inert-ness).
> Total Missing necessary for completeness = 31 electrons in shell #4.
> Aluminium (AL) atomic structure:
> Atomic No 13.
> 1rst shell = 2 (compete),
> 2nd shell = 8 (complete),
> 3rd shell = 3 (15 short of completion)
> Total Missing necessary for completeness = 15 electrons in Shell # 3
It seems like the more shells are missing completion, the more sponge-like the element is to electrons.
(Iron thunderbolt ) I had written quite a few postings on it ....
Its the frequency harmonics & ferroresonance what you have to look at , the energy that makes utility transformers burn up
...MEMA ( Magnetless Electro Magnetic Amplifier ) using 3PH transformers.
Coler’s unit OVERHEATED due to the fact the cores used are not of laminate required to avoid internal current losses and
their conversion to heat. Iron loss was the result and the decay of system to UNDER unity in a short time ... (core-meltdown
) using transformers cores is the answer (ferroresonant quality type )
Coler also has another occult secret I have kept to be released as it becomes well understood that overunity is energy
transformation. It’s the magnetic MODULATOR or (VTA) integrated to it ....(Tip)

1.40. Visual projecting the OU mechanics

M field can be considered a charge constant, as a capacitor being discharged in a COIL lets call it mC (Magnetic Capacitor)
Your COIL core and COIL L being Shorted becomes NEAR 0 resistor where its ENERGY value is eD (electron density per
square centimetre) as measured in the AMPERE density section of an STANDING wave ....
That Means the Magnet being a ROTARY condenser imparts its energy as VOLTAGE mC and converts it to PURE
CURRENT NODE where VOLTAGE = near 0 being 0 perfect virtual 0 Energy point state but where ELECTRONS are at
saturation point and can acquire energy from HEAT and ambient noise ..
At maximal M field where the short circuit is open then the virtual Current node tensor collapses into a relative finite
resistance capacitor where its Ampere density is transformed into a CHARGE value potential , 3 factors contribute here ,
coil core ,wire turns ,wire size, Capacitor Value and its dielectric charge constants under RF signal , where Stored energy
can be defined by Joules at time of discharge , core and Coil will rest to Ambient energy state or preferable UNDER
ambient energy where it COOLS down ..
Whatever is said or commented that is ZPE in its simplest form be it solid state or rotary machines its the same stuff
common to all devices. Keep this notes .. Read Seike’s formulations, he almost hit it ... just was not able to demonstrate in
vitro using standard devices . But all of you have them now ...
On anti gravity phenomena issues is result of forcing electron spin energy down forcing electron to decay, as electron
decays they become NEGATIVE in time and space creating anti-gravitic field.
(other problems do arise with PMs as they contain traces of K40 and other exotic materials that go nuclear so is better to
avoid using 1.06 t0 1.6MHZ syncotron radiation emitting frequency harmonics ..
Stay thermal .. Stay in Energy savings for the time being , until this Hits the Fan spreads wide and open ...

55
What would be the optimum place on the sine wave to short the coil? Just before the peak? Or are you saying at the zero
crossing, zero voltage point of the sinewave. And the optimum length of short?
finding Sweet spot either with reed switch hall sensor switch or optical timing, there your best angle of charge can be
acquired at shorting and opening coil .. Main idea is to have it shorted and then Open it at TOP current sinewave NODE (0
voltage ) as SHORT is 0 resistance ...
fuse switches have advantage they reset at 0 so they are shorted since the beginning tailored to open at top current as
MAGNET attracts the core it Counteracts the REVERSE CEMF (advantage over conventional full core standard
laminations are the Empty spaces ) not the Core material itself .. Its the GAPS that change the impedance character of the
core completely (as Ecklin-Brown Generator) so magnetic Gauss intensity PF VAR factor can be altered by adjusting Gap
,like slide in adjust plates for MEG gauss adjust as Other Sample , in NORMAL practice the welding machines that uses an
adjustable core to control welding current ..
This is as Turning things On by turning them off , It gets you ...
Hard to understand concepts not seen in any book, magnet GAP changes impedance and POWER factor correction VAR
capacity, the Empty space permits ballistic attraction component to counteract CEMF at same time if coil potential is
UNIVEN it acts as linear accelerator of rotary field component 2-3 ratio found in 3 phase and Muller motor design .

1.41. Solenoid
There is info on Coaxial ring solenoid that may be useful for this project, old audio speaker metal caps and hi silica sch 80
electrical pipe machined in concentric rings with concentric series windings that slide in concentric mu metal passive poles
attached on cylinders like squared dovetail ends , or collapsible telescope alike .. slide into each other ring to ring on close
tolerance gaps.
pull is x10 times ordinary solenoid pull ... & requires no magnets
There was a company named Solenoid Corp was blown up by petrol elite as they ran a motor bike all day with a D size
1.5vdc flash light battery, inventor was murdered.
I got all the data using stargate window, and above statements on coaxial pipes within pipes with magnet wire series
winding is its simple secret.
Here is some coil solenoid candy ... http://www.smeter.net/feeding/selfres3.php
Do a search ..http://search.msn.com/results.aspx?srch=105&FORM=AS5&q=coaxial+solenoid

1.42. Tesla coil

a simple Tesla Coil: The secret is simple , you first find the type of signal you have on a site (natural standing waves) you
determine frequency and provide an air capacity and COIL to tap into it, you excite your TESLA COIL TO
SYNCHRONIZE TO the standing wave signature to acquire class c amplifier alike in the coil air capacity elements at hi Q
modes the instant the signals cophases the system becomes self sustaining at signal potential x 10, that is like 64,000 hp for
a 128KHz signature in Colorado springs area .. Colorado USA.
you need to locate the nodes and place the resonators in order to tap the standing wave signals .

So Called 'Tesla Coils' (need better definition)

Take an 'ignition coil' (or any transformer for that matter) THE PRIMARY IS NOT TUNED, nor is the secondary!!!
Transformers are what is called 'broadband' only limited by hysteresis losses (iron), low frequency, or interwinding
capacitance and 'skin effect' High frequency! In the case of ignition coil, don't consider the 'condenser' erroneously, as
tuning, it is only there to prevent the rate of change of flux, and thereby voltage from reaching a level that would arc over
and destroy the contact breaker
If you mean by 'Tesla' open wound air coils, then the 'one turn' (usual) energising winding, with capacitance, is only a
source of massive instantaneous power and flux generation (like a magnetiser), the 'coupling factor' is usually less than .1
(POINT 1) enabling the secondary, only tuned by (self) interwinding capacitance, to 'fly' at a very high frequency without
being inhibited by the primary!

56
Study the formula, E = -LI/T. I, current as induced as DC, as magnetiser, and T, time, which is decided by the natural
resonance of the coil and MINIMUM capacitance.
Capacitance of PICOFARADS between turns is inescapable, (coupling to primary of 1 (one) would kill it dead), and the less
the inductance also, the higher the frequency, and hence reduction of 'T' time. Resonant frequency is 1/2PI root LC, and 'Q'
voltage amplification factor of coil is 1/R root L/C, so minimum value of 'C' critical!!!

1.43. Tesla amplifying transmitter

The Amplifying transmitter .. Nothing else than a RESONANT hi voltage primary With a Capacitor set to discharge at
maximal peak across an air gap into a very low impedance coil being primary exciter of a very large impedance one ..
Were the Extra energy comes from ?
The discharge from the capacitor is hypersignal (DC)+ (DC-) cut-off peak discharge, Were the Damping signals are ? , the
myriad of Molecular to physical wavelength harmonics created within the Coil itself and AIR core space ( being Air core
Tesla coil ) or within a metal core being a car ignition coil like used in early EMA 4 design ...
The core gap acts as NOISE generator and VARACTOR circuit ... of sharp cascading pulses ..
The OU is within the AMBIENT energy that contributes its potential to secondary circuit oscillations (as in Tesla’s
AMPLIFYING transmitter) we speak of.

and on Tesla amplifying transmitter I gave details long ago ..

10 ft diameter spherical capacitor antenna and LC tuneable from 10KHZ to 128KHZ with a 240 FT ground rod ,and lots of
life insurance if you cant manage the Conjured power from heavens .... Excite with another Tesla coil ,when it goes resonant
within EARTH standing wave node it goes 36,000 HP instantly in resonance with EARTH dipole ..
Resistance must be 51.1 ohms at 26856W radiant dissipation (RF) .
Design as that parameter is valid universal one ..

1.44. Tesla quote "tremendous advantage to break at the peak of the wave”
In one of the compilations there is the TRUE Tesla coil driver
The HV secondary is RESONANT to CAPACITOR PLATES where an SPARK GAP connects the Coil primary and
discharges at the CREST of the WAVE
This applies to VOLTAGE node (MAXIMAL ) where in KONE COIL is CURRENT Mode Maximal , the secret as stated
many times is Knowing to USE the POWER NODES in resonance ..
Refer to poor mans thyratron postings for more data .. as it was intended for PEAK triggering the TRANSVERTER PLUG
capacitors applied to RESONANT adjusted PM ROTOR GENERATOR MACHINE .. like Muller or any conventional
machine as NON reflecting JOULE power discharge ..
Crest can be..
Current peak at 0 voltage (Kone Coil)
Voltage peak at 0 current (Transverter Capacitor Plug )
ALL Manifested in TESLA COIL PRIMARY where such BASIC circuit is used in AC signal dual mode .
Ac feeds primary secondary goes peak at resonance charging capacitor spark gap fires at crest into a literally shorted turn
that GOES MAX amperage as gap is active (Joule discharge) where AMPERAGE flow is maximal as such Shorted turn
equivalent where in OPEN air E field is maximal at Spark Gap opening the field signal collapses and regausses causing the
FAMOUS hi voltage effect of TESLA discharge ..
The signal is AC 60CPS but the PEAK discharge consist of Stepped 10KH to 256Khz within EACH sinewave peak , refer
to my Newman motor postings to Spark Gap postings on BEDINI motors and plasma discharges..
Tesla secrets in reality are very simple … to the point of breakdown...

57
1.45. Dipole
Raivo: I have a dipole question (don’t want to ask it through group). Phil has his recovery and pulsing systems in a very
strict design. When you collect the charge you must be separated from the battery or balanced.
That is called impedance isolation ....
If you add just a single diode to create a ground reference for example is wrong, since he says it will shift the dipole away
from the charging battery centre (or whatever).
Remember the NODE issues as tuning SHIFT nodes ampere and voltage within RF structure in a physical
system battery responds to as if it were a hi FARAD capacitor ...
Also - pulsing a coil must always be done with switching it at both sides!
That is to valance core in open core design but in transformer centre tap and acoustic resonance valance is push
pull mode
You have not talked about the symmetry of the dipole and potentials, please explain. Without it - the DC pulsing seems to
be impossible...
Yes I have talked about that as I talked about light bulb being in pure current NODE as being non shifted to voltage
one being able to be lit under water ..
I specified to READ antenna theory and RF nodes, if you read any of it then it may had become evident ...
Phil just read a bit better than you , but he stills need to lean a lot , if you ever kept my notes try to find the ones I
mention the Travelling latching waves across a hysteresis metal rod and VTA latching of old IBM memory cores
....
Or does it correlate to your RF and nodes?
Its same old shit with a different frosting top but is not laws but variables in application..
Phil is just doing a bit more of experimentation isolating the particulars where in a RADIO antenna they form a
whole , he just interpreted certain aspects correctly , recheck my postings on poor man thyratron , RF, Nodes ,
matching , Phil is separating the elements and controlling them as he does he can go back to a few parts design
in simple mode as RV ..
Can be as simple as a camera flash circuit a Party strobe light and a wire coil & hi voltage diode ..
the thing to determine is Your Capacitor Value & your coil value and the OPEN-CLOSE relation ..

1.46. The Coulomb law misconception

The Coulomb law statement that opposites attract and likes repel is not true to Natural law.
Opposite conditions ARE opposite conditions. Likewise, they are opposite effects caused by each thrusting in opposite
directions. It is not logical to say that opposites fulfil any other office than to OPPOSE. Not is it logical to say that opposing
things attract each other.
In all this universe, like conditions seek like conditions. Gases and vapours seek gases and vapours by rising to find them.
Liquids and solids seek liquids and solids by falling toward them.
Radiating matter seeks a radiating condition in the outward direction of radiation. Gravitating matter seeks the inward radial
direction of condensation to find its like condition.
Opposite poles of a bar magnet thrust away from each other as far as they can go. That is the very purpose of the electric
current which divides the universal equilibrium. If opposite poles attracted each other they would have to be together in the
middle, instead of "pushing" away from each other to the very ends.
When depolarization takes place the poles seem to draw closer together, but that is because of their lessening vitality. They
still thrust away from each other until devitalisation is complete. When motion ceases, the matter which it manifests ceases
to be.
Scientific observers have been deceived by their senses into thinking that opposites attract each other because of seeing the
north pole of one magnet "pull" toward the south pole of another magnet.

58
The fact that opposite polarities void each other when thus contacted has not been considered as a factor in the matter. It is a
fact, however, when two opposites are thus brought together by their seeming eagerness to contact each other, both poles
cease to be. Each one has voided the other as completely as the chemical opposites sodium and chlorine void each other and
leave no trace of either one after that contact.
If the Coulomb law were valid, it would not be possible to gather together one ounce of any one element.

From what I have come across, magnets in repulsion will deplete whilst magnets in attraction mode don’t and revitalize
themselves.
Maybe it will surprise you but try to read the latest here: http://groups.yahoo.com/group/minatowheel/
Spherical "forced" monopoles do not attract or repel but do show time differential ...
So we may identify attraction or repulsion as time differential induced acceleration or de-acceleration relative to time &
space.

1.47. Phil on conservation of energy

Phil: Energy can not be created nor can it be destroyed. If it is used, it changes from one frequency form too another.
The BEMF from pulsing a coil is the same energy used too saturate the coil minus what is wasted as heat and in the
magnetic field generated.
Heat, light, magnetism is all just a frequency of electrons being radiated from the same original electrons used too energize
the coil.
If a coil is used too force rotation, and lets say one end is instantly pulsed a north pole as too force against a North Pole
magnet, little too no current is consumed as the coil begins too saturate its core. As the core begins too be fully saturated of
electrons it begins too force these out the end of the cores of the polarity that opposes the electrons radiating out of the
magnet.
The harder the rotor is labouring doing real work, the harder it is for the electrons too escape from the core as it is opposed
by the magnet position. The instant of closing the pulse, and with every action being opposite and equal the coil polarity
collapses at high speed opposite too the original slow charge time.
The extreme high voltage low current BEMF generated in the coil can either be used too form another strong short duration
magnetic field, by placing a resistance or short across its windings by a diode or battery resistance or other means. Higher
voltage means faster saturation time. Or the BEMF can be allowed too accelerate with freedom into a pre-charged capacitor
placing little resistance thus a greater collection of energy is available.
The other means which I use most of all is too allow this energy too fly into a higher resistant coil or transformer with
plenty of inductance, as this reduces much and all loading on the original coil, as it does not put pressure on the coil as the
inductance laminates begin too fill with electrons.
This now stored energy is available for the next pulse, and or can be used too power up another load.
Remember the rotor is doing real work, and we have near all the original energy back, and we "have" allowed the coil too
collapse with ease thus not radiating the electrons out as heat or in a magnetic form from the coil of the wrong polarity.
This is why proper BEMF collection increases motor RPM and allows the coils too run colder as more flexibility is there for
the return energy too flow.
If people would snap out of text book theory that say: "there is a relationship with electrons and a magnetic field but it is a
mystery", but then look at reality regarding the Hall Effect and how the Peltier devices work, it is seen how simple and
obvious it all is.
It is up to the individual if they wish too spend the rest of there life confused with Quantum physics and side tracked by
worthless meaningless words trying too explain a phenomena. Or they can look at the true simplicity of energy and follow
what Tesla stated that "One must think like a child and not confuse the mind with worthless theories".
The biggest area I see people mess up is they think a motor should use a tiny amount of energy or even worse think it should
just put out FE. The motor must be pushed hard and heavily loaded doing real work so then you receive back most of the
original energy, not just in BEMF but also in shaft power too drive another generator or whatever.

59
1.48. Flywheel
The flywheel is a kinetic energy accumulator or I may say a MECHANICAL capacitor ...
It permits regaussing a system from 0 or negative energy states to recharge in the positive interval ones ...
(To ears that can listen to written words)

60
2. RV related

2.1. General RV
A 3 to 7.5 HP 3ph 230/460VAC motor is best to make 1 to 1.8 HP RVs in 60CPS .(5 to 10 HP in 50CPS )
AND ANY motor can be run using adaptive electronics in FULL HP range using: (TAKE BIG NOTE as this is OPEN
SOURCE BASED in Expired Patent Off shelve items and RV open sourced ness)
Control voltage, frequency and pulselength and you can RV any 3PH motor. The phase-angle is turned OU radiant by
means of pulse-length-reactance interaction coupled to amplitude value.
Amplitude control Voltage from 120VAC to 460VAC
Power supply of variable parameters (amplitude control); Voltage regulates Impedance as if it were
VARACTOR tuned LC. This REGULATES HP output and energy saving Impedance states
Frequency control from 0 CPS to Infinite
Frequency control (this regulates speed and Horsepower output as in combination with amplitude.
Pulse-length control from 0 to MAX frequency length pulse
Determined by sine wave or square dc wave length in time (modified sine wave) & sine wave or any wave slope
angle saw tooth, incremental logarithmic, stepped pulsed, quadrature modulated or phase modulated or any
compound modulation or amplitude form , power or RF current & voltage phased angles (power factor).
Pulse-length control this regulates as in case of MODIFIED sinewave 3PH inverter (already Tested in H19)
the ZPE power recovery modes in relation to other parameter adjustments (optimizes best performance
states within range of HP and motor loading)
ANY frequency drive can be MODIFIED to do this; specially the 480ACV ones adding VOLTAGE amplitude
control. That is regulating its final drive voltage from 100 to 480VDC as to be switched by the 3 PH transistor or
IGBTs 3x3 network.
The drive can regulate motors in full range of parameters given in RV disclosure with the advantage of having
FULL rated horsepower at demand.

Frequency, pulselength and amplitude are the key in 3 phase inverter drives. The power remains the same but the output
goes OU. 3 phase diode circuit can recover more power as frequency increases it increases the CEMF voltage.
Using a direct inverter drive will show a POWER reduction at specific speeds (sweet resonant energy multiplying spots).
Regulate Voltage (amplitude) ,frequency and pulselength you can drive anything in its natural OU ZPE resonance points.

Any modified sinewave inverter can be modified to operate in Amplitude , frequency and pulse-length control , Opto-
isolated drives being best option and 12.7VDC operated electronics also Opto-isolated & computer driven as Extra option .
Any number of inverters can be ganged to create multiphase array .Computer used as drivers using Opto-isolated stages.
Sample 3 10KW inverters can drive 30KW 3 phase system with same source and using computer driven 3PH trigger, pulse
& amplitude generation.
(Phil can play with those toys ) as it is EASY OFF shelve no bullshit simple mods , the inverter first stages can also
controlled to drive inverters to ZPE states ... (requires a bit more labour intensive mods but is also over the counter simple )
This is the Compilation of compilations of what I had given public on RV Rotoconversion and its final application on level
one.
Opens door for truth ends denial, as now opens gate for full motor HP usage and way to exceed normal motor HP by
increasing its speed over the normal parameters.
Final puzzle solution.... (and it means you can do whatever you like with electrical power)
That is true meaning of ROTOCONVERTER technology ...and it took 35+ years to be infiltrated into the "system”.

61
the given Mass to frequency relation and the energy squirrel cage takes to magnetize.
In bigger size EM synchronous rotors using a generator as motor-generator makes you an RV low voltage EMA-4 simil
(low cost)
a motor at hi speed (Small) can have same HP as one 10 times bigger and heavier running slow speed .
Raivo made some good experiments on Hi speed RV turbo...(Model 69) experiments..

THE RV POSTULATES ARE THAT OU "Overunity" PHENOMENA IS ONE OF TRANSFORMATION AND

SUPLEMENTS THERMODYNAMICS WITH A NEW VISION OF POWER MANAGEMENT AND
TRANSFORMATION THAT WILL LEAD TO INNOVATIVE METHODS OF POWER USAGE AND SOURCES,
BEING "AMBIENT ENERGY" ONE OF THE MAIN ONES. STOCHASTIC AMPLIFICATION AS VIVID SAMPLE OF
THEORY VERIFICATION. Overunity IS "transformation" not magic.
RotoVerter does not break the laws of thermodynamics, it JUST PROVES THERE IS MORE TO THE LAWS OF
THERMODYNAMICS THAN THE LIMITED STANDARD LAWS AND HOW THEY ARE APLIED .

I have stated any synchronous MOTOR GENERATOR can work as EMA 4 motor...

As seen from source .. P(watts)= I x V x PF = W

In 3 phases ((((I1+I2+I3/3)) X (V1+V2+V3/3))) X 1.732) X PF = W
POWER FACTOR AT 3 PH 120DEG ANGLES IS A RELATIVE VIRTUAL 1
Use 3 45mF caps in each phase ... (wired for 230 VAC )
remember the 3 phase formulas to get 3 phase total power ..
If you use single cap you could pump up to 10.5 kilowatts 700V 15 amps, but it simply overloads primemover, speed goes
down so does self induced generation to a point motor revs up again ..

Scope will show a semi resonant PF angle differential of current and voltage close to 90 deg on alternator. Radiant energy
on this CONDITION is not LOADED as to create it because if loaded the condition goes under unity, so power must be
VECTORED to load, load being part of an LRC circuit, here is where RADIANT energy separates from normal ac. Like in
Kone’s generators coils: You Short OUT coil to create virtual infinite capacitance in order to attain maximal current in coil
at 0 voltage (shorted ).
The true definition of ZPE ( ZERO VOLTAGE ) ZERO POINT. Be it Current node or VOLTAGE node in RF there is
always a ZERO point reference where the logarithmic amplification projects in a spiral from 3d to 4D horizontal from
vertical at 90degrees within a time space cone of 72 degrees scalar projection.. where amplification from ambient energy
occurs,,

If filament lightbulbs are used you can measure the calorimetric output of such in a DARK mass calorimeter (No bullshit
measure ) to see if you are hitting the predicted 1.618 161.8% gain figure compared to input ...
Is said the energy output of a heat element is the same regards the frequency or amplitude & resistance of it , a heat constant
can be figured out in BTU output equal to WATT hour input going to it ,then becomes evident like in DONS page
,Mathematics done becomes evident that you got certified OU ( Energy savings ) PO/PI = Eff

Like Kone’s 3HP motor "every motor has a sweet frequency it gives best weight to power performance”.
The Idea to develop a frequency inverter with programmable parameters was to optimize in this area...
Amplitude, frequency, pulse-length.

62
Thinking RF and resonance plus IMPEDANCE matching and application of roto-conversion principle you got all you need
to work OU and ZPE transform technology with off shelve hardware.

From Baldors (US) lab technicians notes : (A 7.5 HP RV converted motor was run for 4 weeks using a 1200W inverter from
an small 12.7 VDC car battery (open loop) no solar cell or any charging device connected, until battery hit 10VDC volts and
inverter low voltage alarm shut it off.)
I want to see a conventional half horsepower motor do that! Giving it a 50% handicap on RV full one HP load capacity.
The battery will kiss its own ass goodbye in a few hours on non RV motor being idling. 680W versus 12.5W

Steven: showing the benefit of the RV in a drill is not that easy, because the load is very variable and as far as I understand
it that will constantly requires you to adapt the caps as the load changes on the fly. Also it should have power/torque and,
that is not exactly in what the RV excels. Unless you mount an 8hp RV Baldor on a 1hp intended drill press frame.
"1 HP RV is made from say 5 or 7.5 HP 3PH motor
Max load is calculated and capacitor can be set in a mid adjustment range (broad banded) still RV will outperform any other
shit.
Baldor can also wind up universal 120,240,380,460 & up to 920VAC 3PH motors that can be RVed anywhere from 100-
120 200 240 VAC 47 -60cps with only using capacitors and centrifugal start switch
RV is a machine to find solutions.

220VAC wiring fed with 220VAC Line power 60CPS .03 to 23.Ohms
460VAC wiring fed with 120V power 51.Ohms to 600+ ohms.
Several motors are internally winded with parallel wires (e.g. uses 4 smaller wires iso 1 large wire). Series winding
increases impedance, say as wiring from 120VAC 24 line universal 3pH motor to 460VAC.
The 4 groups paralleled wirings divided in 2 gives 460VAC DELTA and 920VAC wiring in Wye (perfect for Asia, AU.
UK, Euro 220 power (50CPS)

> When you say the fields become counter-rotating... are you talking about the fields in the rotor itself?
Like a simile, you are pushed along a conveyor your feet are standing on the conveyor and make the conveyor move.
Conveyor represents the "rotor". YOU are the rotary field induction wave. You walk toward the rod pushing you (Rod
represents the stator rotating magnetic field ) the result is you walk against the conveyor summing your movement forward
contrary to the ROD one onto the conveyor (reversed).
You push as you are pushed 1--> <-----> 2 contrary to vector driving you as you drive a third (the conveyor) "rotor".
1 ]--This pushes you-->
2 <--You are here-->
<--pushing this-->3
1 rotating field movement
2 (Induction field "you") being push by #1 and pushing
3 rotary counter-induction rotor field (being push by #1 by adding up #2 to its movement to physical squirrel cage & iron
laminates as COUNTERELECTROMOTIVEFORCE reversed forward vector( #3 )
All is relative but easy to understand if you see the whole picture from each point of reference. Add you running faster
every time conveyor gains more speed you have Kone’s motor incremental acceleration phenomena explained. Virtual
conveyor foothold is not moving relative to your pushing but its physical entity accelerates away from you incrementally to
the square of the field speed.(gravity simile acceleration of falling object in vacuum applies) .

Mathematics are a key in this.....Let’s go to REVEL-ations 101.

63
Let’s take lowest figure... 591W/.5 = 1182W is this figure familiar?
Let’s take the other.... 716W/.5 = 1432W More familiar? (Tip-->RV alternator)
Let’s take 1182W x 1.732 = 2047.224W 3PH Radiant energy potential using RV alternator in FULL tripleflux 3PH resonant
LC configuration.
(does it make sense)? Does it give more answers? ...For those that have the toys in their homes and labs it will...
In RV frequency determines speed, frequency synchronous speed minus % slip = load speed
Speed also is critical to find OU potential in a GENERATOR
Speed & load = (critical) adjust...
REREAD old postings where I say : OU in generators is manifested at a given speed with an specific LOAD where it
is maximal in gain and performance where it requires lowest mechanical input to give highest electrical one ! ..
(Go back to tuning) get best speed, best load for best performance. Use different pulleys to get best speed for that particular
generator; don’t get fixed on one parameter One is RV the other is the generator

Search for add a phase and rotophase converters

http://www.woodweb. com/knowledge_ base/Electric_vs_gas_mill. Html
Even used in non RV form they save energy as seen in this article
http://www.metalweb news.com/ howto/ph- conv/ph-conv.html
Here is how to build standard Rotophase units...
ADD to RV knowledge database and you are done....
Difference is RV is OU standard Rotophases do not exhibit much of the attributes ... (In fact they blame the savings on
power factor issues)
Not on Rotary magnetic amplification factor issues...
I have done 40 phases capacitor vectored units, its like applying Amplitron principles to motors in reverse mode...
In alternators is Amplitron & magnetron alike in mechanically exited reverse induction mode.
In reality is simple stuff...

I have stated (like a zillion times), you can make any inverter OU if you hack the first stage into "flyback" mode and make it
squeal like a pig.....
Ash: With any frequency adjustable inverter, you will need mosfets that can handle at least 500 Volts, and a
reasonable current. If the mosfets are blowing from the BEMF from the motor.
THE RV PRIME MOVER ACTS LIKE A GENERATOR AND BLOWS YOUR INVERT!!
WHEN YOU ADJUST THE FREQ (slow!!!!!!!!!!!!!!!!!)
Use MOV "VARISTORS" arresters to kill the surge....
ON GUNNING refer to that classic post where Norman Wootan wrote about the FAN motor DESIGN problem they had at
their factory.
Magnetic relay & breakers burnt up & vaporized.
If you reverse or lower frequency as to cause a LEADING forward surge in motor relative to line this condition will create
an EMP pulse of several kilowatts (Megawatts in some bad instances) where anything solid state goes up in blue radioactive
smoke.
Yet for being EMP radiant in nature fine wire does not burn but any bouncing relay contact even 200 amps will turn to
plasma smoke in microseconds with the RF pulse.
Varistor arresters help .... use 75% over line voltage ones !

64
The prime-mover in fact is semi resonant having a 3 element antenna alike resonator within a closed space cavity
(stator)power fed from a power line and transformed internally into a relative virtual rotary field with Hi impedance
broadbanded low Q RF character that goes narrowbanded hi Q low impedance at loading relative to line with certain
specific internal phase shifting {phasor angle changes) witch result in true magnetic amplification ...
(Lets say simile of antenna multiplication factor applied to a motor)
That is why I called the RV AMPLITRON alike device (Primemover & alternator...)
Since alternator primes itself is like ELF wave RF MAGNETRON working at 60CPS RF energy ...
READ microwave theory and applications (Amplitron design & construction )
From NEWMAN, BEDINI & BEARDEN taking a LOOK at the UNIVERSAL EFFECT encountered in the machines the
issue can be compared to DC Edison Boys Club Versus Tesla AC MEN club ...
Speaking of Konemotor the Wire relation to CORE mass is an ISSUE .Returning to SWEET spots where energy thrives &
multiplies within transformations from other energy domains.
4wire bifilar PARRALLELED reconnected to 4 wire in series ....say if motor was wired for 460VAC it makes motor as if it
were wired to 1840VAC IF you Return to a COMPARISON NEWMAN MOTOR AS A SAMPLE WE have a PURE AC
NEWMAN (sic)* MOTOR WITH A VECTORED CAPACITOR CREATING a radiant energy effect where no spark gap is
needed to obtain gain from wire & core BODY, there is a correlation to an OLD post where I stated the HI impedance Wire
core relation was the ISSUE in creating OU and that all 3ph motors were MODIFICABLE TO exhibit THE PHENOMENA
IN PURE "ac" rotoconversion mode (1999,2002 JLN postings).
I wrote Newman and he did not even answered back, but wrote others telling them I was an asshole , (now it seems he will
have to look for a donkey and dive head on into a real one!)
*(no 3 1/4 TON WIRE COIL REQUIRED) NO dc BUT HOSEHOLD STANDARD AC OR MODIFIED SINEWAVE
FROM POWERFULL & CHEAP INVERTERS ..
ALL OFF THE SHELVE... Kone’s verification & RV IS THE THING THAT DESERVES TO BE IN Rense along with all
the replications and experiments here that show DOWN to earth needed yesterday alternate energy savings solutions
(practical do now applications).
Looping will become self evident ....As art is perfected...

In older postings I mentioned the alternator of RV was able to ring being the rotor of the device like a wet finger in a grass
cup , a slow stroke sets in a higher velocity stronger signal along the glass natural resonant frequency..
Electrically you can have a low frequency feed a higher one in intervals of shorter pulses , RV simply sometimes goes over-
revving as KONE RV did riding its own rotor reversed induction wave incrementally.
READ RADAR tube theory ( MAGNETRONS & amplitrons...)
RV alternator WORKS as A MAGNETRON or AMPLITRON tube
Where the ROTOR provides the ENERGY by mechanical means to maintain the electrical oscillation by means of self
sustained REVERSE induction (Repulsion) of the rotary wave components by mutual reversed induction on the rotor
squirrel cage .
Electrical signal is alike a surfer riding a wave or I may say A WAVE riding a WAVE ...

It’s a TENSOR created from the leading rotor into the rotary field of the 3 phases elements within the stator of the motor
coils.
As a violin chord being play, the cat gut strip is not the same frequency than the string but it imparts energy for it to make it
resonate at its tuned frequency and does so at specific speed & timing ..
The wet finger in water cup does the same , the cup has specific frequency (basic fundamental ) that does not vary with the
finger-stroking, is made stronger or lighter but remains stable in a single specific tune or musical note , finger it too fast or
too slow it stops oscillating, finger within a given range affects amplitude within the resonant frequency.

65
There are good cups and bad cups (same goes for motors used to test RV) some give better results than others, (try many
makes & sizes)
RV alternator does a simile but with electrical resonance, where we have other phenomena shown as the mass acoustic
relation to wave electrical one (single wire transmission) linear scalar transform & magnetic amplification related to antenna
multiplication factor & others as stochastic resonance & electro-thermal transformation..(OU)
Its PLAIN RADIO FREQUENCY engineering on steroids...
ONE transforms electric power to OVERUNITY MECHANICAL POWER THE other transforms MECHANICAL power
DIRECTLY to RADIANT Overunity energy.
The most ADVANCED technology is the simplest one where nature can be manifested in its simpler form ..

R: Hector told that the current through the coil has no voltage component, so drag is only half than normal.
R to H: Is it possible that the M field of the shorted coil becomes stronger than the induced M field?
H: YES It does as reflected induction multiplies field x 1.618 (or more)
R: And...does the approaching magnet lower the shorted coil inductance, allowing a much faster current raise within the coil
than "normal"?
H: It lowers the CEMF , coil tends to go superconductive LOW impedance (LOWER)
as VOLTAGE = 0 field "electric" tends to also go to 0 so its half the CEMF not FULL VA power .
as COIL is OPENED then impedance goes ballistic but in relativistic term of ampere volt relation ... , in a sense it remains
superconductive.. until discharged. ..
but RESISTANCE is relative to logarithmic Top amp reading at volts to minimal amp reading 0 and TOP volts in charged
capacitor .at 0 amps
R: Next thing is that coil M field can become stronger than magnet M field during shorting... 1.618 times the PM field and
more.

In 3PH motors the phases carry the angles necessary to vector it to rotation so RV mode in 3 phases is obtained by
governing amplitude (voltage ) input (frequency )to find optimal speed ,and PULSELENGHT that equals alike of capacitor
tuning of the windings to best performance states ... also capacitor can be used in tripleflux configuration to amplify energy
further into OU transform states.
On a final note you will notice generators as is are only 37% efficient ,if you get Harbor freight alike ,diode rotor exited you
will notice it takes like 1,800w in the stator exciter LC measured at AC capacitor amps & volts to generate 120/240VAC.
That is great waste. Try exiting using 220 main winding & caps as in RV alternator (radiant mode ).
Is a big difference to have this tools in the lab ...
RV is reverse dynamometer , but still you need to go low watts and experiment on things as above to grasp the real POWER
of the simple but technically demanding technology .

Basically rotoconversion is method to operate electrical motors as true low loss energy transformers ...(Electrical To
mechanical energy ). Where as in a NORMAL transformer the power loss is minimal when unloaded it can transfer power
efficiently on demand with minimal loss.
Claims ,90% energy savings (minimal idling) 99.9999% in some cases; and others plainly OU Overunity >100%. Standard
motors waste near plate energy rating all the time (Amps).
ON Alternator : Radiant OU energy production RF , ZPE energy ,(PURE RESONANCE)
The extraction methods, solid state (transverter ) Diode plugs and LC/C+C 2x2 2x4 4x4 H variants & 3 PH switched 3x3
networks applicable to inverter usage .
No NEED to rebuilt the electric motor , like in NEWMAN or BEDINI TOYS, HERE YOU TAKE an off the shelve
230/460VAC 3PH electrical motor and operate it in hi impedance (RUN on household 120VAC) wired to 460VAC ... using

66
same UNIVERSAL principle common to this DEVICES "Toys" and use it in REAL devices with STANDARD already
built FRAMES in SOLAR, aeolic, hydro, Motive applications ..
The Phases are vectored and TUNED using CAPACITORS to START and RUN the device in SEMY resonant modes ... Hi
impedance unloaded , low impedance loaded within a range of phasors currents and voltages ( 3 Phase dynamics )

Ronald: What is the phase shift that the capacitor creates in motor - is this 90 or 120 deg???
Can be from 90 to 150° depending on phases impedance at a given time, but VALANCED its 120°.
Relative to 3 phase poles fields are 120°;.relative to ROTOR poles its 90° effective pulsion repulsion modes as force vectors
are more effective at 90DEG ..
Power factor equals 1 when .. Current and input voltage are in PHASE one with the other a .50 power factor is 90 deg off
phase (current voltage relation ).

THE RV OU power as translated from HI voltage lets say 200 Volts 5 amps translates to 20 V 50 amps (1000W).
If your input translates from 120V .8 amp then at DC inverter side it translates to 12VDC at 10A (120W ) don’t tell me you
cant diode vector the 20V 50 amp using impedance matching to the battery side?, the only problem you may encounter is
the detuning due to the varactor tuning effect battery voltage introduces in the impedance matching circuit, nothing that
cannot be solved using RF tech approach (Phil can help on that) I think he looped the thing already.
Is up to him to come forward ( as others that had loop )but keep quiet .
RV LC can go PM low voltage hi amperage resonance Like in past postings statements turning things off to turn them on
,shorting coils to create pure resonant ampere nodes (Infinite capacitance ) (for idiots a plain short circuit does ) as circuit
opens it dumps its discharge as a JOULE potential in a capacitor (remains there until used )
(Don’t tell me that shit is not explained here in a hundred postings or more in a hundred ways " but same sense ")
Capacitance also is INCREASED as VOLTAGE is REDUCED ,coil turns reduced proportional to same conductor mass
(TESLA books state the same ) in impedance matchers & transformer building .
Rewire RV alternator to 24VAC ? resonate at super Q state ?
250A Litz wire ? MMM Does NORMAN WOOTAN still haves those 25V alternators ? mentioned in old postings ....
Sealed hydrogen filled RV have 10 times less friction ....(OLD post data ) & cool better as hydrogen takes heat out better
than air alone does..
You Guys have more data here posted than at any Tesla book ever written , its a pity you haven’t "compiled" the puzzle yet
.
(Like in old postings) it may require a MENTAL enema and a brain compilation first .
Sorry if I appear rude (ITS the "GOLD" rush effect )
"You ain’t got a dammest of an idea of what you have here"
Nor what you may have already have lost ....

I think I told you can USE 3PH ones with step-down 3ph transformers to get the hi impedance and use the tripleflux
capacitors or NO capacitors at all (pure reactive CEMP capture)...

A 10KC RV motor can be run directly from a natural 10KC frequency source.. as TESLA did with his machines...
AN RV designed for SHUMAN resonance can RUN on it .. 11.9CPS
AN RV can run on ANY natural frequency once taken to synchronism with it as if it were a power grid synchronization
making possible the use of scalar standing wave power nodes in nature.
AN RV can even RUN from the electron spin resonance at 1.6 megacycles..

67
My 3PH OU tests: I made a test with the RV, 3-phase driven with amplitude, freq & PWM control.
You can see that CEMF increases with frequency play with amplitude and pulse-length trying to find the best performances
at motor sweet points (where efficiency goes over the limits.....
when transformers are used voltage increases proportionally to frequency ,
that is why I recommend regulated DC (AM) stage and 3-3 6 IGBTs to drive 3 phase modified sinewave .....
I would need now a better variable amplitude control, and the hacked inverter was only capable of going between 140 and
180VDC. Any smart ideas how to improve this?
switches had to be specified in a graph lower voltage lower amperage rating due to pulse averaging filtering , so first stage
needs to be reactive choke forward Q switched
(requires a bit of designing) you are on very interesting new modes of power supply & ac drive design ,,, I advice to
copyright this on any official record or patent it and put it open sourced as this is the type of technology people kill for
....This is part of what I gave Mallove as a 3 phase cold fusion vortex electrolyser ...

Summary
When running at 3000 rpm, the coil produces more power (5 times more then 1500 rpm). Yet the 3HP motor is far less
efficient compare to 7.5HP. Why?
Because there is a Core Coil mass relation that is tied to squirrel cage rotor mechanics ... The Core Coil wire relations sweet
to ZPE and resonant state conditions (very variable in motor Makes and models but best range is 3HP to ten HP limit
Above and Under I recommend PM (permanent magnets) rotors ,then the M field saturation and frequency issues come to
play ( Tons of posted ) broadbanded theoretic tips ,Resonance, power Factor, Pulse management issues, frequency
controlled inverters tuning ...
That 3 HP motor can Perform as a TEN hp motor using a higher frequency and LOWER voltage (electronic turbine concept
) Stepping down using hi speed non contact magnetic gears transform Speed & frequency Eff% gain into Real useful low
speed hi HP power.
(Tuning Sources and Primemovers to specific optimal working parameters ..)

Next step after Optimal coil-magnet is determined is choosing BEST CAPACITOR to attain logarithmic GAIN as coil
Current node potential is transferred to capacitive charge so as Coil to go near 0 current pumping capacitor to max voltage
... That is MAX farad Max voltage potential into chosen capacitor to attain max stored JOULE POTENTIAL at a given
frequency ..
Things to look: Frequency , coil impedance , Q , Capacitor , Mfield intensity .
At rest, PM approaches shorted coil, potential is induced, coil attains maximal current and sees Short as infinite capacitance
where coil attain maximal current relative to its parameters and M field effect .. Coil becomes Current standing wave node
where voltage is 0 but current is maximal .... Iª .
At maximal field intensity Coil is open, From the Current standing wave node (electron density ) virtual Kinetic
accumulator (spring like) current transfers to VOLTAGE potential - + on opposed pair acceleration where T (time) V
(voltage) And I current transfer into a Voltage node (Capacitor ) is determined by Core & wire turn impedance relation to
such capacitor in HALF wave relation where a diode permits energy as voltage potential to transfer fully as a capacitor
charge (one way) half wave (see diode plug) .
OU results as part of a Coil core ambient temperature component is transferred to electric resonant ones (Electron spin &
thermal). Refer to Stochastic resonance as theoretical justification .. Basic genesis formula H=(IxI)rT as Other justification.

RV can be run directly from the air using air capacity plate (RF antenna) using 10nth Shuman harmonic of 72CPS all that is
required is 10 feet sphere capacitor and a heck of a tuning ability to run it totally wireless in Tesla wireless mode ...

68
rotoconverters may be old patent but the disclosure of what can be done with them is not , tap the 10KHZ white noise of the
atmosphere and you have free energy forever , for that you will need 100 pole motors to speed down from those frequencies
or very fast RV electric turbine engines ...

I think there is a bit of misunderstanding in resonance usage, for primemovers is a broadbanded resonance at hi impedance
that goes LOW impedance and higher Q at loading that is 600> ohms unloaded to 23< ohms loaded extremes..

RV is Pure sacred Geometry It is the BASE of the Triangle, the Lost Angular Rock in POWER transformation.
With that I tell Everything ...

Take a generator head (http://www.harborfreight.com/cpi/ctaf/displayitem.taf?Itemnumber=45416). This GENERATOR

uses REVERSE induction winding AS STATED in POSTINGS dating since the DISCLOSURE of BINGO MOTOR
(brown gas project in JLNlab group). Eliminating the Exiting capacitor from exciter winding ... AND Using a CAPACITOR
on its BASIC OUTPUT WINDING to achieve RESONANCE state produces RADIANT ENERGY in well beyond OU
region, applicable to SERIES tuned LCR electrolytic chamber, in CAR alternator using 23K to 24.5KCPS sonofusion can
be attained in electrolytic chambers ..
USING SAME LCR RV and transverter RESONANCE principle ..
In the WORK it was found ELECTRODES reacted with WATER and METAL was transmuted sample LEAD Pb 206
isotope to plutonium .. U239 ..
The solution I gave was the CAPACTRODE ,using CAPACITORS plates and dielectric material (as aluminium oxide)
containing water as centre dielectric where at ac resonance (multi octave to 2.450GHZ ) water frequency sonofusion was
attained in all the harmonic frequencies of RF spectrum gamma .
LC is initiated shorting electrodes, open and TUNE compensated under LOAD "R" as resonance IS ATTAINED)
Car alternators if PERFECTED can run EASY in RADIANT energy mode as to effectively drive hydrogen
sonophotofussion reactors.

A repetition but essential in EMA4 disclosure .. I advice to reread the patent ..

the 3 x 27 9 step 3 phase firing circuit sequential used ...
the secondary firing of spark gap and the stepped discharges produced from A an square pulse to B stepped staircase pulse
into capacitor banks ..
Think TESLA coil and cyclo-conversion into hi frequency that takes on from ..
HVAC 10KV 60CPS to a Capacitor discharge at TOP crest of RESONANT 10KV secondary into an stepped hi frequency
discharge into a hyper Q Tesla coil primary ...
This things point again to RESONANCE hyper Q states, logarithmic magnetic amplification factor in LCs ..
Easy transferable to RV low voltage hi impedance rotary pulsed machines (I refer to a PM RV design ) pulsedriven with
logarithmic power CEMF recovery in full phases diode bridge . 3x3 configured or (n X n) n being number of phases used ..
as in multiphase PM genemotor concept .
all that is required an standard 230/460 3 phase motor with a PM rotor designed as to be magnetized to near saturation point
but not exceeding core saturation as to have minimal on NO saturation drag effect.
you can have an EMA-RV run in AC ,tuned to perform in Tesla coil alike POWER amplifying mode .
Again secret is tuning into the resonant states and optimizing use of the power attained without killing the OU effect.

As a fact is you can wire 0ne phase motors to 460 VAC you can run like RV vectoring the START phase at proper angle
(45deg) , will be a bit less effective than a 90DEG 3ph force vector but i will be effective , all 1 PH motors can be run RV
mode ..

69
In single phase it requires 200mF 370 VAC caps (average to go into resonance ) at 12 Ohms impedance , in 50 Ohms is like
40MF but low Q ,variables are a lot, also need to revise connections & correct ...single phase demands more as is lower
impedance than 3PH ..
More: 120VAC motors can run RV with 28VAC just requires x4to x6 capacitance run oil, start litic (to lower price cost)
that means in 24 VOLT dc battery systems you can run a 120VAC motor DIRECTLY FROM THE BATTERY DRIVING
IT with IGBTs BIASED H network lowering cost of integrated inverter systems in same motor to be run directly from DC
as DC brushless RV motor (PHIL take note) "direct motor driver" ...

synchronous motors using EM or PM rotors attain 0 power usage in RV mode: input 28VAC into 120V one phase motor ..
amps at rotation ... 0 amps ....
intensify field or rotor and amperage reverses to line ...power factor correction becomes magnetic amplification factor .
same goes for 3PH generators made into motors.

