(Mónica V. Cunha, João Inácio) Veterinary Infec PDF

Methods in
Molecular Biology 1247
Mnica V. Cunha
Joo Incio Editors
Veterinary Infection
Biology: Molecular
Diagnostics and
High-Throughput
Strategies
METHODS
IN
MOLECULAR BIOLOGY
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Veterinary Infection Biology:

Molecular Diagnostics
and High-Throughput Strategies
Edited by
Mnica V. Cunha
Instituto Nacional de Investigao Agrria e Veterinria, Lisbon, Portugal
Centro de Biologia Ambiental, Faculdade de Cincias, Universidade de Lisbon, Lisbon, Portugal
Joo Incio
Instituto Nacional de Investigao Agrria e Veterinria, Lisbon, Portugal
School of Pharmacy and Biomolecular Sciences, University of Brighton, United Kingdom
Editors
Mnica V. Cunha
Instituto Nacional de Investigao
Agrria e Veterinria
Lisbon, Portugal
Joo Incio
Instituto Nacional de Investigao
Agrria e Veterinria
Lisbon, Portugal
Centro de Biologia Ambiental

Faculdade de Cincias, Universidade de Lisbon
Lisbon, Portugal
School of Pharmacy and Biomolecular Sciences

University of Brighton
United Kingdom
ISSN 1064-3745
ISSN 1940-6029 (electronic)
ISBN 978-1-4939-2003-7
ISBN 978-1-4939-2004-4 (eBook)
DOI 10.1007/978-1-4939-2004-4
Springer New York Heidelberg Dordrecht London
Library of Congress Control Number: 2014953901
Springer Science+Business Media New York 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this
legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for
the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work.
Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the
Publishers location, in its current version, and permission for use must always be obtained from Springer. Permissions
for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution
under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of publication, neither
the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be
made. The publisher makes no warranty, express or implied, with respect to the material contained herein.
Printed on acid-free paper
Humana Press is a brand of Springer
Springer is part of Springer Science+Business Media (www.springer.com)
Foreword
Infectious diseases of domestic and wild animals have a tremendous impact on the economy
and public health worldwide. Sixty percent of the pathogens that cause diseases in humans
have their source in animals (whether domestic or wild), as do 75 % of emerging human
diseases and 80 % of the pathogens that potentially could be used in bioterrorism. Animal
diseases that are transmissible to humans (collectively known as zoonoses), such as avian
influenza, rabies, bovine tuberculosis, and brucellosis, represent a very relevant public
health threat worldwide, being imperative to prevent and/or control them. Likewise,
pathogens that are not zoonotic but have a negative impact on livestock production, and
the associated financial income, should not be overlooked. Some estimates suggest that
world production of food animals is reduced by more than 20 % due to disease, which may
be particularly important in developing countries where the unavailability of animal protein
is socially impacting and inevitably exacerbates infectious diseases risk.
The World Organization for Animal Health (OIE) was created in 1924 with the aim of
controlling the international spread of infectious animal diseases, but currently, over and
above this original mission, the new mandate is to improve animal health worldwide. The
OIE builds its expertise on a global network of Reference Laboratories and Collaborating
Centers that play an essential role in prevention, detection, surveillance, and control of
animal diseases worldwide. Reference Laboratories serve as centers of scientific and technical expertise for official listed diseases and have particular responsibility for carrying out
confirmatory diagnostic tests for these diseases. Collaborating Centers are centers of expertise in key competences related to the management of a particular animal health issue, such
as epidemiology, diagnosis, risk analysis, welfare, or veterinary training. This global network
of excellence enables OIE to remain at the forefront of world veterinary scientific expertise
and successfully carry out its activities, providing authoritative scientific opinions and advice
on key topics, such as animal health and welfare and diagnostic techniques. Moreover, the
OIE is involved in the preparation of standards on diagnostic assays and their official validation which are published in the OIE Terrestrial Manual and Aquatic Manual and updated
annually by the World Assembly of the Delegates of the OIE (available from www.oie.int).
The achievements of biotechnology are significantly contributing to the development
of novel, rapid, and powerful diagnostic assays for animal diseases, namely based on molecular approaches, such as standard and real-time polymerase chain reaction and isothermal
nucleic acid amplification methods. The recent advent of high-throughput sequencing
technologies is also boosting the prompt detection of all microbes in a sample, uncovering
novel pathogens and significantly advancing veterinary diagnostic microbiology. Furthermore,
the analysis of single nucleotide and large sequence polymorphisms in the genome of
pathogens provides novel information on their traits, such as virulence and antimicrobial
resistance determinants, and supports epidemiological studies. Outstandingly, biotechnology is enabling the development of diagnostic kits that can ultimately be used in point-ofdecision settings, away from centralized laboratories to assist in local decision-making, for
instance during an outbreak. OIE is aware of the opportunities and challenges that these
novel molecular-based approaches bring to veterinary diagnosis and several OIE Reference
vi
Foreword
Laboratories and Collaborating Centers are also dedicated to Research and Development
activities on these fields. In this context, the present Springers book on the use of molecular biology strategies in veterinary laboratory practice showcases the versatility of the veterinarian profession in meeting the challenges posed by the continuous advance of science,
namely in the biotechnology field. The editors have succeeded in bringing together an
impressive group of renowned collaborating authors, primarily veterinary doctors and
researchers of veterinary science, from institutions with established and prized expertise in
the fields of molecular biology and veterinary diagnostics, including several OIE Reference
Laboratories and Collaborating Centers. This book provides therefore an excellent and
authoritative overview of molecular biology strategies for pathogen detection and characterization, along with the most recent technological innovations and their potential to
reconstruct transmission chains and to disclose pathogen biology, evolution, and interaction with the host. Beyond the techniques, the book also discusses the integration of these
new molecular approaches in the framework of veterinary practice and animal health
management. In recognition of the challenge faced by the public and private components
of Veterinary Services and all veterinarians to improve the animal health status worldwide,
this book may aid veterinary laboratories in setting up molecular diagnosis valences and is
a valuable resource to veterinary doctors and laboratory technicians, researchers, and
students of veterinary medicine and science interested in knowing more about these
challenging, but promising molecular strategies to unravel animal infectious diseases.
Director General
World Organization for Animal Health (OIE)
Bernard Vallat
Preface
Infectious diseases of animals represent a significant economic burden to economies worldwide and may raise relevant Public Health concerns. Molecular diagnostics has emerged as
the fastest growing and trending segment of the in vitro diagnostics industry and seems also
promising in the veterinary sector, providing novel and powerful tools that enable the fast
and accurate diagnosis of animal diseases.
In this book, we provide an overview of molecular biology tools for pathogen detection
and characterization, along with potential applications to disclose pathogen biology and
interaction with the host. In Part I, biobanking, biosafety and good laboratory practices,
biological specimen collection and processing, quality assurance and control, and validation
of molecular diagnostic assays for veterinary use are concisely introduced as a basis for the
molecular strategies enclosed in protocol sections. The significance and integration of
molecular biology methods in the framework of veterinary practice are discussed, along
with a SWOT analysis presenting our view on the advantages, limitations, opportunities
and weaknesses, or challenges, of these approaches. The rationale is on the techniques and
applications rather than the pathogen or disease models. Part II is dedicated to the molecular detection and identification of animal pathogens using a wide range of established techniques and covering, also, emerging diagnosis approaches. A brief overview of the advances
on nanoscience and microfluidics is provided, including a discussion on how the recent
developments in these research fields may be translated into field deployable biosensors.
Part III addresses genotyping tools for assessing the genetic landscape and epidemiology of
pathogens. Part IV introduces integrative omics and high-throughput technologies as powerful research tools, yielding massive amounts of information that may ultimately improve
the control and management of infectious diseases. We strived to span a broad range of
molecular approaches, from simple and affordable to emerging and sophisticated, which we
anticipate will be useful for veterinary doctors and laboratory technicians, researchers, and
students of veterinary medicine and science.
Lisbon, Portugal
Mnica V. Cunha
Joo Incio
vii
Acknowledgements
The editors were supported by Fundaco para a Cincia e Tecnologia (FCT, Portugal)
through projects PTDC/CVT/111634/2009 (JI) and PTDC/CVT/117794/2010 and
in the framework of Projecto 3599Promover a Produo Cientfica e Desenvolvimento
Tecnolgico e a Constituio de Redes Temticas (MVC). Alice Santos (INIAV IP, Lisbon,
Portugal) is acknowledged for the cover image artwork. The authors of Chap. 17 are
acknowledged for providing the fluorescence microscopy image used in the artwork.
ix
Contents
Foreword . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
PART I
v
vii
ix
xv
INTRODUCING NUCLEIC ACID TESTING

