ORIGINAL ARTICLE:

ENDOMETRIOSIS

Expression of the pluripotent

transcription factor OCT4 promotes
cell migration in endometriosis
a

c,d

a,b

Jui-Hung Chang, Ph.D., Heng-Kien Au, M.D., Wei-Chin Lee, M.S., Chinge
f
c,d
Chi Chi, M.D., Ph.D., Thai-Yen Ling, Ph.D., Le-Ming Wang, M.D., Shu-Huei
g
a,b,d,h
c,d
Kao, Ph.D., Yen-Hua Huang, Ph.D.,
and Chii-Ruey Tzeng, M.D.
a

Department of Biochemistry, Graduate Institute of Medical Sciences, School of Medicine,

c
d
College of Medicine, Department of Obstetrics and Gynecology, School of Medicine, and
Center for Reproductive Medicine, Taipei Medical University Hospital, Taipei Medical
e
University, Taipei; Department of Dermatology and Centre for Evidence-Based Medicine,
f
Chang Gung Memorial Hospital, College of Medicine, Chang Gung University, Chiayi;
g
Institute of Pharmacology, College of Medicine, National Taiwan University;
School of
Medical Laboratory Science and Biotechnology, College of Medical Science and Technology;
h
and
Center for Teeth Bank and Dental Stem Cell Technology, Taipei Medical University,
Taipei, Taiwan

Objective: To identify the impact of the pluripotent transcription factor OCT4 in endometrial cell migration and endometriosis.
Design: The OCT4 expression and cell migration study.
Setting: Research institution and reproductive medical clinic.
Patient(s): Nine subjects with normal endometrium, 3 subjects with normal myometrium, 36 patients with hyperplastic endometrium,
and 58 patients with endometriosis.
Intervention(s): The expression of OCT4 messenger RNA in normal endometrium, normal myometrium, hyperplastic
endometrium,
and ectopic endometriotic tissues was analyzed using reverse transcription and quantitative real-time polymerase chain reaction
(PCR). The effect of OCT4 expression on the migration activity of the endometrial cells was examined.
Main Outcome Measure(s): Reverse transcription and quantitative real-time PCR, Western blotting, and wound closure and
transwell assays.
Result(s): The expression of OCT4 and NANOG messenger RNA was signicantly higher in ectopic endometriotic tissues, compared
with that of the normal endometrium, the normal myometrium, and the hyperplastic endometrium. The level of OCT4 messenger
RNA in endometriotic tissues was positively correlated with the expression of genes associated with cell migration. Overexpression
of the OCT4 protein in primary human endometriotic stromal cells and human RL95-2 and HEC1A endometrial carcinoma cell lines
resulted in decreased levels of E-CADHERIN, the increased expression of the VIMENTIN, TWIST, and SLUG proteins, and an
increase in the migration activity of endometrial cells in transwell and wound closure assays.
Conclusion(s): The transcription of the OCT4 gene is signicantly up-regulated in
human ectopic endometriotic tissues. The expression of OCT4 may contribute to the
pathology of
Use your smartphone
ectopic endometrial
growth by stimulating the migration activity of endometrial cells.
(Fertil Steril 2013;-:--. 2013 by American Society for Reproductive Medicine.)
to scan this QR code
Key Words: Stemness, OCT4, cell migration, ectopic endometrium, endometriosis
and connect to the
Discuss: You can discuss this article with its authors and with other ASRM members at
http:// fertstertforum.com/changjh-oct4-cell-migration-endometriosis/

discussion forum for

this article now.*
* Download a free QR code scanner by searching for QR
scanner in your smartphones app store or app marketplace.

Received July 10, 2012; revised November 9, 2012; accepted November 16, 2012.
J.-H.C. has nothing to disclose. H.-K.A. has nothing to disclose. W.-C.L. has
nothing to disclose. C.-C.C. has nothing to disclose. T.-Y.L. has nothing to
disclose. L.-M.W. has nothing to disclose. S.-H.K. has nothing to disclose. Y.H.H. has nothing to disclose. C.-R.T. has nothing to disclose.
J.-H.C.
and
H.-K.A.
contributed
equally
to
this
work. Supported by grants from the National Science Council, Taiwan (NSC992628-B-038-009-MY3, NSC-992632-B-038-001-MY3, NSC99-3111-B-038-001, NSC100-2321-B-038-003, and NSC
101-2321-B-038VOL. - NO. - / 2013

003) and Taipei Medical University

Hospital (97TMU-TMUH-06 and 100TMUTMUH-13). Reprint requests: Yen-Hua
Huang, Ph.D., Department of
Biochemistry, Graduate Institute of
Medical
Sciences, School of Medicine, College
of Medicine, Taipei Medical University,
250 Wuxing Street, Taipei 110, Taiwan
(E-mail: [email protected]).
Fertility and Sterility Vol. -, No. -, 2013 0015-0282/$36.00
Copyright 2013 American
Society for Reproductive

ORIGINAL ARTICLE:
Medicine,
Published by Elsevier Inc.
ENDOMETRIOSIS
http://dx.doi.org/10.1016/j.fertnstert.2012.11.033

he human endometrium is a dynamic remodeling tissue with

remarkable regenerative capacity
(1). Padykula (2) proposed that the high
regenerative capacity of the human endometrium is mediated by endometrial
stem cells. The stem cell markers C-kit
(CD117) and CD34 are expressed in
the endometrium (3), and progenitor
cells of endometrial epithelial and/or
stromal cells are present in the endometrium (46). Endometrial stromal stem