RV needs to break the 24 LAW rule. Up to date 23 does not suffice to break the collective barrier to materialize it from 4rth
dimension coordinates to physical reality .
AB,BA,CA Ash look for that in Seike formulations , your eyes will open as you realize its 3 phases .....
Does Abracadabra tells you something in cabala ...?
The star of David is a moebious double delta superconductive tripleflux reactor core.
The oldest and most advance technology is based in symbols, lean to see Seike’s formulations in 4D construct they become
clear as water .
The throne is the CENTER of POWER the SERVANTS hi and LOW are the phases within a looped hyperwave system that
transfer energy states from one level to the other. The POEMS are the key to ZPE transform ,and is evident what he wrote is
too advanced to be of this timeline or this world .
Interpret where he mentions the appearance of RV ... ( the other place ) Fact is RV works ,and FACT is Seike work
correlates to RV directly ,for reason why he did not enter RV directly on its own there is no answer , maybe he was the
judge and he let me to be the executioner to finish off retrograde physics concepts with a physical working model, fact is
any true scientist may had tried his formulations using a 3 phase motor , but I think they got mind biased by the UFO toys
pictured in his first books and they rejected it being ignorant assholes ...

The self spinning of delta Wye Seike model responds to a gravitic spiral flow component (as coreolis electrical force) being
constructed a Rotary Engine made to accelerate over the Spin 4D vector G (gravity) enters NEGATIVE state as rotary
transform becomes reverse flow in time relative to gravitic one ...
More simple as you have RV "GATE" to enter the portal...

The RV effect can be PULSE tailored within REACTIVE component itself being the source the capacitive element defined
by varactor theory as a predetermined voltage (amplitude) and pulse length (time current raise vector) (.triggered pulse)

On Torque be careful, as there are many definitions for it from starting, to running torque, "variable" but on rotation can be
as hi as one HP full rated for 5HP motor. That is not low power especially at 94% eff., nor is at 24,000 RPM with 11 tons
rotating centrifugal force and 30HP power rating at hi frequency (3HP motor).

I wonder if the RV were close by the plants if it would have a beneficial effect on them? Is it similar to radionics and
eloptic energy?
If you tune RV to a frequency beneficial in radionics bio frequency it will enhance plant grow /// Each plant have specific
set of frequencies in acoustic-electrical range that affects it, basic harmonics and sub harmonics..

70
RV is good for hydrophonic farming "pumps" after you study resonant lightning in RV you can use KNOWLEDGE to do
same effect with transformers and pure resonance treat filaments as L "inductance" or Inductive resistance ....
You will find also that NICROME wire is useless with radiant energy stove HEAT elements or WATER heater & stove
oven ones do not work well with this mode of energy; radiation is blocked by shield sleeve .
How can one find the frequency for a specific plant or mammilian health benefit?
Music and its octaves ... as colours in light ..3 are basic 3 more are mix intermediates and merge as a single one White. So is
Music and energy ..

Raivo: Motors are inductive load. That is why in factory with many motors the power factor goes - lets say below 70%.
Power factor is corrected by using proper capacitors in parallel to motor input lines. Capacitance neutralises the inductance -
or capacitive impedance matches the inductive impedance and neutralizes it.
Resonance = inductive and capacitive impedance match. In factory case it corrects the power factor. Alternative to
capacitors is to use condensers or synchro motors (or to run synchro motor in RV mode).
Resonance in factories is still heavily avoided, since it creates peak voltages and resonance damage. So the power factor is
not to 100% corrected but near 95% maybe.
In RV mode there is proper "internal" impedance match and the power factor correction supplies kVARs
(kiloVoltAmperReactive) to the line - to the inductive loads, overunity.
In Bedini motors and pulse systems the coil is an inductive/reactive element that corrects the power factor in _batteries_
(capacitive element). In factories - the capacitor corrects the inductive load's power factor, but in Bedini system it is other
way around - the coil corrects the power factor of the battery (=capacitor), big magnet supplies the energy through the coil.
This secret info is encoded in e-books (PDF).
Resonance is inverse to power factor and relative to broadbanding and Q ... when PF is trashed we get resonance ..
In RV under no loading it tends to be self power correcting to line, but relative to phase relation in rotary mode tendency is
to be as amplitron amplifier where phase elements tend to be resonant relative to rotation ... the load becomes a reverse
inductor where rotor at no mechanical resistance represents a hi impedance relative to stator one. As loaded it becomes a
low impedance relative to stator one correspondly the current - voltage phase angles change.
It is necessary to understand this Phase relation and how it can be USED in reverse to attain power saving ...
Reread, many times I have posted idea in ZPE and OU is to TUNE to OU condition under the LOAD or attain OU in a
NON reflective detuning mode, OU is nothing else than Ambient energy being pumped into a working system as it interacts
with the ambient.
In PF the reciprocal is used as cophased EM energy multiplication factor where attractor M field is lower than attracted M
field in RV rotoconversion mode resulting in overunity. (already explained in past postings). A rotary condenser in RV
mode becomes OU machine (true EMA ) Electro Magnetic Amplifier ...
Need to get that 3D spiral into 4D one! Remember when I posted a battery is a big capacitor with a very long half sinewave
discharge curve … and that Bedini was power factor correcting his battery ...(I did it with a reason...) Key element ....
(Basic).

Currently prototypes of RV concepts are being tested in former USSR Nation by very capable technician-engineers ,we give
Emphasis in correlating phenomena common to all OU systems ,the LC relation and resonance is the key to all systems,
extracting this energy requires a total mastering of prior art (power transformation) and RF radio frequency knowledge,
little by little the in vitro experience is being acquired, we are currently engaged in other activities trying to obtain funding
to accelerate this developments and bring them to the people, currently we are sharing this knowledge, but even basing it in
STANDARD off the shelve items is difficult as OLD concepts interfere in the simple grasp of the truth making replication
within biased mind frames near to impossible , I had 2 university professors take a look at RV concepts ,they took
measurements made calculations check parameters of 3PH transform within 3PH motors on the rotating field power within
it ,they had to accept off the record they were dealing with an ALTERNATE phenomena in power use applications, also at
current DOCTORATE level, Academia FAILED to control the parameters I had manage to use with ease ....(In Vitro
Demo), open no magic box or hamster fart condensate to make it work...)

71
core values determine impedance value summed to PM field ... capacitor must be in a range where LC is resonant if you
have 2 poles at 1800 Rpm you are generating 30CPS you need 2 n 2s poles 4 magnets per disk to generate 60 CPS cone
machine operates at much higher frequency increasing power logarithmically over 60CPS being a dynamotor converter
amplifier in all true sense ....

Well see how many amps you got on your DC side (1. amp at 12.7VDC) theoretic on a 94 % efficient inverter /
just think of what a transformer 120VAC primary in series with the RUN capacitor and its say 18VAC secondary bridged to
the + across a diode to battery + and - to - ...
if needed use secondary parallel capacitor to trafo primary in order to obtain more resistive element within SERIES
LC such vectorizing changes rotation angle a bit off phase ...
Check a good book on series Parallel LC configuration (band pass filters )
Reversing a bit of math your 1 amp figure turns to 10 amps figure of witch 6.18 amps are useful for a looped system .
Watching your impedance and load relations using a multi tap (tuneable secondary to MATCH reversed charge current and
turn battery DRAW into positive charge feedback vectoring the system power factor as a true magnetic amplification one .
Davidkou: I'm assuming that the tuneable secondary of that run cap series > transformer can't be replaced with a variac
(autotransformer) because > magnetic isolation is required in the feedback vectoring.
So, to make a multi tap 18V secondary by hacking the secondary of a 120:18V toroid, about how many taps would be good
to try, and over what voltage (turn) range. Since impedance matching is determined by the square of the turns ration
(N1/N2)^2, might it be necessary to tap, say, every other secondary turn? Is the sensitivity of the matching that tight?
Most VARIACS have a lot of loss due to LOW impedance and cheap laminate (also HI loss ) in a sense they are built alike
the normal motors (to create Waste )
Looking for a hi efficiency transformer with ISDOLATED windings and the proper IMPEDANCE ratios is the goal ..
Taking a TRANSFORMER from an OLD TrippLite inverter and removing carefully the secondary where you can wind 27
turns of Teflon coated #10 wire and be able to wind more or less turns is easy way to do to VALANCE the impedance
magnetic amplification factor ,,
Think in VECTORS and PHASE ANGLES and you get easy answers ...
I always state that Concentrating on ENERGY savings is what LEADS to LOOPED systems ...

commenting about RV Looped Schematic : 16 ways to do it (now 18) and stepdown transformer can be in series with the
vectoring capacitor ( reread ) postings on Magnetic amplification (trafos) and my E-mails on looping.
Refer to Alternator tripleflux setup also and think in SERIES trafos diode bridged also to DC bus forward diode blocked.
If using PM GENERATOR at least 96% efficient looping is easy as kids toy using OU semi-resonant tensoring of DC
vector with proper impedance reactivity to alternator side (semi resonant OU RF mode)

“translated” by Wally:
RV power can be Extracted from the Vector Cap in Primemover
using SERIES transformer tuned to provide the Inverter DC input with a CURRENT vector from a diode bridge at its low
voltage secondary, and feeding this across a current band pass diode into the DC buss to lower inverter amperage demand ...

A transformer say 120VAC primary and 22-18 volt AC secondary is OK for starts where the effect of feedback can be
quantified ...
Capacitor Values must be changed for best performance (tuned) then a transformer can be configured as to be able to add or
take turns as to tune impedance correctly to achieve proper current vectoring to lower battery current to 0 amps or positive
reverse amperage back to the battery , once this is done a mega-capacitor 1Farad at 15VDC can be used to demonstrate the
true looped states

72
This is the most simple way to loop an RV (non loaded) to run perpetually on energy electrically acquired from the medium
..
Reread all Stuff on Resonance MRA , Iron Cores , VTA , MEG ,Ema 4 One of 18 ways to do it ....

look at the virtual phases creation and how POWER factor in case of RV becomes GAIN instead of LOSS as 3 phase rotary
field angles are created .
Things to look and search for, stochastic amplification, resonance, Theory of linear amplifiers RF class C (grounded grid)
6Kd6 finals applicable to magneto-atomic resonant amplification Look into MRA papers at REX research pages .
There is a LOT related in this fields Including Norman Ground Spike phenomena that needs DEEP R&D effort (and money)
to get Norman some programmable pulsing machines and RF measuring equipment modified as log periodic broadband
sensors (antenna) from 0 sine to x-ray wavelengths ... the unseen will become plainly visible (RF)=(RE) in one of its 9 basic
forms. (RF)

core values determine impedance value summed to PM field ... capacitor must be in a range where LC is resonant if you
have 2 poles at 1800 Rpm you are generating 30CPS you need 2 n 2s poles 4 magnets per disk to generate 60 CPS cone
machine operates at much higher frequency increasing power logarithmically over 60CPS being a dynamotor converter
amplifier in all true sense ....

Norm: I have not been able to design something that will allow a sustained resonant condition that would allow tapping
some of this awesome power.
RV alternator does that, just switch a big mF farad tripleflux assembly at full speed into that LC rotary Amplitron and
sparks fly; motor can jump 5 feet to the air and blowing switch elements sky hi .. Effects depend in frequency and speed ...
primemover in reverse gunning can also blow things sky hi .
Gunning is changing field rotation with out stopping the mechanical one resulting in a super lowering of impedance to
hyper Q states by means of reverse forced induction from rotor squirrel cage ..."Superlag " in phase angle to become "worst
power factor figure in the face of earth" ( circuit becomes superconductive ) that is why there is no winding damage its
hyper Q LC but as switch is not perfect the micromilimetric BOUNCE suffices to create gap where plasma is instantly
formed, as it is RF RADIANT ENERGY EASER sets in and you got a sun, its so strong it explodes 1,000 watt mercury
lamps like grenades (experience ) lamp acted like thyratron at a given point (Kaboom!) ..
In solid state by using transformers a series GANG can be set up as to increment power until you can resonate 75 KW with
the little 1 watt pulser posted in files section... the noise is unbearable and its a constant unshildeable EMP generator , but
basics for taming it are here ...
ED (Pcon) recreated the cycling I predicted in RV looped function he is still fighting with the downstep impedance match
of the transformers.
Still way down OU in terms of practical looping use but OU on RV inverter stage feedback (higher power ) on inverter
output than at inverter input relative to battery source ... but still under OU at battery stage due to impedance and phase
angle mismatches ...
amperage still 75% under par .. but 25% recovery is super nice start ! As is road to Overunity dynamics ...
The Idea is to transform the RF power to lower voltage and HI current as to vector it to battery compensating for
VARACTOR diode effect ( battery acts as varactor diode changing the LC resonant value ) Ed has acquired the in vitro
experience on this effect and the tune-detune effect changes in loading impedance parameters occurring in there ...
Key to test and play is RV alternator once that thing is taken to OU by group members there is no way it can be denied as
LOADING can be balanced in the theoretical solution R becoming integral to LC within scalar Hyperwave tensor ... can be
defined as a phase angle within the component as a whole ..
" A battery is a very large capacitor where we switch to a resistance or inductance creating an LCR where it half cycles in a
very long wave until it depletes in a given timeframe .. "
" Bedini power factor corrected part of his half cycle "
"Battery power factor correction ..." where C also becomes virtual L ( check RF theory ) C can become a solid conductor
and L as super hi Q state .. in a pulselength time frame ...
Keine (mkruemel) got 3 phase transformer to circulate , the need is to find the fundamentals frequency of its Natural
ferroresonance and Q it to the hilt with a primary LC let others phases rotate in the natural lower Q fundamentals as to
generate the acoustic harassing noise "ringing" where OU is .. "wavitons within the core "
Well until this is digested a bit I go on stand by

73
To answer previous post question even a kitchen iron sink can be resonated .. on transformers the quality of that resonance
is directly related to laminate quality and construction.
As specified an already ferroresonant transformer can be used to experiment as resonance is "shunted" from power line , I
experimented using hi impedance input and low impedance secondary resonance ( unit acts as power factor correction
capacitor big C to line at LOW Q ...

In Early RV disclosures in JLN I explained the interaction of harmonics within 3 phases to create leading forward
motion instead of having this harmonics acting as a system brake in 3 phase motors (RV mode) ...

My say is ....Concentrate on the energy saving issues. Get RV public... until shit hits the fan ....
Its the method proven already as 90% energy savings that can reduce 40%+ world petrol usage ..
60CPS 120V bench drill 1 HP : normal drill 890W continuous ... RV drill 37W continuous
normal drill (Loaded ) 1023W RV drill (Loaded ) 453W
As engineer what is your choice for a 1,000 drills 1,000 employee drill production line .
normal 890,000 watt hours RV 37,000 watt hours
Its 24 times the money expense to run in non RV mode and in full duty is still..50% less power usage in worst case (all drills
making a hole at same time with 1,000 female employees all PMS! (bitch mode) putting muscle to it
On the Overunity and free energy ....Its Proven radiant energy if RF and RV alternator in resonance produces this energy in
OVERUNITY states , cumulative tensor and magnetic amplification factors ...Overunity is transformation of energy ..and is
a by-product of power management ...
It’s the practical applications the world needs NOW being the first free energy the one you don’t waste and don’t have to
pay for. (Power on demand energy saving modes ) (true energy transformation) with minimal waste (or no waste at all)
RV is the first device given using off the shelve parts where RF ZPE principle is applied as to save energy ....

for motors ...

At least 2 phases are needed to create rotation .... you can have infinite number of phases after that ....
like the 111 phases motor-alternator used in time probes ..(interesting design )
Another way is having the one phase delay itself and produce a virtual rotation within a single LC element ... but that is a bit
off limits even to experienced RF engineers ...

On RV: If the iron got "Stagnant" for lack of use put some start caps as stop > reverse induction braking when you turn unit
power off use start cap as brake , that will jolt the iron atoms to RF radiant alter states again .... ( also will magnetize the
rotor iron laminates )
(post if it works ok with that motor )
check also bearings lube ....
Fact is heat affects permeability and latching capacity of the core atom matrix..
also impedance increases with resistance increase (due to Heat)
there is also a best frequency were RV performance is best for a given motor ..

Joe low watt: Hey If anybody is trying the RV driven 'Joe low watt cell', try different diodes to make your bridge with. I
just got rid of all those tiny bubbles that fill the tank with what looks like smoke. The scope shows a little tiny straight drop
off to the lowest point of the curve, witch looks more triangle like, then continues on to be smooth at the top I'll post a pic of
it. I realize that this "smoke" is gas but it takes a while to get out and that seems wasteful of time and power. Also the gas IS
CONDUCTIVE with this arrangement. If I turn the spoons upside-down it shorts out the RV Alt and I gotta reboot.

74
This may change under pressure or vacuum. But eliminating the smoke all together seems better. This conductive condition
also will allow me to use more cells with the same current cause I can place them closer together and increase gas
production and keep the same load on the alt just by changing the flow. It doesn't look as impressive but the water bubbles
the same at the top of the tank and the fuel is good and loud. I got a scopeshot of the signal that is riding on the 53 vdc bias
to the cell that is now a stack of measuring spoons that put out as much gas as the other hemi set does. Yes they are going
together soon. Like a Hemispherical Concentric Cell "HCC" for short.
What I'm working toward is a cell that puts out gas in a short format so it will fit where the gas tank was in most cars. I
believe this will be better for real world situations cause the tank can be baffled off and keep sloshing from changing the
tuning so much, thus saving current. I think stacking them in a matrix and hooking them in series parallel I can get a bunch
of gas with the RV cause it doesn’t take much voltage or current to do this and the RV is self adjusting as long as I stay in
the slip range of the alt and the sweet spot of the PM I'm cool. Thank god for the chokes or it wouldn't initiate with the RV.
Good thing soup ladels are cheap too. And talk about a short format I can almost make a torch out of this setup and it's less
than 1" tall and 1 1/2" dia.
I'm working on some modds for this as well. I think I can get gas production up a little more with increased flow but that
has its drawbacks too as it causes more "smoke". The bubbles need a little time to get bigger. I would also imagine that
tuning the hemis for optimum gas would help but that is gonna be a bitch cause I will have six hemispheres nested in this
thing. Slow going but I think I will have the turbodiesel running with this setup soon.
Hey guys If this works out we could sell em to people in different size packages that would fit in any car without looking
like Back to the Future. Less intimidating, consumer friendly, and bells tune just as easily as tubes do. And stamped
construction is way cheaper. like a hundred times cheaper than seamless tubing. A standard tube cell will run you $184
USD just for the tubing. with that much surface area I could make a huge amount of gas with this method cause it uses both
sides of more of the available amount of surface space. and shorty short short.
However a flowmeter will tell the tale here as to weather I get more gas. But it looks promising.
Yeah I'm way ahead of ya. I'm putting that spark gap in a glass tube in the tank so I can hit the water with all that UV and
'other effects' and maybe Laze the water a little in between the hemis. Stan the man used infrared leds in his conditioner to
keep the gas monotomic. And I know that UV plays a serious role in dissociation.
So this thing gets to light up too. Now its gonna look freaking cool. There's more.......
250nm UV and 23.0 to 24.50KCPS RF DC pulses from alt to water in 6 phases... 6 SS spheres
(You are getting there )

RV: If vertical spin it counterclockwise .... to get some juice from coreolis twist ..

2.2. PM-RV
RV effect is relative to Impedance and CORE size .. Optimal Reaction is in 7.5HP motors to 10 HP max ...
On Major power design ....
PM or EM rotor IS REQUIRED as to HAVE the TORQUE for higher power application ... such running mechanical
devices.
I can develop motors 1000, 10,000 to 1 million HP easy with just Standard motor frames configurations modifications ...

ceramic 8 non-core saturating PMs half moons I got for FUTURE lab work .....
they go into machined pipe mounted on aluminium rotor insert where shaft passes thru.. my future design is rhomboid half
moon to eliminate the gap harmonics ...
how to hold it in place ? simple a fine non magnetic metal sleeve over it...... can be spun to 10,000RPM cool ... ceramic 8 to
max gauss can never over saturate cores... you will need the rail system to assemble it ..
for 60Hz ac 3600 RPM 2 poles NS: gap is 36° total 1/10 of the circumference (or depending on your winding design
1800 4 poles .. NSNS smaller gap: 1/16 inch for sleeve 1/8 inch max rotor magnet stator separation ..

75
face must match stator face area 324 degrees / 2 pole faces.. Magnet face must be as wide as STATOR face and must not
OVER-LAP it over the EDGE ....(this keeps the field in the IRON lowering losses)
PIPE is hollow as to make field semi -oval and must be magnetic & 1/5 the thickness of the magnets minimal, the centre
insert aluminium or epoxy makes it super light and somewhat isolates shaft from parasitic magnetic influence that produces
drag induction in motor housing ...
Magnets Area: (162 degrees each ) permeability will be identical to a Baldor PM DC motor with 10 times the energy
potential being PM 3PH synchronous design
this motor must be run at synchronic speed and switch on to line ... on matching synchronous power phase or use
konehead style dc pulser reed switch or hall effect transistor drive.....rotor does the switching itself...
Just regulate speed or Baangg!

Extract from postings: (simplified)

IN PM the field of the attracted rotor poles exceeds the field of the rotary field, and then system goes OU as this apparent
power factor correction shifts to pure true "magnetic amplification”.
In LOW impedance this amplification is lost but not in HI impedance RV mode , here under specific EM or PM rotor
magnetic field intensity motor PUTS POWER back into grid as it works !.

power tends to be synchronous to magnetized rotor , in certain rotors at a certain condition rotor becomes counter-rotating
electrically to stator winding fields over-accelerating over the synchronous speed; this happens a lot in DC type winded
rotors shorted to become AC motor type squirrel cage substitute there are very old GE patent on this) also happens to
normal AC motors like IN Kone’s Lawnmower 3PH motor where squirrel cage field becomes counter-rotating electrically
to stator rotary field increasing speed incrementally and becoming self inductive.

RV is synchronous to line, loading determines slip.

On PM (permanent magnet ) or EM electromagnet there is no slip; only a Phasor or rotary angle determined by loading,
exceed that and equals EMP or short condition (critical angle of rotation) in a loaded system is 7deg (usually) on 3600 RPM
reference 365DEG .

In synchronous Rotation magnet attracting magnet increases Voltage as lesser field attractor charges with mayor field
attracted ( I was clear on this issue in past posting on ROTARY condensers and POWER factor correction using PM rotors
to attain over unity in hi impedance modes as Electro Magnetic Amplifier (EMA ) .
Any Motor generator can be modified to attain this modes as is off the shelve, properly designed PM rotors and stator
CORES can do marvels to already existing devices (modifications) to increase efficiency and performance ... The Voltage
used is determined by the LC needs to attain saturation & mechanical rotation within the EMA operation mode, GRAY
operated on PULSES RV demonstrates such a system can be operated in continuous low voltage hi impedance AC feed and
amplification mode, takes a bit to understand Rotary condenser theory and W-VAR relation, reread my postings on BEDINI
power FACTOR CORRECTING his Batteries its EVIDENT it contains MEG and OU SECRET as MEG is SOLID STATE
POWER FACTOR Rotary condenser ( But BEARDEN FAILS to see this SIMPLE FACT or to Explain it , all it takes is to
study POWER FACTOR correction and RV to built a self sustaining OU machine , as Simple as that , NORMAN GAVE A
CLUE as toward that POSIBILITY of balancing magnetic field synchronous in attraction mode to TUNED system as to
attain EMA mode being the MAGNET itself the source of amplification mode as a VIRTUAL Electret Permanently charged
CAPACITOR but this as in MAGNETIC field manifest ...
ADD this NOTES as this are the things needed to GO into the LAB model corroboration of postulates given ..
Again JINIS model is VITAL because depending on Q the M field required to SUBSTAIN the Oscillation in rotary system
under semi resonant EMA state needs to be QUANTIFIED to be incremental and not entropic in nature.

If you convert RV to PM you can pulse it with 6 reed switches or Opto-Transistors and 6 recovery diodes in 3PH bridge ...

76
3600 RPM requires 2 poles 1800 RPM 4 poles (Rotor) Converting BEDINI to 3PH RV Mode For RV Bedini mix you
require (sample ) 3 coils in stator per every 2 in rotor spaced at Equal angle intervals sample 120deg for 3 stator poles, for
6=60 deg for rotor 2 poles 180 deg 4 poles 90deg then you can configure your coils either in delta or WYE
Pulse to emulate 3PH timing at A,B,C intervals recover using simpler 3PH DIODE bridge 3X the power Out...

I forgot ... ROTOR PM N & S poles & can try to run in AC with > > vectoring capacitor ..
Why not RUN a BEDINi in AC ? Use 3 PH bridge for CEMP recovery ..
Your cores may heat up so watch for burn outs .. (use Transformer laminate if they do overheat )
This will prove RV and Bedini are working under the same phenomena ...

single phase RV 28VAC ... 120VAC to 28VAC trafo; work derated use basic same cap value ...
230VAC motors use 48-52VAC .
goes amp 0 as core saturates synchronical to line (interesting effect in some motors )
use generator (PM ) rotor or EM rotor draw power is ) 0
as it generates power factor correction to line across transformer
that will have an interesting effect ... it will make RV suppression more than impossible ....
single phase is not as effective as 3 Phase but it still works as "tuned wideband dipole "

If you go to EM or properly designed PM rotors were there is no magnetic slip loss , as long as you maintain the proper
impedance & power transformation ratios you can scale up indefinitely to any level you want ...
The IDEA is to design based in Kone’s USED RATIOS the same environment engineered to tame the same effect in a
higher power design .. (simple copy & paste )
(That’s the idea of the model demonstration) the parameters are defined by the effect within the model and are the key to
proper electrical formulations (book standard ones) "posted here a million times" ( In semi-resonant radiant states ) to be
repeated in the design of scaled up machinery.
Its a pity people don’t still grasp Kone’s REVELATION in its full form as final VALIDATION of OVERUNITY states
Within RV systems .
AS still the LOOPED Lawn-mower concept is not yet grasped in its simple form ...
Its simple transformation dynamics ( nothing more ).
Kone: I can think of a couple revelations - one is that if you switch an AC leg of a FWBR, with its AC legs over the
SWITCHING, and DC side of the FWBR into a load, and turn on this AC leg switch just after the motor/primary pulse. you
get increase in power on motor/primary side, less draw on motor/primary side too, plus the output into load does not
reflect/lug down the primary either. This is PERFECT for inverter-design for RV work too, besides DC pulse motor work.
(circuit in files section under "recovery circuits"...posted it a million times here already)
The other revelation, is that when turning magnets past coils with RV for generator/alternator work, connect FWBR AC
side across coil, DC into cap, then; first SHORT the coil, and then EXTRACT power into from the coil after the short (when
to short and extract within sine wave can be seen with scope).........this raises voltage in goddamm capacitor X20 !!!!
Not sure what "used ratios" below means......

2.3. Inverters
SOME SINEWAVE INVERTERS DO NOT WORK .......
USE Modified sinewave 1200W or more ... idle draw .6 a remove DRAIN resistor internal it goes down .2 replace with
1000Ohms ones ... Driver can also be modified for lower Power usage ..

77
Remember You can use the big inverter, the Equation can be PART of the POWER management Issues an can be USED
for DEMO as to the need of eliminating WASTE in energy products design and optimize ...... 24W may seen small but
24HRS a day becomes quite a waste if you have to PAY power bills or use FUEL to make them .... KEEP the BIG inverters
,,,,, TEST it UNDER LOAD if is MORE efficient than the SMALL one the overall LOSS in idling is compensated ( DAM
DETAILS ) that need to be addressed in R&D parameters .......
an 80% inverter using .3A idling will waste more energy than a 94% one with a 2A idling draw loaded at 1200W ( do the
math ) needs to be checked out .... UNDER load
my 2500 one uses .63 amps ....
REMOVE the maybe 10 or 20W draining resistors it has in the DC input that are for discharging the capacitor ( in old ones
crossing the output after a time caused short that burned fuses so they build in fast DRAIN resistors into the INPUT
capacitors banks ,,,
tell your in house tech to pheak it by replacing this 10 or 20W resistors with .3 Watt ones ...other way is to BIAS the input
by reverse splitting and Bias diode the low to hi converter ,,,,
just be sure to go slow and careful on those mods ... some inverters can also be pheaked to OU using the pulselength
adjustment ......
I don’t recommend inverters bellow 800W (nominal ) maybe for a 3 HP motor but not for 7.5 one ...

RV recommended power source is modified sinewave that is

30 + pulses in 1/120sec intervals being .80/120 sec long within and with 30 - pulses in 1/120sec intervals being .80/120 sec
long .
Fact all AC drives use 6 transistors to deliver 3 phases in rotation angles within same pattern as above ...
Control frequency and pulselength & amplitude and you get OU at specific set of ranges ( natural Amplification States
within operational parameters within rotary system .
I DO NOT RECOMEND COMPOUND SINEWAVE inverters because they are DESIGNED to KILL overunity ...
Most pure SINEWAVE inverters are DESIGNED to KILL overunity by damping & power factor correction .... Delaying
signal on reactive components connected to them ..
Use cheap modified sinewave inverters & frequency drives; Hack to control amplitude & pulselength ....
Dan: In a 60cps sinewave, there are 60 positive sinewave halves and 60 negative sinewave halves, each 1/120sec long. So I
guess Hector for modified sinewave, you mean 60 + pulses and 60 - pulses, alternatively switched. 0.80/120sec long
translates into 40% PW measured over a full 60cps cycle. PW is to be adjusted between 0 and max 50%.
Cut 60 cps to half cycles you get 30CPS at 1/2 the 60CPS ones but at 1/120 time frame ( relative to way you see it ) but
your clarification is valid.

The modified wave signal comes from H switching 4 transistors alternatively to a dual center connection from negative and
positive terminals 2 transistors turn on then turn off for a short period and the 2 others turn on reversing polarity like an
electric 2 pole double throw switch with common 2 pole inverted X connection to side poles and 2 center poles as the output
( polarity changer switch ...)
The transistors pairs alternatively turn off and on at intervals to create Modified sinewave AC ..
Pulselength , Frequency & amplitude semi resonant states applications.; Any inverter can be HACKED to produce RF
Radiant OU energy .....
Got problems with the Complex electronics ? Hack using 2222 transistors in multi vibrator mode feed transistors gate using
optos ....(optoisolators) .

Just imagine an inverter with modifications as .

78
Ring its input transformer cores to OU charging the second stage to OPTIMAL charge using that DC optimal charge as to
pulse-length control and frequency control its AC output, modifying all existent inverters to do the same using a wire on kit
and instructions to modify such existing inverters ...
A little Driver for optimal DC to DC converter Stage and an opto-isolated universal driver for H net modified sinewave
transistor bridges 47 to 450CPS AC and Pulse-length regulated from 0 to 90%
Just think of potential ... some 450A IGTBS and a few simple universal drivers to play with ... sure can handle some
kilojoules second down the OU road to perfection.. (On Energy savings) LOL!:P
All inverters can be made OU controlling its frequency and pulselength parameters some are OU from the BOX at
SPECIFIC REACTIVE load ...
make those ferrites squeal like pigs mating ! match that impedance and have fun at its 3 levels of adjustment ..Voltage
(amplitude) frequency and pulselength ...
inverter efficiency:
here is where theoretics and practice meet: Measure capacitor voltage at second stage (usualy145V for a Modified
Sinewave system ..
that is AVERAGED by the % of PULSELENGHT in given time period of Positive and negative signal in one single wave
(average) so READ with AN scope and forget the METER reading that is adjusted to MEASURE RMS in PURE
SINEWAVES but nor semi SQUAREWAVES produced by this type of inverters ( Second voltage stage must be 145VDC
as per standard use rule of thumb )
pulselength determines final sinewave potential in RMS - Joules 1/120 sec ! x (TPF time power factor) of signal that is
entropic BLANK spot Off interval subtracted from Turn on time (pulselength ) on time, Raivo got a lot of my notes on this
Timing issues ,that is why I suggest to determine power in Charge value in voltage Current and time in JOULES per
second
In case is How much WATTS a given half sinewave square pulse puts into a load, Joules second as no Bullshit debunker
pacifier ..

Get one of those Sharp inverter technology microwaves. As you operate the thing, notice the inverter circuit design how the
2 IGTB discharge into the primary coil (multi-filar) using 3 capacitive elements to get 800w at magnetron input...
3KV DC from diode plug ....understand why this circuit is OU ... and ask yourselves how it ended in a microwave ovens
...... codeword phrase : Hairy mice (mouse) hatching from eggs (my mistake).
Sharp inverter uses HV plug. Combine with DEC recovery resonator and you got it...
On SHARP Inverters remove CORE SHUNT and drain resistors; System becomes OU ... just reprogram CPU for proper
timing. 290W in 800W out, good for driving 10 F90 8 footers to full light on less than 100w
On Codegen PC power supply design is same as GM charger; just alter the design; change RC resonator values, remove
drain resistors, make it Noisy (resonant ringing) thing goes OU; reconfigure output for 12V 50 amperes, input 120V 2.5
amperes .
And watch for blue flames if you loop directly to DC AC inverter Use battery as Buffer-regulator (It will burn) but if it’s
looping you want that’s it.

Built EMP proof inverters from military surplus electronics

Especially the GATE protected JAN IGBTs and JAN555 ICs learn basics of EW and faraday cage protection and line
voltage suppressors...
Militarize yourselves and improve AVOVE it...

The ac inverter first stage can be magnetic amplified & vectored to battery input , add diode, transformer isolated stages
from phases & switching vectorized to battery input ,phase angled to LEAD in time and looping becomes academic ....

79
An RV attached to battery -inverter & trafo in series with vector cap step down to 19.8 volts DIODE bridged DC going to
feed amps paralleled to inverter with blocking diodes .... match impedance properly on feedback & OU looping is attained
...

I had no problem starting 7.5HP motor with 1200W Modified sinewave inverter (96% efficient) Also started with 800W one
using less start capacitors My 7.5 HP RV runs from 7.2 to 9.8 amps at start from 90MF to150mF 370VAC oil caps ....
starting from inverter is no problem at 60CPS ...seems 50CPS is more problematic due to EMP bounce-back on the leading
Square wave pulse at that frequency ( more power required to start due to shit power factor figures).
AS is inverter can be used , first HACKS are to regulate first stage frequency at load for best power output (using resistive
load)
second is to ADJUST pulse length on second stage to optimize with RV as a load ..(or reactive load ...)
Efficiency of 98% to 103% are easy obtained in that first hack pass .
Inverters with ADJUSTABLE pots using non CPU ICs are best, 556 run ones with programmable clock source are quite
good to hack ...
Its common you broke some eggs wile making omelet (you may see blue smoke a few times in poorly cheap built inverters ,
but be prepared as that is part of the game ...
Choose wisely, study the monster carefully, use scope & proper instrumentation then hack it!
But my Advice is ..
modified sinewave ?
1200W 96% efficient out of the box ? Use as is !

Modified sinewave pulselength can be from .50 1/120 of a second to .80 and that with a 145VDC buss can mean a 120%
efficiency gain at RV end.
seek for the pulselength regulating resistance ..
On inverters with series battery connection at HV side: The series battery connection is inherited from the transformer type
inverter (Early Triplite PC1000 series) but in modified sinewave ? (that’s a new for me ) It unbalances any OU production
by deforming the pulse chain one way +12Vdc other Way -12Vdc , only application I see if they intentionally offset the
square signal from a 3 phase chipset to get 90Deg at the edge from a single 120deg phase ? (preventing hardware hackers to
improve ? )
That can be fixed Eliminating the 12VDC buss & isolating the 145VDC buss (adjusted to 145VDC) with a pulselength of
75%
(that puts it at 96% efficient from a factory trash 80-85% )
POSITIVE Biasing and Ground switching can be USED at FIRST HF stage using transistors or IGBTs with FAST recovery
Blocking diodes that will serve as CEMF recovery Diodes every time a transistor Turns off the REVERSE + pulse goes to
battery as - coil SPIKE goes to battery negative across the transistor diode ...
I think More must be look into when I had Always stated MSW INVERTERS can be made OU.
(They are naturally OU) Playing with OU parameters already explained in the compilations, frequency, amplitude,
pulselength and HARDWARE component "tuning".

2.4. RV video
http://217.159.169.126/~creator/public/ZPE/videos/
RV-Test.mpeg
IN: 109.5V x 1.6A = 175.2W OUT: 208V x 7.7A = 1601.6W (COP 9.1)
RV-1kwBulb.mpeg

80
 IN: 116V x 4A = 464W OUT: 236V x 4.8A = 1132W (COP 2.4)
It becomes ADDED as non reflective to SOURCE but forced toward LOAD it becomes OU (RV video clearly demonstrates
that ) Power factor is not reflected across a motor shaft its ELECTRICAL ...in nature.
The 2 voltage reading one is more REVELANT .... as it complements the picture in ARK files.... 120200x.JPG
There the tripleflux alternator connections can be traced easy to the 230VAC 3 ABC motor wire terminals capacitor is 3
Phase 7.5KVRs power factor correction rated to 480 VOLTS ... this is the setup for tripleflux capacitor LCs creating the
RADIANT energy effects...
I will like to Mount this is a transparent table and work it with a 12V battery hooked to a solar cell and with circuits visible
...
The movie is one thing looking it work is another feeling its power, how 30+ pounds of steel can move at 3500RPM using
so little power is the real revelation, loading it is another revelation .. proves 100 years of wrong engineering practice in
power management and use. I hope someone notices before I die or get killed ... I like to give a bit more than a basic toy for
humanity to play with.
I want to give centrifugal redirectors, thermionic tranverters ,multiphasic generation, Vitrionic energy principles gravitic
shielding, PK amplifiers, teleportation, time travel and other basic good things to permit inter-stellar travel to other worlds
(beginning with fixing this one).
But i think that with the basics people will also need a bit of Social changes, the current system can never lead to a class III
society, It will end as Lemuria or Atlantis, non redundant Easy to destroy by any eventuality centralized feudal technocracy.

2.5. RV-alt
RV-alt: PF is 0 but inter-phase relation is 120DEG relation so in a sense is 1.5 leading power factor figure. the core
reference makes it parallel relative to phasor apparent series connections A,B.C phases (delta or wye), you need to
see it from a 4rth dimensional hypercube projection instead of a flat electrical drawings with a few specifications....
In the hypercube your states are relative to your placement within the physical dynamical variables (viewpoint) or
(reference) and you can see the tensors within given timeframe state of being .
When you see the whole, relatives become referenced to shifting points in time and space .
That is why ZPE has eluded scientists for a hundred years .IT NEEDS to be seen from right brain fluidic mind perspective
linear left brain mentality simply falls a bit short, farts blood & dies wanting.
Nothing if seen as RELATIVE to variables states..
IS that it depends from where you measure or where you reference from within theoretical frame (also in real model) .
Like sample in asynchronous generation current leads or lags ? It depends from frame of reference.

RV ALT GENERATES PURE SINEWAVE RADIANT ENERGY WAVES AT PURE RESONANT TUNING
AND that Whoever understands what I am saying can light bulks with a single wire resonating it from a given mass
(short piece of wire) as if it were RF energy. GENERATOR ,(SOURCE)-WIRE TO LIGHTBULB TO PIECE OF
WIRE WITH GIVEN MASS.. = LIGHT
to get radiant energy to work ...radiant energy as normal electric power have 2 components: VOLTAGE &
CURRENT that make as requirement impedance TUNING a necessity
If your generator and load are not matched in RF as if they were radio antenna dipole it will not work ... They must
be balanced ... is not as simple as taking a frequency source and driving it into a given mass having a load in the
middle. The source will get double the reflected power and burn out as its power factor will be "0" so it has to be
properly matched in resonance to drive the dipole forward to attain end to end resonant energy transmission within
an standing wave in single wire .
Radio amateur antenna design applied to single wire transmission. (simple RF applied to extremely low frequency
where wavelength haves a mass equivalent in a resonant circuit. ( Say as ELECTRO-ACUSTICS)

81
alike RV primemover and RV alternator but on solid state transverter application only you are using NO diodes but
a single wire transmission.
ends are virtual capacitors to common medium be earth or aether (air) or space vacuum capacity , or mass density
resonance (impedance alike) .
The radiant energy source needs to resonate in unison to the LOAD within a single wire and it must be done within a
MATCHED impedance values. SEE it as series resonance ending in parallel virtual ends one ...
This applies to receiving and tapping nature and natural radio waves. built ELF radio detectors and resonate Iron to
thunderbolt levels on those specific frequencies using the methods I descript .
Don’t be amazed if you get kilowatts out of some natural radio sources. rectify using Switching type diodes alike PC
power supply ones LV and TV HV flyback or HV SHARP microwave oven inverter type ones in non reflective plug
type extraction...
OK taping free energy secret is given (Its lab tested ) need only to be replicate it like RV... OK what are you going to do
with it? (applications)
If Others inventors did before me why not all of you ...? what it takes to tune a coil capacitors and a core to a free radio
source ? like 10KC natural sun frequency or Shuman resonance or gravitic tensor or super nova scalar waves? or
any of the natural energy waves crossing the medium non stop 24HRS a day ..?
Enjoy ! and built! copy and keep the postings and do not let this public disclosures be patented by greedy assholes or be
appropriated and SOLD distorted as copyright by dis-informers & scammers!
These disclosures will clarify from Tesla to Testatika puts OU as a book justifiable transform based phenomena ,the
government and petrol mafia bullshit stops with RV ,with the WORKING models the control of academic circles will stop
,that is the reason RV has to go fully public being already replicated and put to applications .
Possibly this will end as a class action against US department of energy and end in congressional hearings where heads will
roll by the dozen (Including some senators).
The Work of many will be UNDERSTOOD and mistakes corrected ..many will be vindicated while others will be torn to
pieces...fact is the disclosure will make other occult things to be disclosed too... what can be replicated (I advice to do).
I did not invent 3Phase motors ,,, I just found and discovered something and revealed it within its natural design. I adjusted
the theoretics to the motor reality not the motor to theory (except for the rewiring & mode of use).
(EMA-4 as sample ) AN UNPRACTICAL ATTEMPT AT REMAKING the electric motor...
That is the main reason RV is so easy to replicate. If others inventors take same path and disclose things as solar cells made
with sugar, so cheap that if you go hungry you just eat them as candy.

OU is manifested in RV alternator ....

ON AC a PM alternator USING PERMANENT MAGNET ROTORS to near saturation point in Iron laminate common off
shelve windings in an off shelve motor and using an off the shelve brain to analyze it ....
OU can be created as in the reverse induction RV alternator making the generator induce a voltage in RF mode into the
capacitor as a receptive load for the Voltage node part of the LC "dipole" signal.
Using diode PLUGS you separate the positive & negative halfs of the sinewave each half capacitor is tailored to charge in
resonant mode relative to magnet induction on coil to charge transfer to capacitor.
The circuits to extract this POWER are already given , the method is already given , PM a normal energy efficient motor
and stop wasting time in useless freaking low power toys ....
The 40 phases generator can be built from any Baldor PM DC motor the 1.8 HP motor in 40 phases can give 10KW using
the stator as Outrunner and fixing the rotor to a freaking plate where 40 positive diodes and 40 negative diodes are wired to
make plugs for each segment and such each can be self triggered by 80 SCRs in non reflective mode ..such setup at 10,000
RPM can give 100,000KW , pulsing can go into 20 x 166.666 cps 3,333.32 pulses per second x Joule second potential of
each capacitor ( there you can go megajoules second x 20 ) into a cascading array using non reflective energy transfer to R
load at a given V voltage with given I current value .

82
centre connection of the wye tripleflux caps can be connected to a 3phase A,B,C diode bridge connections and its DC
output then is paralleled + to + - To - across a "bandpass" diode connected to battery.
Its ouput is switch shorted in reverse as reverse induction starts then switched off as system is powered up to feed current to
battery or Joe Cell or Capactrode or whatever thing you want to Vectorize with DC rectified pulses from ELF radiant
energy waves (60CPS RF ) .

2.6. The resonant generator

Tto the Coil being subjected to inductance from the approaching MAGNET the capacitor must be a virtual short were as
COIL reaches max current peak Capacitors starts to load and reaches maximal load as the EXITING field reaches 0 ...
The higher the Q the shorter length in time it takes to (regause).
sinse PM rotors are hard to get USE 10=15KW generator head as Synchronous motor to built RV EMA-4 equivalent on a
shoe string budget.
the ROTOR is exited by brush from recovered current amplifier circuit .
the head is wired to 460VAC and run as synchronous motor on 120VAC ...
rotor must be taken to speed using RV pony motor as boost-synchronizer

2.7. 10KW Harbor-Freight genhead

230 VAC 1 phase use 100uF to see if it goes to 9-10 amps 226-236VAC Use
only RUN winding in ALTERNATOR 1 phase as LC .. In one phase I tested
one of these 5KW ....
This is 7.2KW:
http://www.harborfreight.com/cpi/ctaf/Displayitem.taf?itemnumber=45416
10,000 WATTS PEAK/7200 WATTS RATED BELT-DRIVEN
GENERATOR HEAD
used as LC alternator the 230 winding as self exited LC can produce 7.2KW x
1.618 = 11,649.6W radiant resonance with some 470W input ... in need to be
optimized as I went low (over budget) and is now in storage.
GOOD for boosting BINGOMOTOR generator output 1800W . but JLN did
not Even answered the darn Emails ...

On Harbor Freight alternator: Its to wire 100mF cap to main winding 220VAC
and remove exciter winding cap (leaving it unused..)
as motor, exciter winding can be used as Starting one using 370VAC caps from 40MF to 180MF ...(tune to best load voltage
option...)use 48VAC with 220 winding and if half 120VAC is use 24-28VAC .
usually this generators use 120VAC - 120VAC centre taped so half has to be used or centre tap rewired to separate series or
parallel 120VAC taps (independent )..
OLD 10KW gensets are EM (brushed this permits pure PF correction EMA 4 RV modes to be used in a SAFER but EV
Gray motor equal , or I may say superior energy configuration... synchronous RV motor generator ... (EM)
electromagnetically exited rotor .