VETERINARY LABORATORY
IN THE
1 Overview and Challenges of Molecular Technologies in the Veterinary

Microbiology Laboratory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Mnica V. Cunha and Joo Incio
2 Significance and Integration of Molecular Diagnostics in the Framework
of Veterinary Practice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Alicia Aranaz
3 Biosafety Principles and Practices for the Veterinary Diagnostic Laboratory . . .
Joseph Kozlovac and Beverly Schmitt
4 Veterinary Biobank Facility: Development and Management
for Diagnostic and Research Purposes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Tina Lombardo, Silvia Dotti, Riccardo Villa, Stefano Cinotti,
and Maura Ferrari
5 Biological Specimen Collection and Processing for Molecular Analysis. . . . . . .
Susan Sanchez and Holly Sellers
6 Validation of Molecular Diagnostic Assays and Quality Assurance
and Control in the Veterinary Laboratory . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Nick Saunders and Ian Sharp
PART II
19
31
43
61
77
MOLECULAR DETECTION AND IDENTIFICATION OF ANIMAL

PATHOGENS IN LABORATORIAL SETTINGS
7 Molecular Approaches to Recognize Relevant and Emerging Infectious

Diseases in Animals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Fredrik Granberg, Oskar E. Karlsson, Mikael Leijon, Lihong Liu,
and Sndor Belk
8 Real-Time Reverse Transcriptase PCR for the Detection
of Bluetongue Virus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Carrie Batten, Lorraine Frost, and Chris Oura
9 Nested and Multiplex Real-Time PCR Using Dual-Labeled Probes:
Detecting and Discriminating Mycobacterium tuberculosis
Complex Members in Cultures and Animal Tissues . . . . . . . . . . . . . . . . . . . . .
Pedro Costa, Isabel Couto, Miguel Viveiros, and Joo Incio
xi
109
125
133
xii
Contents
10 A Real-Time PCR Assay for the Diagnosis of Gastrointestinal Nematode

Infections of Small Ruminants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Florian Roeber, Aaron R. Jex, and Robin B. Gasser
11 Improved Detection of Mycobacterium bovis in Bovine Tissues
Using Immunomagnetic Separation Approaches . . . . . . . . . . . . . . . . . . . . . . .
Irene R. Grant and Linda D. Stewart
12 Detection of Fish Pathogens by Loop-Mediated Isothermal
Amplification (LAMP) Technique . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Hatem Soliman, Mona Saleh, and Mansour El-Matbouli
13 Direct Detection of Theileria annulata in Bovine Blood Samples Using
Standard and Isothermal DNA Amplification Approaches . . . . . . . . . . . . . . . .
Jacinto Gomes and Joo Incio
14 Reverse Line Blot Hybridization with Species-Specific Oligonucleotide Probes:
Application to Piroplasm Detection. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ana Hurtado
15 DNA Microarray-Based Detection of Multiple Pathogens: Mycoplasma spp.
and Chlamydia spp.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Christiane Schnee and Konrad Sachse
16 In Situ Hybridization with Labeled Probes: Assessment of African Swine Fever
Virus in Formalin-Fixed Paraffin-Embedded Tissues . . . . . . . . . . . . . . . . . . . .
Maria Ballester and Fernando Rodrguez
17 Fluorescence In Situ Hybridization for the Tissue Detection of Bacterial
Pathogens Associated with Porcine Infections . . . . . . . . . . . . . . . . . . . . . . . . .
Henrik Elvang Jensen, Louise Kruse Jensen, Kristiane Barington,
Susanne Elisabeth Pors, Thomas Bjarnsholt, and Mette Boye
18 Identification of Animal Pasteurellaceae by MALDI-TOF Mass Spectrometry .
Joachim Frey and Peter Kuhnert
19 Gold Nanoparticles as a Potential Tool for Diagnosis of Fish Diseases . . . . . . .
Mona Saleh, Hatem Soliman, and Mansour El-Matbouli
20 Nucleic-Acid Testing, New Platforms and Nanotechnology
for Point-of-Decision Diagnosis of Animal Pathogens . . . . . . . . . . . . . . . . . . .
Fernando Teles and Lus Fonseca
PART III
145
153
163
175
183
193
209
219
235
245
253
MOLECULAR PROFILING OF VETERINARY RELEVANT

MICROBIAL PATHOGENS
21 Molecular Typing Tools: From Pattern Recognition to Genome-Based

Algorithms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Konrad Sachse and Petra Moebius
22 Characterization of Campylobacter jejuni and Campylobacter coli Genotypes
in Poultry Flocks by Restriction Fragment Length Polymorphism
(RFLP) Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ana Cludia Carreira and Mnica V. Cunha
23 Pulsed-Field Gel Electrophoresis (PFGE): Application in Population
Structure Studies of Bovine Mastitis-Causing Streptococci. . . . . . . . . . . . . . . .
Ilda Santos-Sanches, Llia Chambel, and Rogrio Tenreiro
287
311
323
Contents
24 Multiple-Locus Variable-Number Tandem Repeat (VNTR)

Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary
Electrophoresis: Application to the Genotyping of Brucella Species . . . . . . . . .
Giuliano Garofolo
25 Multilocus Sequence Typing (MLST): Markers for the Traceability
of Pathogenic Leptospira Strains . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ahmed Ahmed, Ana S. Ferreira, and Rudy A. Hartskeerl
26 Single-Nucleotide Polymorphism Discrimination Using High-Resolution
Melting Analysis for the Genotyping of Bacillus anthracis . . . . . . . . . . . . . . . .
Sylviane Derzelle
27 Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs)
Analysis of Members of the Mycobacterium tuberculosis Complex . . . . . . . . . . .
Ana Botelho, Ana Canto, Clia Leo, and Mnica V. Cunha
28 Rapid Microarray-Based Genotyping of Chlamydia spp. Strains
from Clinical Tissue Samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Konrad Sachse and Anke Ruettger
29 Multiplexed Genotyping of Bacillus anthracis by Luminex xMap
Suspension Array. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Simon Thierry and Sylviane Derzelle
PART IV
xiii
335
349
361
373
391
401
INTEGRATIVE OMICS AND HIGH-THROUGHPUT PLATFORMS

UNRAVEL THE BIOLOGY OF PATHOGENS AND THEIR INTERACTION
WITH THE HOST
TO
30 Next-Generation Sequencing in Veterinary Medicine: How Can the Massive