VOL. - NO. - / 2013

cells have been shown to present the CD146, PDGF-Rb (7),

and CD146CD90high cell surface markers (8). The
pluripotent transcription factor, POU domain, class 5,
transcription factor 1 isoform 1 (POU5F1), octamerbinding protein 4 (OCT4), is also expressed in endometrial
tissues (912).
Endometriosis is dened as the presence of ectopic endometrial tissues, primarily on the pelvic peritoneum and
the ovaries (13). Theories of endometriosis pathogenesis
have been proposed (1418). It is widely accepted that
endometriosis originates from retrograde menstruation
in which sloughed endometrial cells exit the uterus through
the fallopian tubes (14). The coelomic metaplasia hypothesis
proposes that the genesis of the endometriotic lesions within
the peritoneal cavity is the result of the differentiation of
mesothelial cells to endometrium-like tissue (15). Theories of
embryonic rest (16) and lymphovascular metastasis (17, 18)
have also been proposed. However, aberrant stem cell
activity in the endometrium was recently linked to
endometriosis (1924). In addition, other investigators have
reported the increased expression of stemness-related genes
in ectopic endometria, including OCT4 (11, 19, 25). The
aberrant expression of OCT4 in endometrial carcinomas has
been described (26, 27). However, the role of OCT4 in
endometriosis remains unclear.
To investigate the role of OCT4 in endometriosis, we
determined the expression prole of OCT4 in ectopic
endome- trial tissues collected from patients, and examined
the role of OCT4 in the migration of endometrial cells in
vitro, using OCT4 overexpressing cell lines and primary
stromal cells derived from chocolate cysts. Our data indicate
that OCT4 may be an underlying molecular mechanism that
stimulates cell migration in human ectopic endometriosis.

MATERIALS AND METHODS

Institutional
Consent

Approved

and

Informed

All tissue samples were collected according to protocols

that were approved by the Human Subject Research Ethics
Com- mittee and the Institutional Review Board at Taipei
Medical University. Written informed consent was
obtained from pa- tients before tissue samples collection.

Participants, Tissue Collection, and Cell

Culture
The aim of our study was to determine whether the expression of OCT4 is correlated to cell migration in human endometriosis. Adenomyosis and chocolate cyst tissues samples
were collected from patients to examine OCT4 expression
in ectopic endometriotic tissues. Normal endometrium, normal myometrium, and eutopic hyperplastic endometrium tissues were also collected from patients as controls. Normal
endometrium (n 9), normal myometrium (n 3), hyperplastic endometrium (n 36), adenomyotic myometrium
(n

30), and chocolate cyst (n 28) tissue samples were collected by microdissection from patients (n 106) undergoing
laparoscopic tubal ligation or benign gynecological surgeries at
Taipei Medical University Hospital. Patients receiving hor- mone
treatment and those with concurrent malignancies were excluded
from our study. Human primary endometriotic

stromal cells were provided by Dr. AP Kao at Taipei

Medical University, Taipei, Taiwan. These were
generated from one tissue of chocolate cysts as
previously described (28). RL95-2 and HEC1A human
endometrial carcinoma cell lines (ATCC) were cultured
in Dulbecco's modied Eagle's medium (DMEM)/F12
(GIBCO-BRL) with 10 fetal bovine serum (GIBCOBRL) at 37C in 5 CO2 in a humidied incubator.

RNA Extraction, Reverse Transcription,

and Quantitative Real-time Polymerase
Chain Reaction
All the tissue samples were frozen in liquid nitrogen
immedi- ately after collection. Total RNA was extracted
using the RNeasy Micro Kit (Qiagen), according to the
manufacturers instructions. Complementary DNA
(cDNA) was synthesized by reverse transcription (RT)
using oligo-dT primers, 1.5 mg total RNA, and the
Superscript III reverse transcriptase (Invi- trogen),
according to the manufacturers instructions. The
quantitative real-time polymerase chain reaction (QPCR)
was performed using the FastStart Universal SYBR
Green Master Mix (Roche) in a LightCycler480
instrument (Roche), and the QPCR results were recorded
and analyzed using the instrument's application software.
This RT-QPCR method was used for the messenger RNA
(mRNA) analyses of all the genes and that were
examined in our study. The primer sequences used for
OCT4A cDNA amplication anked nucleotide positions
369516 (NM_002701) in the 50 region of the OCT4
coding sequence to distinguish the production of OCT4B

cDNA. The primer sequences used for amplica- tions are

described in Supplemental Table 1 (available online). Beta-2
microglobulin expression was used for normalization of the
RT-QPCR results. The RT-QPCR assays were performed in
duplicate in three independent experiments for each experimental condition. The fold-increase in gene expression was
calculated relative to that of the RL-95-2 cell line.

Plasmids and Transfection

The OCT4A cDNA containing the coding sequence for the
360-amino acid OCT4 protein (NM_002701) was subcloned
into the pcDNA3 expression vector. The RL95-2 and HEC1A
cell lines and human primary endometriotic stromal cells
were seeded in six-well plates at densities of 4 105, 2
105, and 6 104 cells/well 1 day before cell transfection.
The transfection mixture was prepared by diluting 2 mg of
plasmid DNA and 4 mL of Turbofect reagent (Fermentas) in
500 mL of serum-free DMEM/F12 medium with gentle
pipet- ting. After a 15-minute incubation, the transfection
mixture was added to the culture medium, and the cells were
cultured for an additional 2448 hours.