A cap across 220VAC winding and exciter winding capacitor removed ..

depending on head & speed 370VAC oil caps decade from 40 t0 200mF to best OU region ...
if 10KW brush unit is used like stated before , you got EMA4 engine .... can be KONEHEAD style reed pulsed or Phil
mode IGBTs driven , it will be OU it will be LOOP-able WITH PROPER (RV MODE APLICATION).
Voltage, amplitude, frequency and pulselength = OU energy transform modes .

83
This GENERATOR uses REVERSE induction winding as stated in posting dating since the disclosure of the Bingo motor
((brown gas project in JLN yahoo groups)
Instructions- obtain this designed generator and modify
1)remove fans and all drag making junk
2)remove capacitor from exiting coil
3)excite main 220 coil using oil capacitors
4)measure power in against power in LC
there is your OU to work with.
5)Use A PM (permanent magnet) rotor with no over saturation of metal cores as in ANY existent HI eff motor,
logarithmically load power to C you and have extracted the OU efficiency. Eliminating the Exiting capacitor from exciter
winding and Using a CAPACITOR on its BASIC OUTPUT WINDING to achieve RESONANCE state produces
RADIANT ENERGY in well beyond an OU region.
Applicable to SERIES tuned LCR electrolytic chamber , in CAR alternator using 23K to 24.5KCPS sono- fusion (see RE-
OU-e-book) can be attained in electrolytic chambers by using the same LCR RV and transverter RESONANCE principle.
In this cheap Harbor Freight ALTERNATOR using the main winding as an LC oscillation with oil AC capacitors suffices to
create the radiant AC power at a 0 power factor. Further then it is required to take amperes to match a filament light bulb
where by the voltage drop becomes minimal and can be lit under water exactly as seen in EV Gray demo. The RV principles
are to Learn to transform adapt and use this energy , to learn to optimize power management .and definitively looping will
come by default.

If you can regulate amplitude (drive output voltage), frequency (0 to 10Khz) and pulse-length.... on a safe 0 to 90% you got
it made ....
you can do anything with an RV ,including run IN OU states in 16 different configurations oil caps or no oil caps (tripleflux
capacitor ) resonated ,series parallel , compound , cross-vectored delta, Wye or combined 12 line delta Wye tripleflux ...
(you will indeed have a lot of fun ...)
others options are using 0 t0 800VDC 10A variable power supply and Opto isolate drivers triggers to 3Phase extra IGBTs
brock (supplied to from the dc power source , (surplus electronics) some quite cheap because people are afraid of hi Voltage
dc equipment ..
That way you can burn 8KW (cold) with no effect on drive electronics or computer hardware hooked to it.
If rotor can stand to it "supersonic RV" like the Army generals called it, But they wanted it "stolen" ,not paid for.
Their loss = people gain ....
Its open source now...

A while back you mentioned that the Harbor Tools 10kw generator head was OU Ready....Do you have anymore info you
could share about what Mods need done to make this happen?
You remove the capacitor from the exciter winding take main 220 winding and place capacitors until you got a reverse
induction driven LC.....
When capacitance produces max power in ac amps and ac voltage in LC...
The decade cap box solution to tune in best capacitance is best shot...
Just remember this energy is 10 to 12 times the input in circulation and its usage must be under TUNED resonant
conditions and non reflective to LC system (Take look at Norms MRA papers)
RF AC differs a lot from standard ac, (Its radiant energy with ZPE component) Newman, Bedini, Bearden, Gray
stuff is the same thing, but it seems only a few had got inside pure AC RF dynamics applied to motor-generator
systems....
It will be radiant energy and it will be OU......
You just need to learn to use this mode of power...

84
Remember it’s RF and as RF it can LIGHT BULBS with a single wire!
Search Tesla, wireless power and single wire transmission...
Remember also to use RV to reduce drag (fan design) bearing and air friction loss issues....
Those HF gens are cheap and with brushed ones wired to 480VAC you can do power factor correction marvels (OU)....
As I know those generators come also in 3PH 120/240/480 volts AC from 10 to 100kw.... (Florida gen dealers) ring brush
ones are A! Ok for OU power factor correction and motive power.

2.8. Raivo quick RV overview

Raivo: Most sweet part - performance boost: you should run RV at 2x speed. I can bet you can see all figures much better as
efficiencies increase. You'll need some variable speed inverter or using 12V battery, some 2x IRF3205 FETs and 555 chip
to change freq between 20-300cps (not lower than 20cps or current draw will be too high on lower freqs), a 600+VA trafo
12VAC to 230VAC (115VAC for 60cps, 230VAC for 120cps, you can use 2x 120VAC in series, primaries in parallel).
Some diodes to collect back the RV-s inductive surge.
Alternatively - if you drive normally your RV with at ca 120VAC and it is wired to 460VAC (wye) at 60cps - you can drive
it at 120cps and quickly switching it into 230VAC (delta) with some switch! Actual mode at 230VAC delta at 60cps will be
460VAC delta at 120cps - and RV mode is met. You still drive it at 120VAC but from 120cps (12VDC + inverter).
(I have run my 2x 7HP RV's connected (1450RPM type) that took only 59W from DC car battery!) RV accepts rectangular
wave very well (the best I'd say).
Might be wise to inverter Run the thing tuning inverter to Load and start Vectoring each coil current to the battery and
compensate for "VARACTOR" drift, Charge vector is voltage differential of source and battery and Current reversing to
battery exceeding the one drawn from it (OU) .
Raivo: About making car battery deep cycle: According to Hector - add _about_ 2 ounce Cadium Bi Sulfate into the battery.
If someone tests it out or find more info about it let others know.
Yes I run a motor with 60V that was wired to 230V. RV mode is defined as 1/4 nominal voltage at rated frequency. If you
double frequency you must double voltage to retain its mode. Power doubles too, even efficiency may get better (not
tested).
Why 1/4? Because higher voltages lead to magnetic saturation and there is "no room" for the energy amplification. Now
about Muller genes - there is also a similarity that there is a certain magnetic saturation range that creates amplification in
generator. Amplification is similar to BEMF, that means if magnet "saturates" the core, the core must drop back to zero, this
range is something that creates an amplification.
The world is leading to oversaturated servo motors (CPU controlled) to hide the RV amplification. In this mode you cannot
have a "magnetic drop do zero effect" so no amplification can be achieved. The design of such motors/alternators have
magnetic shunting impossible to achieve OU.
Those were quick overview of Hector's past teachings.
RV Muller has (can have) an amplification in BOTH - in RV (a simple 3PH motor) and Muller generator ("lossless"
design). By theory many alternators can be OU (right speed and load match). One old Ford car alternator is an example
(info from Muller page)! Arkresearch trick: use DC excited alternator - change DC level to excite, use bulb as load (and you
may get excite power from the generator itself from diode bridge)!
What I see on how to create more COP:
* use PM RV (permanent magnet 3PH primemover) - first you win the slip and rotor energy losses, two - PM magnet
amplification effect, must be well designed
* increase the speed up to 2x, adjust voltage. Use simpler pulse inverter FREQ/VOLT or FREQ/PWM controlled to drive
the prime mover
* use a RIGHT resistor for a load - this is called also impedance matching. You must take an optimal power out.
* power output should be designed simple - a multiphase Y (STAR - very important) diode array AC to DC (low ripple).
You get pure DC output and get no measurement errors. No switching, simple.

85
* there is a big secret burried into switching!!! This info is from another source. If you switch a load you must switch it
from both pos and neg side exactly the same timing (same components). Ref: Bedini original circuit has double switching!,
also Bedini solid state battery charger (? think about it), Tesla switch, Tesla car had 12 valves to drive 3PH motor - why? I
think it was 2x6 valves (6 up and 6 down). You need 6 FETs to drive 3PH motor if you ref to original circuits. If you want
to switch both sides you need 12 FETs. More REFs: Bearden's switching (not to kill a dipole), EVGray (splitting the
positive!). You will require this knowledge if you design a circuit to drive 3PH PM RV using PWM switching.
Kone: Adding to your list, also Bill Muller said to switch DC into coils with two simultaneous switches connected a the
high and low of the motorcoils, (two switches: one on ground one on pos wiht coil between) and then bridge each switch
with its own full wave bridge (four diodes in a FWBR- is this the STAR configuration you talk about?) and the DC out of
the FWBR is your back emf/recoil recovery circuit that goes into a capacitor...he said no switching to the cap, just straight
into it (cap size important) then you output is the cap into load.
Also a secret fellow who has a self-runner told me that his switching on the generator-coil output of it is with two switches
at hi and lo, and he also said to adjust them so out-of phase a bit and the overlap is the only time the coils are on and try to
make a very narrow tall pulse shape looking at it with a scope and make this your output. This is like using two switches to
adjust pusle width - and only overlap of two switches would be ON...

2.9. Kone OU motor

Kone: I have a 1/3hp AC motor working as a lawnmower right now, but if you take off the blade and let it run off the
"perfect" UF size run cap (17uf in this case) the motor accelerates and accelerates way past its normal "idle" AC sine wave
rpm and as it accelerates, the draw in amps goes DOWN lower and lower.
This is incremental harmonics acceleration where the squirrel cage gets reversed field rotation as acts as auto transformer
magnetic amplifier accelerating incrementally as it reverses power into grid and is fed by the power factor correction itself .
An unusual condition that in looping leads to uncontrolled destructive acceleration, in hi Q Modes as motor passes a limit &
coil and capacitors go to hyper Q modes motor does not turn off at disconnect, resulting totally destroyed by over-
acceleration centrifugal force , 30,000 t0 560,000 RPM can be reach in a few seconds destroying unit .
I warned about this anomaly (Now confirmed in the lab by others)
...you have to pull the plug at the house power socket of the motor, or eventually it will explode...Phil got one to blow - he
tried to stop the accelerating by jamming in some more run caps, and boom. This is more evidence of OU operation in
"resonance" mode in RV... just needs to be controlled.
Looping has its dangers as system can feed off negative time flow creating time space anomaly (verified by china scientist
without proper safety measures some years back) "disaster struck"
Whether anyone else has or hasn’t repeated Norms W way-successful PMI servo motor as generator tests is not important -
those tests are real, and overunity too by good margin...and have been on the net for years and he just doesn’t want to
believe it.
Best thing to say to critics who insist OU is not possible, because it hasn’t been proven to them, is YOU prove it to me that
it is not possible and throw ball in their court. They can’t prove it, so everything they say comes back "three times the pain"
(Jimi Hendrix - machinegun - 1970)
That is why I say (don’t believe) do the lab do the math! & read Seike Book on Ultra relativity , what he THEORIZED I
had applied to motors in vitro years in advance , some of his formulas err a bit (on aether tensor aspects but the RF theory
complements what he missed and fixes what he got wrong ...Anyway he is a fu*ng Japanese Genius! deserves a Novel
prize!
(Tip) JINIS experiments complete what Seike missed! Solid state looping of self inductors is real, to that add MRA papers!
(You got it all already) it is public.... but apparently it will take more to notice than when the first airplane was made
(difference is I open sourced all of it) no patents.
Other issue is my brain was not open sourced so it will take a little effort on part of the researcher to understand the scope of
the given things ... (NO problem if they do the LAB experiments that are public) and bend the book rules to favour
OVERUNITY energy transformation as a real phenomena and work enhancing it not against its >RADIANT RF
NATURE<. <-- Last statement being VITAL to its use and applications.

86
Rotor as you may discover is above synchronous speed.
3D tensor projecting forward in time 1.618 to 4d tensor one looking at RV field from 4rth dimensional hypercube
X,Y,Z,D, "E" (Epsilon) referred As Time constant where M =(M (CxC))/(T/T) T=Time.
7.5HP Us motor has a specific C (capacitor) value where over-revving occurs going negative to line.
counting 0 seconds to ten: RV is started (1 second) capacitance is set in .5s speedup starts 3 seconds, 5,000RPM, 5 seconds
bearings start to smoke as it hits 20,000 RPM, RV glows Blue at its motor cap ends, instant blow melt in a 14,000K blue
molten aluminium flame at 10 seconds, if you haven’t run fast within the last 5 ones you can be dead ... as things will fly.
Look at this .http://www.defensereview.com/modules.php?%20name=News&file=article&sid=526
Kone be careful how your lawnmower hits the marbles in the grass. Top secret design (HA!) "we got its motor"
Frequency driven RV: Be careful the toy shows its teeth and claws as the mastery is acquired ... Remember I always had
warned about OVERSPEEDING RVs.... as more things are replicated more things will be revealed.
There is a local time constant to be considered.

2.10. Kone RV-Muller generator

Here are three links together that anyone can see on how to build themselves an RV-Mullergen:
Basic description:
http://www.geocities.com/koneheadx/RVMuller.html
Rotor and magnets:
http://www.geocities.com/koneheadx/32magnetrotor.html
Coils and cores:
http://www.geocities.com/koneheadx/coils32vs13.JPG

the coils have an impedance of .7ohms and are wound of 18ga copper magnetic wire that is motor-rated (double varnished).
the rotor of neomagnets spins very smooth and easy past all the ferrite cores and coils and a finger-spin will keep spinning
for about 10seconds - airgap is about 2mm between coils and magnets.
with the AC RV'd motor pulling in 40 to 60 watts while loading the coils with resistive load, Each coil can pump out 7watts
apiece with the volts and amps measured simultaneously to and across a resistive load and after being converted to DC via
diode bridge and into capacitor of specific size (2uf to 10uf)
The mounting bolt is non-ferrous stainless steel of 1/4 X 20 size and fits right inside the ferrite tube - it is epoxied into
it...also I super-glued the coil onto the core, as well as later epoxy coating over the finished coils...
The magnets are grade 35, nickel plated - they are not the strongest neo magnets you can get - those are grade 45. The
magnets are 33mm X 14mm (see post before this) The rotor spins for 13 seconds with a push-start with one finger (timed it
today) that’s pretty good no-latch spin... The magnetic-effect length to where you can just start to feel the magnetic pull
holding some iron nearby, I would say is about 30mm distance - about the same length as the cores...I haven’t measured this
exact though...
Tips to notice ....
Kone stated the need to TUNE vector RUN cap ( tune source to load )
core COIL and MAGNET EM must be IMPEDANCE matched .....
A magnet has a specific frequency where it matches specific Impedance influencing specific CORE mass or and
composition.
Every generator has a BEST speed best loading "character" where its usually OU (Overunity )
I have already told everyone (on this board only) how to put this "generator attachment" onto an RV motor, hopefully some
of you guys will do this too... the RV part of it is EASY, the generator part of it is EASY - just time consuming winding
coils...
Only arguments "against" the RV Mullergen is that it doesn’t make enough power - only 200W or so as is...but continuous
for 24hrs that would seem enough for charging battery stacks or whatever - just a demonstrator right now - who else has
something OU that someone can make easy in any workshop?

87
Generators on each shaft (dual-shaft motor) and 64magnets in the rotors instead of 32 should be up to 1KW range of power.
Really hard to believe that the Sundance puts out 1KW PER COIL...stuff like that makes it too far fetched for even me to
take serious...maybe V-A "relation ship" it could do this, but under resistive load, the > Sundance probably lugs.
The NORMAL DEVEALED magnet - coil count is 14 - 14 in 3 phase is 3 coils to 2 pole ration Except in 40 phases
overlapping there is 40-2 ratio , Sundance ratio 14-13 .
The MAGNET pole drag issues need to be accounted be it single pole n or s modulation or AC pole resonant logarithmic
Electro Magnetic Amplification .....( TRUE EMA ) .
Goin back to OU , is method not only machine ,Muller ,ECKLIN-Brown & others designs work well with RV , to be
sincere RV is only device tailored and designed to test this type of generators.
RV can be put in market Easy , just let me handle the R&D and engineering department of any mayor motor manufacturer
for a few days , a few mental enemas and a horse whip can do wonders in R&D departments ..
Put this figure 111 phases 15 volts per phase 8 amps per phase
that is 13,320W in a 4 inch x 2 inch space .....
at 50K rpm make it 90KW in that same space ......
I also did my homework in CORELESS design ... Broke some eggs making omelet (verry expensive and demanding stuff
....but takes years to get interest
( WE have a SOCIAL problem not a technical one)
I have 3 options ....
Response from people ( limited )
Acquire power ( will require War )
USE pure psycho-tronic technology development ( Open Stargate to FULL potential ) And may God have mercy on
whoever crosses my path with bad intent.
That is what LOCKOUT is about, Technology is there already the problem is this system will not permit it to be USED TO
FREE HUMANITY OF ITS ENSLAVEMENT , STILL WITH THE LEVEL OF EDUTATION UNDERTAKEN IN THE
LAST TEN YEARS .. a few Days under system and mental retentive goes to hell.
The collective mind needs reprogramming , but with the religious political and individual programming is becoming near
impossible to perform evolutionary changes.
Its impossible to pray to GOD wile consecrating Satan’s ass as the communion. ( don’t forget the ass wipes ) ....
Same with Free energy ...
You cant ASK for free energy in a system where its suppression is the only alternative for the system to survive .

Kone: 13 coils w/ferrite cores bolted to a plastic ring attached

to endplate of 5hp AC motor shown below.
The new rotor attached to shaft will have 32 N-S neo magnets
which should give 8Vdc and 500ma for each coil with
resistive load of around 10 ohms I predict (4watts of DC
power per coil) Another plate of 13 coils is going to be
mounted eventually on other side of rotor too (4W X 26coils =
104W...it will be 40W input the AC RV'd motor will require at
same time also I predict) -
You can use dual coils, also dual magnet disks with COILS in
centre "as Stator" that way magnet GAP energizes coil in
concentrated form
My 111 phases alternator is still on drawing board but uses
dual 6 Nb magnet array enclosed in circular bell housing them

88
this "calipers" the full field in the CORELESS flat coil windings in 111 phases that go to 222TA IC (motor generator design
... )
You may use that to your advantage also encasing the 2 coil
or one coil into looping the field across its length ...
check Tesla early gen patents and the old Ford T magneto
design ...
Photo of 12" diameter, 1" thick polyurethane (cutting board
plastic) rotor with 32 holes drilled every 11.25 degrees around
it through which 32 N-S neo magnets will press into - already
have the magnets in, but didn’t get a picture of that yet.
This rotor is going to spin past those 13 coils shown in photo
yesterday, the 32-mag rotor being attached directly to th 5hp
AC motor's shaft as in the previous 16-mag RV-Muller
experiment...another ring of 13 coils will eventually go on the
other side of the rotor too...
4 photos of RV-Mullergen project:
The 13 coils with epoxy face being coated onto them: http://www.geocities.com/koneheadx/13coilsRV.JPG

The rotor with 32 N-S neo magnets pressed into it: http://www.geocities.com/koneheadx/32mgrtr.JPG

89
One of the hubs of a rotor-side with tightening screw which fits into the key-channel slot in the shaft:
http://www.geocities.com/koneheadx/hub32mgrtr.JPG

The rotor on shaft of 5hp AC motor and 13 coils: http://www.geocities.com/koneheadx/RVMLLR32mg.JPG

rotor and coils on 5hp AC motor: http://www.geocities.com/koneheadx/132vs13.JPG

backside of 1" thick plastic ring of 13 coils pressed onto endplate of AC motor:
http://www.geocities.com/koneheadx/232vs13.JPG

90
Air-gap between coils and magnets:
http://www.geocities.com/koneheadx/32magap.JPG

Today I got the rotor of 32 N-S magnets onto the shaft of the AC motor and also got the airgap between the magnets and
stator coils with ferrite cores to be fairly small - around 2mm - and the rotor spins very smooth and easy so I fired it up and
tested a single coil under resistive load after being rectified into DC.
Results: AC from coil: 14.5Vac AC amps: 1.1A
DC output from coil (after running leads through FWBR): 14.5Vdc (same as AC)
DC amps: 1.1A (also same as AC)
POWER OUTPUT TEST:
DC volts ACROSS 10ohm resistor: 9.6Vdc
simultaneous DC amps TO 10ohm resistor: 690ma
9.6V X .690A = 6.62 WATTS
13 coils X 6.62Watts = 86.06 watts total
INPUT during test into 5hp AC RVmotor was .45A X 120Vac = 54Watts
The motor does not increase in draw when 3 of the 13 generator coils are shorted out completely, so assume then that all of
the 13 coils with a 10ohm resistor on each is not going to increase motor draw either...also this is only half the coils, another
13 need to be on the other side of rotor too for around 86 watts on that side...
So it looks like around 172Watts in DC while-under-resistive-load output possible from this 13 vs 32 generator design, with
I predict will require 60Watts in AC to the AC motor to operate.
ONE thin nice about the Muller generator is that there are no carbon brushes and its a super simple design where anyone
can build one if he can wind up lots of coils and buy enough neo magnets to put into plastic rotor.

91
Putting the rotor onto the shaft of the AC motor directly really saves a lot in input energy and is main thing for good
success this time...I see improving OU ratio even more going "both ways" - PM rotor in AC motor eventually (still cant get
one to work with 120Vac)and also, on the generator side, its a simple thing of just using more magnets in the rotor if you
want more performance - as just think of bigger 64mag rotor, instead of 32 mag one, and how that would go with same
input power and speed...
I couldn’t get that PMI DC servo motor Norm Wootan used as his generator to do anything but lug-down the prime-mover
every time I tried them out as generators - I could get 16W out of them at 3400rpm, and only 8W at 1800rpm so for them to
put out 58W like NW did means he did something I didn’t do (gear step up?...transformer out of AC motor on blank phase
into DC servo motor?)
I can improve on the outs I got last test too, with cap experiments to raise volts and air-gap tighter...Is there an advantage
of using a half-bridge vs a single diode filling a cap form a generator coil?
Is there and advantage of FWBR instead of half bridge or single diode ?What I am thinking is that a FWBR is superior,
since it will capture everything going both ways, and if id does cause lug catching in the backwards direction, it is negated
by Muller odd-even configuration in this case but just wondering what you would do to change gencoils AC output into DC
an put it into cap and resistor load......
That’s Another Weight Into the TRUE WAY to OBTAIN OU by transformation and MAGNETIC amplification , the
Alternator Saturation of the Core wire and consequential OU...
Remember NORMAN WOOTAN did this with off the shelve generator and that by FINDING where the GENERATORS
loose their POWER and OU is attenuated we can find WAYS to Increase OU producing effects
Important :
IF a COIL POWER is INDUCED in a COIL CORE to SATURATION POINT when the MAGNET influence recedes
makes the FIELD collapse ....
IF Induction is not Restricted by means of a DIODE we can SATURATE COIL with no LOAD RESISTANCE as COIL
field COLLAPSES this reverses across diode from coil into Capacitor & load resistor ...Having Multiple COILS charging
into CAPACITORS in Multi phase mode creates a CONSTANT DC tensor impossible to be DEBUNKED as it contains
NO power FACTOR component Being near pure DC.
Primemover receives NO REFLECTED POWER as LINEARITY is BROKEN by magnetic PUMP isolation (Magnetic
halfwave modulation )
Demostrated is ,there is an Universal set of practical RULES and NOW EQUIPMENT to demonstrate Overunity , OU is a
fact , now come Applications .... DENIS LEE SUNDANCE motor IS OU with RV .., EKLIN Brown Generator IS OU with
RV , NEWMAN MOTOR AS GENERATOR driven by an RV is OU ... Muller Motor Now as Demonstrated by Kone IS
OU ,
FACT is ANY HOME GENERATOR or MOTOR can be MODIFIED to GENERATE OU .... using this simple KISS
METHOD of biasing, witch can be Combined with coil "Regausing" Ones to enhance OU effects .
I am REALY HAPPY that AFTER NORMAN WOOTAN , KONE did the Same, as I will never FORGET how he was
treated Like SHIT in JLN group , nor I will forget how the guys at KEELYNET Ignored Norman results , professional
Envy? I don’t Know ....
CARMEN send me Email but I haven’t being able to get MAIL back , years ago I tried to make ALF try RV to drive
EMA4 and MODIFY Standard EM GENERATOR TO PERFORM in EMA MODES ... TO BUILT PM RVs but as You
Know we ended doing war. (Shit Happens)
Congratulations If you LOOP the "mother" make a lot of Copies and teach others to do it (DONT END LIKE MALLOVE )
his goddamed secretively in RV-TV Sonofusion application issues killed him .
The Pressure I got HERE is incredible they are Punishing me Hard for your success , but NUMBERS make FORCE , its a
right won in battle just don’t fall for the games money and deceit, whoever offers millions on conditions of secretivity send
him to hell, as I have done for 5 years since I looped the darn RV .. for the being keep the system OPEN shove this as
ENERGY SAVINGS & teach other How to Do it ... its the "Method" and not the "schematic" that matters, its the
KNOWLEDGE you attained to DO it, not the parts and the items in a list, (that Alone cannot make it ...) Just keep your ass
out of "Accidents" If you LOOP NEVER be alone if you demonstrate it public afterwards nor be isolated from group
protection.
Congratulations ! You were able to do it before the "Lockout" date. That Buys me more time ....

92
ASH, RV needs to Go PUBLIC forget the GODDAMED LOOPING demonstrate the ENERGY SAVINGS Hi impedance
modes of operation using the inverter & battery hooked to the solar cells.
I also need GRANT POWER to shove this UP UNI ass and in Public TV here where I live , My equipment is ready I need
the F450D Van to mount it in . my only problem is being low in $$$ fuel .....
OU will come as A BYPRODUCT of PROPER POWER MANAGEMENT and ENGINEERING , the ISSUE is to
demonstrate this son of bitches had being WASTING energy for 100 years, that POINT cant be DEBUNKED as it can be
simply demonstrated in RV primemover and its ALTERNATOR REVERSE induction generation modes .
The Game that OU comes from nothing ( We debunk it ) OU is transformation of energy.
ZPE is also transformation of energy .....
The WAY to OBTAIN FREE energy is TRANSFORMATION ....
And That can never be Debunked , those that try will go down in history as copulating (fucking ) idiots . Over 50,000
Patents and Its inventors can be revindicated in history in the last 100 years and the power cartel corruption exposed...

If you want to loop check the loop bypass circuits posted for the DC section of RV as long you keep battery at 12.7 volts
and on a charging vector without frying inverter you are OK your load is inverter and battery , need to calculate ampere
loading in your coils and bypass vector it to inverter at the same time reversing current to battery ... Remember Your
VOLTAGE will be a VIRTUAL Value and the Current will be REAL One ..
Voltage 12 to 12.7 in a very long wave Amperage to inverter is a constant , amperage to battery is a variable cycling long
wave also corresponding to OU tensor differential within oscillatory wave as ED obtained in his RV , bad thing we cant
obtain 12-24V 3 phase PM motor alternators but with SUPPORT this can be easy manufactured.
Konehead-Muller motor-generator works....
If RV reverse induction generated 1200W with less than 100W input using LAMINATES ... think What can be DONE with
a PROPER generator design ...
Remember Norman WOOTAN used off shelve PM motor to attain his OU readings as a generator, in Kone pictures this
design is similar to Muller design and a MAGNETO ignition design ....
The Importance is OU is demonstrated, rotoconversion theory definitely applies to MULLER design, we need a
compromise from people to raise money and built a research center where people like us can be supported and can create
the things society needs to survive , the Design and Manufacture cannot be left to those that preceded us with constant
failure nor we can be left HI and DRY giving our hard work free to have a corporate monster Patent and appropriate this ..
Hope Others also Take inspiration on Kone Work and Use their RVs to WORK on their LOW LENZ generators
The REVIVAL of ECKLIN-BROWN generator and magnetic distributor concepts may now be taken more seriously as
DEBUNKERS may have to eat their own words .
You cant Drive an OU generator With a MOTOR that wastes 110% of its energy doing nothing ... but you can drive it with
an RV ....
Other things will become evident with RV , it has a LOAD range where it reflects no loading to source in PM this RANGE
is quite EXTENDED ant there is where the HI impedance PF and EMA issues will hit the fan ... sshh don’t tell anyone RV
alone IS OU ... but as a MOTOR it cannot give OU driving a 37% efficient generator ... LOL! ON OU demonstration ..
It May Had being made Earlier if BEDINI , ALF , or NEWMAN may had used RV primemover to drive their designs ....
And As told before may wished Muller to see his generator working with RV.
Was Kone Destiny to do it ...
If generator is OU RV will drive it .... 1.618 gain will suffice to loop if designed properly ...
Magnetic interrupt and MODULATION combined in semi resonant states is what makes EMA possible and it is
TRANSFORMATION not magic ...
Kone needs all the protection we can give him now and this things need to go public .. ( if looping is going to made public
it needs to be further simplified in order for anyone to make it with off shelve materials and limited work (easy to built)
parts .

93
That was my intent on getting R&D funding and get the stuff as Energy saving out first to later bring out the blue smurf
motor generator units out ( universal motor generator .. ) with those Kone can built hundreds of looped units and teach
hundred people how it is done ..
RV is easy , generators need a bit more Sweat & grease ....
I repeat We the inventors as a GROUP need R&D lab & support no string or gag attached money where our collective
efforts can be driven toward true results.
Kone results were also due to a NO strings attached grant , that proves the $10,000 Inventors Grant Idea to make
WORKING MODELS truly WORKS and may Teach ALLAN STERLING that that was the right path ..
A.S. rejected it , was leaving inventors hi and dry wile corporate mafia redirected the technology for their use ( nothing
came out of it) exept engineered wikipediated mediocrity & theft deceit suppression for money ..
If OU is demonstrated with $10,000 and won Over NASA, Calteck ,NSA,DARPA and SDI billion Dollar Programs I think
is time this son of bitches start giving us the JOBS and support and fire all those arrogant diplomat idiot monkey brains on
their staff .....
IT feels SO GOOD to SAY THAT !!!

2.11. RV-Muller
Raivo: there is also a similarity that there is a certain magnetic saturation range that creates amplification in generator.
Amplification is similar to BEMF that means if magnet "saturates" the core, the core must drop back to zero, this range is
something that creates an amplification.
The world is leading to oversaturated servo motors (CPU controlled) to hide the RV amplification. In this mode you cannot
have a "magnetic drop do zero effect" so no amplification can be achieved. The design of such motors/alternators have
magnetic shunting impossible to achieve OU.
RV Muller has (can have) an amplification in BOTH - in RV (a simple 3PH motor) and Muller generator ("lossless"
design). By theory many alternators can be OU (right speed and load match). One old Ford car alternator is an example
(info from Muller page)! Ark research trick: use DC excited alternator - change DC level to excite, use bulb as load (and
you may get excite power from the generator itself from diode bridge)!
* There is a big secret buried into switching!!! This info is from another source. If you switch a load you must switch it
from both pos and neg side exactly the same timing (same components). Ref: Bedini original circuit has double switching!,
also Bedini solid state battery charger (? think about it), Tesla switch, Tesla car had 12 valves to drive 3PH motor - why? I
think it was 2x6 valves (6 up and 6 down). You need 6 FETs to drive 3PH motor if you ref to original circuits. If you want
to switch both sides you need 12 FETs. More REFs: Bearden's switching (not to kill a dipole), EVGray (splitting the
positive!). You will require this knowledge if you design a circuit to drive 3PH PM RV using PWM switching.
Kone: Adding to your list, also Bill Muller said to switch DC into coils with two simultaneous switches connected a the
high and low of the motor coils, (two switches: one on ground one on pos with coil between) and then bridge each switch
with its own full wave bridge (four diodes in a FWBR- is this the STAR configuration you talk about?) and the DC out of
the FWBR is your back emf/recoil recovery circuit that goes into a capacitor...he said no switching to the cap, just straight
into it (cap size important) then you output is the cap into load.
Also a secret fellow who has a self-runner told me that his switching on the generator-coil output of it is with two switches
at hi and lo, and he also said to adjust them so out-of phase a bit and the overlap is the only time the coils are on and try to
make a very narrow tall pulse shape looking at it with a scope and make this your output. This is like using two switches to
adjust pulse width - and only overlap of two switches would be ON...
http://www.geocities.com/koneheadx/RVMuller.html
Phil: When I saw they were using Ferrite cores, to give them a 2 years boost I mentioned to you about using steel washers.
This is the most perfect laminated core you can make, and for peanuts.
SOMALOY, this is produced by HOGANAS.
This is the latest material used in my electric wheel motor. With ferrite cores there are too many losses. If you want to make
a core very cheaply and are not too concerned about the weight issue, there are some designs I maybe able to help with.

94
Work out the required diameter of the core and the required centre hole. Go down to the local Hardware store and purchase
a box of mild steel washers of the exact size required and as thin as possible. Stack them together until the required length is
obtained and lock together with a bolt. Wrap this in paper Masking tape and wind away with your wire.
I have built over 100 Motors using this system and depending on the grade of steel washers used, normally they will operate
satisfactory up to 1000 hertz. This is one of the best core designs I have made and is the easiest core to wind on.
Kone: Bill Muller would say first to use the strongest magnets you can get, and have the same width of your magnets as the
space between them, the space measured magnet edge to magnet edge, so if you spaced your 1/2" wide magnets center-to-
center still at 1" spacing like I have done, you should make lots more power than mine with 11mm wide magnets if you
keep that odd-spacing of coils against the even number of N-S magnets with no latch-up points... a 12" wide rotor will be
big enough still with the 1" spacing...I bet you wont have any lug problems and air gap can be adjusted if you do..
Kone: My favourite all time coil (for motors) is to take for instance 8 motor-rated double varnished 22GA wires, twist them
all in a drill (not too tight) and then wind a coil with that - and also do the "pullback" after each row (this makes it more
"directional" - like a directional microphone compared to an "ambient" one).I have tried out lots of different coils - cone
shaped, Mylar/tin in between rows, bifilar, trifilar all the way up to "octofilar"...BUT, in GENERATOR coils... none of this
helps any - my advice is just wind tight winds back and forth use ferrite/blacksand/metglas cores, have core length the same
as magnetic field length, and coils as wide as the magnetic file width....I have discussed this with Bill Muller a few times
(optimum coil shape and style) and he says just wind back and forth, and use cores that the magnets slide by easily (low
hysteresis)and that’s it - it is simple especially when they produce 3 times OU.
Bill also showed me a fist-sized caduceus coil they wound, he said they could of/should of worked good for his big
generators, but they were no improvement at all over regular back and forth coils he said. Also I have tried out counter-
wound coils each row from advice from someone with good intentions, but this turned out to be a huge waste of time - but
when thinking about it, I thought it was something new and load-free, but turned out to be no good at all...
Stainless steel connectors and fittings and wire are just about the best conductors you can get. Once again this is something
taught to me by Bill Muller, who had a 30yr head start on building OU machines than me. I had a motor up there to show
him, and I used copper and brass connectors and screws to connect all the coils... he said get rid of all that and use stainless
steel for all connections - least back emf possible...I objected, and said that I always thought copper or brass would be the
best... he said no, they have too much back emf compared to stainless steel, and you can save some draw to the motor by
using all stainless steel connectors. (This is true)

Earl: MA standard generator does have Lenz's Law to contend with. When a Magnet approaches a coil with a resistive load
connected to it, a current in the coil is produced resulting in its own magnetic field opposing the approaching magnet
resulting in drag on the rotor.
Is there a way of loading that coil with some inductive load to delay the current and reduce Lenz's law drag? I call N-S poles
with a coil in-between Faraday induction. As long as you use this I don't believe there is anyway around paying Lenz in
full. This is why I have abandoned N-S systems and am concentrating on N-N or S-S systems. I call collecting N-N
splatter field a "non-Faraday" induction and am hoping that one will not have to pay very much to Lenz. If this is the case,
the machine will be OU.
If splatter field induction also falls under Lenz's law, then all my efforts will be in vain, but my stomach feeling tells me "go
for it".
For your info, N-N systems collect the splatter not between the magnetic poles, but 90 degrees off to the side, in an
orthogonal plane.
Kone: Actually a regular Muller gen setup, with N-S magnets too, makes lots of normally wasted "splatter" energy off the
ends of all the magnets at 90 degrees and also at 45 degrees that can be tapped with thin ferrite cores and winds "pointing"
in there, (Atle Olsen in Norway mounted ferrite splatter coils on his Muller mark2 version which is now secret)
These splatter coils can work alongside/in between all the regular coils in place on the plates. You can double or triple the
power out from a Muller gen doing this, and because of the angles of the cores in splatter-catching angled-arrays af coils
and cores, they don’t have a Lenz-lurch like regular coils do...I made a Muller gen like this (w 90 degree splatter coils
around rotor rim) way back when BillM was still around, and called him to tell and he said "oh yeah I know, try 45 degrees
too". Lenz is still there but minimal in splatter coils, amps output isn’t so good out there however as compared to regular
Muller-type coils...
Lenz can be beat with creative switching, also can be beat (hammer wise) with powerful and super efficient "prime mover"
(RV) Making an RV prototype that run at 6 times the efficiency as regular AC motor, and "on demand" power (36 watts at
idle, not 4000W continuous) is SO EASY.
If you had a 5hp AC motor and some caps, it would take you about an hour or two to clean the bearings and hook it up and
then use it to test stuff. About the same time it takes to post fruitless academic RV arguments.

95
The classic axial-design Muller generator has coils on each side of rotor magnets, and they are face-to-face with the rotor
magnets when they line up. As you know.
Additional coils can be mounted on Muller-generators, a whole ring of as many that fit all the way around, pointing in a 45
degrees; these ones could be mounted right above the existing ring of generator coils with brackets or some sort of 45
degree slanted plate or something that coils with cores could be mounted onto...the idea would be to have cores that
protrude a bit out from the coil, and the part that protrudes could be cut with a ceramic saw maybe so that they have a sharp
pointed end to them, so that they could fit in close to the magnets - then the magnets excite the core, and the winds make
current, and there is minimal Lenz out there, because of that angle the cores point inwards. So these would be 45 degree
splatter coils, also if when you make your Muller you mount the magnets at the very outermost part of the rotor rim (like a
bowman PMM motor's rotor) and then additional coils can be placed at a direct 90 degrees, from the ends (tips) of the rotor
magnets...so this would look insane - three rims of coils surrounding the spinning magnets. I have only tried 90 degree
splatter coils, Atle Olsen tried out 45 degree ones with ferrite cores and liked those a lot...only problem with the 90 degree
coils, the magnets might fly out of the rotor if you put them too close to the edge, but then a rotor rimmed with a thin rim of
stainless steel would fix this...the 45 degree ones would be best mounted with a rotor where the imbedded rotor magnets
stick out maybe a little less than 1/4" from the face of the rotor, since you want the splatter cores to be cantered on the very
tip of the magnet.
When you get a rotor with N-S magnets spinning, just try by hand, sticking hand-held coils and cores pointed at the magnets
at different angles, as well as the existing classic Muller coils and cores in the plates.

The issues with Muller design is to implement in standard frames, where obvious Muller failed but You have electrical
results this cant be interpreted by as told before, those EXPERTS in engineered entropy can NEVER transfer what You
GOT into Usable end universal product as they CANT neither TUNE loop an RV or get OU by pulsing an Iron Kitchen sink
into stochastic resonance mode.
ALF EMA 4s are still useless impractical pieces of Iron if not taken to STANDARD frame , I offered ALF a billion times to
take EMA4 to low voltage RV modes, he paid no heed ( you did first I am glad ).

2.12. Hector’s RV looping

BASIC RV TRUE HP output in Squirrel cage rotor configuration is 1 to 1.8 HP with efficiency range of 97% to 161.8%
(out of the box and properly applied ...
so GENERATORS of 96% EFFF and POWER INVERTERS of 96+ eff are RECOMENDED for experimentation ,,
Normal Standard generators are usually 37% eff P.O.S so you have to look into generator design optimization.
Reverse Induction Generators ARE OU but NORMAL Equipment is NOT designed For RF power operation , such
POWER must be transformed ..
PM RESONANT generators cant be used directly on STANDARD equipment ,the PLUG system is designed to CONVERT
the Inductive radiant energy to Joule potential as a charge (dc) Volts - farad .
Charge then can be Converter (modified sinewave ) to RUN standard devices ..

Gene ([email protected]): Here is a schematic that was posted for the Prime mover to help reduce the input power
drawn to spin the PM at idle with no load on the axle.
I took this and applied it to a 5hp lincoln 3phase motor I had along with the AN-8412 trafo. I put the trafo primaries in
parallel for 120V input and wired it up as shown in series with one side of the cap bank coming off wire 3, into one side of
the trafo, out of the trafo, into one side of the run cap, and the other side of the run cap was connected to wire 2. The
shorting switch over the trafo primary is NECESSARY to get the thing to spin up, otherwise it won't.... no matter how much
start uF you use. The output of this trafo are 4 x 12volt AC secondaries... I put these two in series for an dual output of
24vac. I then fed both 24v outputs to their own 35amp fwbr, one of which fed a 1amp 12volt lamp and the other went to an
auto battery.
Upon starting, Once the motor was up to rated speed I switched out the start caps as normally done. I was running about 25-
30uF run capacitance and used about 200uF in start capacitance. I then unshorted the switch over the trafo primary. This
allowed for the 12volt 1amp lamp to light to full brightness plus I measured an analogue dc current of 3-4amps out into the
auto battery which quickly climbed in voltage. This amperage is variable based on the run capacitance in the circuit... I was

96
able to get the output up to almost 10amps by adding more run caps but the input draw went up to about 2.5amps at 120vac.
The FWBR's get hot even at the low draw I noted above. Using HWBR's halved the current output (not to surprising I've
seen some interesting requirements on rectification with impulsed DC... can't use FWBR's on that, or at least I've not found
an effective way to do so.)
This does show that you can tap the power off the circulating tank... using a series wired in trafo... or perhaps multiple series
wired in trafos to extend the flux induced thru each additional trafo.
I tried last night running the motor with nothing on the 24volt output side of the trafo and opened sw2 on it. This actually
had a bad effect on the input draw... it went up to 3.2amps 120vac input... where as with the battery connected as load it
would only go up to 1.2-1.4amps.
I then put 28,000uF at 100vdc caps on one of the fwbr's output and opened the sw2 and the draw went only up to the 1.2-
1.4amps... So with a cap there to hold the current at the rated voltage from the secondaries it acts like its loaded even when
its not really loaded... > After this I then decided to rapidly flip the sw2 on/off many times in a row to sorta simulate
pulsing thru the trafo to the cap... This worked ok till the voltage went up to about 50 volts at which point the input suddenly
bogged down to the 3.2amps again... I had to take the trafo out of the circuit and discharge the caps to 0 and then put it back
in the circuit to get the draw back down to 1.2-1.4amps input. This was interesting... I sorta now want to reverse the way I
have the trafo hooked up and take the 70 volts and step it up to something much larger... and put that into a cap to see how
that works... Might be able to split the bipolar flows into two separate caps.

In radiant energy the trick is to follow a logarithmic gain within the CAPACITOR being CHARGED in a PLUG to its
highest JOULE component .
Finding the CORRECT value permits you to get BEST CHARGE ratio as a SAMPLE using A Konehead PM generator
were you tailor to GET best C value relative to THE COIL you use and Primemover RPM .

97
Reactive component Coil on INDUCTION from approaching rotary magnetic field Must MATCH the CAPACITOR
VALUE in a SEMY resonant condition as to BE on RE state (Radio Energy) were such energy being PASS to C creates the
highest accumulated voltage & charge Volt Farad ("joules").
In reverse induction such GENERATION must be kept as a TENSOR within a SET of parameters to be able to MANTAIN
reverse induction and RE production ...
Using PM gens solve the Reverse induction problem , the efficiency issues are the ones to tap, 94% eff minimal (as Is)for
OU op required.
remember CAPACITOR VALUE is a VARIABLE within the VARIABLES in ZPE systems ...
The Experiments are the tool to learn to control and understand this variables ..
Engineers went psychotic when I shorted the LOAD and the power went down in the primemover with Alternator power
going thru the roof ...
In RE (RF) this is common thing ) but on standard power engineering practice is termed impossible .
(Until resonance little tricks are understood )
RE=RF (Even if it Takes Tesla fanatics 300 years to understand )
9 types of electricity with the same universal modes of manifestation
3 basic, 3 intermixed 1 common to all (7) all regulated by same laws. as acoustic musical notes or colours of light .. (Its the
same ...)
Can I add additional 8412 trafos in series on wires 1 and 2 to extend those phases as well?
In primemover : series to primemover line a b .series to vectoring capacitor B,C
parallel to vectoring capacitor tripleflux 3x3 diode plugged capacitor in a,b,c phases .
In alternator (direct tripleflux) tensor diode bridging to battery source (as original plan ) very difficult to tune.
delta or wye tripleflux capacitors in 3 pair diode plug self triggered to 2x3 120VAC trafos with 18.8 VDC Diode bridged
secondary outputs that can be paralleled to single DC buss in series ..
There seems to be a maximum current throughput that can go thru the output from any phase, is this correct?
Impedance is related to voltage and current so proper MATCH to obtain required effects is the target ...( there is a range
relative to Iron mass and energy level you can obtain at specific frequency usage in specific hardware you use ... 7HP
motors 1 to 1.8 HP RV mode
In alternator mode 100W in from PM can bring up to 1750W in RE Alternator setup .. quality of hardware determines
quality of results (proper applications)
I & V phase angles go synchronic alternator RE production dies ..paralleled impedances must mismatch a capacitor 90
degrees angle in rotation in a live circuit then alternator RE does not dies...
KEEP the RE active .... kill it you kill OU effects..

Remember the average sampling rate sum divided by the sampling rate gives true RMS value of a half sinewave using
digital scope ...
(I noticed I had given many formulas and corrected some and are not appearing at compilations ..
please Verify these and add to the compilations ...
for this FORMULAS are fundamental BOOK justification OF RV theory ...
and EXPLANATION OF HOW REALY RE works and were OU is "manufactured' within a system .