Amount of Information Arising from High-Throughput Technologies
Improve Diagnosis, Control, and Management of Infectious Diseases? . . . . . .
Steven Van Borm, Sndor Belk, Graham Freimanis, Alice Fusaro,
Fredrik Granberg, Dirk Hper, Donald P. King, Isabella Monne,
Richard Orton, and Toon Rosseel
31 Impact of Next-Generation Technologies on Exploring Socioeconomically
Important Parasites and Developing New Interventions . . . . . . . . . . . . . . . . .
Cinzia Cantacessi, Andreas Hofmann, Bronwyn E. Campbell,
and Robin B. Gasser
32 Functional Genomics of Tick Vectors Challenged with the Cattle
Parasite Babesia bigemina . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ana Domingos, Sandra Antunes, Margarita Villar, and Jos de la Fuente
33 Metagenomic Approaches to Disclose Disease-Associated Pathogens:
Detection of Viral Pathogens in Honeybees. . . . . . . . . . . . . . . . . . . . . . . . . . .
Fredrik Granberg, Oskar E. Karlsson, and Sndor Belk
34 Proteomics Characterization of Tick-Host-Pathogen Interactions . . . . . . . . . .
Marina Popara, Margarita Villar, and Jos de la Fuente
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
415
437
475
491
513
529
Contributors
AHMED AHMED WHO/FAO/OIE and National Collaborating Centre for Reference
and Research on Leptospirosis, Department of Biomedical Research, Royal Tropical
Institute (KIT), Amsterdam, The Netherlands
SANDRA ANTUNES Instituto de Higiene e Medicina Tropical, Universidade Nova de
Lisboa, Lisbon, Portugal
ALICIA ARANAZ Departamento de Sanidad Animal, Facultad de Veterinaria,
Universidad Complutense de Madrid, Madrid, Spain
MARIA BALLESTER Centre de Recerca en Sanitat Animal (CReSA), UAB-IRTA,
Campus de la Universitat Autnoma de Barcelona, Bellaterra (Cerdanyola del
Valls), Spain; Centre de Recerca en Agrigenmica (CRAG), Consorci CSIC-IRTAUAB-UB, Bellaterra, Spain; Departament de Cincia Animal i dels Aliments,
Facultat de Veterinria, Universitat Autnoma de Barcelona, Bellaterra, Spain
KRISTIANE BARINGTON Department of Veterinary Disease Biology, Faculty of Health
and Medical Sciences, University of Copenhagen, Frederiksberg C, Denmark
CARRIE BATTEN The Pirbright Institute, Surrey, UK
SNDOR BELK OIE Collaborating Centre for the Biotechnology-based Diagnosis of
Infectious Diseases in Veterinary Medicine, Swedish University of Agricultural
Sciences (SLU), Uppsala, Sweden; Department of Biomedical Sciences and Veterinary
Public Health (BVF), Swedish University of Agricultural Sciences (SLU), Uppsala,
Sweden; The National Veterinary Institute (SVA), Uppsala, Sweden
THOMAS BJARNSHOLT Department of International Health, Immunology and
Microbiology, Costerton Biofilm Center, Faculty of Health and Medical Sciences,
University of Copenhagen, Frederiksberg C, Denmark; Department of Clinical
Microbiology, Copenhagen University Hospital, Copenhagen, Denmark
STEVEN VAN BORM Veterinary and Agrochemical Research Center, Brussels, Belgium
ANA BOTELHO Instituto Nacional de Investigao Agrria e Veterinria IP, Lisbon,
Portugal
METTE BOYE National Veterinary Institute, Technical University of Denmark,
Kongens Lyngby, Denmark
BRONWYN E. CAMPBELL Department of Veterinary Science, The University of
Melbourne, Parkville, VIC, Australia
CINZIA CANTACESSI Department of Veterinary Science, The University of Melbourne,
Parkville, VIC, Australia
ANA CANTO Instituto Nacional de Investigao Agrria e Veterinria IP, Lisbon,
Portugal
ANA CLUDIA CARREIRA iMed.ULResearch Institute for Medicines and
Pharmaceutical Sciences, Nanomedicine & Drug Delivery Systems Group, Faculdade
de Farmcia, Universidade de Lisboa, Lisbon, Portugal; Instituto Nacional de
Investigao Agrria e Veterinria, I.P. (INIAV, I.P.), Lisbon, Portugal
xv
xvi
Contributors
LLIA CHAMBEL Centro de Biodiversidade, Genmica Integrativa e Funcional,

Faculdade de Cincias, Universidade de Lisboa, Lisbon, Portugal
STEFANO CINOTTI Cell Culture CentreA, Istituto Zooprofilattico Sperimentale della
Lombardia e dellEmilia Romagna (IZSLER), Brescia, Italy
PEDRO COSTA Instituto Nacional de Investigao Agrria e Veterinria IP, Lisbon,
Portugal; Instituto de Higiene e Medicina Tropical, Universidade Nova de Lisboa,
Lisbon, Portugal
ISABEL COUTO Instituto de Higiene e Medicina Tropical, Universidade Nova de
MNICA V. CUNHA Instituto Nacional de Investigao Agrria e Veterinria IP,
Lisbon, Portugal; Centro de Biologia Ambiental, Faculdade de Cincias,
Universidade de Lisbon, Lisbon, Portugal
SYLVIANE DERZELLE Bacterial Zoonosis Unit, Animal Health Laboratory, University
Paris-Est, Anses, Maisons-Alfort, France
ANA DOMINGOS Centro de Malria e Outras Doenas Tropicais; Instituto de Higiene
e Medicina Tropical, Universidade Nova de Lisboa, Lisbon, Portugal
SILVIA DOTTI Cell Culture Centre, Istituto Zooprofilattico Sperimentale della
MANSOUR EL-MATBOULI Clinical Division of Fish Medicine, University of Veterinary
Medicine, Vienna, Austria
MAURA FERRARI Cell Culture Centre, Istituto Zooprofilattico Sperimentale della
ANA S. FERREIRA Instituto Nacional de Investigao Agrria e Veterinria IP,
Lisbon, Portugal
LUS FONSECA Department of Bioengineering, Instituto Superior Tcnico (IST),
Institute for Biotechnology and Bioengineering (IBB), Centre for Biological and
Chemical Engineering, Lisbon, Portugal
GRAHAM FREIMANIS The Pirbright Institute, Pirbright, UK
JOACHIM FREY Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of
Bern, Bern, Switzerland
LORRAINE FROST The Pirbright Institute, Surrey, UK
JOS DE LA FUENTE SaBio, Instituto de Investigacin en Recursos Cinegticos IREC,
UCLM-JCCM, Ciudad Real, Spain; Department of Veterinary Pathobiology, Center
for Veterinary Health Sciences, Oklahoma State University, Stillwater, OK, USA
ALICE FUSARO Istituto Zooprofilattico Sperimentale delle Venezie, Padova, Italy
GIULIANO GAROFOLO Istituto Zooprofilattico Sperimentale dellAbruzzo e del Molise
G. CaporaleNational and OIE Reference Laboratory for Brucellosis, Teramo,
Italy
ROBIN B. GASSER Department of Veterinary and Agricultural Sciences,
The University of Melbourne, Parkville, VIC, Australia; Institute of Parasitology
and Tropical Veterinary Medicine, Berlin, Germany
JACINTO GOMES Instituto Nacional de Investigao Agrria e Veterinria IP, Lisbon,
Portugal
FREDRIK GRANBERG OIE Collaborating Centre for the Biotechnology-based Diagnosis
of Infectious Diseases in Veterinary Medicine, Swedish University of Agricultural
Contributors
xvii
Public Health (BVF), Swedish University of Agricultural Sciences (SLU),