Western Blotting
The transfected cells were lysed in cold protein lysis buffer
containing 50 mM Tris, 150 mM NaCl, 5 mM ethylenediaminetetraacetic acid (EDTA), 0.1 sodium deoxycholate,
and 1 sodium dodecylsulfate (SDS), at pH 8, that was
supple- mented with a protease inhibitor cocktail (Roche).
The cells were incubated in the lysis buffer for 30 minutes
on ice, fol- lowed by centrifugation at 15,000 g for 15
minutes. The

Fertility and Sterility

supernatants were collected for the Western blot analysis.
Aliquots of the cell lysates (30100 mg total protein) were
sub- jected to SDS-polyacrylamide gel electrophoresis
(PAGE) on a 10 acrylamide gel, and the protein bands were
transferred to polyvinylidene diuoride membranes.
The primary antibodies used for the Western
blotting analysis were as follows (Supplemental Table 2,
available online): [1] a rabbit anti-OCT4A monoclonal Ab
(mAb; Epitomics) that specically recognizes the amino
terminus (amino acids 90120) of the human OCT4A protein; [2] an anti-VIMENTIN antibody (Epitomics); [3] an
anti-TWIST antibody (Santa Cruz Biotechnology); [4] an
anti-SLUG antibody (Cell Signaling Technology); [5] an
anti-N-CADHERIN antibody (Epitomics); [6] an anti- ECADHERIN antibody (Epitomics); and [7] an anti-actin
antibody (C4, Santa Cruz Biotechnology). A horseradish
peroxidase-conjugated
anti-mouse/rabbit
antibody
(Jackson ImmunoResearch) was used as the secondary
antibody, and the protein bands were visualized using an
enhanced chem- iluminescence system according to the
manufacturers instructions (Millipore).

Cell Proliferation, Wound Closure, and

Transwell Migration Assays
Transfected cells were seeded at 5 103 cells/well in 96well plates, and the plates were incubated for 24, 48, and
72 hours. After incubation, a WST-1 assay (Roche) was
used to detect cell proliferation according to the
manufacturers instruc- tions. The experiments were
repeated in triplicate for each experimental condition. Cell
density was indirectly assessed by the absorbance at 450
nm.
Human endometrial RL95-2 and HEC1A cell lines and
primary endometriotic stromal cells were transfected with
the control vector or the OCT4 overexpression plasmid, and
were plated in 60-mm dishes at equivalent cell densities for
the wound closure assays. Each cell monolayer was scratchwounded with a micropipette tip. After being washed with
medium to remove the detached cells, the adherent cells
were incubated at 37 C in a 5 CO 2 humidied
atmosphere for 24, 48, and 72 hours. Digital images of
the scratch- wound area were acquired at each time point,
and the gap area was measured.
The transwell assays were performed using 8-mm pore
transwell chambers in 24-well plates (Corning Costar).
5
The upper chambers were seeded with 3 10 RL95-2
5
5
cells, 1 10 HEC1A cells, or 1 10 endometriotic
stromal cells in 100 mL of serum-free DMEM/F12
medium. The cells had been previously transfected with
the control vector or the OCT4 overexpression plasmid. The
lower chambers were lled with 800 mL DMEM/F12
medium containing 10 fetal bovine serum. Cells were
then incubated at 37C in a 5 CO2 humid- ied
atmosphere for 24 hours (endometriotic stromal cells), 24
hours (RL95-2 cells), or 16 hours (HEC1A cells). After
swabbing the nonmigrated cells in the upper chambers, the
cells that had migrated to the lower chambers were xed
with 3.7 paraformaldehyde in phosphate-buffered saline

(PBS) and stained with hematoxylin. The cells that had

migrated to the lower surface were counted under a light

ORIGINAL ARTICLE:
microscope
in ve predetermined elds. The assays were
ENDOMETRIOSIS
performed in triplicate, and the results are expressed as
the percentage of the mean of three wells containing cells
trans- formed with the control vector. Each experiment
was repeated in triplicate.

Immunocytochemistry
Human endometrial RL95-2 and HEC1A cell lines and
pri- mary endometriotic stromal cells that were
previously trans- fected with the control vector or the
OCT4 overexpression vector were xed with 0.05
glutaraldehyde at room temper- ature for 15 minutes,
and blocked in 50 mg/mL bovine serum albumin
(BSA) and 0.5 Triton X-100 in PBS, at pH 7, for 1
hour at room temperature. The blocked cells were
incubated with an anti-actin antibody (Santa Cruz
Biotechnology), and the bound primary antibody was
detected with a uorescein isothiocyanate conjugate
(FITC)
secondary
antibody
(Jackson
ImmunoResearch). The nuclei of the cells were
counterstained with 6-diamino-2-phenylindole (DAPI;
Sigma-Aldrich), and the cells were covered with an
antifading reagent (Vector Lab- oratories), before
microscopic examination using a confocal- imaging
uorescence microscope (Leica).

Statistical Analysis
All experiments were repeated in triplicate
independently for each type of tissue, cell line, and
primary cell. Data are expressed as the mean and TSD,
and the median and the interquartile range are used for

data with a non-normal distri- bution. Statistical

differences between sets of data were examined using a t
test. The Pearson correlation analysis was used to examine
the correlation between the OCT4 and migrationassociated genes. A two-tailed P value of less than .05 was
considered statistically signicant. The GraphPad Prism
3.00 and Stata 11 for Windows (StataCorp LP) computer
programs were used for the statistical analyses.