Remember if the amperage being delivered by the battery is reduced to 0 the unit is officially looped
reverse only from .1 to .02 amps (ripple charging ) it will run forever ...(depending on battery you use the ripple charge
amperage must be calculated ( and is very small ) voltage drop & current it will swing up & down in a LONG hyperwave
cycle ...

98
Battery must be hydrometer tested and distilled water added from time to time as required to preveint dry out of battery
plates ...

2.13. 40-phase motor

Convert DC commutator motor.
Can be diode bridged in 40 phases delta (as is )
The PM stator made as a rotor and the rotor fixed as stator with same length wires going to the 80 diodes 40 + 40 - center
connected to 40 rotor commutator segments .

The PM generator stator to rotor conversion is out for quite a time Raivo has some pictures on my unfinished project (
Short on funds) & dogs biting my financial balls off ...
the PM generator is 10KW DC generator ( not a freaking Kid toy )
(get serious ) I am getting real tired of this return to play with toys thing ,it dilutes any real funding chance . A real motor
generator can be built using the fanuc or BALDOR PM brush motors having EACH segment diode bridged ..
Using the Stator magnets as ROTOR ( Raivo has my prototype units)

2.14. RV replication by Austin Adee

http://aadee92.googlepages.com/rotoverter

start with one LC undo the rest ...

OK in series to LC ( capacitor - & alternator winding ) you must put lightbulbs with SAME AMPERE Rating as your LC
rating . With that I mean the same amperage your capacitor and winding generate at resonance .
Sample :
Say A 1000W bulb at 100VDC uses 10 amps ....
your LC resonates at 10 A ...
Then the lightbulb with the 10 ampere rating will light up with the AMPERE flux of your LC .... yet its voltage drop will be
somewhat within 19.8 volts AC ( Radiant energy effects as in EV gray cold electricity ...
Loading at primemover :
you will notice that if you SHORT the LC at resonance loading is lower than having a higher resistance in series with LC ,
then loading goes up in apparent contradiction of ohms law ..

99
Alternator In 3PH LC mode
Use 3HP Diode bridge in 3X LC series and its DC output ++ -- to a hi amperage car battery ,,
Used with care will take you to a full understanding of OU and ZPE ..
In this last mode in can recharge any amperage battery with no generator burning or overloading as RESONANCE limits
the loss in battery as a Resistance in series with the alternator Rectifier series bridge LC...
Load is just a Phasor within a rotary condenser system used in reverse induction mode ..

On alternator tricks :
the Idea is to take LC to higher power in a semi resonant or purely resonant state were minimal primemover input is
required to maintain the resonant state in 12X energy level ..(resonance) were true power per ZPE theory is 1.618 in
logarithmic power increase due to magnetic amplification of signal ( Power factor as in RF (radio frequency theory becomes
alike antenna multiplication factor in amateur radio practice .
Radiant Energy is RF energy ( this ends with the Tesla Radiant energy mystery ) and all the Pseudo Science bullshit about
ZPE & free energy .
Free energy comes from the integration of ambient supplied energy into an operating system , be it aetheric , electric,
magnetic, vitron, thermal, same rule applies and is not in conflict with LAW of thermodynamics but adds a NEW chapter to
it in the ENDOTHERMIC and endo-energetics theory & applications.
RV is Proof of such statements ..
RV is started with whatever load you have shorted to LC ,once you start system to resonance you open short into R load ...
That means your load is in series with LC but its series circuit is shorted parallel to it with a wire .. open the short load is
direct series with resonant LC ...
A diode bridge can be in series with its AC input in LC and its DC output to DC load ... also cycloconverters or any other
circuit can be used in series to experiment with RADIANT energy power ..
RV alternator is a RADIANT RF Radio energy ELF wave 60CPS RF reverse induction generator. made with off shelve
components . works alike Tibetan glass bells but electrically .....
Wet finger stroking fine wine glass cup ( you will get the idea).

100
3. TV related

3.1. General
Interesting to note that a frequency drive driving RV goes negative on power draw , that is something .
For frequency drives . http://www.galco.com/scripts/cgiip.exe/WA/WCat/allpromo.htm?code=1
With the instructions given in the compilations and postings here any technician can reprogram the drives pulse-length and
frequency parameters and play GOD with ZPE !
The best part is all can be done with existing standard equipment .Its plain stupid to deny RV is real and constructible .And
cost less than any other system on power per watt performance .
Thing to look for charging is the reactor core solid state stuff .
Driving 3PH transformers ferro-resonant with 3PH Diode plugs using the same frequency programmable drives and
tuning to battery specifics internal resistance and turn it negative is the BUILT as IS is proof simple truth that ZPE
is real also in solid state transverter systems .
Problems matching voltages? baluns and transformers do wonders .
As per Ginis disclosure replicating transverter with a frequency drive gives a figure of COP 12.9 Power in power out figure
.
Load tends to DETUNE circuit but with pulse-length and frequency control tuning is attained , the more narrowbanded hi Q
A,B,C LCs are the higher the COP is (hi output) , broadbanding causes energy expenditure to go up and cop to go down , so
LOW internal resistance batteries are recommended for more energy density at higher Q .
Switching battery banks prevents other detuning problems .For TESTING the charge level USE hydrometer to measure
electrolyte density, instead of bullshit susceptible error laden metering.
Its incredible to point out that shorting LC output plug drops input power at lower resistance and opening the circuit in
series with BATTERY increased resistance INCREASES the power requirement! This relates to RF TUNING and true
radiant energy usage in solid state transverter plug, not traditional by the book power usage.

Ronald: You all know that I was pondering a lot related to right phasing cap if we try to resonate 3 phase trafo. Problem is
that we need 120° phase angle.
Yesterday I got an idea. It should be possible to create rotating field without a phasing cap. We just have to resonate all 3
coils for same frequency and simply pulse one transformer leg, triggered by another legs.
If we pulse one leg 120° from another leg again and again, the 2 unpulsed legs should feed into the corresponding
equilibrium...all 120° phase shifted.
Got the idea?
resonate LCs individually (one capacitor each ) VECTOR ,B,C phases with a Phasing capacitor feed AB with AC ,,, Idea
is to attain balanced 3 Phase resonance rotation ....
(just be careful ) in RF things tend to fly if near transformer as it hits pure resonance ...at > Q 15+ power is awesome

Can anyone tell me that for the transverter to become overunity, is it necessary to saturate the core into Ferro-resonance?
YESSS! HA! HURRRAAHHH ! you got it
OU is in resonance of the core !
One way to test is pulsing it with a short pulse & read the way it resonates. There you can find the natural ferro-
resonance of your trafo core
If you see Jinis page scope shots you see some spikes, those spikes are the natural resonance harmonics of the
transformer, the resonant slope indicates also its resonant point is on a sub harmonic as spike is very narrowbanded

101
(compressed in time so Pulse feeding in intermittent pulse-length matched to true fundamental increase its potential
ten fold ( Read Norman Wootan work on MRA ) hyper Q modes.
Resonance is the fundamental base of ZPE energy transformation. OU is transformation.
On an improper heat treated & aged transformer laminate plates at resonance, a phenomena occurs called Iron loss.
(core looses weight) & no one wants to touch the issue with a ten meter pole. Seike reported weight loss in his ferroxplana
cores ...
E = MC(C)÷ and I state M = MC(C)÷/¡îT to explain certain anomalic issues going on here.
proper resonance with nature open door to Unforced sea of energy . Working with nature is the issue ,not against it ...
ON IQ stop watching TV hear only classic music or soft music (relaxing ) forget also about listening to radio....
in a few weeks you IQ will increase dramatically as TV and radio are designed to make people dumb.
best thing I ever made was cutting cable TV off .... Its quite stupid to PAY to make yourself dummier .. Dish OR pay per
view ? (:P] duh?
Back to resonance , (we seek what power engineers want to avoid )as there is where ZPE resides . on the utility
transforming burning noise making ferroresonance ....
every transformer (as well as any motor) have specific states of self resonance where its performance goes above the normal
parameters .
Its just designing proper application of this discovery (sample as RV) and change the engineering waste dynamics to power
saving power management ones .
as Tesla stated Tuning the source to the load needs ...
I say Also tune the load to the source in a resonant unison (music)

Remember a diode plug is also voltage doubler and ac is vectored as DC half waves sines if unfiltered giving compound dc-
ac saw signal, upon certain loading conditions at specific capacitance values signal is not pure dc .

Trafos as anything having CORES & coils have an operation range ....
NORMAL off shelve trafos (Transformers) are from 20CPS to 450CPS range.
Some good metglass trafos can hit from 20Hz to 48KHz (Easy)
With a set of SWEET resonant points and a SUPER OU resonant basic fundamental related to the physical core component
and its ampere turn & mill ratio of wire mass.
The point they squeal like rabid pigs being killed with blunt axes !
there is where the OU is ... (Pure Radiant energy)

Remember I am stating that 3 Phase drives can hit a transformer in one of its basic fundamentals and create
overunity without the capacitors as well as go into Hyper Q modes resonant operation using them ... this opens door
for unlimited power management applications specially integrating amplitude control to ac drives .

EASY transverter.....
TAKE ANY ferro-resonant transformer USE as is ...
POWER up to resonance then start to lower power input until you find the cut-off point ,that is the minimal self
sustaining power it requires... (Study its RADIANT energy (RESONANCE).and OU condition...( Iron core laminate
ferro-resonance )
NEXT Experiment is taping the PERPETUAL "TURN ON" RADIANT HALF SINE-WAVES ... (Normal power
input)

102
GET EXTRA capacitor (identical to original one) and USE the diode plug plus the non reflective extraction system ...
Capacitor Joule potential X 2 x 1.618 x Q factor and x 1.732 if 3 PHASE trafo is used.
Radiant energy right off the shelve ,split - + and discharged non -reflective to "X" load (whatever)it be .

As in Solid state you need LC of proper type a mean to pulse it to saturation and a mean to recover the CEMF pulse into a
Capacitor in semi resonant mode where such capacitor charges logarithmically from a virtual maximal amperage shorted
coil as such coil "opens" up Turns on by turning off and discharges half wave into capacitor.
A properly tuned coil will thermally cool down and energy OUT will exceed energy in 1.618 theoretical logarithmic gain
over a Virtual dipole (radiant energy device) Amperage = 0 as voltage charge is maximal in JOULE potential within semi
resonant charged capacitor (max voltage) within a given farad value .

TV:.http://www.m-primus.com/www/de/data/tv/tv.html
see scope pictures ...If you notice Jinis signal compresses into a F= f/6.6666 area of the half sine .
harmonics up 13.3332 X must be tried .... (and see how the beast hums in time & space )
time compression & dilation must be understood in resonance aspects ,
its like playing music , the instrument must be properly tuned and played right with this I refer to tune and synchronize all
parts of the symphony orchestra (circuit elements).

Ronald: today I tried to pulse a metglas core into ou regions, capturing the back EMP of pulses.
I'm using the core amcc320, and just one primary (17 turns) and one secondary coil(85 turns). In the middle I use a NIB
magnet stack of 6 magnets á 2x1x0.4 cm, with a small air gap between magnets and core because I don't want to
oversaturate the core with the strong neos. Primary is driven by 12 v battery. Energy is decoupled with cap-diode-transistor
combination at secondary coil over a 40 W lightbulb. Energy decoupling and pulse timing is controlled via computer LPT
port.
I tried several pulse lengths, very short pulses up to the full core saturation. Steps where very small, nearly stepless due
controlling LPT pulse lengths via slow mouse move. I tried several cap values on secondary coil from 0.73 µF up to 9 µF,
resulting voltages in extraction caps were up to 400 V.
Input energy I did calculate via ammeter and voltmeter readings. Output energy via scope voltage readings over extraction
cap and cap size.
At no time I could reach an OU state.
Does someone has already experiences with this core and this kind of pulsing? Maybe an idea like higher input voltages or
different number of coil turns?
Maybe a transformer is better ....
You require very hi frequency LOW impedance hi Q on this one to ring it to OU (kitchen sink dynamics) metglass magic is
in kilohertz -megahertz range ..
Kone: 1) Try different diodes, use ones that are the very lowest voltage possible, in fact blow up a few diodes first, to see
what is the lowest voltage rating possible, then go to the next highest step. Lets say you have 400V spikes you see, that
means NOT to try 400V diodes, but maybe around 100V or 200v or even 50V ones....there is a huge difference in what you
can recover when you go to lower voltage diodes...
(Diodes used in PC power supply are super nice for low voltage RF recovery , they can be obtained for free in PC repair
shops from discarded PC power supplies they are hi frequency fast recovery .)
2) Make a FWBR out of four diodes, (try Shottky types too) and use the AC legs to extract from your pulsing circuit, this
instead of a single "steering" diode. A trick Hector taught also, is to put a single Shottky, (fast type) on either one of the AC
legs of the FWBR too, also facing any direction too, so this means a total of 5 diodes...that single diode extra diode on one
of the AC legs can improve voltage recovery quite a bit...maybe 10 or 20% in volts...I think it "orients" the voltage in
polarity before it hits the FWBR and helps efficiency...

103
3) I am not sure where you attach your steering diodes, but looking at it in "FWBR sense" put your AC legs across your
coil, AND put another FWBR across the SWITCH itself (whatever that is)....Now run these two FWBRS DC outputs in
parallel, or try series, and put into a common, or separate caps....(try everything; he FWBR over the switch, will probably
need to switched-out, as you want the switch to be ON just a bit during the primary-pulse, and right after it too, just a bit,
then turn it OFF....this catches the RECOIL of the coil, without lugging the primary down. Switch this FWBR with its
switch on one of the AC legs ,,,,The FWBR over the coil, however might not need to be switched like the FWBR over the
switch, but it might benefit too with a switch on one of its AC legs too....
One more thing, Bill Muller told be the way they do their recovery in their motors is they use two switches to switch on-off
their motor coils, and one switch is at the HI of the coil, the other at the LO...
Then, he puts a FWBR across one of the switches, another across the other....then the DC outs of both run into battery to
charge...pretty simple so try that too...he says this catches the backemf "both ways"...

TV
The transformer core will resonate to overunity transform in hyper Q modes ....
The multiple wave damping effects will be visible in scope as well as its OU basic hyper signal & harmonics .

Iron and ferroxplana (ferric strontium titanate ) AK ferrite ...

The Idea is to take the resonance to hyper Q , Hi Q states 15+> where the transformation magic occurs in the Iron-silicon
matrix and ferroxplana alike.
Once this state is acquired the energy to sustain it is minimal, where an energy VECTOR force can be created exceeding the
energy feed into the system ... ( Reread loop basics ) Reread VTA ( Quantal space modulation , class C basic 6Kd6 pentode
linear amplifiers theory apply to magnetic flux VTA triode modulation one ...

You must calculate the time decay of your circuit lets say exiting the core to saturation with a single ping (pulse to the core
and looking at the waveform in time to see how much it takes for the signal to die down ....
once this is done you find the minimal energy to sustain hyper-resonance lets say at Q 56 its 2.6 %
you can tensor as a potential ( negative resistor) 3% of witch 2.6 % is used for feedback ...
the .4 is OU free energy and is gained in the core region from stochastic& magnetic amplification of signal ..
First is getting it to self sustain ..
Second is extraction of useful energy ,,.
You have to address the way of broadband recovery of the myriad of cascading damping signals that occur within the single
narrowbanded signal ...(hypersignal)
lets say you have a peak at 128KC in a very sharp spike (narrowband ) but within that signal you have a very broadbanded
set of Hi power RF microwave signals at 1.6 GHZ from the electron spin regions of the Iron atoms within the core of
ferroxplana ,with a myriad of sub-harmonics at 1.3 to 4.5 MHz (Way OU )
Its Fact a resonant band pass filter and capture network is needed and it must be impedance matched as not to kill main
reactor resonance and not reflective to same effect ...
Reread x4 caps setups of past postings and harmonic signal capture ( post on trafos & ferroresonance will give light also )

remember an AC signal is composed of a sinewave

so One cycle on 60CPS as sample
Output energy = 1Cycle = 2x 30/60 of a second half waves split into 2 capacitors where:
total Energy = 2 x .5 (CV^2) Joules
P-out = 2 x .5 (CV^2).f Watts

104
than completes the OU equation by book law a bit better ...
PF increase as stated in resonance is 1.618 x Q factor
we are working with a dual capacitor system in AC split in 2 sections one negative one positive ( Were Bedini Failed I flew
) the plug splits a sinewave in .5 of an AC wave at were f= Time/2 so a 60CPS signal is split in 2/120 of a second separate
signals with a 30/60 of a second each intervals at 1/120 of a second length.
(for OU this are essentials ( basic ) for the correct theoretics on overunity transform .

The other factor is the average power figure of half sines from start at 0 peak at max power and decay to 0 .
(that is real RMS value) having that transferred to a JOULE second potential within a capacitor charge & discharge time
within a given frequency to give reap power figure (Overunity) undeniable irrefutable on standard book math ..

3.2. Ferroresonant transformer

Ferroresonant transformers come with a SHUNT (magnetic) to produce parallel reluctance flow within the core to act as
POWER factor correction (but to our perdition) "loss" impedance is not matched in its proper valance to line ...
Part of the power factor reflects to the SOURCE as reluctance magnetic pass in neither designed for ZPE use ....
They look for it as VOLTAGE stabilizer (regulator not OU machine..
BUT ! ( A big one! ) if we LOWER input voltage we can take the transformer to the NEAR frequency cutoff region of
resonance ...
NORMAL transformers can be taken to RESONANCE as ferro resonant ones but REQUIRES more intensive Impedance
MATCHING to power source being low loss VIRTUAL SERIES resonance to line...
No series reluctant shunt to bridge & partially isolate the magnetic path changing the Impedance match to line .
Its easier in 3 phase transformers using A & C Phases as Reluctance is FULL path shunted ( b center phase is unused as is
NULL relative to magnetic oscillations but can be used to measure power imbalance in a & c phases
(If nothing else is available )
BUT if FERRORESONANT trafos can be purchased ( go for One ), as they are natural OU machines ....
And I am the One pointing it out .... FR trafos are MEGS with no magnets .... (I am telling ) Its MEMA (Magnetless Electro
Magnetic Amplifier )
Lower to Lowest AC AMPLITUDE (voltage ) input, Measure the resonant LC power figures , Reread Ginis , learn its
meaning tie the strings to my disclosures .

3.3. 3PH transformer

we took 75KW trafo to 1MW power and maintained it with only 3 watts input ......Just be careful a gunning de-phasing can
EPM to death everything in a 10 mile radius !
That can happen in loading the sidecoils and using center coil as input ,upon de-phasing E field goes from circular rotation
to a linear projection turning the core into a giant EM pulsing magnet and projecting its field outwards ..... In extreme it can
collapse the transformer metal case inwards with any metal object near it being projectile attracted to it ..using low
impedance coils and hi capacitance increases Q at Ferroresonant selected frequency 47 to 450CPS range .... coil impedance
tuning range ..(advised) Feed A or C phase with care in center phase use and loading ....Forgot to mention something
...Seike Book Rotary field formulations are quite valuable to understand better MEGS, Memas, & VTA plus MRA stuff ..

Any 3 PH transformer can be converted to a magnet less Electro Magnetic Amplifier as is .... MEMA ...
That MAKES MEG obsolete ( apart that in went under OU at reactive or at any loading )
MEMA Power can be Extracted using the non reflective Diode capacitor plug system ...
There is a world there in solid state 3 phase power generation ..

105
Anyway you put it using book rules POWER factor becomes a Phase driver force in a 3 phase transformer driven with a one
phase source , like RV a CAPACITOR is used to create the virtual 3 phases ...
Result is undeniable overunity due to natural magnetic amplification factors (RF) within A,B,C phases creation .
Transformers require more delicate tuning since they lack the Rotating inertia of the iron mass inductive forces , but once
resonant states are achieved in rotary fields system is quite stable ...
Just be careful and avoid the PM - EMP conditions already mentioned .
All electrical stuff can be fried dead in miles radius !
Not to speak of Peacemaker toting people ...
So play safe and take care to shield things properly and using fast fuses & safety varistor arresters ...
You still have no idea of the energy contained in an Iron atom !

106
4. Extraction related

4.1. non-reflected to source

If this Power is not REFLECTED to its source and is POWER FACTOR in its worst down to being RF Radio frequency
ELF (Extremely low frequency ) You just require conversion to other energy state .
The condition that created this energy must be maintained .
The system is to induce a voltage in a coil that dumps its potential in a capacitor and the ROTATION speed of the magnet
induction must be such that the CAPACITOR represents a SHORT to the raising coil voltage at a semi resonant condition
as to charge such capacitor to a max potential .. see Konehead shorted coil experiments read my commentary on how OU
states are created RF radio frequency conditions = RE read all on Diode plug extraction and self switching system .
Check The neon light triggers schematics in files section .

Diode plug trigger circuit with neon: as plug capacitor charges, it reaches a peak voltage where it triggers the neon which
then triggers the SCR gate.
Care has to be taken as to such discharge being done in 1/120 of a second to avoid conflict with the charging cycle cap
reloading in LC (to keep it non reflective to source ).
Applicable to meg it solves the under OU states on loading ..(if meg is tailored to reload cap in logarithmic mag gain states
(retuned & redesigned for plug operation ) will operate OU ...)
The neon - trigger timing delay can be compensated by adjusting the circuit to fire just a bit before the sine peak so the scr
conducts exactly at top peak of the sine. On square wave a little mica cap & resistor will be needed to delay trigger a bit
as we have an instant peak we may not be able to prevent early trigger of signal . That is if anyone wants to use square
wave pulses from a modified sinewave inverter as trigger reference or direct self switched pulsing.
values are determined by frequency and power level wanted so has to be user wise selected .
As a mindbender think 6 flashers being fed from resonant solid state 3 PH transformer with each phase TV plugged on
OU states hyperQ iron thundervolt mode ...

On recovery 3 phase generation , non reflective plug recovery AC direct feedback into the DC tensor amperage of the
battery were feedback exceeds source output to system input ..
Revealing factors ( Time ) Phase and resonance & load feedback as tensors , were POWER factor is LEADING in time the
input one ...
Results are Overunity & feedback .....

4.2. Diode plug

Take 2 PARTY neon flashers ! (Radio Shack ) $16.99 each !
use the scr portion (put 2 1000A SCR in there )with similar trigger character than the one it had or tune resistor & cap
values to the big puck one ....
use diode plug and dual cap in whatever LC , RV .TV , MEG VTA (whatever)
with dual triggers to take FULL AC sine and dump it to trafo or whatever load to transfer charge to battery and that’s it ...
same as in LOOPED RV LAWNMOWER OUPUT AMPLIFIED CURRENT HAS TO LEAD IN TIME AND
AMPLITUDE THE INPUT ONE !
(looping is kids stuff) but looping leads to early death a la Eugene Malove style !
Cure , dump it public like I did .....after you people replicate ...!!!!

107
Is in Practice as one capacitor CHARGES in plug configuration the other one discharges and whatever charge remains is
added to next half sine recharge of the capacitors
The Capacitor Being Discharged into a load is totally non reflective as such a discharge rate does not exceed in wavelength
the blank interval of the plug cycle .
That is 1/120 of a second for 50CPS frequency ..
The IDEA here is than IN semi-resonant (RESONANT AC) we have a CONSTANT radiant energy GENERATION at
EACH HALF WAVE CYCLE and SUCH energy is STORED instantly into the CAPACITORS as A JOULE charge
component the DIODES split such CHARGES from the HALF sines of a full wave resonant AC signal (condition can be
Semi resonant also) .
The SPIKE at a Hyper Q circuit can be stored in a CAPACITOR being COMPRESSED & delayed in TIME and TOTALY
ISOLATED from Its source SAY being spitted from a self sustaining MEG,MRA,VTA or looped RV Plugged semi
resonant Muller or RV Muller Kone Remix Genset.
A main RESONANT LC capacitor and inductance can HAVE a lower value Diode plugged capacitor set to CAPTURE
only the NON OU killing spike portion of a self sustaining OU device . this energy can be extracted by self triggering in the
BLANK portion of the oscillation curve wile one capacitor starts to charge from main reactor sinewave the other triggers at
its peak charge in the blank interval .
Reread my 9 year old posting on this subject ..
Look at BAP page for the first TRANSVERTER disclosures using plug system & SCR discharge switching , look in files
section for party strobe light circuit bangers , my postings on using PARTY strobe lights as TRIGERING , (Poor man
Thyratron applications and first NEON light circuit being there ( obvious that SCR only can be used in lower voltage
triggering ) (I think I recommended 1000A pucks ! ) with sensitive neon trigger-able gates ...
On Jinis Page The Resonant Spike can be seen , if we Plug such Spike as the capacitance increases its amplitude decreases
and PULSELENGHT increases ( Read time delay circuit network design) Cycloconversion phaseangle control, power
factor control circuitry .
The Basics are there ...
For RCL applications remember also SCR designed frequency limits for hi frequency applications ..

The "Holey Grail" is in the Non Reflective Diode plug method open sourced public since 1999 .... (Its 1979 old but made to
hit the internet in 1999 open sourced disclosures )
Idea is to CAPTURE a SAFE portion of the OVERUNITY PF Virtual power RE Radiant Energy or RADIO SIGNAL being
created ... .382 of 1.618 as a sample of 10 x averaged energy .
The DIODE plug energy as transferred to a CAPACITOR becomes REAL joule potential ... ( no longer virtual and is
discharged being non reflective to source)
The Claimed RE spike seen at Circuit Start-up is what you seek ! If you look closely it will tensor back to line as a POWER
factor correcting condenser ...
The Idea is not to create balanced power with PF of 1 (unity) but to create -1 or +1 90Deg off phase leading or lagging
current & voltage phases .
Overunity is attained in the LC relation as POWER from phased states becomes unphased being able to pump energy from
AMBIENT tensor one . Be magnetic, magneto-atomic, aetheric, vitic , Thermal , same rules apply ...RF radio engineering
and power engineering ...
The capacitor Once charged only carries a CONDITION or STATE created by a CONDITIONING that differs from the
end product .
The end product is Volts - farad joule where the condition creating it is (Input energy + Ambient tensor Energy)= E stored
Charge in capacitor , add to it the tendency of the capacitor electret material to remain charged , that adds free energy to the
equation as Molecular attraction of opposed charges within electron tunnelling states keep the energy Stuck to the electret .
That Means A charge can be permanently Burned into a material to create a permanently charged capacitor ( I taught this in
the past and a forum Leech that tried to patent it got killed in an airport parking lot (Hutchinson battery worked in this
principle ) but he never disclosed it .

108
Long ago I described in this FORUM how to create a permanent capacitor by HEATING dental wax to melting point and
charging it within 2 14kVDC charged plates until cool and solid ..
like a MAGNET such wax retains the charge permanently as STATIC force where electron tunnelling polarizes a hole zone
and filled zone alike quantal diode (in fact Quantal diode )
This is OLD stuff I already POSTED years ago .. Check also my disclosures on Metherninka TestatiKa .

If you fail in getting this achieved; try this first:

Saturate a coil forward (single pulse)
AT switch off then let it fill a capacitor
find best combination until your JOULE value exceeds the initial pulse one ....
Circuit banger in files section can do that cheap ,or party strobe hacked as circuit banging poor man thyratron let strove
tube Switch the negative let a reverse diode recover the CEMP as coil = bounces toward ground (ground spike) ,,

Charge the coil under no load into resonant node , as blank interval occurs discharge current charged COIL NODE "L" into
C capacitor node to get V voltage at n farads to get JOULE- second potential at capacitor , with multiple coils this becomes
a constant joule output as time overlaps the "blank spots" , there is no reflection as coil reverses polarity as it discharges into
a load .
coil is charged by approaching magnet to saturation , field collapses as magnet passes over beyond pole reversing voltage
and being triggered into a load by diac dual diode dual SCR and dual coil pair calliper exited by single passing magnet ..
within a calliper setup.
there will be no power reflection... as coils will work as rectified receiver antennas relative to magnet passage .
only resistance will be hysteresis and eddy current parasitics .
to valance the reversal 2 diodes at each coil end are used ,CEMF becomes balanced voltage linear vectors within - Diode L
+ diode C .
Looping this is simple , JUST MATCH IMPEDANCE properly ..and beware of the time space events ....

I recommend using the sinewave itself (ITS PEAK) to trigger joule potential out of the caps ...
That is after solving the shorting and current to voltage release Open "node" coil issues..
that can be rotor timed as magnetic field is fixed to magnets and its rotation...
short , load coil to max current , open and release voltage potential to capacitor , discharge capacitor non reflective to load
in the blank interval ...
Its so dam simple all of you may already have RV-Kone-Muller generators running in your labs now ,since this was put out
in the net more than 7 years ago ....
The more poles you have the more pure DC you can collect using multiple phase diode bridge , each coil independently
dumping its load to a collective circuit ,capacitor, battery, resistor "whatever".
remember capacitor will dump its nominal excess charge over the battery then it will switch off to near battery voltage value
remanant .
Sample using SCR you discharge 24volt capacitor into 12.7 battery
SCR will cut off at .3vdc from a relative 0 value , that is 13VDC relative to battery 12.7 VDC so you will have a remanant
capacitor energy stored in it , same applies to a negative resistor or impedance value in parallel discharging of capacitors ,
remanant capacitor voltage will be relative to its VOLTAGE DROP VALUE of the LOAD .
the real energy then is the differential and its current (check the LOOPED RV readings in dons page )
DC and AC same rules apply , take values as vectors within a linear equation on relative energy states , not absolute values
from zero.

109
The zero point rests on a max energy relative point , here pulselength is relevant and total energy in JOULES is relative to
TIME /second .

most frequency drives have already internal recovery diodes ....

if CEMFP falls within a BLANK segment, it returns to POWER capacitor ...dealing with PULSES It is just an
"answer awaiting re-discovery"
Raivo remember how many times I mentioned the harmonics....
redirected non reflective to a load they become pure OU power on Phil reflected power ...
What those harmonics will do reflected back into a pure resonant LC ...????? LC in series initiated by RV alternator ..to
Circuit.
Andrew: The harmonics when reflected back into a pure resonant LC circuit - the circuit will act as a high impedance to the
harmonics and block most of them from reflecting back into the supply.

plug power is taken from Cap positive & cap negative Seen from common Its charge is 220VDC at 62uF if seen as
individual elements within a REFERENCE of 30 Cycle per second each from COLD start in halfway pulse each in 37.5/120
second timeframe but 30/60 second apart each , Scoped is interesting as we start capacitor from COLD 0 charge to attain a
RADIANT charge within a given time from reactive (L) element as Current node to be transferred to Voltage node .. as a
charge , so the charge potential of EACH capacitor must be DEFINED as JOULE SECOND for a true OVERUNITY
TRANSFORM MANAGEMENT ,in this mode residual Tunnelled electron tensor remains in ELECTRET resulting in
ADDED OU from the Capacitor itself (See old Electret and Testatica secret disclosures ( They are related with INTENT to
RESONANT plug as ENTROPY is reversed furthermore .. ) Gain as thumb ruler can be 1.382 over Isotropic . (RF
TERMINOLOGY TO DEFINE BASIC DIPOLE dual nodes in resonance) (Unity gain Base ).
from centre reference in capacitor common the 2 capacitors sum up in series their voltages , LOADED their potential
doubles but divides in joule second as eV/2t here is where T (time) enters the ZPE formulations to be taken as energy
measure also .
Refer to Seike Ultrarelativity concepts in his time reversing oscillator (first editions) where he demonstrates receding wave
relative to gravitic flow within his formulations , then T (time)can be defined as Entropy where gravity is also part of such
entropy in his delta transform equations , he errs a few points but is factual time can be reversed and used as source of
energy as Was applicable to rotoverter in general mechanical transformation (standard time )

On an AC wave A diode plug charges opposed polarity pair splitting AC signal into Half waves where energy component
splits in 2 (1/2) but where CAPACITANCE value is SAME as main LC , so we have C joule potential = Resonant value but
at (1/2) time (30CPS) in case of 60CPS signal , in average discharge we may say Average power = potential divided by
time in JOULE equivalent of C charge .
A coil from saturation State discharges its potential in C 2 times in a cycle where electret remanant electrostatic charge
becomes LOSS within capacitor , in diode plug such loss is turned positive as remanance adds to linear recharge of
capacitors in half cycles ..
Creating logarithmic spiral in resonance is what transfers RADIANT energy (ZPE ) to capacitors as JOULE potential ... OU
..

Dan’s diode plug: Don’t forget the varactor effect and LC frequency drift C2 a/b can be much lower as long it takes less to
sustain LC1 a/b ..
circuit can be self tuned multi-vibrator as it tends to be self adjusting under Varactor effect ..

Coldfusion with diode plug: R must limit C tensor if using 2X C if closed loop C=(C/2) x 2
remember R + C creates Varactor effect where frequency shifting occurs .

110
In dioded HALF tank C is same as in FULL LC compensated for initial 0 point state to max relative current induction in L ,
That is from a PM source induction, C is seen as a Solid conductor to wave ,assuming instant pulse (inductive to be
transformed ) into capacitive potential (joule) the power is maximal at Half cycle 1/2 wavelength but same pulse-length so
we have to sum 2 pulse-length vectors to sum of end product of c1 + c2 at final stage and adding the 1.618 logarithmic gain
... in AC electrolysis is LCk k= capactrode containing water, water as being recombinant transformer Heat out sums heat in
as it recombines augments its energy until attains cold fusion ..
The frequency is electron spin harmonic to molecular resonance 2.450Ghz at 1.725 cps hypersignal tensor .
In a sense to be understood better you have to RV the water molecule taping to its natural transformation frequencies
Parameters as glass dielectric constant its linear tensor relative to harmonics within the plates and all electric hardware must
be considered as not to DAMP the energy RADIATED from the sonofused water ,many things can be done just be careful
not to overdrive your fish tank ... and (beware of getting near heavy lead pipes) wile having strange or uninvited visitors ...

I posted here long ago the sonofusion frequency and the 3 phase 3 electrode cell & the capactrode system ...

lets take a half diode plugged half sinewave ...

you have a saturated core "Shorted" 0 voltage max current..
you "unshort" it into a capacitor , the collapse transfers the potential into VOLTAGE in the capacitor
There you got your 90Deg (because 180 leads you into co-phased signal again with a full wave leading ahead ..
You have "0" current and maximal cap joule potential at X volts N farads ....
And yes overunity transform resides in the potential transfer of core energy or energy from the "medium" in hi states of
natural resonance, atomic resonance and thermoelectric - electron spin transformations ... (Refer to stochastic resonance as a
sample and confirmation ) OU comes from energy transformation..

To get SCR easy to go to 0 current: parallel a second capacitor to SCR circuit that discharges parallel to SCR path as
internal current goes to 0 SCR switches off .

Diode plug – peak detection

Its Switching diodes a resistor and a choke ..
the choke is to advance the phase in relation to the rise voltage curvature to trigger the SCR at its PEAK voltage top ..
Alike a light dimmer that uses CAPACITOR and RESISTOR & the SWITCHING diode ( Usually a 90V DIAC Driving a
TRIAC SCR for full wave light dimmers where the capacitor DELAYS the signal as to trigger in DOWNSLOPE of the
sinewave to control the power going to light bulb...
In PLUG switching we need to tailor a CHOKE (reactor ) to get Switching diode to trigger SCR at Max capacitor Plug
charge were a capacitor and variable resistor can be used as VARISTOR alike to TUNE in the Max voltage turn on Phase
peak ,,,
The Idea is to trigger at top of the half sine peak ,were is non reflective to AC Radiant source ..(reread Transverter Basics )

Good to fire an SCR in nanoseconds peak time ,there is also SS FUSES with nanosecond turn off at max current ..
good for the Konehead shorted coil method to saturate coils to peak and at fuse open up transfer full radiant charge to
capacitor as a joule charge potential (usually OU ).
this fuses reset when power source is off ... fast switching ones are good for 30 CPS at 1/120 second length
x2 diode plugs 30CPS each plug 1/4 incremental sinewave 1/120 second ...
(real data ) for 60CPS AC

111
4.3. Kone recovery non-reflecting to source + (ZPE )
Kone: There are two different "AC leg switching' schemes I have going on I post about –
1) one is the backemf/recoil recovery circuit, where you switch slightly delayed to motor coil impulse ON-OFF just one of
the AC legs of a FWBR, and then DC side of FWBR into caps and load. With this one, the idea is to make a sort of echo-
pulse to the initial motor coil input pulse, and when you cut the power to the coil, the collapsing field and recoil spike
kicking backwards actually adds to the power of the motor, because of the timing of it.
Draw goes down to the motor; Motor speeds up and has more power ; Plasma distinguishes in switching so they wont blow
up; Heavy resistance being pulsed in recovery output doesn’t lug motor down like "normal" recovery circuits...
2) Then there is other thing to do with a FWBR - that is to put the AC legs across a GENERATOR coil and rectify to DC
and into cap and load to check power or whatever –
Phil: What you should do here mate, is switch in a light bulb or some other low resistance instead of shorting the Gen coils
directly. I have done this with the Adams motor and many other motor designs for a long time, and it works great.!
At least you are now putting this normally shorted energy to good work. Also check the specs on the FWBR you are using.
Most you get from Radioshack are far to slow in switching. They are usually designed for around 60htz or a little higher and
you can loose many times the gains because of there slow switching ability. I often make my own FWBR using Schottky
diodes, or with hyper fast diodes. You will be surprised at the added gains from better used diodes.

Kone: Take the RV to the next phase (pun) ...put a full wave bridge rectifier AC leg over that "blank/virtual" phase in it (AC
legs across lines 2 and 3 - where the caps go) Maybe put a transformer across it first if you want - I used a door-chime
transformer - converts 120VAC to 16VAC...then pump that 16VAC into the FWBR (if you want)
Now control that FWBR output by placing a switch onto just one of the AC legs. The FWBR will not function unless this
switch is on. Use the David Kou neon design circuit, or whatever you want, to control when that AC leg of FWBR turns
ON..................
Make it so that it doesn’t reflect onto the draw of the motor, by switching at the optimum points in sine wave feeding RV.
Try SHORTING that blank phase too at points in sine wave, (another switch needed for this) before extracting power from
it. Doing stuff like this makes the RV and awesome battery charger...

Shorting the coils takes them to lower impedance where M field GUNS them to
saturation in a semy superconductive state where V =0 and I = N(maximal Current)
as Coil is OPENED the compressed superconductive tensor (electron saturation) I
(Current) in the wire is released as a VOLTAGE discharge of great magnitude ( reread
postings on NEWMAN motor ) arc effect
REREAD my posting where I described how a coil hi voltage is discharged across a
gap in a series of turn on turn off pulses as its VA NODES roll across the gap ....
Reread posting on NORMAN WOOTAN FAN MOTOR EXPERIENCE and the
creation of NEGATIVE impedance states (Gunning ) resulting in a virtual superconductive state ...
A wire saturated with electrons becomes superconductive at normal temperature being able to stochastically gain
temperature energy (HEAT) and transferring this energy to the ELECTRON region pumping the VOLTAGE UP ,increasing
CAPACITOR voltage ....
NEWMAN contribution may be forgotten , but we cant reject its contribution in understanding this phenomena , RV
alternator is the same but in a squirrel cage reverse induction exited mode..
Bedini, Meg, Jim and Muller is same stuff Maybe I am the only person explaining it as is ... And many hate me for it as it
broadbands and kills all secrets patents and R&D out there ...
Its so dam simple it escapes the mind .... (Tesla’s hidden secret ..)
Kone: shorting coil (switch ON) makes for maximum current produced inside coil, ( as seen by ammeter shorting coil in any
test) but there are no volts registered while > shorted,

112
 Spark gap dynamics: as a voltage spike crosses a GAP this equals a short that makes voltage cut off ( 0 volt state )
opening the spark gap up as it reaches cut off voltage where Ions cannot sustain conductivity across gap as this
open occurs Coil regausses to collapse state where voltage increases again until air Ions become conductive
creating plasma bridge in spark gap , a series of Hi frequency ons and offs creates the bzzzzzzzzt of DC arcing seen
in scope as stepped random discharges within a dc stream ...
then turn switch OFF and this "springs" UP coil output to cap with HV since the current trapped in the coil releases with
vengeance you could say.
shorted Coil dynamics : Exactly ! if we get the magnetic field intensity as to be TUNED in Magnetic resonance in a
shorted condition in a HI broadband impedance coil the SHORT will be seen as an INFINITE farad capacitor
"Virtual solid conductor", for those of you following the experiment becomes quite more easy to understand the
implication of this revelation ...
coil state logarithmically drops in impedance and cools down as it attains a virtual electron saturation becoming
superconductive at room temperature ( 0 voltage is a ZERO point energy state where HEAT will flow and be
transferred to I (current as energy ) ...
As you open the circuit this energy is pumped as a voltage potential into a condenser where it can be extracted with
posted methods ...
It works great and its easy. Plus its not just spikes, as some would say, since with resistor load across cap, you can double
the output of the coil in true-power that way...no resistor or high ohm resistors have more impressive voltage of course....
Its EMA sine wave capture as there is no gap random plasma pulse modulation and energy loss ..
This is the beginning of understanding true ZPE energy production using direct M field inductance ( start ) creating
a near VTA rotary Inductor "reverse of rotary condenser" ..IN low to HI impedance virtual rotary inductor
machine .
hope the people reading this realize the implications and instead of suppressing it take it to the place it deserves
giving due credit to all the people involved in making it possible ....
This information is public and repetitive add on to information given since 1980 ARK Research and EVGray
Groups 2000-2005 ( public domain .) Pass it on .... Thanks.. (things can be turned on by turning them off )

Doesn't putting a capacitor on the DC side of a full wave rectifier take it out of the LC circuit?
If you picture the diode plug it separates C component from LC into 2 half tanks (LC)
In full wave bridge
If you take the LC relation from a 4rt dimensional look you have a varactor circuit linear driven LC at each cycle where R
determines the value of impedance at source driving it (Simple) capacitor size determines peak to peak value of rectified
potential as a charge in a capacitor, energy resultant is calculated in joules (capacitor voltage and the energy it can deliver in
watt seconds (VA
Does rectifier take it out of the LC circuit?
In Transverter plug discharging C in blank interval does take it out of the circuit as load is non entropicaly reflective to
source ..
The remanent charge is recovered by charge cycle in a frequency determined shift within VARACTOR theory specifics
(broadband ) hi impedance.
If capacitor potential is 0 the charging takes a hi Q lower impedance logarithmic C charge within a CORNU spiral (as
optical slit)charge path resulting in true magnetic amplification from the 4D zero point tensor , this under "resonant"
conditions.
Diode does not isolate L from C just converts it to half tank rectifying half wave ... 30cps case of house AC Pulses into C
A diode bridge does the same But doubles half wave pulses 60CPS AC
If a second LC tuned at 120CPS is placed at bridge pulsed DC output you have an AC cyclo-converter frequency doubling
circuit ...if diodes are set as FREQUENCY MIXER bridge using LC and diodes you can convert any signal say Shuman
resonance 11 CPS into useful 66 to 72CPS .... and get free energy from the EARTH resonance ....

113
Needs extreme expertise in AC-RF even if it seems so darn simple ...but RV and transverter are the same stuff anyone need
to understand concept ..(applications).

Kone: Bill Muller told me that their motors have on-off switching BOTH at the "HI" of the motor coil (current enters) and
also at the "LO" of the coil too.
Then he said that they placed the AC legs of a full wave bridge rectifier over EACH SWITCH, and the DC out of each
FWBR feeds a capacitor, so there are two caps for each coil. He says that you catch the back-emf/recoil going "both ways"
this way and you collect more recovery-energy this way.
ALSO: By staggering the on-off timing of these two switches, you can make it so that they don’t turn the coils on-off
perfectly simultaneous, but instead "drift" one to the other, so that you can CONTROL PULSE WIDTH this way. (EASY)
Anyway this might be of help to you guys experimenting with the neon trigger circuit, as it seems a very quick small pulse
width is going to be the only way to get it to working properly....what maybe you guys can do is double-up the SCRS, and
in fact maybe the whole circuit in order to control the pulse width very precise by drifting one against the other...if working
with 60hz, the pos and neg phase will be 16.6 milliseconds, and each phase will be 8.4milliseconds, and (form 0 line to zero
line) and so seems like the pulse width you would want to be playing with would be around 1 to 2 milliseconds in order to
really only capture the "peaks" and/or the "zero point".

4.4. RV primemover extraction

RV power can be Extracted from the Vector Cap in Primemover using SERIES transformer tuned to provide the Inverter
DC input with a CURRENT vector from a diode bridge at its low voltage secondary
and feeding this across a current bandpass diode into the DC buss to lower inverter amperage demand ...
Current bandpass diode: A diode that forwards (passes the ac or DC pulses ) (bandpass ) one way and does not
permit current voltage signal to return leak or scape from accumulator to the source ......
pulse filters , blocking dc pass diode, bypass networks , redundant split DC pass multiple sources arrays , military
triple redundancy circuits , raid power supply hot swap circuit designs , diode pass arrays . blocking crowbar
circuits ,reverse diode protection circuits
A transformer say 120VAC primary and 22-18 volt AC secondary is OK for starts were the effect of feedback can be
quantified ...
Capacitor Values must be changed for best performance (tuned)
then a transformer can be configured as to be able to add or take turns as to tune impedance correctly to achieve proper
current vectoring to lower battery current to 0 amps or positive reverse amperage back to the battery , once this is done a
megacapacitor 1Farad at 15VDC can be used to demonstrate the true looped states
This is the most simple way to loop an RV (non loaded) to run perpetually on energy electrically acquired from the medium
..
Reread all Stuff on Resonance MRA , Iron Cores , VTA , MEG ,Ema 4
One of 18 ways to do it ....

114
Raivo: Based on H's lecture, attached is a circuit idea how to l00p the RV (or preferably PMRV) prime mover only.
Possibly making green men very pissed (green-piss LOL).
components: battery, amp-meter, inverter 60hz, tuning run-cap, 10:1 transformer 100VA or bigger, preferably toroidal
where you can add some turns for better impedance match, diode bridge, big caps.
Pheaking the run-cap in the hope the current to battery ceases or reverses.