Uppsala, Sweden
IRENE R. GRANT Institute for Global Food Security, School of Biological Sciences,
Queens University Belfast, Northern Ireland, UK
RUDY A. HARTSKEERL WHO/FAO/OIE and National Collaborating Centre for
Reference and Research on Leptospirosis, Department of Biomedical Research, Royal
Tropical Institute (KIT), Amsterdam, The Netherlands
ANDREAS HOFMANN Structural Chemistry Program, Eskitis Institute, Griffith
University, Brisbane, QLD, Australia
DIRK HPER Friedrich Loeffler InstitutFederal Research Institute for Animal
Health, Riems (Greifswald), Germany
ANA HURTADO Department of Animal Health, NEIKERInstituto Vasco de
Investigacin y Desarrollo Agrario, Bizkaia, Spain
JOO INCIO Instituto Nacional de Investigao Agrria e Veterinria IP, Lisbon,
Portugal; School of Pharmacy and Biomolecular Sciences, University of Brighton,
Brighton, UK
HENRIK ELVANG JENSEN Department of Veterinary Disease Biology, Faculty of Health
LOUISE KRUSE JENSEN Department of Veterinary Disease Biology, Faculty of Health
AARON R. JEX Faculty of Veterinary and Agricultural Sciences, The University of
Melbourne, Parkville, VIC, Australia
OSKAR E. KARLSSON OIE Collaborating Centre for the Biotechnology-based Diagnosis
of Infectious Diseases in Veterinary Medicine, Swedish University of Agricultural
Public Health (BVF), Swedish University of Agricultural Sciences (SLU), Uppsala,
Sweden
DONALD P. KING The Pirbright Institute, Pirbright, UK
JOSEPH KOZLOVAC United States Department of Agriculture (USDA), Agricultural
Research Service (ARS), Office of National Programs, Beltsville, MD, USA
PETER KUHNERT Institute of Veterinary Bacteriology, Vetsuisse Faculty, University of
Bern, Bern, Switzerland
CLIA LEO Instituto Nacional de Investigao Agrria e Veterinria IP, Lisbon,
Portugal
MIKAEL LEIJON OIE Collaborating Centre for the Biotechnology-based Diagnosis
of Infectious Diseases in Veterinary Medicine, Uppsala, Sweden; The National
Veterinary Institute (SVA), Uppsala, Sweden
LIHONG LIU OIE Collaborating Centre for the Biotechnology-based Diagnosis
of Infectious Diseases in Veterinary Medicine, Uppsala, Sweden; The National
Veterinary Institute (SVA), Uppsala, Sweden
TINA LOMBARDO Cell Culture Centre, Istituto Zooprofilattico Sperimentale della
PETRA MOEBIUS Institute of Molecular Pathogenesis at Friedrich-Loeffler-Institut
(Federal Research Institute for Animal Health), Jena, Germany
ISABELLA MONNE Istituto Zooprofilattico Sperimentale delle Venezie, Padova, Italy
RICHARD ORTON Institute of Biodiversity, Animal Health and Comparative
Medicine, University of Glasgow, Glasgow, UK
xviii
Contributors
CHRIS OURA School of Veterinary Medicine, University of the West Indies, St. Augustine,
Trinidad and Tobago
MARINA POPARA SaBio, Instituto de Investigacin en Recursos Cinegticos IREC,
UCLM-JCCM, Ciudad Real, Spain
SUSANNE ELISABETH PORS Department of Veterinary Disease Biology, Faculty of
Health and Medical Sciences, University of Copenhagen, Frederiksberg C, Denmark
FERNANDO RODRIGUEZ Centre de Recerca en Sanitat Animal (CReSA), UAB-IRTA,
Campus de la Universitat Autnoma de Barcelona, Bellaterra (Cerdanyola del
Valls), Spain
FLORIAN ROEBER Faculty of Veterinary and Agricultural Sciences, The University
of Melbourne, Parkville, VIC, Australia; AusDiagnostics Pty. Ltd., Beaconsfield,
NSW, Australia
TOON ROSSEEL Veterinary and Agrochemical Research Center, Brussels, Belgium
ANKE RUETTGER Institute of Molecular Pathogenesis at Friedrich-Loeffler-Institut
KONRAD SACHSE Institute of Molecular Pathogenesis at Friedrich-Loeffler-Institut
MONA SALEH Clinical Division of Fish Medicine, University of Veterinary Medicine,
Vienna, Austria
SUSAN SANCHEZ Athens Veterinary Diagnostic Laboratory, College of Veterinary
Medicine, The University of Georgia, Athens, GA, USA
ILDA SANTOS-SANCHES Centro de Recursos Microbiolgicos, Departamento de Cincias
da Vida, Faculdade de Cincias e Tecnologia, Universidade Nova de Lisboa, Lisbon,
Portugal
NICK SAUNDERS Public Health England (PHE), Microbiology Services Colindale,
London, UK
BEVERLY SCHMITT United States Department of Agriculture (USDA), Animal
and Plant Health Inspection Service, National Veterinary Services Laboratories,
Ames, Iowa, USA
CHRISTIANE SCHNEE Institute of Molecular Pathogenesis at Friedrich-Loeffler-Institut
HOLLY SELLERS Poultry Diagnostic and Research Center, College of Veterinary
Medicine, The University of Georgia, Athens, GA, USA
IAN SHARP Public Health England (PHE), Microbiology Services Colindale, London,
UK
HATEM SOLIMAN Clinical Division of Fish Medicine, University of Veterinary
Medicine, Vienna, Austria; Fish Medicine and Managements, Department
of Animal Medicine, Faculty of Veterinary Medicine, Assiut University, Assiut, Egypt
LINDA D. STEWART Institute for Global Food Security, School of Biological Sciences,
Queens University Belfast, Northern Ireland, UK
FERNANDO TELES Laboratory of Mycology/Microbiology Unit and Centre for Malaria
and Tropical Diseases (CMDT), Institute of Hygiene and Tropical Medicine
(IHMT), Universidade Nova de Lisboa (UNL), Lisbon, Portugal
ROGRIO TENREIRO Centro de Biodiversidade, Genmica Integrativa e Funcional,
Faculdade de Cincias, Universidade de Lisboa, Lisbon, Portugal
Contributors
xix
SIMON THIERRY Bacterial Zoonosis Unit, Animal Health Laboratory, University

Paris-Est, Anses, Maisons-Alfort, France
BERNARD VALLAT World Organization for Animal Health (OIE), Paris, France
RICCARDO VILLA Cell Culture Centre, Istituto Zooprofilattico Sperimentale della
MARGARITA VILLAR SaBio, Instituto de Investigacin en Recursos Cinegticos IREC,
UCLM-JCCM, Ciudad Real, Spain
MIGUEL VIVEIROS Instituto de Higiene e Medicina Tropical, Universidade Nova de
Part I
Introducing Nucleic Acid Testing in the Veterinary Laboratory
Chapter 1
Overview and Challenges of Molecular Technologies
in the Veterinary Microbiology Laboratory
Abstract
Terrestrial, aquatic, and aerial animals, either domestic or wild, humans, and plants all face similar health
threats caused by infectious agents. Multifaceted anthropic pressure caused by an increasingly growing and
resource-demanding human population has affected biodiversity at all scales, from the DNA molecule to
the pathogen, to the ecosystem level, leading to species declines and extinctions and, also, to host-pathogen
coevolution processes.
Technological developments over the last century have also led to quantic jumps in laboratorial testing that have highly impacted animal health and welfare, ameliorated animal management and animal
trade, safeguarded public health, and ultimately helped to secure biodiversity. In particular, the field of
molecular diagnostics experienced tremendous technical progresses over the last two decades that significantly have contributed to our ability to study microbial pathogens in the clinical and research laboratories.
This chapter highlights the strengths, weaknesses, opportunities, and threats (or challenges) of molecular
technologies in the framework of a veterinary microbiology laboratory, in view of the latest advances.
Key words Molecular diagnostics, Veterinary microbiology, Nucleic acid testing, Animal health,
Animal welfare, Public health, Biodiversity, Validation, In-house, Molecular assays, Quality assurance,
Quality control
Introduction
Active and passive surveillance of infectious diseases in farmed and
wild animals enable the detection of (re)emergent pathogens and the
monitoring of endemic and/or zoonotic diseases and, ultimately,
back up stakeholders, supporting national and international policies
aimed at the protection of animal health and welfare, food security
and public health, and the trade of animals and animal products.
During recent years, the world has witnessed the emergence or
reemergence of a number of major animal diseases such as footand-mouth disease (FMD), bluetongue, classical swine fever (CSF),
and avian influenza, which are emblematic examples of the overwhelming economic, social, and public health impacts that animal diseases may cause. Effective surveillance and control of animal
Mnica V. Cunha and Joo Incio (eds.), Veterinary Infection Biology: Molecular Diagnostics and High-Throughput Strategies,
Methods in Molecular Biology, vol. 1247, DOI 10.1007/978-1-4939-2004-4_1, Springer Science+Business Media New York 2015
diseases require a rapid and accurate detection of the etiological

agent by the use of effective diagnostic tests. Veterinary microbiology laboratories play a fundamental role in this context, the main
purposes being the detection, identification, and characterization of
any pathogenic organisms present in a diverse range of biological
samples, such as tissues, blood, urine, and other fluids collected
from suspect animals. The characterization of the microorganisms
may include drug susceptibility testing and genotyping of the isolates for epidemiological purposes, which is essential to track sources
and routes of infection, as well as for pathogen population studies.
The direct observation by optical microscopy of biological samples,
usually stained by different processes, may give a first indication of
the presence of a microorganism. Histopathological examination
of hematoxylin-eosin-stained paraffin-embedded tissues may also
give indications on the infectious disease and the putative agent,
thus potentially complementing the diagnostic algorithm. However,
the confirmation of an infection usually involves the isolation of the
causative agent(s), followed by identification through additional
phenotypic tests. Also widely used are immunological-based diagnostic methods relying on the specific binding between antigens
and antibodies. These methods allow detecting the presence of
antibodies produced in response to an antigen, or the presence
of an antigen, through various experimental formats, such as agglutination tests, immunofluorescence, and ELISA. All these laboratory diagnostic approaches are based on the analyses of phenotypic
characteristics of the microorganisms and can be designated as traditional, classical, or conventional methods. In contrast, the socalled molecular diagnostics methods detect or analyze, in the
majority of the cases, genotypic characteristics of the microorganisms, such as the presence of certain genes or their respective
polymorphisms. In this context, it is possible to identify the microorganisms at different taxonomic levels, from domain to species,
and even down to intraspecific levels, through the analysis of genes
or other genome regions. Moreover, relevant information can be
obtained about pathogenic microorganisms by the analysis of
molecular determinants encoding virulence factors (e.g., toxins) or
conferring antimicrobial resistance. Importantly, in this field are the
availability, appropriateness, and accuracy of diagnostic and phenotypic characterization tests to avoid selective pressure from unnecessary or erroneous antimicrobial use during therapy.
The field of molecular diagnostics experienced tremendous
technological developments in the last two decades that have contributed significantly to our ability to study microbial pathogens in
the clinical laboratory. Molecular methods have thus been taking
an increasingly important role, supporting, complementing, and,
in some cases, even replacing the conventional methods. This
chapter highlights some of the strengths, weaknesses, opportunities, and threats (or challenges) of molecular technologies designed
for the diagnosis of infectious diseases in animals.
Challenges of Molecular Technologies in Veterinary Diagnosis
Molecular Diagnostics Market