RESULTS
Expression Proles of OCT4 in
Human Uterine Tissues
The participants' proles are shown in Table 1 and
Supplemental Table 3 (available online). Compared with the
hyperplasia group, women with chocolate cyst, but not adenomyosis, were younger (P<.001), and had a higher overall
prevalence of dysmenorrhea (56 vs. 22 , P<.01). In addition, the level of cancer antigen (CA-125) was signicantly
higher in patients with chocolate cyst (P<.05).
The normal endometrium, the normal myometrium, and
the hyperplastic endometrium served as controls for the RTQPCR analysis of the expression of OCT4 and NANOG
mRNA in endometriotic tissues. As shown in Figure 1A, the
level of OCT4 mRNA expression in the adenomyosis and
chocolate
cyst samples (ectopic endometria) was higher (P<.0001) than
that of the eutopic hyperplastic endometrium and the other
controls. The NANOG mRNA was also expressed at higher
levels in the ectopic tissues, compared with the controls
(P<.0001; Fig. 1B). These results demonstrate the increased
transcriptional
activity of OCT4 and NANOG in ectopic endometriosis.

TABLE 1
Description of the study population.

Endometriosis (n [ 58)
Hyperplasia (n
Adenomyosis
[ 36)
Chocolate
(n [ 30) cyst (n [P28)
value
Age (y)
42.6
42.8
34.7 TT 2.6
5.4 (1727)
(2549)
<.001a,b
24.3TT6.0
5.2(3152)
(1840)
23.7TT6.4
3.8(3058)
(1932)
21.7
BMI (kg/m2)
12.7 T 0.8 (1214)
13.5 T 1.6 (1117)
12.8 T 1.3 (1125).060a
27.8 T 4.2 (2135)
27.8 T 2.3 (2131)
28.5 T 2.0 (2330)
Age at menarche (y) Cycle length
(d)T 28.0 (997)
31.5
61.8 T 37.7 (17139)
77.6 T 75.4 (5231)
.162a
CA-125 (U/mL)
33 (91.7%) 28 (93.3%)
24 (85.7%) .632a
Regular cycles (%) Smoker (%) Dysmenorrhea
3 (8.3%) (%)3 (10.0%)
1 (3.6%)
.022a,c
Note: Mean T SD (range) is indicated for continuous variables. BMI body mass index; CA-125 cancer antigen.
Married or living with partner (%) 8 (22.2%)
a Analysis of variance (ANOVA).
16 (53.3%)
17 (60.7%) .584d
b Scheffe post-hoc test showed that the age in the chocolate group was signicantly lower than in either the hyperplasia group (P< .001) or chocolate cyst group (P< .001), but found no sign
23between
(63.9%)
26 (86.7%)
22
(78.6%)
d
c Scheffe post-hoc test showed the levels of CA-125 were signicantly different
the hyperplasia
group and
chocolate
group .627
(P .022),
hyperplasia group and adenomyosis group (P .234). Nor were signicant differences in the levels of CA-125 found between the adenomy
.004d
d c2 test.
Chang. OCT4 in endometriosis and cell migration. Fertil Steril 2013.
.091d

Correlations among the Transcription

Levels of OCT4 and Migrationassociated Genes in Human
Endometriotic Tissues
To examine correlations among the transcriptional levels of
OCT4 and migration-associated genes, ectopic adenomyosis

and chocolate cyst samples were collected and analyzed for

the levels of VIMENTIN, TWIST, SNAIL, and SLUG mRNAs
using the RT-QPCR method. As shown in Figure 2, the
transcriptional level of OCT4 was positively correlated
(P<.001) with those of the migration-associated genes TWIST
(R 0.59), SNAIL (R

FIGURE 1

Quantication of OCT4 messenger RNA expression in human endometrial tissues. Reverse transcription and quantitative real-time
28). The RL95-2 cells were used as an internal control for normalization. Results are expressed as the mean T SD. P<.0001 c
Chang. OCT4 in endometriosis and cell migration. Fertil Steril 2013.

FIGURE

endometriotic stromal cells were transfected with the OCT4pcDNA3 or control pcDNA3 plasmids to produce OCT4
over- expression cell lines. The transcriptional levels of
VIMENTIN, TWIST, SNAIL, SLUG, and N-CADHERIN were

Positive cor
associated
endometri
chocolate cysts (n 28) were quantied using reverse transcription and quantitative real-time polymerase chain reaction (PCR). The
transcript
(B)
TWIST,

(A) adenomyosis, P.447; chocolate cysts, P<.01; (B) adenomyosis, P<.001; cho
Chang. OCT4 in endometriosis and cell migration. Fertil Steril 2013.

0.40), and SLUG (R 0.66) in adenomyosis and VIMENTIN

(R
0.60), TWIST (R 0.81), SNAIL (R 0.83), and SLUG (R
0.84)
in chocolate cysts. These correlations suggest that OCT4
expres- sion may inuence the transcriptional regulation of
migration- associated genes in human endometriotic cells.