115
5. Other Applications

5.1. General
Calculate maximal current your coil attains, calculate a fuse that will trip off under 5% of that maximal
Calculate your Frequency; calculate fuse trip & reset speed to be at least 4 times faster than coil frequency ...
fuse can be home made using IGTB units or bought from supplier specified as linear oscillator trigger device (NCC dc line
pulser) --------------------- That is a kind of constant pulse fuse limiter device used in military equipment to protect from EW
microwave pulse-weapons but normally found as Solid state fuses in the street electronic sales .
Fast switching solid state self resetting fuses .. PARALELL TO COIL
They OPEN up as Coil reaches a maximal current don’t reset until voltage returns to 0 ( 1/300 of a second reset type
recommended ) CAN BE FAST SWITCHING SOLID STATE ONES.

on coil calculated frequency it doubles by each pair of poles over 60CPS, on base of that calculated xC relative to core
,ampere turns and capacity ... you may be resonating off in harmonics and not on coil fundamental (needs to be rotor pole
fundamental ).
coil needs to be designed in frequency generated by magnet passage over it ... so its Q character defined on the fundamental
frequency as to create hi Q states augmenting amplification , coil frequency must be a bit LEADING in relation to rotational
frequency . the shorting and releasing of virtual infinite capacitor into coil charges it as to release xC potential to
fundamental rC .. M field is seen as CAPACITIVE charge as rotary condenser theoretics demonstrate in power factor
correction .
virtual power made REAL power ..(detailing is bitchy, many room for error) those reading are WAY low to be optimal
design ...

Motor and alternator in one: In EM or PM synchronous machine where POWER FACTOR and resonance are used to RUN
in Magnetic amplification mode is possible , squirrel caged ones are more difficult he must find the Sweet point Of
Resonance in the laminate plates where Energy transforms from thermal to magneto-electric energy and be (summed up the
loading) be self sustaining, be inclined more to think that the magic may be in the WATER pump used, that a modification
was made to hydro-sonically extract energy from hydrites in the water creating energy transformation vortex ..
In squirrel cage this condition usually creates over speed looping destroying unit in a few seconds & melting the coils
(danger).
One coil feeds the other resonant angle summing up vectors , this is the same STAR generator developed for US air force
Skunk works Aurora project .. look for Chorus motor patents ... (Eye opener)

A car alternator as is from (OFF the shelve): At a given SPEED and at a given REGULATED rotor EM field intensity
becomes EXTREMELY overunity . 'To the point it can RUN and inverter and feed itself ...
the battery becomes the infinite virtual capacitor where Coil phases load their OU energy to , water in electrolyte becomes
quantal nuclear fuel to the reaction ( so needs to be added daily ) ...

Gray tube is pulse driver RF ac homopolar transformer where the energy in reality is extracted from Electron density
modulation from within standing wave RF signal nodes under pure resonance , same energy is produced in the lower
voltage RV alternator in pure resonant low impedance states.

Dc motors do not make good generators "as is"

If you disassemble one you can see the brushes and the area of commutators they touch . in case of a Baldor DC motor if
you have 40 commutators in 40 windings delta connected and brushes touch only 2 commutator segments you are using

116
only 1/10 of your rotor winding plus the others become shunts drawing power from the first , independent star configuration
prevents self shunting ..
as generator diode bridging in 40 phases bridge uses full potential of windings in overlapping phases in continuous DC
stream in magnetic PM top N-S field crest within the structure ..
Good test is to create PM end bell from PM dc motor and rotate it with RV in a full phased Wye rewired DC motor rotor
(Now stator) and quantify energy generated in pure DC ..
that is raw 4 times over the full load capacity of motor at 10 times more efficient . Depending in Quality of motor and rotor
laminates ( some really suck ! ) RV permits you to see where they suck and why ?... its where quality and design influences
performance ...

ANY power supply can be made OU.

Eliminate Draining resistors.
I think if that does not clear the point and POWER management is not properly implemented in a DESIGN, OU simply
remains lost within the circuit designer ignorance lost in the bias voltages ICs Regulators and Resistors within the circuit
itself ..
Solution , ELIMINATE LOSS , like in RV , Optimize design as to lower switching and regulating requirements , an opto
isolator LED requires 3 milli-amps to glow full power to switch a 2 milli-amp Fet oscillator off as to regulate a resonant
12V LC plug and other 10MA to switch the non reflecting 2x2 output circuit
Switching Diodes , opto-isolators , a few hi ohm bias resistors fets No ICs requiring 10W to operate No Regulators radiating
heat to air ,no resistor heaters ,no waste ...
That is the WAY to OU ... and any PC switcher can be taken to OU . In fact Any HF inverter can be taken to OU from the
85% eff to 161.8% logarithmic gain if pheaked properly to its load ..

Any modified sinewave inverter can be made overunity ... Any PC power supply (billions on use and on stock ) can be
made OVERUNITY .. How ? eliminate losses , use resonance as teached in RV and transverter and apply to its ferroxplana
transformer and use power management method to optimize ...
There is a resistor and small capacitor (damper ) in main transformer input coil; replace with COIL with variable adjust core
(TV flyback ones from VO circuit do fine ) tune to OU.
Eliminate drain resistors use direct loading to do this at 12.7 volts set regulator to 12.7-13.8 depending on your battery specs
, this is done by locating V sense and changing values that trigger zener reference.
The most simple OU device is a home door buzzer with a reversed diode across the buzzer and the coil being positive
biased .(that meant its switched by its negative pole). As is energized it attracts the metal strip ,the circuit opens, field
collapses EMP is created rectified and returns back to source. How is done? by properly timing the tension of the strip as to
properly time the pulse-length required to set OVERUNITY resonant radiant states within the coil that transform more
energy into the CEMFP going back to the battery than the one needed to saturate the buzzer core coil .

Any brushed generator 2 bearing (even One phase ) run at 1/4 voltage rating as a pulsemotor with rotor excitation
controlling magnetic amplification factor once synchronized to source power or pulse source and tuned recovery circuit ..
can easy demonstrate this theory in vitro .. Kone already did with his Konemotor, I just want to point the way using
STANDARD off the shelve stuff.

"Richard R." <oouthere@y...> wrote:

In Bedini's g-flux generator, the higher the load the lesser the input power required to turn the rotor. Someone duplicated
the generator and found the efficiency was around 30% (if memory serves) and Bedini responded by saying he should have
used a brushless motor and bifilar windings is why the test results were so poor. The test results also showed more power
was consumed with the higher loading of the generator which is opposite of Bedini's test results.

117
Unless I'm mistaken, if you have bifilar windings the only way this would make a difference is if they were shorted on each
other and then the result would be more efficiency with the lower resistance. They would essentially cancel out each other
and kill the majority of the back flux in the core.
Am I mistaken?
TUNING ! it’s Impedance & capacitive tuning ..
In resonance you can tune to hi Q and hi energy states wherever you put a LOAD and detune to LOWER Q resonance
power will be reduced.
RADIANT ENERGY IS RF and every part of a circuit relates to the next .... (Unless is decoupled and isolated)(Opto switch
RV plug)
Jerco: Thomas Moray device is in fact DCR (Direct Conversion Receiver) - as far as I figured it out. Just instead of
information you use - energy.
BTW you need delta pulses to activate oscillations. In Moray's time - there were sparkgap telegraphic transmitters
that did it. Nowadays you have to do it (sparkgap oscillators are banned). I think I saw here one design that had
sparkplug + tube (instead only tube) for this purpose...
To me OU is no problem. the problem is applying it to an entropic system ..(power savings are no problem ) 98% on idling
and getting better 161.8% savings in PM(PM) systems and raising minimal in EMA mode EMRV cogeneration .

(Gene, read my postings on fridge motor start windings )

7 colours ,7 musical tones , resonance , harmonics ...
Tap the super novae standing wave of 3.5 cycles per second; or use earth resonant standing wave ... (Its free energy )
the issue is I concentrated on RV because Quantal harmonic motivators are off the peoples reach at this time ...
The need is for do now applications effective technology .
PURE Reactive RVng was of first Things I engaged on long time ago ... differentiating tuning values within reactors
create rotary phase field definitions ...

Kumaran: I tested the circuit with 7 magnet rotor (separated by 1") & single stator. The rotor turns with slow RPM. Later I
added small NIB magnets (12.5mm x 2.2mm) and glue it on top of current magnet. The gap between stator and rotor is
2mm. Still slower RPM.
Later, while the motor is running, I increased the gap between stator and rotor. Now the more RPM increased tremendously
and input amps decreased. Then I added another stator 180 degree a part with same gap distance between stator & rotor. The
RPM doesn't increase much.
I measured the voltage across the battery voltage is 19VDC.
I switch the multimeter to VAC and measured the voltage between transistor collector and ground. It shows around
39.0VAC. When I increase the pulse resistance, input amp drops and collector/ground VAC increases. Can't understand
why? Can anyone explain this phenomena?
YOU ARE power FACTOR CORRECTING YOUR BATTERY WITH AN ac SIGNAL WITHIN A dc ONE , PING!
BOING! CIRCUIT ! AC readings in DC compound modulated signals are very revealing. I recommend using Scope.

not being able to access information on capacitive cooling. They are hiding information on many cooling projects
Its all out in pieces ...: VTA - Resonance - Stochastic resonance - Einstein Bose condensate ( Laser cooling )
Simple test , bend plastic ruler touching your lips; Bend it in, it heats , bend out, it cools ....
Electrically do the same to a ultra HI Q LC with a magnetic latching core ,made of material like OLD IBM memory cores
(magnetic) ..or "VTA" programmed magnet material ...
It will self cool and transfer the HEAT energy to electrical one
"Transverter " basic setup .. and non loading power extracting method (Applicable to MEG or any EMA system..
http://www.nuenergy.org/alt/energy_amplification.htm
the search for ideal core material ...
Answer ....
http://www.rexresearch.com/sweet/1nothing.htm
add ZPE book concept and you are on the ROAD ....

118
5.2. Joseph Newman device
The Joseph Newman device seems to be "easy". What do you think about this and its concept?
Newman is DC; RV is AC
Newman is HI impedance ( 5 tons of it "wirecoil" )
RV is hi impedance AC cored using capacitor to create virtual phase with off the shelve 3PH 230/460AC motor and
capacitors ...
Newman is $10,000 toy (As actually sold)
RV is < $2,000 (well made) and has 1000 times more HP per weight watt than Newman motor and can deliver full 1HP+
power at 3450 RPM in 60CPS (using 3PH 7.5HP motor as RV baseline)
(Solar Power on demand mode applications)
> And the last one, did you ever heard about tap "free energy" from concentric capacitor system.
In RV that is tripleflux capacitor vectored 2x2 ,1x2, 3x3 diode- capacitor variations (16 possible in all combinations) to
attain similar effects .
Capacitors in resonance are OU due to stochastic wall charge remanance, used in electret combination in as per
sample testatika device it can work as quantal vacuum diode rectifier, charge being pumped by molecular diode
electron tunnelling the tendency to remain charged becomes the energy source itself.
Search "Electrets" "Electrostatic charged materials"

5.3. Electric car

Electric car
A rotoverter to propel it in power on demand mode .... ?
As electric car motors are standard no matter what load you put on 100% waste excepting the electronic pulsed ones, (but
still a waste) as 80% of the energy is also wasted by LOW impedance usage .

5.4. Aircar
Ronald: Lee Rogers Air car principle:
Have a look for Joule-Thomson-Effect! Read carefully! Suka -matron = Lee Rogers
Idea is to let HEAT do the job...move the piston...drive the turbine blades, and heat does the job, if you let
********************************************************
A GAS EXPAND IN UNDER PRESSURE REGION WHILE IT DOES WORK
********************************************************
LR'S engine had problems if driven below 2000 RPM. The reason is simply, that piston movement was to slow, compared
to expansion of injected air, so heat didn't the job, but pressure did. Think about it. The key is that simple. I can't understand
why we couldn't see it all the time. Don't get caught from vortex too much. Vortex is an ideal heat-to-directed-movement-
transformer, but not much more (in this case), so first understand its principle, and then understand that you can have similar
effects without a vortex as well.
You don't need a 1:1 tornado-model to get energy from heat. All you need is LR and a source for the damned valves! LR ist
simple, and the patent explains all very well. The compressor is not a special one. This part has to be designed simple in a
low-losses-manner. The key is, that energy out (air injection -> work) and energy in (re-compression) are not equal events.
Compression happens like described in schoolbooks, where we need the formula
*************
pxV = nxRxT
*************

119
But at the other side we have air INJECTION. Here comes Joule-Thomson-Effect into play, where air releases MORE
energy towards piston due to EXPANSION of INJECTED air into a RECEDING medium. That’s the key that no one seems
to notice. The air cools down much more due that, than you would calculate with the formula above. Backpumping that cold
and dense air makes unit self sustain. In a sense its easy stuff. You have to insulate the high pressure chamber thermally,
and you may have a pressure offset from exhaust back to compressor, a pressure above 1at, so that the compressor does not
have to pump from "0" bar, and you can design this "pipe" like a heat exchanger, so you are able to gain HEAT from
environment again, to push up the pressure/volume of the pre-compressed air. The injector valves have to be as near as
possible to the cylinder.
I have a 3 cylinder 4 stroke engine and a lot of that pneumatic stuff, but no valve that is able to withstand 40 bar pressure
and which is able to open and close within some few milliseconds. And as soon all parts are there, it will need some
experimentation and optimization, as soon all is done right. An overall pre-calculation ist not easy done, as lot of parameters
are moving targets, and a lot depends on RPM, injection timing, duration and amount.
PS: If you know how I could get some valves, please let me know. It would be a great help, man.

Formula: For each degree centigrade in temperature drop wile air performs work it decreases 1/273 its volumen ..
In re-compression the VOLUMEN in an acquired chamber is constant to the media temperature its medium determines ,
given such volumen is recompressed in a cold dense state it gains energy in the compression chamber as well as from
ambient temperature ..
Heat becomes FUEL as in hurricane or tornado ..
(Suka-matron "basics")
Air press valves will do fine .... 5/8
or use lower pressures ....

Raivo: All off-the-shelf stuff:

http://www.vaccon.com/venturi.html
http://www.vaccon.com/highvacuum.html
http://www.thomasregister.com/olc/smartcat.aspx?az=67697102&advancedsearch=yes&bgcolor=FFFFFF&border=0&bord
ercolor=000000&cartlink=yes&columnsort=yes&counters=no&email=yes&font=Arial%2c+Helvetica&fontsize=2&linktex
t=Back&listsort=yes&orderimage=https%3a%2f%2ffanyv88.com%3a443%2fhttp%2fwww.thomasregister.com%2folc%2fccc%2fmm%2fcec_AddToCart_f0
1.gif&printpreview=yes&ptnolink=yes&rfqimage=https%3a%2f%2ffanyv88.com%3a443%2fhttp%2fwww.thomasregister.com%2folc%2fccc%2fmm%2fcec
_AddToRFQ_f01.gif&showdiscounts=yes&stripecolor=FFFFEE&tablealign=center&tablewidth=700&textcolor=000000&t
ype=details_order&rn=4167906&template=http://www.vaccon.com/buyonline.html
Hey - those Venturi Vacuum Pumps VVP are based on Venturi effect - those are OU!
Put RV + compressor + VVP inside the tank. Let VVP to suck ambient air in. The air that goes out makes work - use off the
shelf air motor.
VVP draws ambient air in efficiently by vacuuming 80PSI (5.5bar) is required from compressor (ca 2L/s). $115 or
something.
High power energy system.
What are we waiting for?

5.5. Al Franceour
Kone: Al Franceour in Canada has two GRAY motors, he bought them from Norman Wootan a few years ago....I don’t
think he has run them yet...check out the "ALFenergy" yahoo groups...
The classic GRAY motor is not very popular since no one really wants to work with 6000VDC impulses with the resulting
120000VDC induction spikes...
I have a good invention (called konehead motor) of taking the regular GRAY motor design (N-N coils for power - rotors
against stators - similar to regular forklift motor actually) and then adding permanent magnets just "downstream" in the

120
rotation, the magnets are in the stator position, and so these added stator-magnets "regauge" the CORES of the ROTOR
coils - that is, the magnets pull the polarity of the cores back to the polarity of how they were BEFORE the coils were
ignited for the N-N power stroke.
What this does is give a free power stroke to the motor, a power stroke that doesn’t require any extra power impulse (less
draw then along with more power to shaft) and so the rotor-stator "approach in rotation" will not be rotorN-statorN
(CLASH) but instead becomes rotorS-statorN which becomes a free-pull.... (coils and cores don’t just return to "default
polarity" on their own - they need either an impulse through coils, or magnets to pull the core to the polarity they were
before the power-pulse)
Anyways if you understand all that you will also understand it makes the classic GRAY motor design pretty much obsolete
- you get X4 power increase doing this I figured from prototypes I built as compared to just N-N coils-only power...and you
dont need or want that 6000VDC power input with design like this too.
Besides that, using off-shelf AC motors, or as one example, Permanent magnet-rotored home generators converted into
working as motors, (Hectors advice)you can do the GRAY motor magic stuff without having to build a million dollar
6000VDC prototype from scratch....AC is DC both ways - take GRAY motor design and flip the polarity in 2nd power
stroke in off-shelf AC motor and you then can use AC motors to "be" GRAY motors...
Because Gray's motor design captures the recoil and back-emf of the motor coils through diodes or "Gray tubes" and puts it
into caps to power another pulse, and/or into 2nd battery stacks to charge them ...this is what makes them overunity/free
energy if you have a very short pulse width and good core material and do it all right - there is tremendous power in the
spikes and recoil and backemf of pulsing motor coils and status quo engineering would just steer it back into the coils
immediately (for no real power gain) or grounds it out (both ways to get rid of the very HV induction spikes..."destructive
transients" which destroy switching among other things) So the fact that GRAY from start did some good work gathering
and steering all that normally wasted energy into useful work, makes it a great thing - however, that extreme HV is not
necessary for overunity operation is what I think...(opinion here)
Also one more thing, when you make your motor coils to be transformer winds (primary is motor coil, secondary is
transformer wind AKA pickup winds) then you can pulse-out the secondaries when motor coils are OFF...which means
there is "no reflection" on primary when secondary is loaded with resistance.
I have always thought when GRAY discovered pickup/secondaries in his motors, that is when the tech got repressed and
became dangerous to oil corps greed and profit and eventually EG got a bullet in the brain for going too far with it. (also
opinion)

5.6. PMI pancake motor

PMI pancake motor: The magnet wire is used partially as for hysteresis regaussing to increase field as motor is loaded in
attractive-repulsion modes.
I choose reverse induction RV alternator as RESONANCE sets the rotor field intensity on reverse induction under a set of
variables dependant on Inductive and capacitive values used, motor speed and load relative to such setup is easy to quantify
and regulate .
With fixed magnets LC parameters are also fixed to GAUS intensity and its changes in time ( so PM & EM RV comes after
dominion of Squirrel cage RV ) > Primemover and alternator <.
PM requires a nominal speed a nominal capacitor value to acquire radiant energy vectoring into a given JOULE value at X
voltage N farads ( pheak )
Here Kones COIL shorting becomes useful tool in certain system like Muller, Bedini type motor-generators & others.
[A short equals a virtual infinite capacitor whose potential wall reduces voltage to virtual zero where current tends to go
infinite at where at max current under maximal saturated field is opened ...
Where it discharges its potential in a capacitor (if in hyper Q resonance ) at highest charge potential in joules. ]

Coil shorting creates total amperage NODE at 0 voltage in impedance region . ( 0 point energy )
AS coil reaches saturation is open and current NODE energy transforms to A maximal voltage at a given maximal farad
value as 0 current max peak is reached . Energy is stored as JOULE potential as it is DC it is undebunkable with no power
factor bullshit talk.

121
So Capacitor VOLTAGE and farad value are critical to TAP the RADIANT ZPE VALUE .. That is what the INSISTED so
much on TUNING is all about and the non reflective power extraction made already public is all about .
IT makes possible the recovery OF overunity transformation energy in any system non reflective to source.
(Transverter) diode plug (Oldest site with the info)"still on line".
HYPERLINK http://www.nuenergy.org/alt/energy_amplification.htm
NEWEST replication and confirmation http://www.m-primus.com/www/de/data/tv/tv.html

In brushed designs the Stator can be made to rotate as the brush segments are diode vectored each for TOTAL winding use
instead of only the few segments that the brush contacts .
In a flat pancake motor using Nb magnets on the rotating Stator its 111 segments are 222 diode phase bridged in 111 phases
for a total of 800 amperes at 12.7VDC using 222 10Ampere diodes delta phase bridge. At hi rpm and cryo-cooled it can
power a transatlantic ... as a Motor It can (with a properly designed 111 phases 444 transistor 111 H networks supplant a
747 jet turbine ... megahertz and hypervelocity..
http://www.grc.nasa.gov/WWW/RT/2004/RS/RS11S-choi.html
I dump this info on electric turbine "hints" I can make them better lighter and stronger & more efficient !
Think BIG PM RV gang some 3x3 450A 1200V transistor network to that 3Phase controller and move the world to OU
with off the shelve stuff! Modify to PM RV and OU!

5.7. Raivo: zero lug gens & cores

Raivo: I have compiled a very important info on this zero lug generator and about its CORES. Ronald read it! If all goes
well Ronald will build two versions, one for me. I bought him 50 very strong N45 1'' dia magnets $344. Below you see
Phil's text about transformer driving to OU and how to collect BEMF properly. (DanC and Rain - it is your area of
expertise).
PHIL: " Because the BEMF is the same potential or greater than the first pulse it is common to see the motor
begin running backwards. But basically it's not the best efficient drive mechanism as we are going one step
forward and two steps back."
"If you run the same combination as a generator, 500watts plus, is easily obtained. Yes there is a loading that will
be applied on the PM when the generator is working hard but there are also ways too combat this with some
simple circuitry."
"I have not released much of this before too many people, but it is here now so enjoy.
My new concepts are a many generations ahead, but with this technology I am sure you will see advancements for
your own motor designs."
"Each core is 25mm in length and tuned for a 25mm diameter Neo Magnet 5mm thick. You can glue 2 together if
needed, but this 25mm length core is optimized for one rotor operation with a steel backing plate linking the core
flux fields. So there must be alternating magnet polarities on the rotor when using this length core. 1mm and
1.2mm wire was my preferred size wound on the cores."
"If you decide too run these cores in like my motor design expect high torque and RPM so balancing and strong
bearing mounts are needed. I would like you too also try the wire wound core at the same time with your Muller
generator and see what happens. You will see a new dimension in a collapsing field with its spin back through the
steel wire. One layer of 1.5mm soft fencing wire wound on a wooden or plastic tube is perfect from what I have
found also. Some here are using florist wire as it is also a soft composite."
Conclusion:
- one key is using hollow cores
- The generator is wired into a two phase generator with 16 coils and 24 magnets.
- guys - do you read out the same that this generator requires the external circuitry to drive BEMF through the load to help
out the generator (zero friction)?

122
Phil: Not quite true when you say the current will charge the magnetic flux. At the first stage of pulsing an inductive coil or
transformer the voltage is what creates the magnetic field. The current or the consumption of energy is used too maintain
this field or only to push the field a little stronger in strength.
A good transformer or coil concept is where it uses no current at all under any situation. The problem is when a load is
applied the inductance capacitance and resistance all change and it all becomes out of tune for the pulse width and
frequency being used.
With the RESDECT circuit and if operating properly it should sense this new adjusted frequency by monitoring the voltage
peek and immediately stop the pulse.
It is much easier if we monitored the current where the instant there was a rise, we know that the magnetic field had been
formed and can discontinue the pulse. The LT1161 is a perfect chip with its sense pins on board and can be used for this
operation. The problems are where the frequency can be very high but where there isn't quite enough driving power there to
continue a push needed for something like in a motor operation.
Because the BEMF is the same potential or greater than the first pulse it is common to see the motor begin running
backwards. But basically it's not the best efficient drive mechanism as we are going one step forward and two steps back.
The reason I often say to use a light bulb is because if we were to drive an inductive load in series with a coil the two
BEMF's being from the load and from the coil smash into each other and blow out.
It all comes down to 2 options. First we use 2 batteries or we use 2 loads or we use 2 of everything. But if we have a motor
that has 2 independent coil banks we can do it all within the same motor. Anymore phases create too many components and
more complex switching.
So what I am trying too say in my tired state, if we pulse the coil or a transformer in series with a load and can have some
balance where they behave similar too each other, or better still where the load has a little less resistance than our coil we
can perform work but get all our energy and some more back.
Now if a transformer is placed in series with our load so the low voltage side is hit here. Then we monitor its flux buildup,
voltage peak or current being consumed, we can use the secondary side for a free cap charge. But our load is now doing
some work. Then the collapse of our Transformer causes a second charge into the capacitor that must be rectified of coarse.
This stored energy can be sent too the load by taking just 1/3 of our cap voltage as long as the load isn't also oscillating at a
frequency we can't match correctly. With a light bulb it really doesn't matter what the frequency is and it makes our circuit
less complicated.
Hey, I have just slammed together what I was talking about before with the transformer circuit. This I have built, and it flies
high O-U. I do not have a circuit printout but I can easily draw one in a short time. The Zener regulator is no good for high
wattage but I did use another monitoring circuit too know the minimum voltage level.

5.8. Rain with his Bedini

Rain: Today I did some really interesting tests with my small Bedinimachine.
Yesterday I rebuilt it so, that one part of my bifilar coil is a drive coil and the second part is connected to FWBR. So the
drive coil and back-emf collection coil are not connected, they only have magnetic coupling via coil core (car ignition coil
laminates). My timing is accomplished by the reed switch, whose position and angle towards the magnets determines the
pulse start and pulse width correspondingly. Everything is adjustable, even the coil distance from magnets can be changed
easily during run time.
The drive transistor is an IRFZ44 FET and the reed switch creates just control impulses at FETs gate. Proper resistors make
sure that the gate's internal capacitance is always discharged and that the switching is fast enough. There is 2k2 resistor
between gate and source and 220ohm resistor going from gate to reed switch. Other end of reed switch is connected to
battery plus. This setup can be used as normal Bedini setup with 2 or more batteries where one bat drives and others can be
connected to this FWBR for charging with back-emf spikes. Or this setup can also be used in loop-back mode. Which I did
today. I finally understood where the perfect drive impulse start timing has to be (although it has been said before in some
Bedini postings in yahoo groups).
If you check my pictures (attached), then you see, that in scope shots (which are taken from the FETs drain, at the low end
of the drive coil, upper end of drive coil is at battery plus) there is a bump just before the drive pulse (when FET connects
the coil's lower end to ground). This bump is an induced voltage that is created by the approaching magnet (when magnet
approaches the coil's core). NB! When our rotor is moving at high speed, but all drive pulses are disabled, then actually
there is a similar voltage bump, but going towards the ground potential instead, right after this first positive-going bump. In

123
the scope shots this negative-going induced voltage (created when the magnet leaves the coil core) is masked by the drive
pulse. The bumps are the bigger, and the slope between the bumps the steeper, the nearer is the coil core to the rotor
magnets. So I checked that when the drive pulse coincides exactly with this negative-going voltage bump, the draw from the
battery would be minimal. Actually in my loopback mode tests with proper timing the rotor was moving around 2200RPM,
but the draw from the battery was only ca 30mA due the fact that the back-emf was collected by secondary coil and routed
back to the battery via FWBR.
Also now I understand the Hector's explanations that the coils magnetic field can be actually overcome by the permanent
magnet rotor field and in some situations the power will be driven back to the battery. Imagine this - let's increase the drive
coil's inductance 2-3 times (so actually I need to rewind my bifilar coil sometime). Now the induced voltage in the coil
(when magnet approaches the core) might get even bigger than the initial battery voltage. Just exactly during the drive pulse
(which should start at the exact moment when magnet is starting leaving the core - in scope pic the FET drain voltage just
begins after the first bump to fall lower than the battery voltage) the coil's lower end voltage is anyway already approaching
the ground level (or even going negative) => NB! The coil's upper end is going POSITIVE => almost no current is drawn
from battery or maybe even current is put to battery instead when the induced voltage is sufficiently high... It's just all about
the timing and tuning the power pulse parameters. And the coil needs to have low R and quite high L. And core has to have
low eddy current losses – car ignition coil core is good for this. And when our rotor has sufficient mass, then the magnet,
when approaching the coil core, is accelerating the rotor (magnet is attracted to core), and upon magnet leaving the coil core
the attraction is just nullified by drive pulse and later the pulse's wasted energy can be recollected as back-emf. This kind of
motor can do a lot of work for very little input current in loopback mode. Or it can charge some extra batteries...
In original Bedini schematic the drive pulse start position is automatically set quite right due to the inductive feedback
system. So the drive pulse always starts, when the magnet is leaving the core and the induced voltage/current in the control
winding (which is connected to NPN transistor base) is sufficient to open the transistor. And the drive pulse width in Bedini
circuit is controlled by the series base resistors value. My system seems to be more flexible and more easily tuneable by
changing just the reed switch position and angle. My rotor has 2 magnets and reed switch is positioned 180 degrees from the
drive coil. So when one magnet is at the coil core, then the other magnet is at the reed switch.
Anyways, it has been an educating day... Finally things are getting clear to me via in vitro testing of course. And the
oscilloscope (and amperemeter) is a must for this kind of experiments.
Kone: If you want to try a couple more easy experiments, one would be to put a FWBR over your motor switch, and extract
the recoil of the coil through this FWBR by using another switch that turns on just after the motor switch turns on, and
turns off just after the motor switch turns off (staggered timing)...run the DC into a 2nd battery to charge...put the "recoil
switch" on either one of the AC legs of the FWBR...when you pulse-charge the 2nd battery, your motor draw will go down,
your motor will run faster, and the 2nd battery will take a charge too....also you can run this recoil-recovery into your bifilar
pickup wind too, try either parallel or series to see which works better.
Also another thing is to place a magnet behind or next (downstream) to your motor coil core...you'll find that one polarity,
will "regauge" your core, so that it is not "stuck" in the repulsive-polarity when it comes around and approaches the motor
coil core after just being energized repulsive just after the repulsive motor pulse. Bedini does this in his patent. - This should
also provide another "bump" in the scope shots, and might even double your rpms too...

5.9. William Barbat patent application

Patent application from William Barbat
The language may differ a bit but is same cake with a different frosting cover, transverter and reactor core is same shit, as
explained in this patent its a remix of old information on REX R&D page with the RV & Norman Wootan info posted here
and in the net.
http://www.rexresearch.com/hubbard/hubbard.htm
http://www.rexresearch.com/coler/colerb%7E1.htm
see 1. The "Magnetstromapparat-" pictures ...
http://www.rexresearch.com/teslamt/tmagxmtr.htm
http://www.rexresearch.com/mra/1mra.htm
If those don’t open eyes nothing will ....
who is claming it ? suppressing its publication ? GM holdings?

124
5.10. MRA & Piezo
Magnetic Resonance Amplifier (MRA) - Norman L. Wootan
Hyper Dimensional Aetheric Energy Tapping Device
The Magnetic Resonance Amplifier was a joint
development project between Joel McClain, Palmer Texas
and Norman Wootan, Dallas Texas during the period of
fall 1994 to present date. Attachment (1) one you will
find a chronological history of messages taken from the
Keely-Net BBS, which outline the developmental dialog
that was posted for the record. The complete
documentation for this project is several thousand pages
in extent therefore only selected information is here in
presented. Most of the hard core experimental effort was
in person, one on one with Joel either at my lab bench or
at Joel’s house, on his kitchen table workshop. During
the summer of 1994 I met Joel and soon recognized a
similar desire on his part to get involved in some serious
research on the subject of free energy and anti-gravity.
Since I had more than two of everything needed to equip a research effort I took several truck loads of “goodies” to Joel for
he had no test equipment to work with.
We compared notes and found that we had been reading and researching in the same areas. He was very much into pyramid
energy and “sacred geometry” while I had been looking into hyper dimensional physics and tetrahedral geometry. My
interest in the tetrahedron and nested tetrahedron geometry was spurred on by my contact with a woman who claimed to
have ridden on an alien craft. Her description of the flight physics was based on the “virtual rotation” of energy within the
crystalline lattice structure of the craft to overcome the quadrapole effect of gravity and provide the time severing jump to
the hyper dimension. This terminology was not foreign to me for Tom Bearden had exposed this theory in his Excaliber
Briefing which was based at the time on scalar waves or now known as longitudinal waves which are timeless and travel at
infinite velocity or in the hyper dimension ala Whittaker and Maxwell.
In 1994 I became vice president of the American Gravity Field
Energy Association founded by Hans Neiper of West Germany.
Tom Bearden had been a former President of this organization. In
Han’s book, Revolutions in Medicine and Technology was the plans
and description of the famous Neiper Ring, which displays anti-
gravity traits when powered up. Joel and I decided to build the
device for it was being talked about in the New Energy News
published by Hal Fox up in Salt Lake City, UT. Thus began our
research into the hyper dimensional energy and anti-gravity.
The results of our effort are at attachment (2) two as the MRA
documents and subsequent testing. The MRA is a finely tuned
resonant device incorporating two highly non-linear components
which when operated at ultra high “Q” provide more output than
input into the circuit. Please refer to comments by Professor
Terman, Dean of Electrical Engineering, Stanford University in
attachment (3) three at page 51 regarding the circulating currents
versus input current in a highly tuned circuit operating at ultra high
“Q”. The principle behind the MRA is the same found in the Star
Wars research done at USC with lasers and barium titanate crystals.
They found that when laser light is phase cancelled or folded back
on itself (phase conjugate mirror or PCM) the resulting longitudinal
waves or scalar potentials cause an energy amplification effect thus
could be used as a satellite killing weapon. This research was
published in June of 1994 in Scientific American. With this
information and understanding the crystalline structure of basic elements in the periodic table, most of which are cubic or
face center cubic in shape (nested tetrahedrons), we proceeded to put together our first MRA. Our objective was to create

125
“virtual rotation” of energy within the “nested tetrahedral lattice” structure of the elements within our circuit. Barium ferrite
magnets and barium titanate crystals were selected. All of the elements involved are of the cubic or face center cubic
structure that we needed.
At attachment (4) four, are articles and letters that were written during the testing and verification of the MRA. Robert
Taylor, our business partner in Atlanta provided the capital to employ Dr. Bass as our Patent Attorney and the necessary
testing for verification of the MRA. The successful test conducted by Scientific Atlanta, Concordant Technologies and
Georgia Tech University were not documented in writing for they did not want their organizations named in another “cold
fusion” debate. The Teledyne Ryan test was officially documented and signed by the testing physicist.
At attachment (5) five, is the final affidavit filled by Dr. Bass prior to the Patent Office granting of the Patent. In the final
days before this last affidavit the NSA requested a copy of all the information regarding the MRA. Robert Taylor provided
the requested information so we just put “two and two together” when the Patent Office rejected our patent and came to the
conclusion that it was futile to fight the Federal Government in a protracted law suite. The MRA is as always an over-unity
device that needs the necessary research and development funding to flesh it out and put it into a usable product for the
market place. We have done all we can do to prove the concept and theory behind the device. Since we placed all of the
technology on the internet complete with all the technical updates as we proceeded with our project it should be expected
that others would pickup the ball and run with this promising device. Who knows, someday you may walk into Wal-Mart
and find a MRA that will power your house or be in the form of a perpetual battery for your bass boat or your lap top
computer.
In February 1995, Joel and I did a MRA prototype demonstration in Atlanta, Georgia for the head procurement officer and
two staff electrical engineers from IBM Corporation. They were, in their words, “blown away” by the demonstration of
over-unity by the circuit. IBM wanted the MRA for the lap top computer battery application plus rights to all other
applications upon successful patent of the device. If the MRA was adequately funded in the research and development area
it would create a very significant change in the entire energy industry from rechargeable power tools, computers,
automotive use, decentralized power generation and central power generation systems.

Tuning procedures used on the MRA

A MRA was constructed using two ea. Of the Radio Shack barium ferrite magnets #64-1877 that Greg Hodowanec
referenced on page 4 of 18 in article written fro New Energy News as found on the Rex Research site. I wound 100 turns of
#26 stranded wire on the primary then wound (overlaid) 162 turns of #30 stranded for a secondary which gave me a PHI
(1:1.618) Ratio. For those that do not know about the “Golden Mean” or Phi ratios you need to do some serious research
before proceeding any further. Everything related to this project refers directly back to this ratio. This ratio is paramount to
the study of the resonant phenomenon as employed in this device. The piezo used in the attached circuit was the standard
Branson Welder element, which we were told, was lead zirconate piezo crystal with a primary resonant freq of 32KHZ.
MRA was driven with a HP200 vacuum tube signal generator with a 48V lamp on the DC output from the full wave bridge.
Tuning requires finding the various resonant points and zeroing in on the most powerful, finding that very sharp resonant
peak.
Attached are three oscilloscope photographs, circuit diagram (series resonant MRA circuit) and a resonant curve for a series
resonant circuit, which depicts the region of operation that we seek to find.
This document will describe the tuning procedures used to bring the resonating circuit into that loss less ultra high “Q”
region slightly on the right side of the resonant peak. Keep in mind that we are tuning a series resonant circuit, which
produces a slight reactive component (current lagging) when tuned to the immediate right side of the resonant curve. This
tuned position provides us almost infinite impedance in the input side of our circuit.
To reach this finely tuned, ideal resonant condition it is first necessary to find that resonant condition shown in oscilloscope
photo #1. This photo depicts a net capacitive condition with the current clearly leading the voltage traces. The next step is
to tune through the resonant peak to find a condition of net reactive which shows a current lagging scope trace as shown in
photo #3. Now we tune ever so slightly down in frequency to approach that infinite “Q” sweet spot which lies just to the
right of the resonant peak providing an almost infinite impedance in our primary which also brings the current and voltage
into a very favorable power factor which yields the maximum gain possible as depicted in photo #2.
When working with the MRA you have to understand the conditioning that has to be observed. Tune your MRA to a
resonant condition and leave it running for several hours in a room temperature of about 75 degrees. A cold magnet will not
work in the MRA. There is a strange columnar field that slowly builds around the device. You have to experiment with the
length of the clip leads that you use to connect the signal generator to the MRA. I have one small MRA that will light a 15
watt florescent tube via signal generator input using 12 inch #18ga. leads but will not work with 18 inch leads. Remember

126
that you are working with a resonant device so all factors relate and must be observed. This is the reason so many
researchers have totally failed to make the MRA function. It is due to lack of understanding of the basic principals
involved. If you examine the scope photos you clearly see the high number of harmonics involved in a properly tuned and
functioning MRA. These higher order harmonics are the key to achieving O/U. Without a sharp resonant curve to begin
with you will not get the results desired. The taller sine waves are the potential (voltage) and the packed (bright) wave
forms are the current wave form from the current probe. Potential (voltage) in these photos are approximately 50VAC peak
to peak with a signal generator input of less than 5 VAC. Digest this and we will discuss more later. I have many wild
stories to tell regarding some of the really weird things that happen around the MRA when it has been running for a long
time at resonance.

Ashtweth: I have a friend helping me with an MRA replication, we are about to source the components. Any how here is
some information i got From Patrick, he will consider putting it in the Panacea university site if we can get it working Wish
there was a standard order for MRA parts, that’s the hardest part in FE, you cant get kits any where or the same parts.
Quote- the MRA calls for a barium titanate piezo (as shown at
http://peswiki.com/index.php/Directory:Magnetic_Resonance_Amplifier
http://peswiki.com/index.php/Directory:Magnetic_Resonance_Amplifier>
Don't forget that all of your windings relate to the resonant frequency of the crystal and so getting the crystal cut and shaped
is really the starting point. The original was circular, 3" diameter 3/8" thick with a 1" hole in the middle. If the signal
generator can manage sinewave 40 kHz, then it should be ok. Though the circuit looks ever so easy, -End quote

Norm: The easiest MRA duplication would be the one that Greg Hodawanak did in the New Energy News articles. It used a
ferrite core transformer and planar capacitors in the form of silver mica. It proved O/U real easy. You can get the whole
article and test results from the REX
Research web site. This version was used at the Teledyne Ryan O/U demo and resulting published report. The piezo
elements that Joel and I used were from Branson Ultrasonic Welders. The transformer was a barium ferrite magnet from an
old IBM main frame hard drive. These parts are hard to find these days. That is why I suggest you pull up Greg's version for
the components are readly available from any good electronics supply house.

On MRA remember the OU energy is contained within a mixture of damping signals within the piezo cascading hypersignal
signature
In piezo oscillations the mechanical energy deformation of the crystal matrix behaves like a dommino effect were this signal
needs to be captured broadbanded from the mayor narowbanded main hypersignal like capturing the ripple waves atop a
mayor sunami taking place within the circuit ....
(same applies to ferroresonance in IRON cores )
I recommend hi resolution scopes so you will be able to see what I am speaking of ...
Once looked at work can begin in filtering and power extraction & feedback circuit of the system ...
(not so difficult having the proper tools)

Piezo: ON MRA the coil must be resonantly matched to the piezo crystal used
LC where C is the crystal device (piezo) similar to Jinis experiment is started and input lowered to near cut off ...
NEEDS quite a high drive to initiate. Drive 100W into the mother, then it can self sustain with near one watt! as you lower
power...it becomes OU in hyper-resonant mode squealing like a knifed pig if frequency is within audio spectrum ..
The extraction is done within parallel resonant capacitors within the .382 extraction of the OU in 1.618 logarithmic gain
state .Using diode plug and non reflective switching extraction...Output must exceed input signal as to be successful
(usable)
components are critical ... TV flyback horizontal ox coils are good (the tuneable core ones} Ultrasonic cleaner piezo is ok ...
as to try simple off shelve system ...

127
Be careful with it ITS skin deep cauterizing RF voltage potential
IF you want I later post pictures on the driver I used & the piezos (ultrasonic 36,000CPS & 72,000 cps)
Be also careful with piezos, they don’t like pulses exceeding their structural integration limit ...(They simply EXPLODE
like grenades)
SO drive them incrementally .... until they latch to hyper-resonant states, a LOWER harmonic also can drive a higher
frequency crystal to Hyper-resonance
It sounds like the Barium Ferrite in the magnet core is the most key component
barium strontium titanate ....otherwise known as "ferroxplana"
But Iron will do as well.

On MRA results:
If you look at the piezo is more an acoustic tensor capacitor with character of a reactive nature at atomic level ...
If a dc potential is held on a piezo it either expands or contracts remaining so as the charge is held ,once the power is cut-off
a collapse of the mechanical tensor releases the stored potential as a charge (electrical current )
To understand MRA you have to understand the nature of the components involved , within the piezo you may say you have
a set of virtual LCs each with their own character that expresses as a compound set of signals as circuit works in hyper Q
modes ...it has capacitive and reactive component as well .
In microwave technology a capacitor can behave as a reactive component and a coil can behave as a capacitor , to remain
simple in the explanation that is applicable to MRA mechanics ....
The MRA is a TRANSPONDER just learn what it transforms and from where ...
(Iron thundervolt ) "reread Norms post exchange on all subject " for practical hints ...

On MRA and looping

From its basic resonance the Frequency crystal must lead the piezo frequency phase by at least 7.2 degrees ---
That keeps the time decay factor from making the feedback to drop of due to dephasing ....
(Same thing applied to looped lawnmower)

5.11. Hendershot
Hendershot secret is contained in reactor core diagram in files
Read Norman Wootan MRA work that sums it up and is still under ELEKTRON energy transformation elements (Aether is
3 levels up ) in engineering , hendershot is within electron energy amplifiers classification (Level 1A ) RF radiant energy
Transformation devices.(Basic)
few steps ...
learn to attain resonance , understand its Q modes, broadband narrowband, understand conversion losses & gains,
understand current nodes and voltage nodes (basic)
understand Q gain and Electron density magnetic multiplication factors .. stochastic resonance basics ..phases and rotary
magnetic components , feedback amplification , power factor correction and the full MRA papers and reference coupled to
in hand lab experience in all prior components in vitro
That is impedance (coil an cores) fundamental resonance & harmonics in transformers & impedance matching in RF
engineering practice antenna matching and RF transformer matching applied to POWER transformers in pure resonant
looped states ..
Concept is simple 2 resonant tanks in ultra hi q states tailored to co-phase and amplify themselves in a loop using a
ratio matching of current and voltage nodes of 1:5:1:5 where condition is such that thermal electron energy is
transferred to circuit maintaining its power in a self sustaining loop where true gain results in logarithmic projection

128
of such signal Cop 1 : 1.618 with resultant lowering of electron Kelvin temperature constant at a rate of 38.2% N
BTU HR .
Its simple, but as RV, tuning is really Bitchy & requires part per billion accuracy to replicate (part specifications ) not
possible with 10% 5% or even military .001% part specifications .
So will have to wait a bit as I can find off the shelve stuff to do a kiss anyone can replicate toy ...
In Hendershot there were 2 coils and 2 booster capacitors coupled to transformers alike ferroresonant ones .. weavebasket)
engineered to HIDE its simplicity ... like RV its simplicity does not sell it so he had to make SAME mistake as EV Gray
Exclusive not even GOD can replicate stuff ( YESS ! Once I show this stuff I will be Rich ,so and so ) not even his son
knew how to replicate it and he taught no one .
And that is the mistake, Q is dependant on COIL core relation and not on single static parameters (apparently LOW Q ).
same concept was Mema tested in dual 75KW transformers, at resonance that went to 750KW resonant virtual energy
spinning the rotary signal within 3 X 3 end to end looped phases that is 1.5 megawatts of raw power using homopolar
bazuka type match for feedback (external elements..) This was not taken to loading stages as to measure output capacity, but
as theoretic rule its non reflective potential was 38%, frequency range is 47CPS to 450CPS depending in Q and
broadbanding, system Does respond to Location and is subjected to anomalic phenomena responding to hi degree of
degaussing (severe).So men in black ,ET blondes and mean mothers from outer space get to be the order of the day once
you make this and get it operational Want to make it Easy? ... Think ferroresonant transformers LC
Reactor core.gif in ark files is basic BLOCK diagram; AChomo.jpg is basic coupling method , circuit Banger is starting
(initiator) or System Motivator

5.12. EMF_Recycler2
Spark: I posted some photos of a
circuitmaker simulation
Can someone point out the errors?
add more zeners for more power, use
4pole relay (not in CM)
the introduction of the inductance T1 is
what causes it to pump up.
Remove d3 and power flows back to the
battery possibly ruining it...
www.drspark.com\idea003.php for
original circuit

129
Interesting! You used H switch transform engine to gain energy from the stochastic wall created in the capacitor tendency to
remain charged within the magnetic feedback (pulses) creating a 4x4 MEMA with relays!
http://www.drspark.com/idea003.php
The zener diodes are to prevent it from frying ! ?
The resistor temperature difference stands from the genesis equation (posted here long ago).
H=(IxI) rT reverse delta t transform; One side burns while the other freezes (In hyper Q driven circuits).
Use oil caps or electrets to see how far it goes into hypersaturated stage.
Nice Idea is to do that using full resonance in looped REACTOR core design in pure AC.
Since you got the knowledge it will be easy, just as from DC to AC.
It’s a MAGNETLESS ELECTRO MAGNETIC AMPLIFIER (MEMA) now anyone (with your tuning experience) can built
MEMAS from any transformers.
If your scope shots don’t lie the raising curve can be calculated and a portion of the power can be extracted using split
capacitor plug system. Go pure AC on this one.