Molecular diagnostics appears as one of the highest growth segments within the overall in vitro diagnostics (IVD) market, which is
currently estimated at approximately 36,000 million, and is fourth
in terms of sales behind the segments of immunology, blood glucose
tests, and clinical chemistry [1]. The market for molecular diagnostics thus passed from a nonexistent dimension in 1990 to over
3,000 million in 2011, with a forecast of 4,980 million for 2016
[1], corresponding to a compound annual growth rate (CAGR) of
almost 11 %. In this segment, nearly two thirds of the market value
corresponds to the use of molecular tests for the diagnosis of infectious diseases and to the study of their agents (approximately 1,950
million in 2011), including sales of reagents, equipments, services,
products for extraction of nucleic acids, and other consumables. Of
this amount, approximately 1,155 million (59 %) is dedicated to
the diagnosis of viral diseases, with a particular emphasis on real-time
PCR-based tests. The remaining amount corresponds mainly to the
diagnosis of bacterial infections, with particular emphasis for microorganisms such as Chlamydia trachomatis, Neisseria gonorrhoeae,
methicillin-resistant Staphylococcus aureus (MRSA), and Clostridium
difficile. The market for molecular diagnostics of fungal agents and
other eukaryotic parasites is still very small.
The overall veterinary IVD market is a fraction of that of the
human market and was recently estimated at 2,064 million
(in 2013), with a forecast of 3,030 million in 2018, representing
a CAGR of about 8 % [2]. The market is mainly driven by the growing incidences of disease outbreaks and of zoonotic diseases, the
increasing companion animal market (backed up by the rise in the
adoption of pets), the increase in the disposable incomes in developing countries, and a rising demand for clinical diagnostic tests
specifically designed for food-producing animals (in order to meet
the demand for safe meat and dairy products and the increasing
number of livestock) [2]. The majority of sales occur in the United
States (45 %) and Europe (30 %), but the demand for veterinary
diagnostic tests is steadily growing in the Asia-Pacific and Latin
American countries. The main segments of the veterinary IVD market are clinical chemistry, immunodiagnosis, and hematology, with
the fourth position corresponding to the molecular diagnostics, with
a total market value estimated at around 292 million. This last figure should increase to approximately 500 million in 2018 [2].
Brief Overview of Molecular Technologies in the Veterinary Microbiology

Laboratory
Molecular methods have two main applications in the veterinary
microbiology laboratories. Firstly, and probably the most common, these methods are used as tools to identify, characterize, and
genotype the microorganisms following their culture and isolation

from samples. Secondly, these methods can be used to detect
pathogen nucleic acids directly in the biological samples, allowing
working with inactivated materials, thereby reducing the risk of
environmental contamination and occupational infection when the
pathogens are also zoonotic. The molecular diagnostics technologies comprise basically two main strategies: the hybridization and
the amplification of nucleic acids, although many systems based on
the amplification include additional steps of hybridization to identify the amplified products.
The direct hybridization with labeled DNA probes allows the
identification of microorganisms cultured from biological samples
and, in some cases, the direct detection of their presence in those
samples. Among the firstly described applications of nucleic acid
hybridization methods in the veterinary context, we find, for
example, the detection of bovine herpesvirus type 1 in bovine exudates [3] and of Trypanosoma evansi in infected blood samples [4].
In a more recent example, the hybridization with specific complementary DNA probes has allowed the discrimination between
Streptococcus species associated with mastitis in cattle [5]. Despite
their high specificity, the applications based on the direct hybridization of nucleic acids were never really adopted for the clinical
routine diagnosis, since they are very labor-intensive, costly, and
slow. Additionally, these applications usually have a reduced sensitivity since a high number of target DNA copies must be present in
the sample. To circumvent this difficulty, in vitro cultivation may
yield a high number of the target microorganisms, bringing an
additional limitation in cases where the handling of large quantities
of viable pathogens is not recommended.
The most used nucleic acid amplification technology in veterinary microbiology laboratories is, undoubtedly, the polymerase
chain reaction (PCR), introduced in the mid-1980s [6]. Reverse
transcriptase PCR was also introduced at that time, allowing producing copies of DNA from RNA templates [7]. Among the first
applications of PCR in the veterinary field, we find examples for
the detection of porcine herpesvirus type I (causing Aujeszky disease) [8]; of Neorickettsia risticii (formerly, Ehrlichia risticii) [9],
implicated in the Potomac horse fever; of the equine herpesvirus
type 1 [10], responsible for respiratory, neurological, and abortion
problems in horses; of Toxoplasma gondii in sheep [11]; and of
Babesia and Theileria parasites in cattle [12], among others. There
are currently thousands of published works describing the use of
PCR-based methods to detect, identify, and characterize pathogenic microorganisms of veterinary relevance, these methods being
particularly useful for the study of fastidious organisms that are
difficult or impossible to cultivate in artificial media, such as viruses
and bacteria of the genera Brucella, Mycobacterium, Rickettsia, and
Chlamydia, among many others. An important landmark that
greatly contributed to the accumulation and popularity of molecular

technologies in diagnostic laboratories, including the veterinary
context, was the introduction of the real-time PCR in the mid1990s [13, 14], enabling the detection of amplified nucleic acids as
they are being synthesized. This technology also allows quantifying
the number of copies of template nucleic acids present in a sample,
useful, for example, to estimate viral loads, to monitor the success
of antimicrobial therapies, and to potentially discriminate infection, colonization, or contamination of the samples. The technology of real-time PCR has been widely exploited to support the
diagnosis of viral diseases, of which many are notifiable to the
World Organisation for Animal Health (OIE), such as FMD, CSF,
and bluetongue [15]. Many other applications have also been
developed to detect veterinary-relevant bacteria, such as particular
ecotypes within the Mycobacterium tuberculosis complex species
[16] and eukaryotic parasites, such as Theileria annulata [17].
Among the strategies for nucleic acid amplification are also
worthy of note those based on isothermal processes. For example,
the technology of nucleic acid sequence-based amplification
(NASBA) has been used to develop diagnostic tests for several
viruses with single-stranded RNA genomes, such as the FMD virus
[18]. In another example, the technology of loop-mediated isothermal amplification (LAMP) has gained increasing interest in
recent years for the use in molecular diagnostics tests, and there are
also several references within a veterinary context, for example, for
the detection of the CSF virus [19], the FMD virus [20], and species of Brucella [21].
The DNA fragments amplified by PCR or by other technology
of nucleic acid amplification can also be analyzed by hybridization
with DNA probes immobilized on solid supports (reverse hybridization), such as nylon or nitrocellulose membranes, glass, or other
materials. The reverse hybridization technology on nylon or nitrocellulose membranes has been used, for example, to detect and
identify species of Babesia and Theileria directly from blood samples of cattle [22, 23], and to genotype Mycobacterium bovis and
other veterinary-relevant tuberculous mycobacteria by spoligotyping [24, 25]. Several systems are currently commercialized that
may enable a differential diagnosis result within hours. High-density
systems for reverse hybridization have been also developed, commonly known as microarrays, allowing the simultaneous analysis of
hundreds to thousands of different genomic targets in the same
assay. Microarrays are particularly useful for studies of gene expression, and, although still very expensive, some applications have also
been described for the detection and identification of veterinaryrelevant pathogens such as Mycoplasma spp. [26].
Nucleic acid sequencing has also become common for
microbiological diagnostic laboratories due to the rapid technological developments in this field and the consequent reduction
of associated costs. The sequencing of certain genes or other

genomic regions amplified by PCR enables to easily identify and
genotype the microorganisms, by using, for example, multilocus
sequence typing (MLST) approaches [27]. The more recent
introduction of the next-generation sequencing and metagenomics technologies has, among other applications, allowed the
discovery and characterization of newly emerging or unknown
pathogens, independently from culture, excellent examples being
the identification of the Schmallenberg virus [28] that recently
affected cattle in Europe, or the recognition of viruses that
affect bees [29].
SWOT Analysis of Molecular Diagnostics Technologies