OCT4 Overexpression Stimulates the

Migration of Human Endometriotic Cells
To examine the role of OCT4 in promoting cell migration,
the RL95-2 and HEC1A cell lines and the primary human

evaluated using RT-QPCR to quantify the effect of OCT4

expression on the expression of these migration-associated
genes. As shown in Figure 3A, signicantly higher levels of
transcrip- tion were detected for the migration-associated
genes in the OCT4-overexpressing RL95-2, HEC1A, and
primary endo- metriotic stromal cells, compared with the
control cell lines. The results of the quantitative analysis of
the Western blotting data are shown in Supplemental Figure 1
(available online). Western blotting analysis showed that the
overexpression of OCT4 was correlated with increased
VIMENTIN, TWIST, and SLUG protein expression (Fig.
3B). The overexpression of OCT4 was, however, correlated
with a decreased level of E-CADHERIN protein expression.
These results suggest that the OCT4 protein may inuence
the regulation of VIMENTIN, TWIST, SLUG, and ECADHERIN protein expression in endo- metriotic cells.
The results of the WST-1 proliferation assays
(Supplemental Fig. 2, available online) demonstrated that the
overexpression of OCT4 did not signicantly alter the cell
pro- liferation rate. The quantitative results of the transwell
assays (Fig. 3C) showed that the overexpression of OCT4
signicantly increased the migration activity of the RL95-2,
HEC1A, and primary endometriotic stromal cells. The results
of the wound closure assays also showed that the
overexpression of OCT4
signicantly increased the migration activity of the RL952, HEC1A, and primary endometriotic stromal cells
(P<.05), compared with the control cell lines (Fig. 3D). In
addition, the
immunocytochemical analysis and confocal imaging revealed
that changes in the intracellular actin bers and changes in
cell morphology had occurred in the cell lines in which OCT4

was overexpressed, compared with the control cell lines,

resulting in actin ber extension and a transition from an
epithelial to a mesenchymal phenotype (Fig. 3E). Taken
collectively, our results indicate that the expression of the
OCT4 protein stimu- lates the migration of human
endometrial cells.

DISCUSSION
The OCT4 protein is a key transcription factor in the
regula- tion of self-renewal and pluripotency in
embryonic stem cells and primordial germ cells (29, 30).
Recent studies have shown that OCT4 is also a key factor

in the reprogramming of somatic cells to a pluripotent state

(31). The expression
of OCT4 in somatic (32, 33) and
malignant tissues (26, 27,
34) has been widely reported. In somatic tissues, OCT4 is
expressed in the prostate (32), the lung (33), and the
endometrium (11, 12). Recently, OCT4 was detected in
ectopic endometrial tissues (9, 11, 19). The expression of
OCT4 in the human endometrium has been shown to
contribute to regular endometrial reconstruction (11, 12),
and the stemness of endometrial cells has been
demonstrated using unfractionated human endometrial cells
to establish animal models of ectopic endometriosis (20, 35).
Our results show that the expression of OCT4 was
signicantly higher in human ectopic endometrial tissues

FIGURE 3

The OCT4 increases expression levels of migration-associated genes and migratory ability of human endometrial
cells. (A) The relative transcriptional levels of VIMENTIN, TWIST, SNAIL, SLUG, and N-CADHERIN (N-CAD) in RL952, HEC1A, and primary endometriotic stroma cells with or without OCT4 overexpression were determined using
reverse transcription and quantitative real-time polymerase chain reaction (PCR). (B) The relative levels of
migration-associated proteins in RL95-2 and HEC1A cells with or without OCT4 overexpression were analyzed by

Western blotting. Data are representative of at least three independent experiments. (C) The effect of OCT4
expression on the motility of human endometrium cells at 0 and 48 hours was quantied using a transwell assay.
(D) The effect of OCT4 expression on cell migration of human endometrial cells at 0, 24, and 48 hours was
evaluated using a wound closure assay. The percentage of the area in the wound closure assay with or without
OCT4 overexpression is shown. (E) The cellular localization of actin protein in human endometrial RL-95-2 and
HEC1A cell lines and primary stromal cells with or without OCT4 protein overexpression was evaluated using
immunocytochemical staining. Nuclei were stained with 6- diamino-2-phenylindole (blue), and actin was
detected with uorescein isothiocyanate conjugate (green). Higher magnication and phasecontrast images are shown. *P<.05 by t test.
Chang. OCT4 in endometriosis and cell migration. Fertil Steril 2013.

(adenomyosis and chocolate cysts), compared with eutopic

endometriotic and normal uterine tissues (Fig. 1). The upregulation of OCT4 transcription in somatic tissues is
associ- ated with cancer stem cell formation (36, 37), and
OCT4 expression was reported to be associated with
cancer metastasis (38). Emerging evidence suggests that
cancer cell invasion and tumor metastasis are strongly
inuenced by the epithelial-to-mesenchymal transition
(EMT) process. The transcription factors TWIST, SNAIL,
and SLUG have been shown to increase cell motility and
regulate the EMT (3943). Consistent with the previous
works, our data show that the expression of OCT4 was
positively correlated with TWIST, SNAIL, and SLUG
mRNA and protein expression in ectopic endometriotic
tissues and cells (Fig. 2), as well as the expression of an
additional migration-associated gene, VIMENTIN. We
also observed EMT-related morphological and molecular
features in endometriotic cells and primary stromal cells in
which OCT4 was overexpressed (Fig. 3E).
Cells with the EMT phenotype share characteristics of
stem- ness (42), and recent reports have shown that OCT4
expression enhances the EMT and promotes metastasis in
lung adenocar- cinomas (38). The EMT has also been
shown to be associated with the stem cell pluripotency of
human liver buds (43). The results of our wound closure
and transwell migration assays show that the
overexpression of OCT4 stimulated cell motility in the
endometriotic cells and primary stromal cells (Fig. 3C and
D). Thus, our data indicate that OCT4 contributes to cell migration in cell lines from endometrial adenocarcinomas
and puried endometriotic stromal cells.
The expression of OCT4 is inuenced by the hypoxiainducible factor (HIF)-2-alpha transcription factor (44), the
epithelial cell adhesion molecule (EpCAM) transmembrane
glycoprotein (45), and insulin-like growth factor 1 (IGF-1)dependent signaling pathways (46). Endometriosis is an
estro- gen (E)-dependent inammatory disease (13). In
ectopic endometriotic tissue, E2
is overproduced by
aromatase, and is not metabolized because endometriotic
tissue is decient
for 17^a2-hydroxysteroid dehydrogenase (HSD17B2)
activity
(13, 47). The positive association of high levels of E 2 and
OCT4 expression in ectopic endometrium was supported in
a recent report that demonstrated E receptor (ER)-mediated
OCT4 expression and sphere formation in human breast
cancer (48), and the expression of OCT4 in ectopic chocolate
cyst cells (ovarian endometriomas) has been linked to
ovarian cancer (27).
Ovarian endometriomas is associated with neoplastic
processes that result from unknown pathogenic mechanisms
(19), and patients with both endometriosis and ovarian cancer
typically expressed elevated levels of CA-125 (4951). The
results of these previous studies are consistent with our data
that showed signicantly higher level of OCT4 in cells of
ectopic chocolate cysts and the serum level of CA-125 compared with the eutopic hyperplastic tissue (Fig. 1 and
Table 1). The expression of OCT4 in ectopic endometrial
cells, especially in chocolate cysts, may foster self-renewal