Let’s cook the goose ...

130
Connect positive side of C7 across a diode to loop into battery + V1positive
Eliminate R1 eliminate R2; IF it overcharges battery being driven at driving it is OU , eliminate zeners & you got an
incremental doubler accumulator ... If it farts and dies or pops smoke try again...specially if popping smoke (OU overdriven
). battery must be sustained at max charge ..else Goose is cooked ....
Anyway its an interesting experiment from another perspective. applicable to magnetless meg ...
Try using diode plugs and H ganged IGTB network.
As I see now is same transverter stuff but dc switched for those in solid state stuff.
The Impedance at relay side must equal in X times the voltage created in bridge side where it becomes dividend of voltage
and current multiplier.
The first info on the stochastic wall stays the same, gives light in the darkness.
LOOP the goose! stick that beak back inside him ! use a capacitor instead of a battery ! to see decay entropy or OU
"enegentropy" accumulative incremental feedback ! ...
You can limit peak using switching diode or varistor to a disconnect relay to drain source so it loops on off ...
Its an open loop demo and battery drain is not specified neither the energy transform & joule potential transferred from it, in
doubling is simply a pump and it does burn but that energy will be accumulative from battery in a long time pulsed as a
short time one doubling .
Use a charged cap looped as source
If it burns then you have it right if it farts and dies then tuning sucks and is Under OU.
The incremental energy is relative as is impedance matched to its POWER input.
Loop the dam thing with a charged capacitor.
If it self sustains it’s a simpler solution to drive transverter circuits and loop RV itself using capacitor power splitting &
voltage doubling... It will saturate core to the hilt, the CEMF incrementing its joule potential by core energy feedback to
input source.
The question remaining is the collapse frequency and impedance issues to be solved.
Use oil caps higher voltage SCR drivers ? or IGBTs Its the applications not the simulations that put it in real world
applications.

5.13. Suckamatron
OK you suck (I mean the machine ) air enters at 14.7 PSI 11psi average it does work at 98% eff in air turbine , self cools
like in hurricane and is extracted at 1/273 more density per degree it cools down performing work, use gravity in long
chimney structure and unit self runs , I can make it work as I know the little bitchy details that the people wasting 10 million
on it did not know .
What use to give this knowledge? a Calteck son of a bitch will patent it and paid agents will make sure I don’t develop it so
all of you remain fucked paying for electricity ..
The original lightsavers lights were designed to work for 20 years using tritium deuterium mix and an LC resonator , you
got better light. I got $10 a lot of lies was left out and those that got millionaires with what I gave FREE they didn’t care
SHIT you still are like you are, (fu*ked).
Asian Quake and Tsunami is a fart compare with what they will get in a near future ... Karma awaits at the corner, if I don’t
get the POWER to change history, history will kill all of you within its entropic processes ..

Jinis: You should know that the excess energy comes from the ATMOSPHERIC PRESSURE !! We all walking around on
the earth under 1 bar pressure. If you take Thermally Isolated vertical pipe (like chimney stack ) foam insulated inside out ..
put air turbine on top and SUCK at bottom using RV ... as air performs WORK it densifies to LIQUID goes down machine
creating vacuum ...
Snip Forget VORTEX its SUCKING ! (need to learn to suck ).

131
Created temperature difference mapped to the applied energy for separation.
Gravity assisted bottom sucking !!!!
But the pressure which earth atmosphere uses to fill the middle of the tube (cold region)
ALL the tube after it exists turbine into INSULATED HEAVY DENSITY GO Down PIPE sucked at bottom by RV vac
pump
because of the lower molecular air density is "for free". It is OU.
Its a simple 2085 heat transformation engine constructed with the ideas i am giving you now and with quite danger risk ,
timeline is screwed you have no future but thermonuclear war if I am not allowed and funded properly to do this .. And that
was already tested in vitro in alternate timeline ..
Power out summed to acquired power in system is equal or surpasses power input.
In suckamatron : Power creates vacuum, exterior air at X density performs work as it tries to fill void, it densifies and drops
down gravity assisted gaining energy ,as it does is extracted requiring small percent of original energy as is at higher density
and pressure (liquid Air) in EXTREME Thermal reactor configuration where energy is used near 100% and sink is totally
isolated.

TUBE IS THERMALY ISOLATED ONCE IS INITIATED GRAVITY OVERTAKES AND CREATES sink ....
WITHIN TURBINE air DENSIFIES as it performs works and falls (still performing work until ejaculated at bottom of
machine ... (in an Extreme engine as Liquid air) .. being AIR HEAT and GRAVITY the DRIVING ENERGETIC FORCE
this can be proven in vitro anywhere .

HOT Air is suck in, performs work in Thermally insulated turbine stages where as thermodynamic LAW cools further as it
performs more work gaining density where gravity imparts energy as it flows down a SINK ,pipe or structure designed for
such action.. being denser resulting in creation of more vacuum force until such air becomes liquid state as it reaches lower
level in such pipe or structure ,
In Pure turbine design AIR gets denser and by means of centrifugal cryopump is removed requiring a fraction of the energy
produced by the turbines being self sustaining using PURE heat as FUEL.
Hurricanes and Tornados are the same ,here we create an artificial condition where the Carl von Linde principle works
performing WORK and creating a self sustaining sink, The main Factor is Insulation of the COLD sink once is created ..

Study a HI pressure Anti-cyclone weather formation , is same but put inside a pipe ..
As Air performs work Is being Sucked into EXPANSION across turbine it CONTRACTS due to self cooling as it performs
work ..
Turbine Works as Vacuum lower pressure of pipe air densifies as it performs work becomes heavier creating zone of falling
air that sustains vacuum, in reality is simple as hell and less expensive than the solar heated model that is being made in
Australia , difference is my model can work down to liquid air and encompasses the working of non-gravity assisted
systems ..
A jet engine can be made to work in reverse, Rockwell aircraft corp. did this in the 1960s using WATER and heat as Only
fuel.

5.14. Ecklin Brown

"sanderpupae" s.sinttruye@ See: http://home.planet.nl/~sintt000/Ecklin-Brown.jpg
For 3/4 inch square cores by 6.5 inches long ..
DC core 100 (turns per layer}* 6 layers for 600T #18 magnetwire ..
AC cores 100 (TPL)* 12 layers 1200 turns taped at turn 400 and turn 800 ..
Hope this helps you , as in Kones Muller you CAN SHORT coil and OPEN it as field is opened ....

132
You verified why shorting WORKS .... you charge COIL in full AMPERAGE node within 0 Voltage point ....
o point energy .... do all of you get the POINT now ....transfer that to a capacitor as JOULE potential .... using diode plugs ..

One way to test best Amperage node angle is setting indexing opto disc in rotor with indexing mark and use it to mark
digital chart (2 channels aligned to index) ,record the Node amperage relative to ROTOR half moon position and field
intensity , there best position is found to get optimal discharge into a given Volt farad value relative to rotation speed &
best OPERATING system frequency ..
(optimal ) also a rotor can be eliminated switching only one side of the cross but must be reconfigured properly ,a 911 axial
rotor can be used made of flat transformer laminates without cutting round shapes
Let me explain , transformers have E shapes and I shapes laminate forms .... You cut some E shapes into U shapes cutting
center core ... then some E shapes are cut into L shapes where the bottom matches to form perfect equilateral CROSS
leaving 4 prongs there the I shapes are used to bridge the CROSS shape in "11" configuration ... That simplifies the design.
I call it the 911 configuration as spinning cores form an 11 shape mounted in the spinning disc and 4.5 + 4.5 inches length
of Original test 11 sum 9 inches length so its the 911 configuration ..
smaller E shapes from 3 PH trafo were used and bigger trafo I shapes as for axial commutator .. needs to be longer &
wider for full coverage of POLE face gaps ....
The beauty of using 3 PH transformers is the CORES you need are already made .. 120/230/460VAC using 2 transformers
gives you 4 coils with 2 spares 6 coils total and 3 phase transformers can be obtained cheap in salvage yards from small 3
pounders to 7 ton monsters , you only need the patience to separate 0ne by one all the plates with no damage and use proper
no brur cutters (die cutters) preferably to cut the shapes you need to form the 4 prong U L cross shapes and rotating 911
cores ..

Solution as for Ecklin Brown and other full open gates is partial shunting , this restricts the impedance broadbanding of
going from total closed path to total open one ..
How its done: simple gap is partially bridged with some laminate as the bridging used in ferro-resonant transformers
dividing the input -output windings (laminate shunt ) this does the effect of presenting a Virtual partial Short path
increasing the impedance core coil turn relation, similar to reluctance generator principle but i propose as tuneable by
making shunt adjustable at will.

OK in a rotor you got flywheel effect from rotor mass or integrated flywheel pulleys or your primemover rotor , RV,
Bedini, Newman Kone, or Mullermotor atomically mutated hamster spinning a wheel (whatever )..
The Gate is attracted to the field poles, as a neutral piece of iron as is integrated to a ROTOR is subjected to a ballistic mass
ratio of attached mechanical rotating parts it will try to overcome and overshoot attracting poles as a satellite overshoots the
earth in orbit ... since it haves no magnetic polarity of its own is subjected to attraction (Lenzless)it permits to close a gap
and induce power on a coil as field in core is MODULATED in intensity by close opening inverting field close and open &
inverting field in AC mode, power is generated by managing PURE magnetic flux switching.
Lenz law is decay of that ballistic orbital path, field switching is done closing and opening a magnetic gap, if switching
energy required is lower than the produced by alternating magnetic field you got OU.
Using magnet as an energizer battery or magnetism itself as a POWER source ...
A magnet is a transformation engine formed aligning atoms to direct its paralleled force .... Its a form of electric power ...
The need is start to accept this and find the ways to tap to this energy source, from MAGNETIC go MARNETIC (Active)
form "Viticity" Vitrionic energy , AKA- VRILL , chi , electromagno etc.

5.15. Muller
Muller simplified ..
Take 3 phase motor and built a PM rotor that takes its stator core to near saturation (not above).

133
Use a 3Phase semi resonant diode plug system feeding a DC bus to feed a modified sinewave inverter H driver stages to
drive AC system .
I think People had not noticed that a 3 phase motor with a 2 pole rotor has the same Valance pole Switch character than
Muller design. ...
Only that core is Bridged ......across poles .. but that does not take any performance off ( contrary) it keeps field confined to
work area increasing HP and efficiency ....
Ask Norman Wootan He is a well qualified Motor design Engineer for a second enlightening opinion ...
You can eliminate Lenz effect by close tolerance machining and still maintain the current? The Muller machine as I
understand it eliminates cogging by design but i was unaware that Lenz drag could be controlled through distance
manipulation.
Not only that ,,
Lets say you use Utility transformer laminate (.003% E decay )
The Approach of the poles is signified as Gain, where POLE attraction sums to COIL as amplificative power, where in semi
resonant condition such POLE reverses to REPELL the pole once it passes the face ..
That Sums up as GAIN also (or as theoretically justifiable rotary magnetic amplification ...
what it requires ? (Simple synchronization of signal) as IT can be DONE in using 3 phase generators at hi impedance of
ANY kind ...
Check .. Rotary condenser design .... Pulsed operation servomotor- generators design and RV theory ...
Closer Gaps lower impedance value increasing circuit Q at maximal energy maximizing the energy transfer ratio from
ambient electron spin energy component , if done right a pole temperature reduction will be noticed were energy is taken
from electron ambient temperature and transferred to the electrical charge one ...
But My mission here is not to Fix Muller generator flaws, like open broadbanding of its hypersignal components and
consequential under OU operation...
Its to point out The Advantage of POLE OFFSET of his design ...and where to fit this in standard motor application..

5.16. Ping-pong looper

A radio shack strobe light , and a disposable camera flash circuit ...Off shelve items ....
The Flash camera circuit generates 350 volts from 1.5 VDC battery ... This becomes our 1.5 Volt DC Inverter - Motivator.
REMOVE the original 380V 180mF capacitor from Camera circuit, flash Coil and circuit can be removed also ,,,, the
Strobe light usually is similar to the camera circuit Flash
we take the Hi voltage FROM THE CAMERA CIRCUIT AND FEED IT TO THE STROBE CAPACITOR USUALY
350vdc 22uF ( capacitance can be decreased to shorten strobe pulse time ) and increase rate ....
The Party Strobe light becomes our "Coil wacker" circuit, the original variable controls the strove rate within the capacity;
your Inverter - motivator haves to charge it .
This simple off the shelve Thingy can wack a transformer primary with a good jolt, only place primary in series to xenon
strove and source Ground .....
Disposable camera may go for $12, for free if you hunt photo shops trash bins , the radio shack strobe from $19.95 to
$79.95 depending on model ( hunt for them in Pawn Shops and garage sales ( $1 to $10 _) is common sale tag price ... or
look in the trash as students graduate at year end ... ( They Usually throw away all their kinky stuff including wild sex party
strobe lights ... (new !) ...
So equipment Source may come free , as the energy it is able to put in a coil , add a few recovery diodes a la Konzen
design and built your own energy ping pong device .....
you "Ping" it ...it ponNnnNnNNnNngs! back !!!
first advantage is XENON bulb acts as a fast pulse thyratron tube , and is $200 dollars cheaper per watt, (Cheap EV gray
tube substitute)

134
In flash cameras is a Coil that triggers the tube to fire as you discharge a capacitor to its primary ....(igniter coil )
In strobe flasher a zener or switching diode senses the capacitor voltage and fires capacitor across an SCR into Igniter coil
primary at a given variable resistor setting .... this fires the xenon tube into action ..
this controls flash rate and intensity .... your coil in series to it and ready to bang some joules into its core !!!
Solid state EV Gray motor alike !
B+ Source , coil , Xenon bulb Reverse IKV diode across bulb then Ground ..
as Xenon fires it saturates Coil and as coil current reaches max Voltage turns off, coil BEMP feeds across diode to source
capacitor recharging it as is path of lowest resistance for reversed pulse ... A neon may be used in series with diode as to
create cascade stochastic resonance gain exiting coil to transfer more energy from its ambient temperature regions to the
electrical ones
"coil temperature drops under ambient operating at that condition"
*************************************************
Anyway is simple stuff you can all make with a bit of common sense ..
Off the shelve Way to bang a 100KW transformer to OU life .... using an Energizer 1.5 VDC AAA 0r D battery ....
Cascade a series of recovery EMP circuits and feed power back to xenon capacitor ...
OPPS! if you remove battery and it keeps flashing you know you got OU !
Just limit overload .... and remember capacitor retains residual charges capable of nasty harm and pain ...
(Safety first ) Be discrete and pass it on ... don’t get hysterical looping it teach others to do it first, don’t get killed ...
The only hard thing is tuning the LC properly , it can be a few turns of wire looped in an OLD iron kitchen sink , if you tune
it to the Sweet "point" you remove the battery and it will keep flashing non stop ...

Usually pulse litics are WELD ended low impedance ...

the FULL metal strip is welded at spiral ends this lowers
internal strip impedance irregularities reducing
broadbanding . .
normal litics are strip connected and have power stealing
internal Impedance differences in the strip coiling , OU is
lost and TOTALLED in this as energy is broadbanded
and lost in wide spectrum frequency (low Q )
construction makes big difference even in same VALUE
and voltage of capacitors as manufacturers don’t rate
them in "Q" standards .
The ability to discharge its potential in a given time on a
given load ... (at maximal joule potential Shortest time
possible) .
"CQ" parameter ...
This things given here in the EVGRAY group university ... HEHE ! as little is found in standard practice books ...
This is it ! part 1 look now for Tandy party strobe lights ! 120V AC ... a few mods and eureka!

135
Raivo Facilitated a useful Trigger
diagram ...
I undressed it a bit and uploaded it to
ark files ... can be added to existent
flash circuit...
you only need to select proper capacitor
value you want without exceeding the
xenon blow out amperage rating ...
as explained connect your coil in
biased series to the capacitor and xenon
" thyratron substitute gate ....

OK this is the Way Coil is connected as

to use xenon tube as hi power poor man
thyratron switch ...
as the trigger coil excites the tube the hi
voltage is grounded saturating COIL & core ... as the Tube switches off the CEMF drives across diode to source ....
charging the capacitor above its initial value if you TENSED your coil to OU state energy transformation .
That means if you remove Source inverter battery, system will keep on flashing acquiring its energy from core
transformation , as it feeds back to capacitor ...
Its the Most Simplest low cost project to attain looping demonstrating OU .... and the hardest to suppress.
he trigger can be a PULSEMOTOR REED switch , the Pulser or whatever method you choose for your particular
application , for EV Gray circuit test to hi voltage Coil exciter this little circuit becomes the poor may way to OU as
cheap surplus xenon lights can pulse into the "megajoules regions" there is no excuse for that special Caduceus or VTA
core latching , transformer or meg project coils and cores to RING to OU states ..... specially if you tune that coil right !!!
Tuning is bitchy but is worth every effort as TUNING = OU ...
Just review all notes on resonance and Kone recovery
circuits .
After you get it right the only problem that you have is
what you are going to do with it ..... o_O ???
Simple , teach others to do it and pass it on , if the
petrol mafia comes to bother you .. blame me for
giving it public and send them to hell !
Be careful low impedance Big transformers can give
Kilovolt-Ampere ringback...
This little toy is VERY dangerous ( use extreme care
)
You are Dealing with MEGAJOULES in low
resistance and impedance regions , within Magneto-
atomic resonance grasp ! (OU)

I have to Integrate Schematics after administering myself a "mental enema" (To make no mistakes ) Reassemble toy, retest
in vitro verify disassemble again and store.

136
The simplest is to buy a 120AC strobe from radio shack and drive it from the hi voltage diode end of the camera flash
inverter to the strobe capacitor, Schematic points are polarized and colour marked , so its no big problem to integrate using
them .
The trigger circuit can be integrated to camera circuit if similar to uploaded one , your coil design integrated to it ...
Remember this is intended for low impedance HI Q circuit development ... "Narrowbanded"
Will not work with low Q hi resistance HI impedance coils "broadbanded" as OU is lost in low Q non-resonant states.

"Jim”: this one looks similar...a little reading between the lines. http://perso.wanadoo.fr/quanthommesuite/circuitzolt.htm
Basically is the same , as mention before OU is in any coil and core within Specific set of parameters ...
Only difference is Xenon will not burn as easy as a FET or transistor under ZPE tensor regions .. Xenon flash tube is poor
mans thyratron tube substitute ( Test it ) compare to IGBTs where silicon fails xenon stays cool ... and requires NO
HEATER like Expensive thyratron ... In a sense is more like a Super expensive COLD cathode GOVERMENT restricted HI
speed Thyratron tube alike !
So My comparison was a bit Under real estimate of its worth in R&D .
As posted here , the components play a mayor role if you see graphs the pulse is narrowbanded as well as the LC response
to it being Hi Q so Capacitors play important role ..
I think OU is no longer in question .. its the applications what we need to deal with ....
ADD plug recovery design to this , split C & feedback minimal power to sustain Source charge ...
What you got ? LOOPING ? YES ... SELF SUBSTAINING OXCILLATOR !
(It works ) I am only awaiting for replications ... but it appears is as bitchi to do as RV .... (Tuning)
For the Guy with a 2x4 desk and an apartment closet as lab is more practical to work with small simple concepts than 175
pound motors.
The things I know I try to take into Standard off the shelve components and hardware so everyone can experiment within
their economic restrictions , I just like to kick the system face showing anyone can get OU from others peoples trash ...
Gives a true sense and value to "recycling", that is resources recovery and reuse into practical items.
WITH THIS i DONT TRY TO MAKE RV OBSOLETE ....you still need the MOTORS to run things .. and as very
important R&D tool , I try just to give the needy guy a chance ....
I am still trying to Undress the PC power supply dynamics into OU ones to see if this little "snakes" can bite their own
Tails
But after a lot of transistor burning I decided to pull Xenon flash as thyratron substitute , targeting PC power supply ferrite
transformers as Victims in the pledge for simple public domain OU ... A few mods .. and BANG! DC like hell pouring out
the Low voltage end ... ( needs to be regulated ) and a small antenna to Recollect free electrons within the 1.6 MHz
resonance range .. to refresh system core to stable ringing ..
Try it ....
I am still simplifying it .. (I am an electronic nudist !) simple Naked circuits in plain view ..

http://perso.wanadoo.fr/quanthommesuite/circuitzolt.htm

Introduction
"En publiant ce circuit très simple, j'aimerais donner aux amateurs, l'occasion de prouver que l'extraction d'énergie
électrique du vide existe bel et bien.
Le but de ma lettre est de faire connaître mon travail et aider à développer des générateurs quantiques pour l'usage
des gens et des industries.
J'ai décidé de rendre publique un premier circuit, et les amateurs vont pouvoir l'expérimenter."

137
 Présentation de l'auteur
" Mon nom est Jean Zoltan Szili. Toute ma vie, j'ai travaillé dans la recherche scientifique. Depuis sept ans, je suis
retraité.
J'ai habité treize ans en France. Cinq ans à Lyon et huit ans à Paris. À Paris, j'ai travaillé à l'Université d'Orsay en
Physique des Plasmas. Je suis né en Hongrie. J'ai émigré au Canada ( Québec ) en 1969 et j'ai trouvé du travail à
L'Institut de Recherche d'Hydro Québec dans le domaine de la recherche scientifique. J'y suis resté vingt-huit ans
jusqu'à ma retraite.
Un jour, au restaurant de l'institut, j'étais assis à une table en face de deux ingénieurs et de leur invité, spécialistes des
transformateurs. J'ai écouté la conversation, et les ingénieurs ont dit à leur invité, qu'ils savait calculer les paramètres
des transformateurs avec une précision de 0.1 %, mais qu' ils trouvent 2 % de puissance électrique en trop toujours.
Ce surplus de puissance électrique reste inexplicable tout en tenant compte des pertes ohmiques etc.
Je suis sortie du restaurant en pensant que ces 2 % de puissance en trop pourrait venir d'une source inconnue.
Quelques années plus tard, j'ai pris connaissance de la théorie de l'Energie du Point Zéro. J'ai supposé qu'il devrait y
avoir un moyen d'extraire une partie de cette énergie phénoménale.
Depuis ma retraite, je travaille intensément pour trouver des circuits électroniques qui pourrait extraire de l'énergie du
point zéro.
Rapidement, j'ai laissé de côté le travail de laboratoire pour de la simulation sur ordinateur, afin d'accélérer mon
travail. J'ai essayé des milliers de circuits avant d'en trouver un et puis plusieurs autres de ces circuits qu'on dit en
anglais " overunity ".

Méthode de travail
"Quand on explore un domaine inconnu, on doit utiliser le tâtonnement empirique. Petit à petit, on apprend à
connaître ce nouveau monde inconnu de la science et utiliser ces nouvelles connaissances pour trouver des circuits de
plus en plus performants.
Actuellement, je sais assez bien comment extraire le ZPE. La puissance de mes circuits va de quelques milliwatts à
plus de cent kilowatts. Ces circuits doivent être alimentés pour fonctionner, mais à la sortie des circuits, les gains de
puissance (COP = énergie de sortie/énergie d'entrée) peuvent être très élevés. Le gain ou COP peut être 2, 10, 100,
1000 et même plus.
Dans ces simulations, j'ai toujours utilisé des composants électroniques existant dans le commerce.
Cela peut faciliter la réalisation de ces circuits au laboratoire. Ce travail reste cependant à faire.
Tout d'abord, ce circuit a été mis au point sur un programme de simulation sur ordinateur. Ce qui permet de réaliser
la simulation, c'est le Modèle Jiles-Atherton de l'électromagnétisme. Ce modèle a été conçu pour respecter la réalité
expérimentale et non pas la loi de conservation de l'énergie. Je ne peux pas donner de garantie en ce qui concerne le
bon fonctionnement de ce circuit, mais jusqu'à preuve du contraire, faisons confiance à la simulation. Ce programme
est utilisé partout à travers le monde dans les laboratoires électroniques et physiques. Il est très proche de la réalité
expérimentale même si dans 99.999 % des cas sur 100 l'énergie est conservée."

Le Mécanisme d'extraction
"Il existe des conditions spéciales pour qu'il y ait extraction d'énergie des fluctuations quantiques du vide.
Le mécanisme d'extraction, à mon avis, est basé sur la résonance ferromagnétique. Les électrons libres échangent de
l'énergie avec des électrons virtuels du vide. Normalement cet échange est parfaitement symétrique. Résultat : Pas
d'extraction d'énergie.
En plus, les électrons sont des fermions, et en mécanique quantique, deux électrons ne peuvent être dans le même
état.
Il en résulte une dispersion très large de la fréquence de résonance ferromagnétique, qu'on pourrait appeler semi-
collective. Cette résonance se situe entre quelques centaines de MHz et quelques GHz. Néanmoins, les circuits
fonctionnent à une fréquence inférieure à un MHz. Par contre le circuit doit être construit comme un circuit
fonctionnant au moins à 25 MHz. Il faut éviter les boucles, utiliser des composant adéquats etc.
Dans ces circuits, il faut utiliser des méthodes spéciales pour rendre l'échange d'énergie asymétrique. Dans ce cas

138
 seulement, il y aura une extraction d'énergie.
En publiant ce premier circuit, mon but est de stimuler la recherche ZPE. Surtout je pense aux amateurs.
Une nouvelle concernant mes recherches: Je pense avoir trouvé une loi physique, reliant le courant électrique dans
une bobine ( comme utilisé dans le circuit envoyé ) et l'inductance de la bobine. Cette relation courant et inductance
semble fondamentale dans l'extraction de la puissance électrique. Cette relation est réciproque. Une variation de
courant fait varier l'inductance et une variation d'inductance fait varier le courant.
Quand le courant électrique augmente, cela fait diminuer l'inductance, et une diminution de l'inductance fait
augmenter le courant... et ainsi de suite. C'est l'effet d'avalanche. Cette diminution d'inductance a une certaine limite
déterminée par le circuit électronique. Une fois l'arrêt de l'avalanche, le processus s'inverse. L'inductance augmente et
cela fait diminuer le courant...et ainsi de suite. Ce retour prend moins de temps, parce qu'il n'y a pas d'extraction de
puissance électrique du vide pendant ce retour. Normalement, à cause des pertes électriques, l'avalanche ne
recommence pas sans stimulation ( ex: une impulsion électrique dépassant une certaine valeur ).
La formule physique de cette relation est la suivante:

I (L1) = (K1 / L(L1)) - K2 ou I (L1) est le courant circulant dans la bobine et L(L1) est l'inductance de la bobine.
K1 et K2 sont deux constantes (invariables) dépendant des composants du circuit.

Par l'ajustement des constantes K1 et K2, les courbes du courant et de l'inductance sont pratiquement identiques.
Pour d'autres circuits, la formule pourrait changer, mais ce qui est important, c'est que la relation courant et l'inverse
de l'inductance devrait rester valable."

Le circuit électronique à énergie libre de Monsieur Zoltan Szili

"Ce circuit est bien simple en apparence, mais pour réussir à le faire fonctionner, il va falloir prendre des précautions
draconiennes. C'est vrai, qu'il fonctionne à une fréquence relativement basse de 20 kilohertz. Par contre, le signal du
générateur d'impulsion doit être un signal carré, positif, avec un temps de montée de 10 nanosecondes de 0 volts à +
5 volts.
La simulation indique très clairement, que si le temps de montée du signal carré est plus lent que 10 nanosecondes,
l'extraction diminue très rapidement et s'annule complètement entre 50 et 100 nanosecondes.
La simulation montre également qu'une capacité parasite, au point de connexion du transistor (M1), de l'inductance
(L1) et la résistance de sortie (R1) d'une valeur de 100 picofarads vers la masse, détruit complètement l'extraction
(cette capacité de 100 picofarads peut-être la capacité d'une sonde d'oscilloscope).
Les inductances parasites peuvent également empêcher l'extraction, si elle dépasse 10 micro Henry.
Au montage du circuit, il faut minimiser les boucles, comme si le circuit devait fonctio.nner à 25 Mhz
En fait l'élément d'extraction est le ferrite toroïdal de l'inductance (L1)."

Schéma et mesures

139
 "Pas besoin d'un oscilloscope pour prouver la sur unité : il suffit de mesurer 2 courants ex : entre la terre et la
résistance R2, et entre la terre et la résistance R1"

140
 Flash Intensity and Capacitance
It is very important that you select the storage capacitor (C3) and its associated limiting resistor to suit the flash tube.
The following section shows how the capacitance and resistance may be calculated.

The flash intensity is measured in Joules (Watt / Seconds). The energy storage (in Joules) of a capacitor is
determined with the formula ...

Energy (Joules) = 1/2(CV²) where C is capacitance in Farads and V is voltage

A typical strobe might use a 200uF capacitor charged to 340V, which gives about 11 Joules per flash, thus ...
Energy = 1/2 (200e-6 * 340²) = 1/2 (23.12) = 11.5 J
It is actually less than this, since the entire stored charge in the capacitor is not used, but this errs on the side of
caution. This is important, since we don't want to melt the tube or subject it to any more mechanical shock than it
was designed for. Assume a maximum flash rate of 15 f/s, each with a duration of 1ms (meaning effective power is
actually nearly 11,000W per flash!). A passable guideline is ...
Total Energy (Joules) = 0.5J per 10uF (at 340V)
We can now calculate the average dissipation of the tube ...
Dissipation (Watts) = f/s * E where f/s is flashes per second, E is energy in Joules
For our example, the tube will have a continuous dissipation of 172W ...
Dissipation (Watts) = 15 * 11.5 = 172.5W
This means that the tube should have an average power rating of 200W (or 200 Joules), or its maximum rating will
be exceeded. To be able to flash at the maximum power at higher flash rates is not generally necessary, so we can
limit the power simply by increasing the value of the input limiting resistor. This will increase the life of the tube,
and ensure that its safe working temperature is not exceeded. Where you really do need to operate at maximum
intensity at the higher rates, consider using forced air cooling for the tube (and the limiting resistor - this will get

141
 HOT!)

Resistance
R3 limits the current into C3, the storage capacitor. The value of the storage capacitor must be selected to suit the
flash tube (see above). The value of R3 is dependent on the maximum flash rate and the value of C3. At a typical
value of 100 ohms it will need to be rated at about 100W for normal use. With a 220uF cap this has a charge time
constant of 22ms, allowing up to a 20Hz flash rate with only a slightly reduced voltage, but at this frequency the
resistor will be dissipating close to 275W!! That was not a misprint - even at a 10Hz flash rate dissipation is over
100W.

Calculate the resistor using the following guidelines ....

R = 0.02 / C where R is the resistance and C is the capacitance (0.02 is 20ms)

P = (1200 * f/s) / R where f/s is the maximum flash rate per second
The above equations are approximate only, but will provide a passably accurate result. Needless to say I take no
responsibility if your flash tube melts and the resistors explode :-)

An Example
You can get a 100 Joule tube, and want to flash at 15Hz maximum. At the tube rating, this will allow a maximum of
100/15 = 6.6 Joules per flash (say 6.5). This requires a capacitance of 130uF based on the guideline above. The
resistance should be 150 Ohms at 120W, although you will almost certainly get away with a 100W rating

If you refer to the diode yes , as the Xenon bulb Cuts off...
COIL or core power will drive from the negative of diode Return to the positive of capacitor B+ across coil ends + - .
Idea is Xenon drives coil with its plasma pulse to OU & reversed diode recovers Back EMP and refeeds to capacitor , neon
in series to diode is optional ... can be used to step-reboost power into Coil as it feeds back to capacitor like Bedini motor
alike application.
IDEA is COIL and CAPACITOR RELATION TO BE IN HI Q RESONANCE !!!!! within coil CEMP recovery ...(OU) to
permit gain transform from "ambient" energy to occur .
But OFFSET at discharge across xenon tube to be compressed in time as to saturate COIL core , this EXTRACTS the
Magneto atomic thermic electron spin energy and HEAT energy from core and coil transferring it to CAPACITOR ( done
right coil temperature drops down ) indicating OU transformation is occurring ... no magic, plain science ,single shot, self
reloading, pulsecharger.
HERE JM CHARGER INFORMATION becomes Critically Important as his contribution in this have great value in COIL
parameter selection and INITIAL theoretics well adjustable to Xenon Low impedance Hi Q coil pulsers . ( READ all his
papers & compare schematics ) correlate to Kones RECOVERY circuits , reread all post related to this ..
Advisable .. And then start getting FUN !!! ^_^ ...
Little simple devil .... ( bitchy to tune ) but easy to make ... Once OU it will keep on flashing forever . Like Kone self
recharging capacitor in his motor But here the capacitor charge defines trigger firing so it can be self regulated, caring not to
Pulse dephase it firing off phase (As It dies off ) or in charging interval "gunning".giving sharp noise ping in tube (can even
explode it if Q is extremely hi and dies OU killed "kaput" !.
Working:
The pulses are very obnoxious even inside a faraday cage locked inside a safe ... the fast TICnngggg .TICnnnggg... drives
anyone crazy.
Unit signature is detectable from satellite as nuclear trigger test, in intense Hi Q pulse, definitely attracts attention as it
differs very much from a "normal" strobe signature .
This puts Megajoules E field as RF ELF waves out into the AIR (Aether) ... Its a powerful device for its size .
Simple But " Intense " Just try to shield well from "eyes"

142
Yours and those in "space"... OLD microwave ovens make perfect
Faraday "cage" for it ... got it ringing ? just be wise what you do with it ... the problem is not getting OU , but what you are
going to do with it after you get it ...
An "adjustable core" like in OLD radios is advisable AM type or lower frequency HI Q core , Diode 1KW 1AMP flyback
diode from old TV PCB
The flyback core may also be good for a separation adjustment core design (core Gap tuned ) using your own custom coil ..
wired in SC10 5/8 ID PCV plastic tube or paper form assembled in glued plastic adjustable frame .. .
As the coil OU concept is understood is time to give a poor’s man way to BANG! it to life ! no Expensive IGBTs burning
up ..
Will be hard to remove 300 billion xenon tubes flashers from market and suppress this ... :P

Note: A big Soda cracker can be used as a shield but AIR in it will increasingly heat due to Xenon flash pulse, can be a fire
risk ... and it does not attenuate the Tinging very much , in fact it amplifies the noise to an enchordial TANGGG TANGG
TANGG ! ..
KEEP this posting ! VIN ( VERRY Important Notes ) copy plans and keep ... Give to others, teach others to do it ....
another note , if battery is isolated from HV end ,.pulse can be driven across battery in series , but in every time they
overcharge and transistor mini-inverter dies of heat delirium (Burned down).
Original Idea is to Initiate with Little inverter then turn off..and let it "self motivate" with the Capacitor alone .
Other circuits are possible , even charging and using 12VDC car battery , but I reveal as group learns and people steal the
stuff already posted and spread it like a virus .
This FL 12 volt Emergency lights mechanics use in emergency become the pulser SOURCE ... 700VDC + working as
lights recharging the battery at same time .. a HV HF diode bridge in series to FL and HV secondary feeding HV to charge
pulse cap ..
Isolated power can be fed to battery, by using the poor man thyratron tube substitute and OU coil "REACTOR CORE" ..
You get Illumination and a self looped battery recharger ...
Call it a Battery life Extender Device ....
I gave Carlos Avila some FL non looped 1.5 emergency light illuminators ....
But the real fun is running it in HF 3 PHASES ! from 1.5DCV source .. and feed loop it back !
http://groups.yahoo.com/group/EVGRAY/files/A.R.K%20%20%20FILES%20/F403PHwye.jpg
Z.E.U.S Zero-point ,Energy ,User ,System

Hector gave me a hint some time ago.

Search for US Patent 3,977,191 AEROPS-Engine.
Atomic Expansion Reflex Optics Power Source. Its a fully enclosed piston engine, similar to combustion engine, but
with no intake and no exhaust. The working medium is a noble gas mix, but you don't need noble gas, and you can use even
standard combustion engine.
You can use HV to "ignite" relative LV cap discharge through the ion channel to create a plasma ball within the engine that
creates implosion/explosion reaction due cavitation.
This HV/LV combination seems to be the key for a lot of patents (gray tube, Tesla’s ball-lightening, Joe Cell, AEROPS
engine etc. etc. ).Another key word related to air engine is Cavitation :)

143
5.17. Kone DC servo motor
Kone: I tested the same sort of DC servo motor NormW used as his generator in his OU tests of his RV years ago. It’s a
"low Lenz" PMI brand dc servo motor as the generator. Seems to me that speed is the governor with these type motors since
both amps and volts go up with more speed for one thing.
It becomes Hi frequency generator at N speed X load it’s OU; the bitch is to find at what N speed X load it does that and
tune properly to RV primemover ... Every alternator and GENERATOR has what we call a SWEET point where it peaks in
power related to speed watts and load in generating modes.
Raivo:
1) Internal resistance of DC generator: R (internal) = U (alt. open circuit) / I (current through 100ohm R) - 100ohm
If internal resistance (IR) is "high" you should run at 3600RPM instead of 1800RPM. You'll get lower internal losses which
hide OU. Sample: if you run 10A current and IR=0.5ohm, then internal power loss = 50W
2) You tested: 19VAC on 100ohm @1800RPM ->19x19/100=3.61W. I recommend that you enter 50-100W area. So
hopefully there or above illuminates the break-even point. Try 4.7Ohm R.

5.18. VTA
VTA magnet conditioning is done subjecting magnet to RESONANT AC while magnet is oven RED hot and sustain this
AC RESONANT condition until magnet cools down , this creates a LATCHEABLE "latching" molecular condition as .618
strong on the field Q intensity resonance as source is REMOVED, magnet continues to latch by itself under influence of LC
circuit resonance where energy sustain itself in hi Q modes being transferred from THERMAL- atomic energy within the
magnet to the Hi q resonant State ones .... (Since 2002 I exchanged correspondence with Ashley Gray in this subject and its
relation to Meg ....)
Material required is ceramic 8 with memory-latching sintering like the ones USED to manufacture the IBM magnetic
memory core thoroid ferrules
Overunity is nothing more than the transformation of energy added to a working system where Input power + Transform <
than output energy.
The condition required for VTA is having a Latching field magnet
Magnet temperature drops as latching pumps energy from thermoatomic regions to resonant electric ones...
In a bar by sample latching is initiated at one end with a 1 W pulse and the rolling latching wave across bar generates 100W
in LC field. Such magnets must not contain K40 or any other radioactive element that will go nuclear with resonant
condition.... Burning magnet internally into useless crap. This being standard practice to dope commercial magnets with K
40 to limit their use as Transverters....
http://www.nuenergy.org/alt/energy_amplification.htm
Old ceramic magnets used in FIRST PM motor designs can be OVEN latching programmed.... nice hunting, after you got it
working nice survival....
Be careful as Ceramic is a glass; as a glass you must EVENLY heat it up not TORCH it to "pop and Crack" hell....
http://www.keelynet.com/energy/vtakey.htm
http://www.rexresearch.com/sweet/1nothing.htm
The Gray version COP was 1.3 within the predicted 1 to 1.618 logarithmic true MA Gain; only way to extract it is with the
diode plug ....at RESONANT STATES hi Q.....
Sonofusion resonance of natural deuterium in pure water "distilled"
(Free energy is like sex .... first is foreplay "Energy savings”; after that OU and ZPE transform can enter the field ELSE the
Dame will cry rape ....

Barium is extremely carcinogenic, microwave oven Magnetron tube ceramics are made of it...
I have pure Barium-copper rods I got from Experimental 1947 equipment and the things are as bad poison as depleted
uranium.

144
Tin, ferroxplana on the other side can be EATEN and will not harm body.... In fact our body manufactures ferric strontium
titanate; goes out in ton quantity in sewer water.... (Japanese first extracted the stuff from human shit) and used it for
making HF TV transformers (flybacks).
About radium is true it does not exist as is a NUCLEAR compound not a pure element, chemical binding can bind 2 or
more elements electronically, nuclear binding does it at nucleon level, if we see nitrogen by sample in reality is CO©÷
nuclear compound ...React nitrogen with PURE IRON and nitrogen turns to CARBON MONOXIDE as it looses one
hydrogen nucleon to iron in an exotic reaction (transmutation) CO©÷ Lasers in reality use NITROGEN GAS!!!!!!
http://www.dogpile.com/info.dogpl/search/web/Biological%2Btransmutations%2B.

Aluminium metal no longer is pure, manufacturers were offered alloy that makes aluminium more "workable" but RUINS
the aluminate reaction.
Sample as Creation of Hiperatoms AL13I12 Aluminium Iodate cluster ION Polyiodides it takes a single atom contaminate
specific to ruin the reaction ... final product is ruined...
With Sodium aluminate catalyst is the same

one quite specific frequency.

Stochastic RESONANCE takes place in SPECIFIC frequency ranges within the NOISE figures of a crystal latice .
That is its NATURAL noise RESONANT frequency ...where CONJUGATION and amplification occur .
We are TALKING about AMBIENT energy BEING added to a GIVEN frequency input ...
Wherever in VTA the energy input is modulation and the magnetic energy is the B+ power source of the amplifier (Atomic
Magnetic Alightment Flux being MODULATED alike a class C linear amplifier ..
Bearden pointed to a TRIODE amplifier ,I may say its more a grounded grid pentode say 6KD6 as a sample ....
The NATURAL frequency state is what we must SEEK ...
"repeated a zillion times "SEEK the SWEET frequency" were the circuit resonates too ...
In case of a core and coil placed in a magnetic path the way to MODULSATE it is placing a SORTED shield winding
90 degrees from the one parallel to the MAGNETIC flux and ENERGIZE it with a COIL also 90Degrees within
same magnetic PATH , the SHORTED coil E field overcomes the magnetic flux one bending its PATH causing the
PHASED coil to desaturate and emit energy as its internal field collapses .
(Secret bof VTA revealed ) once more ....
This was discovered in EARLY 1914 by RADIO engineers using the coil within a COIL AIR core transformers that had a
GIRATING centre coil to TUNE and compensate PHASE drift in REGENERATIVE amplifiers .
To AVOID interference and DETECTION can SHIELDS were Used
It was found that the centre coil BEING EXCITED with a WEAK source signal as RADIO unit "CAN shield & coilset "
was PLACED NORTH to SOUTH it amplified the signal 23,000 times ....
Sweet Floyd discovered that effect and used it to CREATE VTA .
As I know He was a NAVY radio Technical and Worked with very early TOP secret NAVY radio sets ...
I have one of THIS early COILS that were contained within ALUMINUM shield CANS Frequency ? 455 KC ..(Early radio
regenerative intermediate frequency ) still used in AM radios today ... He also discovered the IBM magnetic CORE
LATCHING properties and BUILTED a CASCADING magnetic LATCHING AMPLIFIER ..
READ SWEETS MAGNET CONDITIONING papers ...
He later MIXED the 2 effects in VTA amplification maybe in an EFFORT to HIDE the trade secret of his work making it
HARDER to replicate and understand ..
Another SECRET disclosure I get strip naked for you people ..
Use it Well ...

145
(Add to INFO VTA file repetitions) keep Public Keep open sourced .
An Extra comment I make , IF Bearden Knew ,Why he lied so much about it and converted MEG into a pile of BULLSHIT
disinformation ? IF VTA was the TRUE origin of MEG work ? ( MEG USES LATCHING EFFECT of FIELD SIDE TO
SIDE alike IBM magnetic MEMORY cores ...
MAGNETOTRANSISTOR USES VTA ORIGINAL principle discovery.
Well Caltec and NASA Forum LEECHES and MIT bloodsuckers FEED on the exposed corpse! (Vultures Welcome )

5.19. About Tunecharger

The trick the chargers use is they "catch" the current. Assume, you have cap1 -> coil (L) -> cap2 setup and you switch it
exactly this way:
* When cap is empty and the current flow in L is max you disconnect cap1 and use diode to drive BEMF from coil L into
cap2 you would theoretically catch 99% of energy. The diode voltage drop and losses in FET's switching near the output to
90-98%. Simple. This is that JM thinks ;)
About OU systems the coil is very similarly switched like in tunecharger, but it is more tuned to anomalic region where
trafo sounds weirdly and BEMF in LC charging curve includes extra power from external "environment".
Ronald mentioned spark-gaps - it helps tuning the anomaly range as the spark is series of repetitive on/off signals
"activating" the core (Easer/Lasing effect). Chris uses the same principle in his plasma engine (zero spark suppression),
seems to be like motor, but it isn't.
JM, do I understand it right, does your latest tune-charger use fixed PWM/frequency written in software?
JMI: The charger #4 uses fixed freq and duty cycle. This is all documented here including typical waveforms (from scope)
and source code, see: /file/3rd generation folder here, March 2005 files.
The pulser section switching is slightly under maximum current, indeed.
Anyone can build a similar setup from given instructions and parts list and make actual testing. The "best" freq/duty must be
determined empirically depending on the inductor.