The available information in the literature on the development and
application of molecular diagnostics methods is profuse, including
the description of methods for the detection and identification of
veterinary-relevant pathogens causing diseases listed by the
OIE. However, relatively few molecular methods in the form of
widespread tests or diagnostic services have been successfully arriving to the IVD market and seldom have been adopted officially by
national and international veterinary authorities as reference methods for a particular animal infection or disease. The use of molecular tests turns out to be optional in most laboratories, being used
only when the classical diagnostic methods do not allow a satisfactory response [30]. Despite the great advantages normally associated with molecular diagnostics technologies, for example, in terms
of specificity and sensitivity, accuracy, and speed of response, laboratories face several challenges in the implementation and use of
these methods and, sometimes, in the interpretation of the clinical
relevance of the results. In Table 1, we detail our view on the most
relevant strengths, current weaknesses, opportunities, and threats,
or challenges, associated with molecular diagnostics technologies,
possibly contributing to a better comprehension of the current
state of the art of the IVD segment in the context of veterinary
diagnosis and to outline some clues regarding the future.
The implementation and use of molecular methods is usually
more expensive when compared to the classic microbiological
diagnostic tests, since they usually require a relatively sophisticated
laboratory infrastructure and equipments, and reagents and consumables are also typically more costly. In addition, the procedures
may be more demanding and/or have increased complexity, in
particular to prevent the occurrence of cross-contamination that
may lead to false-positive results, which in turn require more specialized technical personnel. However, the simplification and
increasing automation of various procedures have been contributing to a greater integration of molecular diagnostics methods in
Table 1
SWOT analysis of molecular diagnostics technologies in the veterinary microbiology laboratory
Strengths
Weaknesses
Overall higher analytical and diagnostic

sensitivities and specificities, higher
accuracy, and shorter time-to-result
Suitable for the analysis of a large
number of samples (e.g., high sample
throughput in automated systems)
Suitable for the detection of a wide range
of pathogens, at different taxonomic
levels (e.g., virus, bacteria, fungi,
protozoa, and other eukaryotic parasites;
detects fastidious microorganisms and
those that cannot be cultured)
Allow the discovery and characterization
of newly emerging or unknown
pathogens (e.g., broad-range PCR assays
or metagenomics)
Can be also used after the starting of
antimicrobial therapy (results not affected
by the presence of antimicrobials in
samples)
Eventual delays in sample collection,
transport, and storage have less effects
on the final result (DNA is a very stable
molecule)
Suitable for identifying antimicrobial
resistance and highly virulent strains
(by targeting the respective trait-associated
genes)
Possibility to detect several pathogens or
respective genetic traits simultaneously
(multiplexing capability, allowing to
obtain more information per single test,
at a lower cost)
Suitable for the direct analysis of a wide
range of biological samples (e.g., tissues,
blood, and other fluids; nucleic acids of the
pathogens can be detected directly in the
samples, allowing to work with
inactivated materials)
Possibility of quantification of target
nucleic acids in samples (e.g., to assess
viral load in the blood, to discriminate
between infection, colonization, and
contamination, to guide treatments,
and to monitor progress of disease)
High discriminatory power for
microorganisms typing (e.g., to track
sources of infection, assess transmission
chains and epidemiology studies)
Molecular data is easily shared using
public databases online, and a wide
range of bioinformatics tools for analysis
is available
Higher costs for establishing a molecular biology

laboratory (including facilities, equipments, and skilled
technicians)
Comparatively more expensive reagents and
consumables (also usually requiring more costly
transportation and storage conditions, such as a cold
chain)
Usually requires technically complex procedures (with
meticulous following of effective standard operating
procedures and quality control; accuracy, reproducibility,
and reliability of some assays may depend on the expertise
of the technician and of other factors such as instruments
calibration and batch-to-batch variation of reagents)
Higher potential for the occurrence of false-positive
results (e.g., due to specimen contamination by target
nucleic acids)
Higher potential for the occurrence of false-negative
results (e.g., related to the difficulty of extracting
pathogens nucleic acids from some specimens or to the
presence of inhibitors of amplification reactions)
Nucleic acid detection may not always prove
involvement in infectious processes (e.g., in active vs.
latent infections, asymptomatic animal carriers, and
opportunistic pathogens members of the normal microbial
flora)
Nucleic acid detection cannot usually differentiate
between viable and nonviable microorganisms (unless
the molecular target is, for example, messenger RNA,
which is more technically demanding)
Single use of molecular techniques does not allow
archiving of samples for future study (e.g.,
microorganisms are not normally isolated in pure
culture, which can limit epidemiological surveillance)
(continued)
10
Table 1
(continued)
Opportunities
Threats
molecular diagnostics is one of the highest

growth segments within the IVD market
Rising demand for clinical diagnostic
tests for food-producing and companion
animals
Less strict regulations in the veterinary
IVD sector can promote a more rapid
adoption of new technologies (when
compared with the human IVD sector)
Professional guidelines and educational
efforts to disseminate molecular
diagnostics and data interpretation
Increasing automation of molecular
diagnostic assays (contributing to a
greater integration in diagnostic
laboratories, making also possible the
remote analysis, and lowering the cost per
test)
Demand for diagnostic tests for use in
the point of decision (e.g., directly at
farms, slaughterhouses, or local veterinary
clinics and laboratories)
Demand for the development of simple,
efficient, and fast nucleic acid extraction
and purification assays
Novel technologies becoming more
mature for the development of
alternative molecular diagnostic tests
(e.g., microfluidics and nanotechnology;
biosensors)
Novel applications and increasing
affordability of next-generation
sequencing approaches (e.g.,
metagenomics)
Increased amounts of gene and genome
sequences information in publicly
available databases
Some expertise in classical diagnostic
methods is disappearing (e.g., expertise
in virus culture and electronic microscopy)
Pressure to keep a low cost per analysis in the

veterinary field (which is more pronounced in the
livestock segment than in the companion animal
segment, including pets and horses; may limit a more
widespread adoption of molecular diagnostics
technologies)
Lack of harmonization between the molecular tests
used among different laboratories (which may yield
contradicting results, also related with different levels of
exigency in the implementation of these tests)
Clear algorithms for the use and interpretation of the
medical relevance of molecular results may be difficult
to establish (standards for reporting molecular data
and respective interpretative criteria need to be
established for most infectious diseases)
Conservatism of the medical personnel in the adoption
and prescription of new diagnostics technologies (also
associated with the usually little importance given to
molecular diagnostics technologies in veterinary medical
curricula)
Difficulty in assessing reference materials and good
gold standard methods to validate molecular tests
clinical laboratories. With the currently available technology, it is

now possible to process and extract nucleic acids from hundreds of
samples and proceed to analysis for defined genetic markers in less
than a working day. Thus, the ability of molecular-based methods
to analyze hundreds or thousands of samples in a short time, and a
greater speed to reach the final results (also potentially contributing to limit the use of unnecessary empirical antimicrobial therapies),
11
may generate substantial savings, making these technologies more

competitive in terms of cost per analysis. An earlier detection of the
infectious agents in diseased or carrier animals may also limit the
spread of these pathogens to neighbor animals (and even to
humans) and improve the overall quality of the veterinary service.
Another important aspect is related to the sensitivity of molecular methods. It is widely recognized that the analytical sensitivity of
these methods is extremely high, particularly in those based on the
amplification of nucleic acids, often being possible to detect the
presence of a single copy of the target nucleic acid in the reaction
mixture. In contrast, the performance of molecular methods may
become unsatisfactory for the detection of nucleic acids directly
from samples, yielding false-negative results. A problem still largely
unsolved concerns the processes of extraction and purification of
nucleic acids from biological samples (e.g., blood or tissues). The
extraction and purification of microbial nucleic acids from some
biological matrices prove to be complicated, due to the intrinsic
characteristics of the agents (e.g., difficulty to lyse cell walls, such as
in bacteria from the Mycobacterium tuberculosis complex), due to
the presence of a much higher proportion of nucleic acids from host
animals, or related to the presence of inhibitory compounds in the
nucleic acid extracts that may affect the success of the amplification
reactions [16]. Protocols for the extraction of nucleic acids, including several steps of mechanical, chemical, or enzymatic lysis, and
several purification steps can be efficiently used in research, but are
not practical or are too expensive for routine use. Thus, the availability of efficient, consistent, and reproducible nucleic acid extraction processes adapted for difficult biological matrices, yet affordable
and simple to use, is still an unmet need that has hindered the widespread routine use of molecular methods in the veterinary microbiology laboratory. The consistency of the extraction process becomes
even more critical if the aim involves the quantification of the
pathogenic agents in the samples.
Another major challenge of molecular diagnostics lies in the
lack of harmonization of the operational procedures used among
different laboratories, which contrasts greatly with the situation of
conventional diagnostic methods, whose use is very standardized.
In veterinary medicine, molecular tests are largely designed inhouse and implemented locally in different laboratories, as there
are fewer commercial diagnostic kits available (also due to the
smaller IVD market). Thus, to detect the same agent in the same
type of sample, laboratories may use different methods for the
extraction of nucleic acids and/or discrepant primer sequences
and/or diverse amplification conditions. Consequently, the comparison of results among different laboratories is complicated and
may even be contradictory, an illustrative example being the discrepant results for the PCR-based diagnosis of feline immunodeficiency virus (FIV) infection in cats by different laboratories using
parallel samples [31]. The level of optimization and exigency in the
12
implementation of molecular diagnostics methods varies greatly