and in- crease cell survival, and the EMT is a hallmark sign of
cancer stem cells. Thus, the role of OCT4 in promoting the
migration activity of endometrial cells may contribute to the
progres- sion of ectopic endometriosis to ovarian cancer (19).

In conclusion, this is the rst study to demonstrate

the impact of the pluripotent transcription factor OCT4 in
the pathophysiology of ectopic endometrial growth
through promoting endometrial cell migration. These
ndings may be useful in the development of therapeutic
strategies for preventing ectopic endometriosis and
associated ovarian cancers.

REFERENCES
1. Gargett CE, Schwab KE, Zillwood RM, Nguyen HP, Wu
D. Isolation and culture of epithelial progenitors and
mesenchymal stem cells from human endometrium.
Biol Reprod 2009;80:113645.
2. Padykula HA. Regeneration in the primate uterus: the
role of stem cells. Ann N Y Acad Sci 1991;622:4756.
3. Cho NH, Park YK, Kim YT, Yang H, Kim SK. Lifetime
expression of stem cell markers in the uterine
endometrium. Fertil Steril 2004;81:4037.
4. Gargett CE, Ye L. Endometrial reconstruction from
stem cells. Fertil Steril 2012;98:1120.
5. Gargett CE, Masuda H. Adult stem cells in the
endometrium. Mol Hum Reprod 2010;16:81834.
6. Wolff EF, Wolff AB, Hongling D, Taylor HS.
Demonstration of multipotent stem cells in the adult
human endometrium by in vitro chondrogenesis.
Reprod Sci 2007;14:52433.
7. Schwab KE, Gargett CE. Co-expression of two
perivascular cell markers isolates mesenchymal stemlike cells from human endometrium. Hum Reprod
2007;22:290311.
8. Schwab KE, Hutchinson P, Gargett CE. Identication of
surface markers for prospective isolation of human
endometrial stromal colony-forming cells. Hum Reprod
2008;23:93443.
9. Gotte M, Wolf M, Staebler A, Buchweitz O, Kiesel L,
Schuring AN. Aberrant expression of the pluripotency
marker
SOX-2
in
endometriosis.
Fertil
Steril
2011;95:33841.

10. Park JH, Daheron L, Kantarci S, Lee BS, Teixeira JM. Human
endometrial cells express elevated levels of pluripotent
factors and are more amenable to reprogramming into
induced pluripotent stem cells. Endocrinology 2011;
152:10809.
11. Forte A, Schettino MT, Finicelli M, Cipollaro M, Colacurci N,
Cobellis L, et al. Expression pattern of stemness-related genes
in human endometrial and en- dometriotic tissues. Mol Med
2009;15:392401.
12. Matthai C, Horvat R, Noe M, Nagele F, Radjabi A, van
Trotsenburg M, et al. Oct-4 expression in human
endometrium. Mol Hum Reprod 2006;12:710.
13. Bulun SE. Endometriosis. N Engl J Med 2009;360:26879.
14. Sampson JA. Peritoneal endometriosis due to the menstrual
dissemination
of endometrial tissue into the peritoneal
cavity. Am J Obstet Gynecol 1927;14:42269.
15. Gruenwald P. Origin of endometriosis from the mesenchyme
of the coelo- mic walls. Am J Obstet Gynecol 1942;44:470
4.
16. Russel WW. Aberrant portions of the mullerian duct found in an
ovary. John
Hopkins Hosp Bull 1899;10:810.
17. Sampson JA. Metastatic or embolic endometriosis, due to the
menstrual dis- semination of endometrial tissue into the
venous circulation. Am J Pathol 1927;3:93110.
18. Sampson JA. Heterotopic or misplaced endometrial tissue.
Am J Obstet Gynecol 1925;10:64964.
19. Pacchiarotti A, Caserta D, Sbracia M, Moscarini M.
Expression of oct-4 and c-kit antigens in endometriosis.
Fertil Steril 2011;95:11713.
20. Sasson IE, Taylor HS. Stem cells and the pathogenesis of
endometriosis. Ann N Y Acad Sci 2008;1127:10615.
21. Gargett CE. Uterine stem cells: what is the evidence? Hum
Reprod Update 2007;13:87101.
22. Chan RW, Ng EH, Yeung WS. Identication of cells with
colony-forming
activity,
self-renewal
capacity,
and
multipotency in ovarian endometriosis. Am J Pathol
2011;178:283244.
23. Figueira PG, Abrao MS, Krikun G, Taylor HS. Stem cells in
endometrium and their role in the pathogenesis of
endometriosis. Ann N Y Acad Sci 2011; 1221:107.