5.20. Ferroresonant Electrolisys & sonofusion

http://jlnlabs.imars.com/bingofuel/html/bfr5hpgen.htm
Just think: Eliminate the darn carbon rods use stacked capactrodes as hydrogen- oxygen generator and RV alternator as LC
sonofusion resonator .... (Be careful, Bingo can go “bango” in this mode ...)

Capactrodes: Water AC capacitors .... CAPACTRODE "Insulated electrode "

If Ac is passed capacitively across insulated plates, the inner insulated surface acts as electrode (Hector designed that
concept for COLD fusion…)
The Water disassociates within the charged surface region at n change x voltage z frequency within a given resonant NODE
in LC configuration within a given area ... water becomes its own electrode ... sonofusion easy attained in RF radiant modes.
If plates are stacked, the charge in series produces more gas than a single chamber using same current as in hi Q resonance
water becomes superconductor metal
Frequencies all harmonics of 23, to 24.8KCPS
Hydrogen is a METAL ... deuterium and tritium also ... compacted to Hydrogen 21 "SI21" it creates cold fusion ...
After normal water disassociates, heavy water remains in the chamber.
Why you think Mallove was killed for? (It was not for "planting Roses" HEHEHE ! ). He constructed a model, went
greedy, but choose very unwisely to whom he showed it to ....
I invented the capactrode concept trying to find a way to eliminate electrode wear in electrolysis gas generators and charge
purify water; its one of the 230 projects I have and I posted and explained it public long ago in this same forum ..

146
Shared with Mallove the more "deep specks" ....
I searched and it seems to have disappeared ... so copy and keep now an you can bet SOBs forum leeches are ready to patent
it ...
I used zaphyre, pyroceram, pyrex, glass quartz and other materials as well, concept works well and haves many Uses
specially in COLD fusion, where it can reduce the price of reactors dramatically ...
Use wisely keep public don’t go greedy, don’t get killed .... 3 PH resonant capactrode rotary sonofusion reactor is a reality
and is part of resonant RV LC concepts ...
100 W in 1000W out is average COP 10 but is not a toy , requires NASA Eghead brain to built (and I think even doctorate
level ones may still fall wanting ... )
But that does not mean you all can’t try the capactrode concept
IN DC is also a far out concept ... just beware of the Radiation blue light ...
Water does really strange things used as a "capacitor" dielectric ...
For your Information ultra pure water is NOT conductive ...
Under a charge it BECOMES a POLYMER ....
As a polymer it can be programmed to phaseshift into SHAPES & forms .. this responding to Human PK commands ...
in a few century you all can learn to use this ...... but not under this systems of things ..

You may recall the furor over the announcement in 1989 that two scientists had chemically induced a fusion
reaction without extreme temperatures and pressures. This so-called cold fusion was later discredited, mainly
because their results couldn't be duplicated in other labs.
Now, another approach could hold more promise. As in 1989, the initial experiments are being conducted using
small containers of liquid; however, there's nothing cold about the results this time. The new approach is based on
a process called cavitation, in which bubbles in the liquid rapidly implode, momentarily increasing the temperature
and pressure within the bubbles, perhaps to the levels required to initiate fusion.
Cavitation can be induced by bombarding certain liquids (specifically hydrocarbons such as acetone) with neutrons,
which generates nanometer-scale bubbles. At the same time, sound waves are directed into the container at one or
more of its resonant frequencies, causing standing waves to form. Bubbles at the antinodes (regions of maximum
pressure variation) expand and collapse at the same rate as the acoustic frequency, and as they collapse, they emit
flashes of light; this is called sonoluminescence.
Scientists at Oak Ridge National Laboratory in Tennessee realized that sonoluminescence might indicate fusion-
friendly conditions within the cavitating bubbles, especially if the acetone is laced with deuterium, a heavy isotope
of hydrogen that fuses more easily than conventional hydrogen. According to a recent peer-reviewed paper, their
preliminary findings seem to support this hypothesis. For example, they detected neutrons emerging from the liquid
that were clearly not coming from the initial bombardment — one telltale sign that fusion was occurring. They also
detected traces of tritium, another heavy isotope of hydrogen and a byproduct of fusion.
This process is technically known as acoustic inertial confinement fusion (ICF), but some refer to it informally as
sonofusion. Among those now working on acoustic ICF are D. Felipe Gaitan and Ross Tessien at Impulse Devices
(www.impulsedevices.com). They intend to develop commercial applications within the next decade. Their system
uses piezocrystals as the acoustic source, generating sound waves in the 10- to 100 kHz range. At any one of the
resonant frequencies, their reaction chamber amplifies the sound waves by a factor of 300 to 1,000.
If they're right, the sound waves we all use to make music could be the key to complete energy independence for
the entire world. Who knows, maybe your studio could provide the sound waves that allow a sonofusion reactor to
power your studio. Now that's what I call a beneficial feedback loop!

5.21. Energy saving bulb

Mike : Sylvania 13w "energy saving" bulb, 1 year old, electronic compensation for half cooked bulb now is 92 watts.. 13
watt bulb now takes 92 watts... so i suggest tanked incandescent bulb or led bulbs..
the bulb has an internal start resistor ( remove the shit and filament start caps ..
wind ox secondary with 47+ turns of fine well isolated wire ..

147
use as I originally designed it ( tune with series cap to resonate the mother )
1W lights 8 footer tube to full luminance ....

5.22. Plasmatronics
Davidkou: Plasmatronx.gif in the ARK Research folder of files section is the schema I'm trying to replicate by hacking the
kit circuit a bit.
I've removed the mains voltage doubler section (C2&C3 in kit)
because I'm using a single trannie 12V mini-inverter to ramp up a
high voltage on an external test cap (which can be swapped for
different types and values from 1uF to 100uF).
In the kit, I've also reduced C1 (trigger cap) to 47n, the 220K voltage
divider resistor to about 3 Mega ohms, and removed the lower
voltage divider resistor 390K. This is in order not to draw too much
from the main firing cap, without changing the time constant too
much.
The kit circuit is automatically triggered, but a manual override can
be achieved by temporarily disconnecting the feed to trigger circuit.
The test coil is placed in between the main firing cap and the hacked
kit board with Xenon and neon trigger circuit.
At the moment I'm playing with different test coils and recovery
diode arrangements and will report findings in due course.

Remember the values are targeted for resonance ..

in resonance the goal is hi Q (hyper Q with low decay loss) ....
In Iron core the idea is to use the aether-energy tensor within the iron matrix to extract energy from the medium (ferro
resonance) and transferring such to the system output as acquired OU energy ..

5.23. Lighthouse gen

Norman Wootan: I just ordered some neo's from K&J Magnetics to build Kone’s simple little lighthouse fan gen. The
magnets are the RX04XODIA which are diametric magnetized and are 1 inch dia. X 1 inch tall with a 1/4 inch bore. Right
cylinder mags that can be mounted directly to the fan motor hub and run perfectly balanced with a very powerful revolving
mag field. I'll write up a report when I get it running and get some advice as to your pickup coils. I have a large number of
air core coils to use on the gen. With a smooth cylinder shape magnet we can mount the pickup coils in any configuration
and air gap that we want. What do you think of this approach??
If coreless coils are seeked use a flat rotor from a PM coreless car fan motor (111) phases, the core can be machined out and
wired in the center using a jewel soldering mini solder.. 111 fine wire terminals can be brought out across the center and
taken to 222 111 + 111 - 111 phases bridge hi speed switching diodes RF capable ..
the combined output will exceed 80 amps at 18VDC (hi speed)
Using Nb grade 60 in the rotor will take the little UFO gen to 100-200 amps range

148
6. Other info (related & not-related)

6.1. Other
Keep the notes as definitely they will be understood and verified in the future ... UFOs run on 3PH looped self induction
power. My DNA also runs on it... As anybody else’s can also be modified to do so. Energy transfer comes from WATER.
Was it Jesus that mentioned the Rivers of Living Water?

So we take a millimetric microwave signal that vaporizes carbon inside water and we have instant fuel ...Using powdered
COAL,
So with that logic, if one would blend a mixture of coal dust and water, feed this to a combustion engine, and replace the
spark plug with a home microwave magetron........presto. Yes? I’m interested in this idea. If the electrolysis anode/cathode
method proves insufficient, my next move was going to be microwaves.
By golly Hector, maybe you're on to something. I've already got the generator, engine, etc.....the whole setup. Only thing I
lack is a bag of $$$. LOL
-or-......just throw it into a bucket of water and press ON. See what happens. (a tiny itty bitty bit)
No, just transformation from one form to another but if the self (people) are not transformed I don’t think the ambient of
slavery will change with any technology ....A meter will be put to it...
Today is WATER, tomorrow is AIR ... pay per breath or die.
Maybe what is needed is take a look again at Niagara Falls and ask HEY! There is energy there to power all the WORLD by
wireless means! Why we must pay with BLOOD for petrol? Why we must BOW to a corrupt minority enslaving our lives?
Those are the right questions...

hamey34: With the motor running with the fan vents open it draws about .75 amps (96 watts) read with an analogue clamp
meter 5amp scale Voltage 128 volts. With the fan vents closed amps read about .4amp (51 watts). I am pleased with these
results as they are in line with the results of others.
You will be more pleased if you Study the EFFECT covering the FAN had in the RV ... This principle is the ONE
REQUIRED for the THERMODYNAMIC TURBINE REACTOR Tesla Proposed 100 years AGO....
To put a hurricane in a box generating energy from Ambient heat...
As RV this is "Another Toy" but is quite more expensive....
From that moment on I need an Army to protect me..... as that is true energy from the vacuum... and is mechanical in nature
....cyclone vortex energy ... "Absorbatron engine" Thermal reactor converter.
Just ask WHY motor energy needs go down as you cover fan and HOW the Thermodynamics LAWS can be "Raped” with
it using "gravity”!

Another "Murder attempt" was performed on me; it will take a bit to restore molecular cortex integrity using XL100
technology...
What was the kind of the attempt? BIO/EM/CHEM? Hope you fine after the XL100. Btw. what’s the XL100 tech? Some
EM used to restore DNA structures or something more advanced?
BIO - EW mix ... XL100 is transdimensional cyborg technology.
Just remember the Physical is result of the Morphogenetic fields projected by the energy hologram into the biological
structure.
Repairing damage is done at energetic level, like sample RADIATION doses of 200 rems transfer the energy by means of
the water to the hologram damaging it you reverse the hologram to create water fusion fission the damage can be repaired
regaussing the hologram field.
Transmuting SI 21 isotopes within the body creates COLD fusion; reencrudation is possible within a time space closed loop.
(Repair is possible)

149
The US army made experiments substituting human blood with fluosolType of Oxygen carry chemical ... resistance to
radiation was 1000 times over normal as there was no water to ionize .... blood was then restores and liquid removed.... due
to the strong cocroach smell the reactions to it were sometimes severe (allergic). The experiment was discontinued
afterwards..... the inspiration was the roaches resistance to ionizing radiation,,,,
It’s the water IONS that kill. no water. no cells killed
In Chernobyl the people that where partially dehydrated survived more than those "watered up”
Reconstruction of damaged body requires phase shifting water molecules into biomorph regulators ....more easy to say than
do, (I am still alive) & 98% functional that is what matters...

The 2.4 GHZ wireless LANs are killing people (disrupting water based fields retransmitting Evoked potentials to satellite
.... (Use other frequency) in work or home...
Microwave Ovens are 2.45.... Wireless lans are 2.4 t0 2.8 more damaging as they sweep within neurocortex resonance
retransmitting the evoked potentials, Humans become Gamma guppy (passive encoding retransmitting tags ) to be picked by
Stargate and the WIRED (Matrix) intelligence system .
2 systems are Used, the CELL phone ALMS system and iridium sat-sat.
The Pattern of each being of the planet can be scanned and detected with capability for interception, with suprahuman
development you can fight back, but with population still in the Stone Age the few with this technology are Gods in control
of every being...
Too bad they don’t have the wisdom Of Gods, when the magnastrom awakes they will be fried along with their little God
wannabe toys ... The Universal LAW is quite unforgiving with that kind of beings.

Looks good. 2 magnets and six stators. Wiring diagram for 3PH is as > below.
http://www.reliance.com/mtr/images/mtfig11.gif
Haven't tried this for myself yet.
No! LOOKS quite bad as this design is self shunting to produce loss
The power factor figure 96% proves an inherent phase imbalance due
to interpole cross phasing...
In a true PM 3Phase Synchronous motor the Phasing power factor is
UNITY or LEADING 3 to 7 % as a minimal.
The EFF factor going over 96% minimal.....
Check wiring pole setup ... (OU Inhibited) they better come up with
better stuff ... that is why I suggest to BUY our own motor manufacturer...

Muller RLC circuit drawing

It’s same as a reactance driven transverter dual LC voltage node cancelling circuit...
Study RF rules for signal cancellation...
You get power nodes where it occurs, where electron density varies within an area, you can tap a DC potential from the
standing wave component being much stronger potential as the signals creating it (ZPE) dam! So basic!

Smith patent
Make one as Instructed in patent and if it uses 1/20 of the power in idle mode it can be challenged as Smith patent is based
in OLD expired Rotophase converters and RV disclosure predates it by 20 years (Ask Norman Wootan If you desire to)
A Rotophase Differs from RV mode in IMPEDANCE, Voltage, and current, operation & transformation theory.

150
A motor Operating under Smith patent will use stated plate current all the time, the difference is RV uses near no power as
long is not loaded, and acts as a transformer with derated HP ... (standard mode).
In PM modes HP can EXEDE the non PM original motor power 10 fold and 100 fold using Frequency control &
pulselength control. Every time I had answered the same Psy ops intervention in various forums and the darn thing pops up
like a turd that stubbornly refuses to be flushed down. Go to Keely Net, A darn Floater!

Common Earth is 23% Iron, red earth has more of it use a plastic bag over a magnet & pick it up wash it with water to
separate detritus. 94 % pure non-ionic silica iron will result...
How to solidify ... dissolve Styrofoam in cheap gasoline or paint thinner until thick as honey mix with iron powder and let it
solidify to a hard plastic inside a proper mould

Rain Järvelaid: My new resonant motor tests can be found at

http://www.schetelig.ee/~raivo/rain/230703.html
Also linked at www.hot.ee/raj

Suppress calcium totally in a chicken diet, provide potassium only diet. The chicken Fusion-fission engine turns Potassium
to Calcium in transmutation Hydrogen fusion-fission reactions.
Search Key words “Biological transmutations”
Some Lead & mercury poisoned goose laid golden Egg "shell containing gold' This usually after Eating Earth containing
monatomic elements called ORMES ... otherwise known as phylosopher stone .
Key Words Ormes, monoatomic gold, ORMUS, transmutation, alchemy.

THE US military is funding development of a weapon that delivers a bout of excruciating pain from up to 2 kilometres
away. It consists of electromagnetic pulses emitted by laser induced plasmas". It concerns so-called Pulsed Energy
Projectiles (PEPs), which fire a laser pulse that generates a burst of expanding plasma when it hits something solid, like a
person (New Scientist, 12 October 2002, p 42). The weapon, destined for use in 2007, could literally knock rioters off their
feet.
It is 24.5 GHZ MASER not laser ....it’s 10 times up of your microwave oven frequency
It just overloads your skin nerve endings the same way as a CD burns when put inside a microwave oven (surface skin EM
effect)
countermeasure are easy , full body tin foil suit ...and eye ear and mouth fine metal mesh protector , you are protected by
faraday cage effect ... house metal screens can do fine also ,stainless steel being the best ...
RV& RV alternator is EMP EW proof ... driving TUBE radio it can mean survival while others die off....
Communications are the key to command.

If it can be done before Shit hit the fan the better, Remember the codes I gave long ago ... K11 (911) = 11 = K +
7/7/(2005=7) = K777 21 days to go RV must reach President Bush desk but is not up to me but to the people out there that
can Understand above and beyond normal eyes. (Those are hard to get ) Idiots rule the world ...
Chevron 7 locked 2 more to go ... than means of 9 seals 7 had being broken (timeline events that dictate human evolution)
the atomic giant is to be awaken. (Watch the Wires)
Karma can be negotiated, it’s up to them to take chance to do so.

Raivo: About making car battery deep cycle: According to Hector - add _about_ 2 ounce Cadmium Bi Sulphate into the
battery. If someone tests it out or find more info about it let others know.

151
Resurrect gel-battery: Vector an RV alternator dc output into it, use VR6 cadmium bisulphite solution to reverse sulfatation
was possible ...just be careful with fusion reactions.

Kone: Pop a big neo magnet down a copper tube (or nickel if you can find one) and you will see how conductive metal will
slow down the drop of the magnet as an experiment.
On this same line cut a line "gap" down the metal pipe the magnet will fall with 95% less resistance.....
the pipe "ring" short to m field was removed ... A rod within a rod spun at right "tensor" will be negatively inductive, a 4FT
long tube can generate 3000 amps at 15VDC as I get funding I can demonstrate this postulates I can tap the atomic spin
atomic engine itself ...
I attained homopolar reverse induction making copper magnetic super resonant conductor at 0 cycles per second
resonance....
Using no magnets..... Only ("reverse induction”)
The sinewave is a flat singularity within 4D space where power becomes a linear differential within 2 points in node & anty
node of its linear construct.
Variables are magnet gauss , tube material and density & impedance , and I don’t feel up to explain rail gun design when
you people are still stuck lock in atomic drag issues .....
Reread Raivo postings and my comments on saturation and drag issues with super PMAs generators...
Don’t get stuck on a pipe dream.... Understand what I am trying to tell and reach a point of understanding as you can drive
any generator OU with its specific MAX Q point on Core mass MF intensity and IMPEDANCE relation...
Key "Alightment" read Hall Effect and room temperature superconductivity (magneto-thermo nuclear cooling)

Eb: Have you noticed the amps go up more when you load the coil with a resistor vs. shorting out the coil? (in Kone gen)
Raivo: One thing that comes to mind is in vitro tested postulate that LC draw amps in primary are lower than RLC.
If you have RV and you have LC resonance in an alternator - RV prime mover takes lets say 1A. If you add a resistor that is
RLC you will have RV input 1.5A. It is explainable by simple resonance theory.
So coming back to you coils - your coil may have virtual LC inside it. If you short it you have LC. When you add R you
will have more draw in an input as you said. This is the ONLY explanation for now how you get this anomaly.
One way is to test your coils from 10-1000hz and graph the impedance, so you will detect its L and inner C parameters. It
may have some internal "semi-resonance" at that RPM freq that allows this anomaly to happen.
I think I had tried to teach how to create this "Anomaly" for 5 years.... (RV alternator is this anomaly in vitro)
Read Ampere load postings ... reread posting on resonance broadband and narrow banded Q issues and Q core gain & EMA
stuff. THIS CONDITION is the ONE NEEDED TO CREATE OU...

Getting OU is easy taming the tuning is a pure bitch.... but you are not alone getting stuck on the RLC is normal until you
can get the bitch on heat and start making hush puppies......
THINK of PM- LC and (R) load as a single related unit, think of turning R into L, as if shorting coils...
Remember also you will be fighting an army of PK trained operatives that will try to erase your brain of everything you had
attained...
Things to Watch burnt plastic smell (as ROCK aspartame or Explenda, inhaled it erases short term memory and fucks
frontal lobe .... (Its PK teleported to your nasal system.
The enemy is the one in silence.....

Ed: when you connect two diodes (same type) in parallel what can happen is know as current hogging.... look at the forward
voltage vs. forward current on the data sheet below.... when the current goes up in the diode that came on first the forward

152
volts of that diode goes up as well... when the forward voltage of the diode that turned on first gets to the turn-on voltage of
the other diode in parallel ... the other diode starts to conduct.. So what you end up with is current hogging, both diodes
come on but the diode that came on first hogs more of the current...
Not only hogging but gunning (Gun diode) they oscillate in RF mode modulating current and voltage.... That is why they
must be MATCHED PAIRS (same reverse resistance) they are usually worth ten times the normal ones price.... As is one in
300 shot to one to match a PERFECT 4 zero tolerance figure using digital DVM pair matching measurements.
So start buying them Bulk and match in the different values in 1K of diodes you may match a perfect 50 pairs 10% or so ...
in different values and a quartet or matched trio ... Exact value 3 to 4 in 1,000 approximate.

Things to "peak" remove drain resistors in Inverter circuits where possible. Use regulator chip for electronics instead of
energy sucking zener and VD resistor ... On HV side the same, optimize and reduce loss...
On generator, start dumping the output to the battery across the shunt start comparing power input and output until you get
it to OU...
FORGET ABOUT DUMPING POWER in RESISTORS start dumping it in a looped system ... NO is LOCKED OUT, and
is small token of shit hitting fan dynamics adding WW III to it...

There are only ten different types of people; those who understand binary and those who don't.

interesting experiment is put 3 wire turns around 2 inch plastic pipe in line of the vectoring capacitor (running) and use Nb
magnet to series mag tune the cap ... as and OLD type radio Plunger Core tuner .
Remember this same effect you get on an OU system generating LOW cycle per second hyper waves. Similar to 2 VFO
tuned frequency beating in resonance; ED got same effect on loop trials.

Sample as Bedini, Newman or Muller motor setup....

A magnet Approaches a COIL. (With a Core)
As stated in Ecklin brown Concept a magnet Attracts Iron 7,000 times to Air.... so a rotating magnet is attracted to the Iron
in a core...
As Explained by my person in PAST postings referring to POWER FACTOR correction, a minor field attracting a mayor
one becomes a source of energy. "See Synchronous converter theory apply to RV theory” That Is EV GRAY EMA essence
...

Ken: Bill's latest Paper is an eye opener. It connects complex numbers to hidden dimensions of free energy, space and time.
I always thought the appearance of the square root of -1 was a strange thing. The presence of 2 complex solutions in the
quadratic equation for an RLC circuit manifests resonance (radiant energy). If the solutions are real - you have no
resonance.
ax2 + bx + c = 0
x = -b +/- sqrt (b2 - 4ac)
2a
your doorway to other dimensions.
There is more to it, Seike formulations are doorway to understanding this...
Square root of one is a new region of mathematical realm that needs to be adjusted also the primitive digital computers of
today must be replaced with analogue sine integral ones...

20 HP,1765 RPM,3PH,60Hz,575V,TEFC-M&C,IEEE45; USCG 259 Below Deck, Prem Eff, FM,256T,1.15 SF,F Insul.,40
C Amb.,Tropicalized,F1 Box, Stainless Nameplate, All C.I. frame, Baldor

153
Its nice to convert to PM rotor, the reactance relation to mass is relative hi over 10HP and results in lower torque, but other
characteristics can be used to advantage. At that price that motor is a gift, will make a real eye pull out of socket demo
working from a car battery ., may require to use soft start at 48VAC then go to 100-120 AC as rotation is attained then work
on the pheaking issues , Bearing grease friction, internal losses (fans)& Fins.
A real nice real world tool in hi standard industrial grade.
If going PM be sure to select proper magnet intensity as not to go over saturated, as to avoid drag issues and calculate well
the interpolar distances to avoid parasitic harmonics...
"I love stainless" be sure to first exhaust all Use as Is experimenting before doing irreversible changes and alterations you
may later regret ( Play Safe )Optimize on power management that opens way to ZPE ..

All fuel contains WATER, magnet Polymerizes such to fuel changing an oxygen bond to extra hydrate one (pair).
Use PURE water free NAFTA and MAGNET does nothing as there are no water molecules to form hydrite pairs (they
reduce evaporation and slows burn temperature and creates more vapour pressure.
But for a 3% savings I rather Lean the Stuff and use firestorm V.2 plugs (still cooking somewhere)??

Our visible spectra ranges from red over orange, green, yellow, blue, indigo to violet. So, my simple question. Why we see
violet, the last colour, in a sense like a mix of the colour before (blue) and the very FIRST colour (red).so in a sense, it
results in a closed colour circle...but in reality it is no circle. In reality that are just ascending frequencies.
Because it is a higher octave , a harmonic Lower an upper can be sustained within a fundamental like having a motor strobe
lighted at 3800 RPM shows single spot try 7600 RPM (you get picture) .
many engineers had made BIG mistakes by ignoring multiples that is why you start in lower strobe settings and until you
hit Fundamental (no multiple images of strobe Mark), light is similar as any other signal where RED ends the higher "red"
starts, Is it really Blue ? Or the darker colour of a superior dimension.
Think (OCTAVES)

Konehead:
Tried out shorting straight across a single generator coil with a big 10W magnetic reed switch - both leads of the switch on
both leads of the coil, and the switch being turned ON from OFF normally but the 32 N-S rotor magnets - the switch is just
held by hand about an inch away, and timing of switch adjusted by just moving it slightly. This created a lot of plasma
inside the switch, and also made more watts output measuring with different resistances across the DC of the FWBR...
From 7 watts with no switching up to 10W with switching for example with both tests and same coil, (20 strand 36GA litz
w/ferrite core of 21 ohm resistance, diodes and cap, (400V rated FWBR, capacitor is 47uf/450V)
This was the first part of the test, after looking at it and comparing switching the "coil shorted" to no switching at all,
I then hooked up the magnetic reed switch to switch ON from normally OFF but this time from the FWBR positive output
lead into the capacitor (no resistance) and did this by running the reed switch in series between the positive of the FWBR,
and the positive of the cap...When I did this, the volts into the cap (normally 38VDC with no resistance) instantly became
158Vdc, and climbed to 280Vdc in the 47uf/450V cap and then settled there.
I brought this voltage down with resistors, and when taking off the resistor, the volts would climb back - looking inside the
reed switch was now not lots of blue plasma like the previous short-out test did to the switch, but instead now small purple
spark as the reed switch fills the cap by connecting the positive DC out of the FWBR to the positive terminal of the
capacitor (easy circuit - chop the pos into cap)
So this was really something - to get a hold of reality I then did some resistor load power tests with this time switch the
resistance across the capacitor with meter leads across cap, and the switch is between the neg of the FWBR and the
resistance, with the other end of the resistor attached to the positive leads of both the FWBR and the cap... (Switching in
resistance across cap with switch in series to resistor from ground of FWBR and cap)
Tests with pulsing-resistance across cap:
20VDC @ 20ohms

154
34VDC @ 30 ohms
31VDC @ 180 ohms
Compared to just resistor only across cap:
14VDC @ 20ohms
17VDC @ 30ohm
26VDC @ 180 ohms
anyways both my meters had blown fuses so I couldn’t look at input amps while testing this, but the original idea and reason
for pulsing the load across the cap, is that then you can cut Lenz latch to the rotor so you have less input draw...it is
surprising how much switch can make the capacitor rise in volts - not expected but it happened...probably duty-cycle would
need to be calculated to make the resistive load numbers more down to earth, (or not)but the cap going up to 280VDC was
real, and it would seem that the switch and its timing was helping charge up that cap by collecting some normally in-the-
way backlog of back emf or plasma..

Thing to look is Norman Wootan Posted OU readings from RV long ago , but Who truly had taken a serious look at the
simple original setup and Using properly matched and Lenz loss corrected STANDARD generators had repeated it ..
Ark files first picture.
The answer is simple , in a PM generator Logarithmically charge a CAPACITOR to joule potential under half resonant
diode rectified state (as transverter plug does ) ,
That kisses the goddamed greed goodbye as whoever likes it or not that is the secret to overunity,
An LC & some diodes (Nothing more ) in whatever mode put in whatever complex combination computer driven
electronics, parallel series Inductive capacitive networks fact is OU is in logarithmic gain encountered as a magnetic energy
component is converted to a charge in a capacitor under resonance state..
Also is contained as quantal charge of linear polarized electron tunnelling permanently charged materials, (Hutchinson
battery and electrets)
Capacitors (OIL & film) tend to HOLD a remanance charge (permanent if not reversed ) in Unipolar forward switching that
charge contributes as OU energy (from atomic polarizing tensor energy (Kemio) .Phil WORK well enters in this Area as
Metherninka TESTATICA does .

The Idea is as in Solar energy applications you can tune motor to be a power on demand device (using 12-50W ) and being
able to deliver up to 1.8 HP with effective eff of + 97% and having 90% minimal energy savings on idling time ( machine
tools ,lawn mowers, Pumps , saws , log splitters , ( Solar Home workshop ) drills, lathe, whatever... (Impossible with
"standard" motor setups ...)
Other Use is as R&D tool, REVERSE dynamometer...
If your generator is OU RV will tell you ... (First ever to replicate and DO this was NORMAN WOOTAN with 3HP GE
motors)
RV is a bit I may say more "Cost effective" and practical. (It’s not an INVENTION but a discovery, (RV) method to run a
motor in impedance matched lowest energy expenditure mode. Electrical to mechanical energy conversion at lowest power
loss - SEMY resonant & resonant states to source. Completes Tesla’s teachings on resonance and tuning.

Any generator (brush) type can be converted to a Gray motor and be ARC gap commutator controlled to get RF radiant
energy effect Why you need this?.. ANY motor or generator can be made RV type motor-generator electric turbine using
also ZPE radiant energy modes. It seems there is this tendency to mirre in obsolescence instead of going next step....
Go simple go cost effective...
Use what is at hand.... (ZPE is there waiting to be seduced)
Just remember most of the statements I have posted in the last 7 years had being validated and with irrefutable lab proof...
Those Harbor freight generators can be made into Gray motors add a ring brush to the rotor (EM) and play with the ac and
pulsemode combinations (limit it to 4,000 RPM and you are OK)

155
No need for a $10 million proto when you can build a full ZPE lab under $10K ... (the cost of a Newman motor) using off
the shelve stuff.... (Anyone can make an RV) I think with the same mindset anyone can built a Gray motor Or I may say use
same principle in a more efficient cost effective platform...
The experience Konehead had acquired with the pulse motors is fully applicable to this cheap already made generators ... try
the voltage impedance combinations in semi resonant modes using CEMF recovery methods. 3ph generators are more
effective (120 deg) pole angle resulting in a more effective 90 deg pole pull-push magnetic force vectors...
Power slavers (debunk that)! How it was? A 30KW generator running at RV /Gray mode using under 8 amps? ) most of the
preliminary testing has being done here already on what is needed to get these things to run. (Easy)

Heavy water takes more energy to electrolyze than normal water.

Top secret is that the non electrolizable leftover on electrolysis chamber is PURE heavy water (di Deuterium oxide)
Nuclear Terrorist wannabees here now know! (Enjoy)
BUILT YOUR own ghetto apartment bathroom nuke plant breeders to make plutonium!

Phil: So just like a transformer tuned for the mains frequency it uses virtually no energy unloaded on the primary (water
balloon). As we apply a load to the transformer secondary (floating ring), our primary wants too rise in frequency.
The primary also wants too raise in voltage also, but because we have it all clamped at the mains voltage and because our
frequency is now all wrong, we now are consuming current.
This water-bucket system is a really good explanation of resonant effects. And it is actually the same system how H's RV
works - when driving a 400V-wired motor with 110, there is plenty of room for magnetic fields to grow without saturating
the irons. Basically RV primary works in current-resonance mode, amplifying the torque.

3 is the number that is a balance in the universe.

Please study hard the Rodin coil.
HYPERLINK "http://rodinaerodynamics.org/"http://rodinaerodynamics.org/
It is all so simple, 3, 6, 9. "Three numbers", 3 + 3 = 6. 6 + 3 = 9. 3 + 9 = 3.??? Because 12 = 1 + 2. We are now back too
the beginning.
What you have is a universal equation where a coil like that has been tested using Rodin's formula is already been proven
too be OU by the big guys.
Taking this a step further, and as I have explained too people like Raivo Ed and Ron many times, when I design a circuit,
and it is too say operate on 12volts, I do not use 12volts in my formula. I use plus 6volts and minus 6volts and a centre
dipole where these branch out from.
So there are 3 legs that we rotate around and work with.
The centre dipole is the number 9, and what pressure is applied on 3 and 6 being in any conducting circuit applies the same
pressure on 9.
OK, I will keep this simple. With a standard generator they only think whilst designing, with 2 potentials being an AC
current and or complicate with 4 potentials or more, adding the Lenz effect eddy currents and whatever they can think of.
All you need too do is look at nature and fine tune the motor and or generator too work naturally without brute force.
Ok, it is simple. We use a natural magnet attraction (9) then this generates a voltage (3) the Lenz effect on entry is (6).
Finish it there. Now as the magnet is trying too leave this coils core another magnet is attracted too another coils core
somewhere around the rotor.
So can you all see that working with 3 numbers and 3 potentials means the attraction, the wattage generated, plus the Lenz
effect are all the same energy potential. They have worked together at the same energy level and it is a balance being it
really cost us nothing in rotation too have an energy potential.

156
Ok, another secret is a one way valve. Just like a diode or the Tesla valvular conduit you want this entry too be your bonus
but no pull back or a resistance on exit from the magnet.
This is where we want a balance where another magnet is being attracted too a core whilst our previous magnet is exiting.
Remember that our previous magnet exiting has no Lenz effect, Eddy currents, because we have switched off any generated
output and left it alone.
It is just like a 3PH motor or any AC motor where there are 3 potentials too work with.
Get a thick piece of Aluminium and sit it at the end of a coil. Energize the coil and watch it blast the Aluminium away.
This is why as I have said before too you all, an AC motor rotor works on an energy pulse (3) causing attraction too the iron
sections (9) and repulsion against the Aluminium sections (6), at the same time.
Reverse all this for generation, and have attraction (9) balanced with 2 other potentials being (3) and (6).
Now I have dug a very deep hole for my self, it is best I stop here. LOL.

Subject: Re: BAP 23nob06

Attached is a bullet proof circuit for your Bedini motor. It can take just about all types of sensors being Opto or Hall or
mechanical. The circuit also has an adjustable pulse duration, and full BEMF recovery. It will operate from 12 too 24volts
as well.
With Mr. Adams coil and magnet size's I don't recall any specific geometry, except he was strict on the fact that the coils
should be wound too a resistance where, say a 12volt source was used, the coils should just have enough power too
neutralize the permanent magnet.
First I found that square magnets are bad where the corners leak a lot of flux.
So from thousands of tests this is the formula that we worked out. With a 25mm diameter round magnet, my core diameter
was 16.6mm. Well actually we went for 17mm too be exact, but it always showed the best sized OD of a core was 2/3 the
size of the magnet.
Hmm, I remember now also Mr. Adams core length. He said too do the paper clip test. That's where you measure the
distance where the magnet will just start too pick up the paper clip off the table, and that was the core length.
Ronald, when you get the 16/24 motor jigged up right you will be in for some surprises. The magnets will not attract too
your core centre.
For a little test this is what you do. Get a piece of glass and place a magnet under this, then get a steel washer with the same
size hole, as the hole though your core and the washer should be the same size OD as your core as well.
Then slide the washer over the magnet on top of the glass, and what you are looking for is where the washer just starts too
levitate directly over the face of the magnet. Sometimes you will see the washer kick up a little on one side and leap off too
the side. Now, it may mean putting some thin shims of cardboard on top of the magnet until this happens, but this is your
perfect air gap.
Don't worry if the air gap is anywhere from 4 too 7mm as there are some other wonderful things that come from the hollow
core. What you will find is that the magnetic flux vortex's too a pin point at this exact air gap distance, at the right voltage.
What you also will find is that there is no magnet drag.
Ed, has built a very nice 16/24 motor, and when he turned it by hand slowly, said he felt some resistance. But I told him too
now spin it a little faster and watch again. He replied back I was right as the rotor becomes free.
Now, in this mode you are in for serious Horse Power and efficiency, but this is where the circuit takes over where you have
near unlimited RPM so, balancing of the rotor is very important.
So even at idle there may only be one coil bank that gets a little tap every now and again. But load down the shaft at idle
and you can not stall the shaft. The processor will adjust the timing and pulsing to prevent the shaft pulling back. With a
scope you will see the battery under this load drop say 2volts then boot 2 or more volts higher than normal.
So Ronald, if you want to, you can run the circuit attached and change this too the Adams principle by just closing the air
gap. This is how it originally started and was always OU.

157
But the difference will be that the core registry will be where it locks between a North and a South magnet, and you will
"not" have high torque.

Hi Peter, I have uploaded to the photo section how I calculate the core and magnet sizes and also core length. You can move
around with the measurements somewhat so just use this as a guide.
But this simple formula has been tried and proven and used in many motors, but where the ring magnet was latter removed
and the outer sleeve modified for interacting with the centre magnets only.
The centre hollow core I developed for a new type of coil magnet combination, and too prevent the magnet registering in
the centre of the core.
You will have more pushing distance with the hollow centre core, as it has a tuned distance where the field forms a focal
point. An example is where one of our electric motors had an air gap of approximately 5mm.

one way is too use capacitors with the generating coils so there phase shift begins too more so allow only voltage potential
charging, taking a lot of the Lenz effect out.
The voltage taken from the capacitor to a load should be no more than 1/3 of the fully charged capacitor. Also it is ideal if
you do not pull anything from the capacitor when the generating coils are trying too top them off, at the peak of the coils
voltage output.
So a simple circuit that monitors the coils wave form, and when at its lowest voltage in the wave form, and then dump 1/3rd
from the cap. Load matching is simplest here also.

Originally posted on Schauberger groups by:- Esa Ruoho, this may be of use to you builders.
Keely atomized water by using a specific sound frequency. He listed many different frequency vibrations, some of which
are listed in Living Energies.
"To obtain some insight into what may be the relative magnitudes of the various levels of energy or vibratory energetic
matrices here involved, it may be enlightening to refer to comments in The Secret Doctrine7 concerning the 'Keely Motor', a
free-energy device constructed by John Worrell Keely, which operated through the creation of a 'neutral centre', or in Viktor
Schauberger'-s terms, a 'biological vacuum'.

We are told that Mr. Keely defines electricity 'as a certain form of atomic vibration'. In this he is quite right, but this is
electricity on the terrestrial plane, and through terrestrial correlations. He estimates:-
Molecular Vibrations at 100,000,000 per second
Inter-molecular vibrations at 300,000,000 per second
Atomic-vibrations at 900,000,000 per second
Inter-atomic--vibrations at 2,700,000,000 per second
Aetheric vibrations at 8,100,000,000 per second
Inter-aetheric vibrations at 24,300,000,000 per second
(ED: note that these are 3,6,9 in effect, see below for 3,6,9 on Keely and Tesla (also Rodin math has correlations to 3,6,9, or
so it would seem according to Horowitz's "Walk on Water" book)
The vibrational level of the so-called ethericities would probably lie somewhere between the inter-atomic and inter-aetheric
in the above table. Moreover they may well function at frequencies that can be beneficially or detrimentally affected by
human thought. It is a known fact, for instance, that the level of white blood corpuscle production can be significantly
influenced by the positive or negative attitude towards life of the human host.
The extent to which the collective human psyche may influence these ethericities and their proper function may well be far
greater than we imagine.

158
going through what I’ve compiled on Keely at the peswiki powerpedia page on him, here are some things related to high
frequencies and molecular disassociation of water:
HYPERLINK "http://peswiki.com/index.php/PowerPedia:John_Keely"http://peswiki.-com/index.-php/PowerPedia:-
John_Keely

From JoesCell2:
Professor Keely found that water will explode at a frequency of 42,712.2 Hz. ... did it with a Quartz Bowl....Think Quartz
and how symmetry applies to magnets because that is how quartz crystals are formed, via symmetry. The 42,712.2Hz was
applied to a quartz bowl with distilled water at which time it EXPLODED and disappeared. After this experiment Keely
began studying geometric shapes that hold these specialized frequencies which can manipulate matter and the mind. So the
power of the mind possibly can be realized by the special shapes that Keely discovered from special frequencies. If you
know how this works you wouldn’t even need a Joe Cell to make power and after a while not even the special shapes
because you could use your voice. I will add that if you want your Joe cells to work better place it on a 10 or 12 point
tesseract made on copper foil. You can get it at lowes home improvement in their building materials section.
Verification of frequency to produce aetheric force from water?
A recent (1965) possible verification of the frequency Keely used to dissociate water into aetheric force was related to me
by a scientist when we were discussing certain aspects of free energy. He wishes to remain anonymous for obvious reasons,
but his name is on file. I have no other verification of this experiment, however I believe it merits telling. The scientist, I
shall call him Dr. X, was doing experiments with ultrasonic sound in a column of water. The object of the experiments was
to devise a means of separating various densities of materials by injecting them into a column of water which was subjected
to an ultrasonic standing wave vibration. The experimental setup is sketched in Figure 3-3 (for BBS considerations a
description follows). A Barium Titanate ultrasonic transducer was fixed to the bottom of a [quartz tube] which was closed at
the bottom and open at the top. Pure water was poured into the tube and the water column was "tuned" so that a standing
wave was produced at 40,000 CPS (cycles per second). The transducer was powered by a 700 Watt power amplifier which
was driven by an ultrasonic frequency generator. Because of the large amount of power put into the column of water a
certain amount of evaporation took place at a constant rate when the transducer was energized. Therefore, to maintain a
standing wave in the water column a feedback device caused the frequency to be raised as the water evaporated and the
temperature changed. As a test, Dr. X decided to run through the experiment with only water in the tube to ensure that a
standing wave was maintained as the water evaporated and the frequency rose higher and higher. When the experiment was
started everything worked beautifully. Dr. X took periodic readings of his instrumentation and was assured that the standing
wave was being maintained. Suddenly, with no warning whatever the water disappeared from the open quartz tube. He
looked up thinking to see the water splashed on the ceiling when to his amazement a clean hole went right through the
ceiling. The hole was the same size as the inside of the quartz tube. Further investigation showed the hole continued on
through the roof also! Dr. X checked his notebook and found the last frequency entry to be 41,300 CPS. It was shortly after
this that the water disappeared. Because of the time interval between the last reading and the disappearing water, the
frequency sent to the transducer was higher than the last reading and Dr. X said it could well have been very close to 42,800
CPS, the Keely dissociation frequency. This obviously dangerous event caused Dr. X to dismantle the equipment and try
some other approach to his problem. This experiment points the way to the use of our modern technology in conjunction
with Keely's laws of dissociation to change matter into energy without the use of radioactive materials or extremely
expensive atomic accelerators.-"

Modern science and Keely

Keely reported disintegration of mass with standing waves (which is now a commercial process),
Keely reported producing light in water (what is now termed sonoluminescence/ triboluminescence)-,
Keely reported acoustic levitation (verified by NASA and others) though Keely went FAR BEYOND this brute force
technique,
Keely reported geometries that could intensify sound pressures without adding additional energy (recently patented and in
use by MacroSonics)-,
Keely reported cold in the presence of certain 'orders of vibration' (now patented as an acoustic refrigeration and cooling
system),

159
Keely reported that sound could be used to heal the body but went further saying the 'convolutions of the brain' were
knotted or restricted, resulting in all manner of physical problems when the nerve energy was restricted, this is still
unproven as modern medical researchers work on the EFFECT rather than the controller (CAUSE) of the brain, that will
change as more people begin to experiment in this area.
Magnetic Resonance Amplifier
With low-level ultrasonic input signals, the Magnetic Resonance Amplifier (MRA) produces usable direct current power at
levels above unity. This circuit is based upon the work and theories of John Ernst Worrell Keely, and is offered into the
public domain in his memory. (From [rexresearch mra article (HYPERLINK
"http://www.rexresearch.com/mra/1mra.htm"http://www.rexresea-rch.com/mra/-1mra.htm)]

369
John Keely, wrote that the vibrations of "thirds, sixths, and ninths, were extraordinarily powerful." In fact, he proved the
"vibratory antagonistic thirds was thousands of times more forceful in separating hydrogen from oxygen in water than heat."
In his "Formula of Aqueous Disintegration" he wrote that, "molecular dissociation or disintegration of both simple and
compound elements, whether gaseous or solid, a stream of vibratory antagonistic thirds, sixths, or ninths, on their chord
mass will compel progressive subdivisions. In the disintegration of water the instrument is set on thirds, sixths, and ninths,
to get the best effects." aqua1.txt from keelynet.com (HYPERLINK
"http://www.keelynet.com/keely/aqua1.txt"http://www.keelynet-.com/keely/-aqua1.txt)

Note well the Tesla quote about 3-6-9

If you only knew the magnificence of the 3, 6 and 9, then you would have a key to the universe. -Nikola Tesla

Way of producing tritium as well as excess energy from cold fusion with a platinum catalyst
Sodium aluminate (I was the one giving him the technology). IT is made by reacting sodium hydroxide (LYE) or otherwise
known as caustic soda with PURE aluminium to form sodium aluminate...
The ORGINAL catalyst used in the COLD fusion MAYO jar in Salt Lake City Utah 1983 ((cheez whiz) jars do fine also...)

All fuel contains WATER, magnet Polymerizes such to fuel changing an oxygen bond to extra hydrite one (pair).
Use PURE water free NAFTA and MAGNET does nothing as there are no water molecules to form hydrite pairs (they
reduce evaporation and slows burn temperature and creates more vapour pressure.

Cleanup Ten kilometer wide SOLAR structured TAKIRA type ships...Watch for lightning storm tops as atmosphere shown
REDISH colour. Use IR camera if possible then you will see, be careful as you can be blinded by blue plasma ray directed
down at low level rhomboid formation used to DRAW negative orgon nimbus.
When they are here something BIG is happening I was with a friend when they showed up I was able to look strait at the
ship but my friend was temporarily blinded ... Made the ID4 movie ones look like trashy toys, bad thing I had no digital cam
I might had taken some really scary pictures, A real GOD biblical proportion spectacle..
And you can bet there will be more; it’s easy to uplink to this things and download data (Using PK)
The problem is how to make a prototype: two separate lenses must be used. One broad banded band pass glass lens using
prismatic splitters to focus at proper wavelengths using 3 CCDS as you may already know if familiar with photonic
engineering colours diffract differently so in a very broad banded system focal distances differ creating blurring and
defocusing at ends from centre spectra. Lens either has to be proportionally colour spectra corrected (as the ones used in
colour TV LCD PROYECTORS AS TO COMPENSATE DIFRACTION across the gamma .. or spectra split and managed
separately ...
One filters all but IR, the other filters all but UV.