from laboratory to laboratory, from those that simply reproduce a
particular system that has been described elsewhere in the literature, offering little quality control to those who effectively conduct
a technical validation and quality control of the methods, assessing
their specificity, sensitivity, and positive and negative predictive values, among other features.
Important in this context is the availability of reference materials and adequate gold standard diagnostic methods to validate
and assess the performance of molecular tests. International
agencies, such as the OIE, are making efforts to alert for the need
for international standardization and validation of molecular tests
for the use in veterinary microbiology laboratories and are making available relevant guidelines and procedures toward that aim.
Nevertheless, since there is currently no major regulatory validation hurdles for the marketing of veterinary molecular diagnostic
tests for infectious diseases, veterinarians and technicians must
keep themselves informed and be smart buyers of these tests or
services [32].
Perhaps one of the major challenges with regard to the molecular diagnostics technologies is precisely the interpretation of the
clinical relevance of a positive or negative test. A negative result,
which may indicate the absence of the agent, should always be
interpreted considering the limitations of the specificity and sensitivity of the molecular test since, as mentioned above, false-negative
results may occur, for example, due to the inefficiency of the nucleic
acid extraction methods. With respect to the positive tests, the
interpretation could be considered straightforward, for example, in
cases where the presence of a particular pathogenic agent implies
the occurrence of disease. However, a positive amplification result
does not always mean that the agent is present in the sample in a
viable state. The agent may be dead or nonviable, or there may be
only remnants of nucleic acids (e.g., in animals that began therapy
or when the agents have been successfully eliminated by the
immune system) [33]. An interesting but yet unanswered question
for different infectious diseases is how long the nucleic acid of
causal agent may remain detectable in the samples after treatment
and/or recovery of the animals. In other cases, nucleic acid detection may not mean that the animal is effectively ill, for example, in
cases of latent infections, in asymptomatic carrier animals, in hosts
in equilibrium with the agent, and when dealing with ubiquitous
microorganisms. The vaccination of animals may also interfere
with the performance or interpretation of molecular diagnostics
assays, the detection of FIV in vaccinated cats being a good illustrative example of this limitation [31]. Moreover, when the disease
is caused by opportunistic pathogens belonging to the normal
microbial flora of animals, the interpretation of a positive molecular test also becomes more difficult, being necessary to differentiate
13
between colonization and active infection. Veterinary doctors and

technicians should be aware of the enhanced accuracy and speed of
molecular tests for the diagnosis of infections but also to understand their limitations. Thus, clear algorithms for the use of molecular tests must be settled for each disease (and eventually for each
animal species), establishing the appropriate specimen to collect,
the suitable timing for collection, and the proper test to use,
namely, regarding qualitative versus quantitative response, and
whether it is fit for purpose (i.e., fulfills the needs of the situation).
The clinician should be aware of the pathogenesis of each pathogen and collect the most adequate sample for its detection since
the analysis of the wrong sample type is a common mistake leading
to false-negative results [34]. A clear reporting of molecular data
by diagnostic laboratories, an effective communication between
the laboratory and the clinical settings, and clear interpretative criteria for the results have also to be established, requiring welldesigned clinical studies. Molecular results should be analyzed
considering the limitations of the techniques, the epidemiological
context, and, preferably, where appropriate, in complement to the
classical methods in a search for various relevant phenotypic and
genotypic characteristics of the agents. Ultimately, the veterinarian
should bring together all these results within the context of the set
of clinical signs and symptoms exhibited by the suspect animal(s),
to reach a final diagnosis.
Very few studies attempted to investigate the need for education in the field of molecular diagnostics technologies among veterinary practitioners. As an example, a recent survey assessed the
knowledge and clinical use of PCR-based diagnostics in equine
practice by diplomates of the American College of Veterinary
Internal Medicine [34]. Noteworthy, the results of this study
mostly express our own perception on the level of existing knowledge about these technologies and its applications in the general
veterinary community. Although the majority of the surveyed veterinarians reported being familiar with the principles of nucleic
acid amplification, just over half of respondents knew the difference between standard and real-time PCR. Most of these professionals also reported to regularly submit samples to specialized
laboratories for the PCR detection of pathogens. However, this
study found surprising that blood was the most commonly submitted sample, given that the majority of respiratory, enteric, and neurologic equine pathogens are not detectable in the peripheral blood
[34]. Particularly relevant, this survey found that specialized information about molecular diagnostics is not routinely accessible to
practicing veterinarians, and most of these professionals emphasized the need for an improved and continuing education on these
technologies. Professional guidelines and educational efforts
should be therefore increasingly developed to disseminate the best
practices in molecular diagnostics and data interpretation and
14
directed to all the people in the diagnostic chain, from the owner,
farmer, or professional that collects the sample to the person that
reports the result and the veterinarian that has to make an enlighten
evidence-based decision.
During easily transmitted and economically impacting disease
outbreaks, such as FMD, the early detection of infection is particularly important but is often impractical to test all the samples in
centralized reference laboratories. Moreover, in many regions of
the globe, even the veterinary reference laboratories may not be
adequately equipped to face these threats. In this context, the
availability of diagnostic methods for use in the point of decision
(e.g., directly at farms, slaughterhouses, or local veterinary clinics
or laboratories) is particularly relevant and is forecasted to represent a major opportunity for the IVD market. Molecular diagnostics methods generally are not applicable in these circumstances,
requiring the use of sophisticated and expensive equipments operated by skilled technicians. The increasing availability of portable
thermal cyclers may be potentially useful for a wider use of molecular technologies, allowing their implementation closest to the
regions where outbreaks occur (e.g., in regional laboratories or in
the field) [15]. The use of isothermal technologies for the amplification of nucleic acids, such as LAMP, may also prove useful in this
context because of its lesser requirement for sophisticated equipments. The detection of amplified products by electrophoresis is
not practical outside the laboratory, but disposable strips for lateral
flow detection of nucleic acids are also already commercially available [19]. Other fields experiencing great developments are microfluidics and nanotechnology. The procedures normally required
for the molecular detection of pathogens in biological samples,
including cell lysis, extraction of nucleic acids, amplification of
specific genomic targets, and their detection, can all potentially be
integrated into autonomous miniaturized microfluidic systems,
enabling the development of molecular diagnostics devices (commonly referred to as lab-on-a-chip), which can be used in the point
of decision [3540]. Nanotechnologies have also sparked interest
in the development of new diagnostic tests, including molecular
tests, taking advantage of the unique properties that many materials exhibit at the nanoscale [41, 42]. Biosensors based on these
technologies are likely to eliminate the need for any steps of extraction and amplification of nucleic acids from samples [42], and several prototypes were recently described in the literature for the
detection of viruses and bacteria.
Conclusion
The unprecedented growth of human population, increasingly
demanding for more food supplies and animal protein, changes in
land use, globalization, industrialization, deforestation, and climate
15
change, among others, have cumulatively and irreversibly affected