24. Silveira CG, Abrao MS, Dias JA Jr, Coudry RA, Soares FA,
Drigo SA,
et al. Common chromosomal imbalances
and
stemness-related
pro- tein expression markers in
endometriotic lesions from different ana- tomical sites: the
potential role of stem cells. Hum Reprod 2012;27: 318797.
25. Gotte M, Wolf M, Staebler A, Buchweitz O, Kelsch R,
Schuring AN, et al. Increased expression of the adult stem
cell marker Musashi-1 in endometri- osis and endometrial
carcinoma. J Pathol 2008;215:31729.
26. Wu Y, Liu S, Xin H, Jiang J, Younglai E, Sun S, et al. Upregulation of microRNA-145 promotes differentiation by
repressing OCT4 in human endometrial adenocarcinoma
cells. Cancer 2011;117:398998.
27. Peng S, Maihle NJ, Huang Y. Pluripotency factors Lin28 and
Oct4 identify a sub-population of stem cell-like cells in
ovarian cancer. Oncogene 2010; 29:21539.
28. Kao AP, Wang KH, Chang CC, Lee JN, Long CY, Chen HS, et
al. Comparative study of human eutopic and ectopic
endometrial
mesenchymal
stem
cells
and
the
development of an in vivo endometriotic invasion model.
Fertil Steril 2011;95:130815.
29. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct3/4 denes differentiation, dedifferentiation or self-renewal of
ES cells. Nat Genet 2000;24:3726.
30. Scholer HR, Ruppert S, Suzuki N, Chowdhury K, Gruss P.
New type of POU domain in germ line-specic protein Oct4. Nature 1990;344:4359.
31. Okita K, Ichisaka T, Yamanaka S. Generation of germlinecompetent induced pluripotent stem cells. Nature
2007;448:3137.
32. Sotomayor P, Godoy A, Smith GJ, Huss WJ. Oct4A is
expressed by a subpop- ulation of prostate neuroendocrine
cells. Prostate 2009;69:40110.
33. Ling TY, Kuo MD, Li CL, Yu AL, Huang YH, Wu TJ, et al.
Identication of pul- monary Oct-4 stem/progenitor cells
and demonstration of their suscepti- bility to SARS
coronavirus (SARS-CoV) infection in vitro. Proc Natl Acad
Sci U S A 2006;103:95305.
34. Karoubi G, Cortes-Dericks L, Gugger M, Galetta D,
Spaggiari L, Schmid RA. Atypical expression and
distribution of embryonic stem cell marker, OCT4, in
human lung adenocarcinoma. J Surg Oncol 2010;102:689
98.
35. Masuda H, Maruyama T, Hiratsu E, Yamane J, Iwanami A,
Nagashima T, et al. Noninvasive and real-time assessment
of reconstructed functional human endometrium in
NOD/SCID/gamma c(null) immunodecient mice. Proc Natl
Acad Sci U S A 2007;104:192530.
36. Mathieu J, Zhang Z, Zhou W, Wang AJ, Heddleston JM,
Pinna CM, et al. HIF induces human embryonic stem cell
markers in cancer cells. Cancer Res 2011;71:464052.
37. Kristensen DM, Nielsen JE, Kalisz M, Dalgaard MD, Audouze
K, Larsen ME, et al. OCT4 and downstream factors are
expressed in human somatic uro- genital epithelia and in
culture of epididymal spheres. Mol Hum Reprod
2010;16:83545.

38. Chiou SH, Wang ML, Chou YT, Chen CJ, Hong CF, Hsieh WJ, et
al. Coex- pression of Oct4 and Nanog enhances malignancy in
lung adenocarcinoma by inducing cancer stem cell-like
properties and epithelial-mesenchymal transdifferentiation.
Cancer Res 2010;70:1043344.
39. Chen YJ, Li HY, Huang CH, Twu NF, Yen MS, Wang PH, et al.
Oestrogen-induced epithelial-mesenchymal transition of
endometrial epithelial cells contributes to the development of
adenomyosis. J Pathol 2010;222:26170.
40. Kalluri R. EMT: when epithelial cells decide to become
mesenchymal-like cells. J Clin Invest 2009;119:14179.
41. Acloque H, Adams MS, Fishwick K, Bronner-Fraser M, Nieto
MA. Epithelial- mesenchymal transitions: the importance of
changing cell state in develop- ment and disease. J Clin
Invest 2009;119:143849.
42. Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, et al.
The epithelial-mesenchymal transition generates cells with
properties of stem cells. Cell 2008;133:70415.
43. Su J, You P, Li WL, Tao XR, Zhu HY, Yao YC, et al. The existence
of multipo- tent stem cells with epithelial-mesenchymal
transition features in the human liver bud. Int J Biochem
Cell Biol 2010;42:204755.
44. Covello KL, Kehler J, Yu H, Gordan JD, Arsham AM, Hu CJ, et
al. HIF-2alpha regulates Oct-4: effects of hypoxia on stem
cell function, embryonic devel- opment, and tumor growth.
Genes Dev 2006;20:55770.
45. Huang HP, Chen PH, Yu CY, Chuang CY, Stone L, Hsiao WC,
et al. Epithelial cell adhesion molecule (EpCAM) complex
proteins
promote
transcription
factor-mediated
pluripotency reprogramming. J Biol Chem 2011;286:
3352032.
46. Huang YH, Chin CC, Ho HN, Chou CK, Shen CN, Kuo HC, et
al. Pluripotency of mouse spermatogonial stem cells
maintained by IGF-1- dependent path- way. FASEB J
2009;23:207687.
47. Bulun SE, Lin Z, Imir G, Amin S, Demura M, Yilmaz B, et al.
Regulation of aromatase expression in estrogen-responsive
breast and uterine disease: from bench
to treatment.
Pharmacol Rev 2005;57:35983.
48. Jung JW, Park SB, Lee SJ, Seo MS, Trosko JE, Kang KS.
Metformin represses self-renewal of the human breast
carcinoma stem cells via inhibition of estrogen receptormediated OCT4 expression. PLoS One 2011;6:e28068.
49. Socolov R, Butureanu S, Angioni S, Sindilar A, Boiculese L,
Cozma L, et al. The value of serological markers in the
diagnosis and prognosis of endome- triosis: a prospective
case-control study. Eur J Obstet Gynecol Reprod Biol
2011;154:2157.
50. He RH, Yao WM, Wu LY, Mao YY. Highly elevated serum CA125 levels in patients with non-malignant gynecological
diseases. Arch Gynecol Obstet 2011;283(Suppl 1):10710.
51. Macdonald F, Bird R, Stokes H, Russell B, Crocker J.
Expression of CEA, CA125, CA19-9 and human milk fat
globule membrane antigen in ovarian tumours. J Clin
Pathol 1988;41:2604.