160
The light would have to be recombined after the filters/lenses so that it could be projected onto a CCD chip or some film.
Think on adapting already existing Sony 3 CCD COLOR CAMERA TO THIS TASK (AND SOME STIRLING CRYO-
COOLER) TO A KODAK LOW IR ELEMENT.
Light be spirally polarized and co-phased in harmonics creating optical soliton wave (Virtual Solid STANDING WAVE)
LIGHT SPEED CAN BE "0". ,electronically such signature can be defined by type of s= can and data conversion stream
used to recombine data in adjustable single image from a SINGLE LINE OF REFERENCE , a surface contact can
determine linear contact at other point (everything can become transparent to such "vision" as photon becomes carrier of
information from a surface it contacts , full shape of a target can be determined by single line of scanning using
phaseshifting in place of contact using atomic resonance transponding of a single atom.
From this basics I determined Red shift in the universe is due to gravitational de-acceleration and not to expansion as
postulated theoretically, light from far sources in space will be defined with circular polarization proving a gravitic
signature imparted in photon ... the universe shape is more like an onion shaped torus divided in 7 sectors, where are inside
a tiny rotating string within the edge of sector 6. Black holes do tell tales ... Hawkings is near that answer
EDMOND SIENTIFIC got quite a load of off the shelve stuff you can play with to test this things.
I contacted a German company whom specialize in optical filters and polarizing lenses, as they can produce materials that
with precise frequency filtering and polarizing capabilities. Unfortunately it would cost around £100 for a square cm
sample!
> I was thinking that maybe certain types of crystal may be useful in 'processing' the light, but I have no idea which types
may work.
IR TO GREEN TRIPLERS TO START WITH BUT GOVERMENT WILL START TO ASK QUESTIONS. THEY DONT
WANT THEIR STEALTH PLANES APEARING NAKED in the sky ... if you ask for iodine crystals you are dead. Phased
correctly you can see 4d. So it’s quite touchy, need to specify need and propose other than original one, one engineering to
deceive the other to do what you really want...

THINK IN MUSIC OCTAVES WITHIN A COLOR YOU HAVE 7 TONES OR SHADES OF SUB TONES AS IN
BASICS, IN MICROWAVES YOU HAVE A MICROWAVE GUIDE CAN CONDUCT MULTIPLE FREQUENCYS
THAT RESONATE WITHIN A GIVEN SET OF MEASURES ... IN VLIR YOU CAN SE THE basic TEMPERATURE
SIGNAL OF HUMAN AURA USING IODINE CRYSTALS , USING STOCHASTIC RESONANCE OPTICAL
AMPLIFICATION YOU CAN DETECT A HUMAN BEING BIO SIGNATURE 600 METERS deep inside a cave under a
mountain such amplifiers are top secret and are being used in spy satellites ,can detect DNA RNA signature from 24,000
miles up ....(Yes dial you up by DNA code )
It makes me sick how they entertain the sheep with 100 meter resolution mars pictures when actually they have sub light
wave-length neutrino telescopes & other toys to see a fleas ass hair from here to the moon...

Does the ratio of "accelerating FORCE" to "electrical Input-power" change, if system moves faster into forced direction?
Yes inversely proportional to the speed of light and as light speed is attained the charge equals 0 as electron mass becomes
infinite and enters 4D but this is dependent relative to time direction and polarity used
If electrons rotate in anti coreolis force orientation of spiral within spiral in disc surface yess ...(G e- shield ) system entropy
has to be reversed in time to attain OU as local - G field is created to counter the positive G earth field

Mister Electron (electricity) meets mister Audio wave (acoustics)

Hurricanes Meets RV ... The "HEAT" transforms to OU the WAVE feeds on it and self sustains.
http://www.frank.germano.com/vortexscience.htm

I learned to run it in RV mode long ago using superluminal speed covering the full light spectra ...
Using 3 basic colours as phase value of the 3 brain nodes, potentials of 4 million DBs can easy be achieved ....

161
"literally I can poke holes in the sun" with it but need to work on ID part of brain as the genetical safety interlocks prevent
me from using and controlling it effectively , I need to isolate from universal collective mind to fully control it but the
problem is people will start dropping like flies as they depend on my nodal connection as terminals , that is about 3.8
million people to be exact , that connect across my genetics matrix to godmind .
Its great responsibility ,but is time to teach this and let people test it for themselves,(time to acquire some responsibility).
And stop saying the devil made me do it or it was gods will ...
Jesus told people to be like him ..That is to get the MORALS the power and do things right ... Its our CHOICE to change
history and make earth paradise..
so make use of the opportunity ....

On observation I can tell you that radium and polonium are not natural elements. True! they are Radio-active form of lead !

Other way of making plastic is dissolving to saturation the white foam used to package things in gas until it saturates to
heavy paste , let it evaporate dry in exposed OUTSIDE air you get a SOLID block the size and volumen you use ... like half
paint pail ....
once is total solid you Lathe to form you like .... takes a bit to dry but a LARGE block is worth quite a lot and hard to get ...
yet this is cheap to make only need to be patient with the long dry wait ...

To be sincere A single UFO can destroy earth back to the stone age in a few Hrs all the EARTH government technology is a
child toy compared to what a pissed off ET can do with a single ship using a 3 megawatt ZPEM generator ...

6.2. Quantum pendulum

Take a 1 inch PVC pipe, orient its ends toward N, S poles take a string and a 4 oz weight you can slide up or down, tie
string to top of pipe swing it and adjust it to swing from east to west.
If you adjust it to 1.6 cycles per second it will never stop as it will feed on earth rotation charge....
as pendulum swings to the east it takes energy from earth rotation to the west as it goes up and mass increases as it swings
back it takes extra acceleration in its swing toward the west and mass decreases gaining height each times it swings until it
reaches 1.6CPS synchronizing with earth motion sub harmonic ..
I just screwed planet earth giving this away. As all is needed is calculate pipe circumference weight mass and cord length...
Energy used can stop earth rotation. If used in great quantity...

secret is string tries to wrap around pipe as weight goes east gaining kinetic mass and energy from earth movement west as
tries to go into ascending spiral (logarithmic)toward the east Earth rotation serves as energy pump to the pendulum motion
wile earth reduces rotation proportional to the pendulum energy gain .. infinitesimally small , but built a billion of them with
a few trillion tons of force they can truly "rock the earth"
That is in the basic manual study of how civilised worlds destroyed themselves in early evolutionary development using
gravity wheels & gyroscopic energy capture.
as the menacing gyroscopic thrust is affecting earth now, the vertically mounted machinery and non- equator oriented
rotation is messing up earth rotation if something can cause polar shift is the Chinese Dam 16, million pound each vertical
rotor generators & hydros ..
Call that "planet X" and don’t tell humans the truth.

Gyroscopic disruption of earth rotation is more dangerous than global warming or any other menace earth had faced ... as
we can loose our moon & invade Venus orbit....
Definitely a fatal love encounter with the Venus Goddess

162
Remember worlds in collision. Every event has an origin...
Mythology may prove to be a recollection of long forgotten facts
Planet Lucifer, Andros, Tir, tiamat ... The Fall of Lucifer may be symbolic of an industrialized gyroscopically imbalanced
planet going out of orbit and crashing on ? Mars????
Will we repeat the same mistake again? In astrological parody terms I see the connection of Uranus to brain is too strong ...
so astrologically there is a 99.99998 % of possibility for an encore! Stupid repetition...

In Chas Campbell device, gravitic energy is taken and it steals energy from earth rotation and coreolis spin. We truly
"screw" the planet using that as energy source...
"Anti gravitic" is not same as gravitic using the rotation earth differential to attain energy by taping the movement of the
earth to extract energy using "gravity" assistance
gravity wheels , pendulums , gyroscopes fall in this class ....and some type of ION engines,,.
(Steal earth rotary energy )
Searl is anti gravitic , gets aether energy from time & space itself .. not related to gravitic flow , it sets own gravitic field ..

6.3. Lead-acid battery desulfator

I used this circuit to recover several car batteries that otherwise were useless. For those that are experimenting battery
powered RVs.
Get yourself a bunch of sulphated batteries from a wrecking yard for nothing, and if they do not have any internal shorts
they should be regenerated to near full capacity after charging for a week or two.

6.4. Firestorm spark plugs

There is what is call electron cooling by means of electrical charge. HEAT is due to an increase in electron orbital energy
level ..
If Combustion is enhanced by the arc producing NITROUS OXIDE at the same time creating COLD plasma that permits
more energy to go into GAS expansion than creating RADIANT HEAT in IR regions...
Coating inner engine in reflective IR region titanium nitride or iconel monel alloy increases IR reflect going to nitrogen
CO2 expansion.... as if spark plasma where an acoustic laser thermal resonator alike where energy goes to mechanical
expansion of GAS .
Again I go to the FACT ALL OU is due to transformation of energy.

163
My proof of theoretical concept relies on an Expired patent number 3,977,191 Atomic Expansion Reflex Optics
Power optics Power source (AEROPS) requires an Extreme engineering knowledge to understand and replicate.
Firestorm SPARK plug creates a similar effect, quantifiable and justifiable under the OU transform theory I have posted so
much about.

6.5. Cold fusion

For cold fusion, Use aluminium and sodium hydroxide....
Use the sodium aluminate as catalyst
USE pure aluminium, this was demonstrated to Perkin Elmers Labs in 1969...

6.6. Characteristic Impedance of a Transmission Line

You learned earlier that the maximum (and most efficient) transfer of electrical energy takes place when the source
impedance is matched to the load impedance. This fact is very important in the study of transmission lines and antennas. If
the characteristic impedance of the transmission line and the load impedance are equal, energy from the transmitter will
travel down the transmission line to the antenna with no power loss caused by reflection.-end quote
I’m reading the navel manuals of antenna and radio waves propagation check the previous posts of this group as the navy
manuals are a great introduction for the laymen until I can get my copy of the ARL antenna manual (could only read a bit at
a time here in the library, assholes wont let you take a freaking book out the place cause of construction an this being a
reference library …)
So ill bring in a portable scanner and scan its ass why they watch.
If we are dealing with radio frequency, of which the navy consider to be the lowest form of radiant energy being photons!
Since atmospheric pressure (the medium carrying the waves) is going to be altered by weather then perhaps that’s why some
days you will get in consistent results? Along with the factors matching the ionosphere... (Explained below)
Certainly by wave propagation of the radio waves this can be proposed by such theory. Whether or not that’s directly
connected to the over unity issue I don’t know. Of course I may be way off here.
But for the behaviour of RF standard theory assumes
When radio waves are reflected from flat surfaces, a phase shift in the alternations of the wave occurs. Figure 2-7 shows two
radio waves being reflected from the Earth's surface. Notice that the positive and negative alternations of radio waves (A)
and (B) are in phase with each other in their paths toward the Earth's surface. After reflection takes place, however, the
waves are approximately 180 degrees out of phase from their initial relationship. The amount of phase shift that occurs is
not constant...
It depends on the polarization of the wave and the angle at which the wave strikes the reflecting surface. Radio waves that
keep their phase relationships after reflection normally produce a stronger signal at the receiving site.
Refraction
Another phenomenon common to most radio waves is the bending of the waves as they move from one medium into
another in which the velocity of propagation is different. This bending of the waves is called refraction. For example,
suppose you are driving down a smoothly paved road at a constant speed and suddenly one wheel goes off onto the soft
shoulder. The car tends to veer off to one side. The change of medium, from hard surface to soft shoulder, causes a change
in speed or velocity. The tendency is for the car to change direction. This same principle applies to radio waves as changes
occur in the medium through which they are passing. As an example, the radio wave shown in figure 2-8 is travelling
through the Earth's atmosphere at a constant speed. As the wave enters the dense layer of electrically charged ions, the part
of the wave that enters the new medium first travels faster than the parts of the wave that have not yet entered the new
medium. This abrupt increase in velocity of the upper part of the wave causes the wave to bend back toward the Earth. This
bending, or change of direction, is always toward the medium that has the lower velocity of propagation.
Frequency
For any given time, each ionospheric layer has a maximum frequency at which radio waves can be transmitted vertically
and refracted back to Earth. This frequency is known as the CRITICAL FREQUENCY. It is a term that you will hear

164
frequently in any discussion of radio wave propagation. Radio waves transmitted at frequencies higher than the critical
frequency of a given layer will pass through the layer and be lost in space;
But if these same waves enter an upper layer with a higher critical frequency, they will be refracted back to Earth. Radio
waves of frequencies lower than the critical frequency will also be refracted back to Earth unless they are absorbed or have
been refracted from a 2-22 lower layer.
The lower the frequency of a radio wave, the more rapidly the wave is refracted by a given degree of ionization. Figure 2-16
shows three separate waves of different frequencies entering an ionospheric layer at the same angle. Notice that the 5-
megahertz wave is refracted quite sharply. The 20-megahertz wave is refracted less sharply and returned to Earth at a
greater distance. The 100-megahertz wave is obviously greater than the critical frequency for that ionized layer and,
therefore, is not refracted but is passed into space.
What frequency is the RV? If you can only tell from the reflection, then your original wave is at higher frequency according
to the navy, read below.
PROPAGATION PATHS
The path that a refracted wave follows to the receiver depends on the angle at which the wave strikes the ionosphere. You
should remember, however, that the RF energy radiated by a transmitting antenna spreads out with distance. The energy
therefore strikes the ionosphere at many different angles rather than a single angle. After the RF energy of a given frequency
enters an ionospheric region, the paths that this energy might follow are many. It may reach the receiving antenna via two or
more paths through a single layer. It 2-25 may also, reach the receiving antenna over a path involving more than one layer,
by multiple hops between the ionosphere and Earth, or by any combination of these paths.
Now whether this is gonna come into an east west thing I don’t know, ill be videoing that in my video RV test (east west
saving watts)
Plus this
Multipath Fading MULTIPATH is simply a term used to describe the multiple paths a radio wave may follow between
transmitter and receiver. Such propagation paths include the ground wave, ionospheric refraction, reradiation by the
ionospheric layers, reflection from the Earth's surface or from more than one ionospheric layer, etc.
DAILY.—Daily variations in the ionosphere are a result of the 24-hour rotation of the Earth about its axis. Daily variations
of the different layers (fig. 2-14) are summarized as follows:
• The D layer reflects vlf waves; is important for long range vlf communications; refracts lf and mf waves for short range
communications; absorbs hf waves; has little effect on vhf and above; and disappears at night.
Hence why I was asking the frequency of the RV
In the E layer, ionization depends on the angle of the sun. The E layer refracts hf waves during the day up to 20 megahertz
to distances of about 1200 miles. Ionization is greatly reduced at night.
• Structure and density of the F region depend on the time of day and the angle of the sun. This region consists of one layer
during the night and splits into two layers during daylight hours.
• Ionization density of the F1 layer depends on the angle of the sun. Its main effect is to absorb hf waves passing through to
the F2 layer.
• The F2 layer is the most important layer for long distance hf communications. It is a very variable layer and its height and
density change with time of day, season, and sunspot activity.
SEASONAL.—Seasonal variations are the result of the Earth revolving around the sun; the relative position of the sun
moves from one hemisphere to the other with changes in seasons. Seasonal variations of the D, E, and F1 layers correspond
to the highest angle of the sun; thus the ionization density of these layers is greatest during the summer. The F2 layer,
however, does not follow this pattern; its ionization is greatest in winter and least in summer, the reverse of what might be
expected. As a result, operating frequencies for F2 layer propagation are higher in the winter than in the summer.
They are most of the factors effecting electromagnetic radiation according to
Reference
Introduction to wave propagation and transmission lines and antenna form the navy’s non citizen’s issue.
This might be painfully obvious to some and a moderator might really kick my arse for this.

165
Now you can understand the basic Optical relation of LC and signal in ZPE compression ,the Cornu Spiral and logarithmic
gain within a given transform engine , too much, for a book, as thick as an encyclopaedia will not suffice but this is nice
condensate basic start ..

6.7. LEDs
Kumaran: I have tested LED again in sun light. OK the good news is green LED gives good voltage 1.4V. The bad news is
no amps at all even tested with 2000uA scale with DMM.
Simple use led to charge a capacitor across HOT RF diode or fast switch type and zener switch cap to discharge at maximal
load...
The 1.4V signal is half RF microwave signal at 280 to 380 nanometer that is like 500 NM centre frequency half wave ... if
down converted in half wave. (Deep IR)
Test use full wave HF bridge and drive a capacitor, voltage will increase to 3.2 V DC as vectored potential....
Led DC in reality is modulated Half wave DC vectored light ... (microwave) energy ... so as RF in VOLTAGE NODE it
haves no current unless you charge it into a CAPACITOR turning it to a POTENTIAL (charge) differential.
Another one for the notes bin ... more to come as Test feedback is posted.
"Leds can be made into Quantal diodes"
Phil: It is exactly the same how Tesla pulled energy from the ground, you must pulse a frequency in the circuit to activate
and tune with the potential. With Tesla he had his ground connection and a plate above ground to get the voltage difference.
But you will have no current unless you oscillate these two with the load.
So many people say that A Magnet has all this energy but can't or don't know how to tap this energy. If you get a magnet
and swing it past a coil you get electrical energy. What you have to realize this is a frequency or a time where the Magnet
passes the coil. This is where you don't have to do it mechanical but pulse at a frequency to simulate a momentum on the
Magnet.
Another weird thing here, A Neodymium Magnet is charged at a very high frequency. This means its field and momentum
are oscillating very high, too tap into this we have to tap into a frequency that is in harmony with, or an octave of this
frequency.
It doesn't mean we have to pulse any energy into the system, but a matched pulsing frequency of what we are dealing with.

6.8. to determine Inductance

It is easy to measure inductance of a ferric cored inductor while letting any desired current flow through the coil. Just take
an op amp, a power transistor and build a constant-current source. The output impedance of a constant-current source tends
toward infinite so you will not affect any AC measurements of an oscillator.
Or
FIRST: DISCONNECT THE TRAFO FROM ANY AC SOURCE!
Next, use an audio generator with a series resistor connected to the trafo. You can use even the computer soundcard and any
sinewave generator program. Adjust the frequency until the voltage on the resistor is equal to the voltage on the
transformer/coil. When the two voltages are equal, your series resistor is equal to the coil's reactance at that frequency. Now
you have the reactance of the trafo. Read the frequency and calculate the inductance. Reactance = 2 * PI * Freq *
Inductance. There are some tutorials about this on the Internet. Maybe on that same site I mentioned before.
Raivo: Procedure:
* sinewave function generator - 1A, from 10..2000 kHz.
* For each frequency, having constant 1A going through the coil, measure voltage.
* In normal L the voltage should increase quite linearly with increase in frequency as AC impedance increases. (It is
actually a math using complex numbers in AC but roughly U=I x impedance)
* In LC series the voltage should drop to zero at some frequency where L & C impedances match = resonance.
This is a rough method I have measured the coil inductance, running constant 50cps 1A AC through it and measuring the
voltage drop.

166
When you do this test, also measure the bandwidth. Change the frequency off peak, in both directions until the maximum
voltage peak decrease by 0.707 and note both frequencies. The bandwidth may change depending on pot value so try
different values and note down the measure pot value for each case.
Now for the results of my test. Secondary winding connected in series to a 50k resistor and to the 50ohm output of a
function generator. At 6.8 kHz the voltage across a 50k resistor is at minimum and voltage across transformer winding is at
maximum using a scope to measure. At any other frequency the resistor has a constant high voltage and the transformer
winding is very low voltage.
I guess you found the natural resonance of the secondary winding. Remember that every coil has capacitance between
windings. At that frequency the impedance of the coil rises and so the voltage.

6.9. Power Factor Correction

The apparent power in an ac circuit has been described as the power the source "sees". As far as the source is concerned the
apparent power is the power that must be provided to the circuit. You also know that the true power is the power actually
used in the circuit. The difference between apparent power and true power is wasted because, in reality, only true power is
consumed. The ideal situation would be for apparent power and true power to be equal. If this were the case the power
factor would be 1 (unity) or 100 percent. There are two ways in which this condition can exist. (1) If the circuit is purely
resistive or (2) if the circuit "appears" purely resistive to the source. To make the circuit appear purely resistive there must
be no reactance. To have no reactance in the circuit, the inductive reactance (XL) and capacitive reactance (XC) must be
equal.
As In a Stator the PM rotor within a given impedance makes this resistor negative
(1) If the circuit is purely resistive or (2) if the circuit "appears" purely resistive to the source.
This is LOAD ... LC as seen as RESISTOR ... and as Such you READ AMPERAGE and multiply by the
VOLTAGE SOURCE and GET ITS VOLTAGE drop VALUE ... (Basic Ohms law) named AKA - Voltage drop.
As VOLTAGE drop in line is minor than voltage drop in virtual LC resistor, as generator works in HI impedance Rotary
condenser mode ... Synchronous
as VOLTAGE drop in line is minor than voltage drop in virtual LC resistor, that Means virtual RESISTOR
possesses ENERGY transferred from attracted M field to attracting M field
IN IMPEDANCE MATCHING IS CURRENT MUST BE EQUAL even if RESISTANCE is unequal Voltage and
Resistance being determinating variables as to MATCH virtual resistors and reverse energy to source where then
Current REVERSES being of mayo magnitude than source.
As LC voltage is INDUCED it attracts the ROTOR magnet so M1 attracting magnetic field attracts M2 summing
and exceeding M1 turning the VIRTUAL Unity resistor to NEGATIVE overunity resistor as its ENERGY LEVEL
is mayor than the one supplying it (Source).
That means Current at a given POINT reverses to SOURCE aporting ENERGY to it ... Usually in VARS as Power
factor and co generator Laws apply....
This Resulted In Electro Magnetic Amplification where H=(IXI)Rt EMA. Where APARENT power Contributes to
SOURCE POWER on OTHER mode of RESONANCE taken to a POWER factor corrected NUL, ZERO POINT energy
state VAR production. In HI virtual OU impedance Value.
http://www.nepsi.com/formulas.htm Here are some formulas....
So all of you can understand what POWER factor correction is....
http://www.astrosurf.org/lombry/qsl-antennas-basics.htm
Some BASIC Need to Know RF for OU stuff
http://amasci.com/tesla/tesceive.html
More on RF stuff you need in EMA applications...
Now for the kill THE M field is your POWER SOURCE.... as to create SELF amplifying amplitron RV PM alternator....
FACT ANY HI eff GENERATOR wired to 460VAC and run synchronous in 120VAC can be used to make and
demonstrate this principle.

167
Once understood a PM generator is WIRED as to create this same effects.
As told Instant Applications in Energy savings are now possible.
From cogeneration to motive power ... There is NO excuse as I have explained how to do it gave the formulas and explained
BASIC theory ... you already Got Basic RV tool...
Just need to understand what I am telling you and apply it to the PM driven Coils ... Reread from start as above statements
do explain clearly...

6.10. “Lingam power”

Indian secret "Lingam power" unveiled. Now you all know even if its "encrypted" is symbolically designed to activate
"hidden knowledge" already contained in HUMAN GENETIC code for this work; idea will pop to mind like a shotgun blast
" just retain it " and apply.
To run 3 brains in 3 phases (red for heart chakra, blue for right lung upper chakra and yellow for pineal gland). R L &
central NS will run in 3 phases rotation upon vectorizing mind waves in 3CPS. Blue cachina stargate opens, and I reveal
my face…

Ash: biocompatible musical Spectrum frequency in Resonance?

Colour Frequency spectrum converted to ACUSTIC electrical Sub-harmonic Equivalent. Musical Tones
http://www.riferesonator.com/bio-electro.htm
http://www.rt66.com/%7Erifetech/
http://www.rifetechnologies.com/
http://www.dogpile.com/info.dogpl/search/web/therapeutic%2Bmusical%2Btones%2B
“The magic sinewave is 3 cycles per second. You have to cycloconvert it in powers of 3”
Does a drawing of this exist visually? I can draw that on my synth(s) 1000+ thanks to my hacker friends hehe
“Progressive cycloconversion along the SINE wave integral matrix using 8 transformers. 8 musical notes
3, 6,9,12, basic combination is 142857.
RV is just 3 points in a triangle in that hologram
You go from the macro to the micro ...
the thing is take this to 3d from 7, 6, 5,4d.”
How can I mess with those numbers and or sequences man?
OK numbers and "CODES" to play with ...
0.758241 voltages x 42.85 x 7
These are DNA Genetic code alterations needed to work physical in sinewave transdimensional states:
A..4"(AA, CAA, C, GAA, CC, GA)5"...G
A.....(CA)(AA)(GA)(CAA)....G
ACAAACAACGAACCGACAAG
142.857
475.281
253.968
Matrix 666 = 333+333
27+30+33=90 Hz
9=1+4+2+8+5+7=27
Transformation elements required ... 8
Ronald: Interesting is matrix 666 and 333.
6*6*6 = 216
3*3*3 = 27
216 / 27 = 8 (octave)
Ash: would these suffice for distances between decibels:

168
I am convinced of this relation between sounds (sine wave being very important but I do not know why yet) and the
physiological/mental/spiritual aspects. Been looking for links about that
Found this but can't vouch for this one
http://www.soulinvitation.com/superDNA/superDNA.html
And this one about Cymatics
http://www.mysticalsun.com/cymatics/cymatics.html
The link below gives some tables for use. It gives suggestions for use with sounds and DNA structure.
_http://www.goldenmuseum.com/1611GenCode_engl.html

7 colors of light are the base for all existent DNA /RNA combinations in the universe.
Man is represented by Yellow, RED, Blue
Woman by violet, green, orange....
where female and male form 6 that create the David star with the WHITE color at the Centre 7 corresponding to the duality
of universe represented by 11 male & female letter K ....
CODE (K777) this corresponds to genetic codes (mutations that correspond to music "sound" and light (energy) matter
corresponds to "Lucifer" trapped light energy were God spirit is represented as Christ crucified .. that means YOU (people)
as part of GOD spirit are BOUND "crucified" to material existence ...
"Forget about the Jesus paid for your sins stuff"
In reality is You as part of creation are part of GOD spirit incarnated (Bejesus) and are nailed to a material existence
(crucified to the Vertical horizontal planes of 3D) suffering your Ignorance "sin" of not remembering your origin "God"
knowing dung of how to control its 48 basic laws, just think of the hard times to get the basics of the other 4096 Laws base
for Universal construct 'creation”.
If this does not hit a ring note, codes k888, K999 will ring a bell as nature has 2 roads in evolution, one is transformation the
other entropy and destruction (I am a master at the 2) so those dealing in black magic will soon see the fruits of their work,
as I will step and walk in their ashes (In a sense already done) '2137'.
There are 3 things that need to be deal with.
politics
religion
Economics
With politics we deal with the truth, logic, and get rid of politicians.
With Religion we tell humanity the truth , tell them that paradise is made were he is , that moving man to HEAVENS will
not fix the problem , but only turn heaven into another hell ..(Requires Transformation) Education , as any thing else Faith
is ENERGY you can waste it kneeling before an stone idol or you can use it to acquire wisdom and become one with GOD
... (choice) .Get Rid of religious fanatism (all religions)..
Economy ...
Base it in abundancy and accumulated Work , where the value of things are determined by man Hour not by decadent
entropic devaluated money system, turn the WORLDS armies to fight poverty and ignorance teach the ancient wisdom of
tantra to regulate population and to transform human entity to beings of light (also by Choice ).
In 7 years Earth can be reprogrammed rebooted without recurring to destruction (thermonuclear warfare) to ERASE
collective memory.
Like in RV ... Energy can be transformed with minimal Waste...
Man can also be transformed with minimal waste.... That is what technology is for (tool for transformation) not idol to be
worshiped as a God...
A few Drops of water into the sea.....

6.11. Info from ‘Lightwave’

Lightwave wrote: http://www.pat2pdf.org/patents/pat7151394.pdf

169
Fortunately these patents and thousands of others violate close to a dozen of Tesla's patents between 1890 and 1900.
http://www.tesla.hu/
Even E. V. Gray's patents violate Tesla's, including his "conversion tube" that is just a Tesla coil in reverse. Voltage to
amperage, instead of amperage to voltage.
RV motor is not much more then a Tesla motor where he describes loading caps for "other use" for the cost of turning the
motor.
Everything is dependent on the "collapsing magnetic field" that produces a "scalar" like wave, which is a "time varying
energy" in implosion mode that lags time slightly, where the energy to spin the electron to keep it in sink with the local time
field, is now available for free use. Energy flows into the "system" instead of flowing out. Energy is "convergent" and not
divergent, and is why the "school girl motor" can do what it can do.
The spin in the electron in a "scalar wave", is at 90 degrees to normal, and instead of the electrons travelling down the wire,
they instead spin around the wire, caused by the magnetic wave that has now become the power source "in itself" from the
collapse. More like a "wind" going down the wire. The magnetic wave is turned inside out, and now resembles a "smoke
ring vortex", "with a leading and trailing edge" (lopsided), that surrounds the wire, and travels down the wires from each
end of the coil, as a single packets of energy, at 1.5 to 2 times the speed of light. Tesla clocked it at 1.5 times, I suspect that
if a perfect scalar is produced, that it is in fact twice the speed of light. A collapsing magnetic field can never produce a pure
scalar wave.
Although I have never built a "SGM", here is an experiment I predict you can try with one to produce above unity. Most
people thing the initial pulse pushes the magnet, it is the opposite, the pulse attracts the magnet, and the collapse is a
"momentary time reversal", and then pushes the magnet, while generating energy. The more energy you can draw off, the
more it will push the magnet.
First get a piece of thick walled 3/4" copper water pipe and add it into the series circuit to accentuate the "90 degree spin".
Wrap a coil of wire around the pipe and monitor the voltage. The induction is at 90 degrees with this type of energy, and is
not the same as high voltage, although it resembles it with out amperage.
The standing scalar wave produced is very short and still might not register very well at this moment as the wave length is
dependent on the angle of the smoke ring magnetic field.
"Self induction" is the key to stretching this wave into usable amperage, and is how a Tesla coil works, but there MUST be
an open circuit for the "magnification" to occur. Spark gap, high voltage SCR mosfet...Electronics may or may not work for
this as well.
A "choke coil" will work as a Tesla coil in this manner, and does not have to be that big with negative time energy.
A flash from a camera should work fairly good for this. (Not tried yet)... Add the air coil first, then the flash tube, then the
pipe, and then to the blocking diode and battery. A cone on either side of the flash will work best. >--< .
To even get more, first pass the energy through a step up transformer, as is, (Tesla patent), and the output can go directly
through the diode to the charge battery with out any loss.
Then use the coil and flash, on the secondary. Careful.....
It's interesting that a spark discharge already has the magnetic field at 90 degrees to normal....
Try adding a small tube to each point of the cone for electron mass and higher current.
You can make longer durations by making your own flash tube with Pyrex glass and argon gas. Draw vacuum off to raise
resistance and energy levels by causing a longer time duration of the open circuit.
90 degree induction has no back EMF. Back EMF is caused by "self induction" in normal electrical energy that induces a
"mirror induction" in opposition, similar to the induction in a generator, and the relationship between stator and rotor coils
in electrical generation causing the back force we have to push on to generate energy. Scalar induction makes a parallel
path, just like in a mirror, passing from one coil to the next, energizing the whole coil all at once in mirrored reflections of
induction. The larger the wire, the greater the amperage, the longer the wire, the greater the voltage, combinations increase
both. BUT ONLY IN AN OPEN CIRCUIT.
Another Prediction.
Make a SG coil of very large diameter wire mass, or multi strand all exactly the same length, solder ends, and then twist
counter clockwise to make clockwise turn in wire,(hint: why do you think they call it Clock "WISE") with only 6 turns in
coil for light speed resonance. Make it a closed circuit loop.

170
Here's an interesting patent for all to consider..http://www.pat2pdf.org/patents/pat6946767.pdf
This is very similar to a motor drawing I uploaded to Bruce Perot's
http://groups.yahoo.com/group/nuenergy/messages
energy group, but he deleted it after my website newtimesenergy.com was wiped off the internet by force for posting info
about 911, and particularly a huge asteroid circling the sun, disrupted by the comets converging on our solar system back in
2003 in the crossing of the galactic plane.
http://cfa-www.harvard.edu/iau/Animations/OuterSmall.gif
My motor generator has the stationary magnets on the face of the coils, in opposing poles, and instead has coils on the
interrupter and runs in "school girl mode" for "self motive generation".
A collapsing magnetic field is an implosive magnetic vortex. Energy is "convergent" and draws from the fabric of "time"
itself, and time is regulated by electron spin in the expanding universe. Time is expansive, and each revolution of the
electron, it expands just ever so slightly, but represents huge amounts of energy. Approx 27,000 Km of electron surface area
is exchanged every second between the two internal spinning vortexes, and double that in "scalar mode".
Work it out... E=MCC one hydrogen mass spinning with two internal opposite spinning bodies like little gears, for each
second of time...huge amounts of energy goes un-noticed in a balanced equilibrium each and every second. Space is not
empty, but is the "water" mentioned in Genesis 1. The foundation to the building blocks of the temple of the universe, and
all mater, that Christ spoke of.
"Drink of my blood, eat of my flesh, and you will come to know me" indicating that he is the Universe, and all energy and
mater is, and exists of the creator.
I eat and drink "mater" energized with positive spin energy to survive every day...The spirit of God...
As you may have been paying attention to one of my first post on this forum, although I am not unknown by Kone and
Hector from about 4 years ago.
Earth quakes.....not a subject I am proud of, as my predictions have taken close to 500,000 lives now.
June 13th to 25th is going to be extreme, worse then Sumatra 2004. I am now predicting 9 to 11 mag, which will likely be
Earth crust shattering, and will set up an extended period of vibration once the initial friction stress is relieved. Earth's crust
is already floating from the 9.6 in Sumatra....
Last warning....Move away from coast lines, low lying areas, Earth quake prone areas, volcanic areas (there are more active
volcanoes then ever before, due to internal electron scalar vibration, caused by the galactic alignment with our solar plane
and the galactic centre, effects of galactic gravity, and how it works to effect us, and keep our position in the galaxy. No
place will be safe if this does manifest into something bigger then we can handle. Make sure your mind is in the right place,
and who you are in relationship with the universe. There is NO RELIGION, only spirituality, and it is a personal thing not
found in a church or religion.
The way to heaven is thought the 12 pearly gates, and the 12 pearly gates are the electron. Each pearl being a colour, one
negative, one positive, 6 colours of natural musical resonance within the vortex cone, creating the meaning that heaven is
internal, existing outside of time. The connection is within ones self.
The "Secret" is not what you can do for yourself, but what you can do for the good of another, or the good of all, with out
the want for yourself.
Knowledge is the greatest gift of all. Wisdom is what you do with it.
There is only one law. Time flows forward, and energy is a state of time distorted. Negative can not exist without its balance
in positive.
Negative time spiritual energy feels very much like Positive spiritual energy. It's easy to be fooled by the feeling of
goodness from negative acts of self righteousness.
Spirit follows the same universal laws of energy, by way of deeds and actions; it is built right in to our DNA, and is a Scalar
function of superconductivity. Loose your spirit; loose your spin time energy. Fall behind time, and your spirit becomes
negative in time, which is degenerative.
Crossing the galactic plane from the negative to the positive scalar gravity side has great effects on spirituality. Man will
have to do more to catch up to the flow of time as it advances faster as we pass further into positive space. The time interval
I am talking about, is not external, but internal, in-between the two vortexes as the positive one gets larger, as the counter

171
clockwise one gets smaller, according to galactic position, maintaining light wave circumference in spin, dictating the speed
of light.
Light follows the curvature of space time in the expanding universe in an outward spiral. Look at the heat rise off the hood
of a hot dark vehicle, and you can see the light bend. Simply stand a ruler in the heat field, and get right down and look
through the heat, and you will see the ruler stretch out as light follows the curvature of positive energy expansion.
Follow it through and you will see, that the universe at one time, sat at the end of your nose.
And what shape is the universe???
PS. Hector, do you remember who "Mabus" is?
I walk on the water, and fear evil no more, for I am positive space time energy. No one can take my energy except God, or I
give it away freely.
They may take my flesh, but they can never take my spirit. Whosoever rejects a gift of positive energy reflects their own
back in a loss.
You feel that rush?? You’re feeling the movement of spirit energy, but which way is it going?
Get out your "ruler" (hint: ruler...he who knows how to measure the light), and measure the light, find the pearls. But the
first thing you will find is the star of Lucifer, the pentagram. Look deeper for that music. If it can't play a tune, it's not light
resonant.
Why does a "ruler" have 12 inches?
Light wave
News just in as I write this.......after already just typing my Earth quake stuff...
------------------------------------------------------------------------------------
http://www.earthchangesmedia.com
Mitch Battros - (ECM) Earth Changes Media
Mayan Message More Explosive Than Previously Considered
Due to time constraints, we pre-recorded this "live" broadcast direct to Guatemala earlier today. What Carlos Barrios and
other high priest elders have to say is more intense than I had thought. This interview will be played in its entirety tonight
beginning at 9 PM. You can access this by going to the ECM website and clicking on "listen live".
Carlos Barrios and Mayan High Priest Santiago have warned us to watch for a swarm of moderate earthquakes to circle the
Ring of Fire in July. This will be a precursor for events in August and September. They are expecting an increase in
volcano, earthquake, and tsunami activity beginning this summer.
Carlos reminds us the Mayan Calendar is based on "cycles". This is how they are able to predict with such accuracy. But
man can play a roll in lessening the extent of events. There is more, lots more. I will send out a follow-up tomorrow.
You can listen to this recorded earlier today broadcast at 9 PM (Pacific) by going to the ECM website.
Today's NASA news release on the connection between earthquakes and volcanoes has the geological scientific community
standing at attention. It has long been known there is a direct and causal connection between volcano activity and
earthquakes, BUT not the other way around. Full Article:
http://www.earthchangesmedia.com/secure/2007/article_16945.php
Also today, a news release from the Mid- America Earthquake Centre located at the University of Illinois, has been
requested by the Department of Homeland Security Federal Emergency Management Agency to conduct a study
investigating the effects of investigating the effects of a potential New Madrid "big one." Full Article:
http://www.earthchangesmedia.com/secure/2007/article_16944.php
Yet a third news release yesterday describing the violent eruption of ' Piton de la Fournaise' resulted in the collapse of its
summit. Magma is being spewed 200 meters into the air and the lava has cut off a national highway. This violent awakening
of 'Piton de la Fournaise', a volcano on the Indian Ocean island of Reunion, continues to spew ava. Many experts are calling
this "the eruption of the century." Full Article: http://www.earthchangesmedia.com/secure/2007/article_16943.php

6.12. tasmin
It’s called t.a.s.m.i.n ....Its RV x C, 3 antennas in 3 phases exceeding speed of light rotation.

172
Sample 300MCPS = 1 meter wave-length Tasmin spacing is one meter from each antenna as frequency hits 300MCPS you
hit light speed as you increase angle of rotation by increasing frequency signal exceeds speed of light reversing time in local
singularity ...
Special reflectors are needed to confine the vortex at specific mass reflection so it does not hyper-expand.
300 MHz frequency is also as sample (others can be used) Montauk Used a walk in AMPLITRONs frequency of 2 to 6
meters. As light speed is attained unit becomes PK mental energy amplifier. Only prepared people can use the machines ...
(fluidic mind)
Before the world burns up some of you may go to the past and try fixing this shit. (But it may become worst). Leave time-
travel to the Gods.....
anyway your body can hit C using biological DNA/RNA stargate as transmutation of lower elements is engaged body goes
into mono-atomic transition where you can teleport trans-dimensionally in time & space.
Like RV is easy to make ...Tuning, like always is the bitchi part...

ZPE and looping can be replicated and had being replicated , so I have no more problems regarding that past and future
experiences ..To prove without doubt the other statements requires for me to descript the construction of TASMIN
(timemachine) and make into off shelve homemade device .
To create time vortex all is required is set 3 antennas in a triagle say at a frequency of 27 megacycles that is 11 meter radio
control device frequency (FCC licence required up to 250W TRX) this antenna is set to work as RV device works
generating 3 Phase RF signal from 27MHZ RF transmitter once this is attained the frequency is increased to attain
supraluminic speed where time portal opens up in centre of vortex. triangle is 11 - 11 - 11 meters point to point .
Bad use leads to continental warp and sinking of US continental mass under the sea if paradox is created screwing up
timelines.(this can result from this posting ).
But as RV and looping any kid can easy replicate in their home hacking any amateur radio and some antennas to set up and
create hyper-supraluminic rotary time engine portal.
Also energy can be recovered and system made selfrunning on time space energy (Easy with RV stuff).
Just beware of dynosaurs poping up and eating you and the machine ...Montauk ended as energetic T rex lunch .....(In my
1982-83 timeline)
Just take a bit of responsibility with this knowledge ...as is easy to become Like Lucifer and be kicked out to lower infernal
dimensions (minderased) and naked.
Time also to study a bit of religion and divine law and combine up with a superior moral and logic so we can create a better
"alternate" timeline world , using GOD technology requires God morals and spirit ,so better work on those be-Jesus spiritual
states if you want to play with this toys.
Power requires responsibility. But as the timeportal technology was mentioned here the need is to make known is part of the
current problem we have to face that hangs over us like a sword of justice.
(I altered history ) and all of you can do same and create paradise on this earth . No need to have a genocidal thermonuclear
war !
(You got the tools !) use them !
Lets see if the Gnostics awaken from their slumber and the religion movements start doing Gods intended true work.
They can use RV technology to make paradise quite easy combined with the technology they already have.
(I cant stay in this planet forever .....) Need to go and help other worlds...maybe can do here until 2043 if urn resists the toil
...so try to "hasten" things a bit OK ! Get with the do now applications and the real world use ,as money is acquired lab can
be used to make time-machine toys and all this other higher educational instruments that can be used to teach humanity a
better path ,learn from past so you don’t repeat same shit over and over again, from a circle engage in spiral incremental
evolutionary path .
I have great hopes for all of you , I think you can do much better than Atlantean race did, will be a pity to see the sinking of
another civilization with so much potential as this Human one haves.
(Get on Gods good side OK ! )

173
6.13. Healing water
Water subjected to resonance becomes "clear" of negative crystallizations .. (thought forms ) & becomes curing
homeopathic -morphological reconstructor at molecular level (physical body)...
any water put under RV rotary resonant field will do the same ; preferably distilled pure water in pure silica (glass
container)
FDA & pharma goons kill people for this stuff .... (i give it for free )

Also read old postings from Hector.

Idea is to use a round container and 3 or 6 outer HV electrodes (no physical connection to the water), where water between
electrodes becomes dielectricum of a "water-capacitor".
Then feed electrodes with HV in 3 phases to create rotary HV-field and resonate the 3 phase water capacitor.
Water molecules, as they are dipoles, align along HV E-field, and water becomes ROTOR of your setup...similar to RV
rotor in M-Field...and a lot more to it.

Before FDA kills you ......

using capactrode ( a glass fish tank (square) with "ss" tape outside the glass fish tank plates filled with pure distilled water
as to form capactrode ...
such capactrode is resonated in series with a 10KV HV trafo HV winding to form resonant LC
Water becomes negative ion charged and forms bonds of hydrogen trioxide in polymeric bonds with dihydrogen oxide in
amosphoric liquid state being bacteriostatic-astringent and reconstituting medium for living human cells.

Kone: Perhaps cancer cells/viruses also follow the path of least resistance, like electrons, and when they encounter water
with "no resistance or "memory" they jump into IT and not anymore the various glands and organs they can and did saturate
, and when the person urinates, the cancer goes with it - just theory...
They get burnt by the "hydrated oxygen" .... Water is the receptacle for fire and there are 21 forms of basic hydrogen, most
potent being "hydrogen 21"

a fish tank with metal foil or plates at its sides makes a 12 gallon capactrode at resonance 245 CPS glows blue green ..
& you get the cancer zapping "amosphorous" (erased) water ...
resonant in LC tank being series capacitor (capactrode); only need to put the metal foil plates on 2 of the sides to generate
the effect

6.14. Neo Magnets

A Neo mag is compressed powder and any small deal of influence to it will crack it open. Probably it can be drilled if you
got a very high grade drill tool but I won't recommend it...
Neo material is much alike Depleted Uranium ....
get it inside body .. you are dead ...

6.15. Chip security hacking

One way to hack some chips security code is to use a black code with full length and then using a blank program burning it
over the other program the original program remains the same and the code is opened ... (will not work with some types of
encryption ) but its worth the try ...

174
How long is security key then fill all characters pixels with black overwriting anything that was there ...
&#9616;&#9616;&#9616;&#9616;&#9616;&#9616;
Then appending full program space pages in non writing blank space ..
at programming it gives checksum error but original program will be intact and can be extracted using Black key burnout ..
They may have corrected this in new chip design but most programs permit appending and write over ,,,
PC 10 programmer permits that operation

Read a blank chip to Know its natural "blank" state use the hex character repeated say over one meg blank page spaces in a
one meg chip , the thing is it will NOT write already Written spaces but will give a checksum error at completion , you just
ignore the error states ..( some programs stop at first error but have ignore option..) choose (ignore all ./
The Intent doing that is to OVERWRITE the security key by writing over all full pixels of black characters ...but leaving
original program intact .. ( some chips use other method like masking ROM , those cant be read unless you read the mask
Rom also ( requires physically rewiring internal chip fuse to re-enable external I/O Rom read .. on some chips that is
impossible as data buss is internal read only as mask is burn . , program has to be CPU I/O buss hacked in a working system
/
(with this I had Screwed half of the existent chip security in the market )

many Manufacturers leave the FUSE option off so in CASE they need to change options they can reprogram the chips or
add instructions in blank OPTION zones ...
IF your chip reprogram security FUSE is not BLOWN reprogram it with an append command //
write over the security password with dark pixel ALL logical ones and your program all in ZEROS telling to OVERRRIDE
errors (skip)
if chip does not ERASE within internal command at write-over the original data will remain ...
Must use program that permits to HEX edit chips data and appending alike 27XXX series EEproms but tailored to work
with CPU type chips.
enter black pixel password and read what is written on it , the original data will come out ...
Does not work in burn once encrypted chips nor in ones with Blown fuse
Will work in all REPROGRAMABLE Updatable ones with the security hole as described...
Must Look If your Chip is hackable ...

175