SUPPLEMENTAL FIGURE 1

Relative protein expression levels of migration-associated proteins in RL95-2 and HEC1A cells with or without OCT4 overexpression. Western blo
Chang. OCT4 in endometriosis and cell migration. Fertil Steril 2013.

VOL. - NO. - / 2013

8.e
1

SUPPLEMENTAL FIGURE 2

Effects of OCT4 overexpression on cell proliferation in human endometrial RL95-2 and HEC1A cell lines and primary endometrio
Chang. OCT4 in endometriosis and cell migration. Fertil Steril 2013.

SUPPLEMENTAL TABLE 1

Real-time polymerase chain reaction (PCR) primer sequences and product size.
Gene

Accession

Forward primers
0

Reverse primers
0

OCT4
NM_0027
5 -CAACTCCGATGGGGCCT-3
01
NANOG
NM_0248
50 -CCTGTGATTTGTGGGCCTG-30
VIMENTIN
NM_0033
65
50 -GAGAACTTTGCCGTTGAAGCChang. OCT4 in endometriosis and cell migration. Fertil
Steril 2013.
80
30 -TCTCGGTCTGGAGGATGGAGTWIST
NM_0004
5
0
SNAIL
NM_0059
74
3 -CTTCCAGCAGCCCTACGAC-30
5
85
SLUG
NM_0030
50 -GAGCATTTGCAGACAGGTCA68
30 NNM_0017
5
0
CADHERIN
92
GGTGGAGGAGAAGAAGACCAGB2M
NM_0040
5
48
GATGAGTATGCCTGCCGTGTG-30

550 0
GACAGTCTCCGTGTGAGGCAT5
-TCCAGCAGCTTCCTGTAGGT30 -GTTATCCAGCTCCAGAGTCT5
30 -CGGTGGGGTTGAGGATCT-30
5
50 -CCTCATGTTTGTGCAGGAGA30-GGCATCAGGCTCCACAGT-30
5
50 -CAATCCAAATGCGGCATCT30

Product size
(bp)
148
78
170
152
70
123
72
114

SUPPLEMENTAL TABLE 2
Antibodies
list. Protein
OCT4A
Vimentin
Twist
N-cadherin
E-cadherin
Slug
b-Actin
b-Actin

Assa
y
WB
WB
WB
WB
WB
WB
WB
ICC

Antibody Cat.
No.
2907
2707
sc-15393
2019
5409
9585
A5441
A5441

Compan
y
Epitomics
Epitomics
Santa Cruz
Biotech
Epitomics
Epitomics
Cell Signaling
Sigma
Sigma

Note: ICC immunocytochemistry; RT room temperature; WB Western

Chang. OCT4 in endometriosis and cell migration. Fertil Steril

2013.

blot.

Origin

Dilution

Rabbi
t
Rabbit
Rabbi
Rabbi
t
t
Rabbi
t
Rabbit
Mous
Mous
e

1:3,000
1:1,000
1:500
1:40,000
1:10,000
1:250
1:10,000
1:200

Incubation
period
Overnight, 4C
Overnight, 4C
Overnight, 4C
Overnight, 4C
Overnight, 4C
Overnight, 4C
Overnight, 4C
2 h, RT

SUPPLEMENTAL TABLE 3

The phase of uterine cycle in study population.

Endometriosis (n [ 58)
Sampling time (%) Endometrium (n [ 9) Myometrium (n [ 3) Hyperplasia (n [ 36) Adenomyosis (n [ 30) Chocolate cyst (n [ 28)
Chang. OCT4 in endometriosis and cell migration. Fertil Steril

Mense
Proliferative phase
Secretory phase

1 (11%)
5 (56%)
3 (33%)

2013.

0 (0)
3 (100%)
0 (0)

1
(3%)
35
(97%)
0 (0)

3 (10%)
12
(40%)
15
(50%)

2 (7%)
9 (32%)
17 (61%)