biodiversity at all scales, from the DNA molecule to the ecosystem
level. All animals, either domestic or wild, and humans face similar
health challenges imposed by pathogenic agents. Over the last
century, laboratorial tests had a tremendous impact on animal
health and welfare, contributing to ameliorate animal management and animal trade, helping to protect public health, and ultimately helping to minimize biodiversity loss. The growing
technological innovations in molecularly based tests have contributed to more rapid pathogen detection results and to the certification of the sanitary status of animal or animal groups, to increase
our understanding of the epidemiology of pathogens, to support
their control and eradication, and to provide guidance to policy
makers. On a more fundamental perspective, molecular technologies have also been crucial to increase our understanding on
pathogen biology, including interaction and coevolution with the
host and, also, on xenobiotic (including antimicrobial drugs)
resistance.
Unquestionably, molecular technologies have broadened up
the scope of veterinary diagnostics and will be increasingly used
for the rapid diagnosis and study of the pathogenesis and epidemiology of infectious diseases. It is likely that in the near future,
as has happened in recent years, molecular methods will replace
some currently used classical diagnostic tests, providing significant improvements in specificity, sensitivity, and speed of
responses. However, the pathogenicity of a microorganism is a
complex phenomenon resulting from mechanisms and interactions at the genomic, regulatory, and expression levels. Thus, a
complete picture of the characteristics of a microorganism, especially those relevant for their pathogenicity and interaction with
their hosts, can hardly be achieved only on the basis of the analysis
of their genome. The real added value of molecular technologies
will be their complementarily use with conventional microbiological tests, properly integrated in a laboratorial diagnostic and
research algorithm, allowing the collection and analysis of multivariate phenotypic and genotypic characteristics of pathogenic
microorganisms.
Acknowledgments
This work was supported by Fundaco para a Cincia e Tecnologia
(FCT) through projects PTDC/CVT/111634/2009 and PTDC/
CVT/117794/2010 and in the framework of Projecto 3599
Promover a Produo Cientfica e Desenvolvimento Tecnolgico e
a Constituio de Redes Temticas.
16
References
1. Hughes MD (2013) Molecular diagnostics,
market trends and outlook. Enterprise Analysis
Corporation (www.eacorp.com), Stamford,
United States
2. Anonymous (2014) Veterinary diagnostics
market by products (clinical chemistry, hematology analyzers, molecular diagnostics, immunodiagnostics, diagnostics imaging), by animals
(companion, food-producing, dog, livestock,
poultry, swine): global forecast to 2018.
Markets and Markets, Dallas, United States
(Executive Summary)
3. Dorman MA, Blair CD, Collins JK et al (1985)
Detection of bovine herpesvirus 1 DNA immobilized on nitrocellulose by hybridization with
biotinylated DNA probes. J Clin Microbiol
22:990995
4. Viseshakul N, Panyim S (1990) Specific DNA
probe for the sensitive detection of Trypanosoma
evansi. Southeast Asian J Trop Med Public
Health 21:2127
5. Almeida A, Albuquerque P, Arajo R, Ribeiro
N, Tavares F (2013) Detection and discrimination of common bovine mastitis-causing streptococci. Vet Microbiol 164:370377
6. Saiki RK, Scharf S, Faloona F et al (1985)
Enzymatic amplification of beta-globin genomic
sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:13501354
7. Kawasaki ES, Clark SS, Coyne MY et al (1988)
Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemiaspecific mRNA sequences amplified in vitro.
Proc Natl Acad Sci U S A 85:56985702
8. Belk S, Ballagi-Pordny A, Flensburg J et al
(1989) Detection of pseudorabies virus DNA
sequences by the polymerase chain reaction.
Arch Virol 108:279286
9. Biswas B, Mukherjee D, Mattingly-Napier BL
et al (1991) Diagnostic application of polymerase
chain reaction for detection of Ehrlichia risticii in
equine monocytic ehrlichiosis (Potomac horse
fever). J Clin Microbiol 29:22282233
10. Ballagi-Pordny A, Klingeborn B, Flensburg J
et al (1990) Equine herpesvirus type 1: detection of viral DNA sequences in aborted fetuses
with the polymerase chain reaction. Vet
Microbiol 22:373381
11. Wheeler R, Wilmore H, Savva D et al (1990)
Diagnosis of ovine toxoplasmosis using
PCR. Vet Rec 126:249
12. Figueroa JV, Chieves LP, Johnson GS et al
(1992) Detection of Babesia bigemina-infected
carriers by polymerase chain reaction amplification. J Clin Microbiol 30:25762582
13. Heid CA, Stevens J, Livak KJ et al (1996)

Real time quantitative PCR. Genome Res 6:
986994
14. Williams PM (2009) The beginnings of realtime PCR. Clin Chem 55:833834
15. Hoffmann B, Beer M, Reid SM et al (2009) A
review of RT-PCR technologies used in veterinary virology and disease control: sensitive and
specific diagnosis of five livestock diseases notifiable to the World Organisation for Animal
Health. Vet Microbiol 139:123
16. Costa P, Ferreira AS, Amaro A et al (2013)
Enhanced detection of tuberculous mycobacteria in animal tissues using a semi-nested probebased real-time PCR. PLoS One 8:e81337
17. Santos M, Soares R, Costa P et al (2013)
Revisiting the Tams1-encoding gene as a
species-specific target for the molecular detection of Theileria annulata in bovine blood
samples. Ticks Tick Borne Dis 4:7277
18. Lau LT, Reid SM, King DP et al (2008)
Detection of foot-and-mouth disease virus by
nucleic acid sequence-based amplification
(NASBA). Vet Microbiol 126:101110
19. Chowdry VK, Luo Y, Widn F et al (2014)
Development of a loop-mediated isothermal
amplification assay combined with a lateral flow
dipstick for rapid and simple detection of classical swine fever virus in the field. J Virol Methods
197:1418
20. Yamazaki W, Mioulet V, Murray L et al (2013)
Development and evaluation of multiplex
RT-LAMP assays for rapid and sensitive detection of foot-and-mouth disease virus. J Virol
Methods 192:1824
21. Prez-Sancho M, Garca-Seco T, Arrogante L
et al (2013) Development and evaluation of an
IS711-based loop mediated isothermal amplification method (LAMP) for detection of
Brucella spp. on clinical samples. Res Vet Sci
95:489494
22. Gubbels JM, de Vos AP, van der Weide et al
(1999) Simultaneous detection of bovine
Theileria and Babesia species by reverse line
blot hybridization. J Clin Microbiol 37:
17821789
23. Gomes J, Soares R, Santos M et al (2013)
Detection of Theileria and Babesia infections
amongst asymptomatic cattle in Portugal. Ticks
Tick Borne Dis 4:148151
24. Kamerbeek J, Schouls L, Kolk A et al (1997)
Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 35:
907914

25. Matos F, Cunha MV, Canto A, Albuquerque T,
Amado A, Botelho A (2010) Snapshot of
Mycobacterium bovis and Mycobacterium caprae
infections in livestock in an area with a low incidence of bovine tuberculosis. J Clin Microbiol
48:43374339
26. Schnee C, Schulsse S, Hotzel H et al (2012) A
novel rapid DNA microarray assay enables
identification of 37 Mycoplasma species and
highlights multiple Mycoplasma infections.
PLoS One 7:e33237
27. Boonsilp S, Thaipadungpanit J, Amornchai P
et al (2013) A single multilocus sequence typing (MLST) scheme for seven pathogenic
Leptospira species. PLoS Negl Trop Dis 7:e1954
28. Hoffmann B, Scheuch M, Hper D et al
(2012) Novel orthobunyavirus in Cattle,
Europe, 2011. Emerg Infect Dis 18:469472
29. Granberg F, Vicente-Rubiano M, RubioGuerri C et al (2013) Metagenomic detection
of viral pathogens in spanish honeybees: coinfection by Aphid Lethal Paralysis, Israel Acute
Paralysis and Lake Sinai Viruses. PLoS One
8:e57459
30. Hunt PW (2011) Molecular diagnosis of infections and resistance in veterinary and human
parasites. Vet Parasitol 180:1246
31. Crawford PC, Slater MR, Levy JK (2005)
Accuracy of polymerase chain reaction assays
for diagnosis of feline immunodeficiency virus
infection in cats. J Am Vet Med Assoc
226:15031507
32. Daniels JB (2013) Molecular diagnostics for
infectious disease in small animal medicine: an
overview from the laboratory. Vet Clin North
Am Small Anim Pract 43:13731384
33. Duarte MD, Henriques AM, Santos-Barros S
et al (2013) Snapshot of viral infections in wild
carnivores reveals ubiquity of Parvovirus and
34.
35.
36.
37.
38.
39.
40.
41.
42.
17
susceptibility of Egyptian mongoose to Feline

Panleukopenia Virus. PLoS One 8:e59399
Pusterla N, Mapes S, Leutenegger CM (2006)
Survey of the large-animal diplomates of the
American College of Veterinary Internal
Medicine regarding knowledge and clinical use
of polymerase chain reaction: implications for
veterinary education. J Vet Med Educ 33:
605611
Bearinger JP, Dugan LC, Baker BR et al (2011)
Development and initial results of a low cost,
disposable, point-of-care testing device for
pathogen detection. IEEE Trans Biomed Eng
58:805808
Beyor N, Seo TS, Liu P et al (2008)
Immunomagnetic bead-based cell concentration microdevice for dilute pathogen detection.
Biomed Microdevices 10:909917
Kim J, Johnson M, Hill P et al (2009)
Microfluidic sample preparation: cell lysis and
nucleic acid purification. Integr Biol (Camb)
1:574586
Wen J, Legendre LA, Bienvenue JM et al
(2008) Purification of nucleic acids in microfluidic devices. Anal Chem 80:64726479
Heo J, Hua SZ (2009) An overview of recent
strategies in pathogen sensing. Sensors (Basel)
9:44834502
Ahmad F, Hashsham SA (2012) Miniaturized
nucleic acid amplification systems for rapid and
point-of-care diagnostics: a review. Anal Chim
Acta 733:115
Jain KK (2003) Nanodiagnostics: application
of nanotechnology in molecular diagnostics.
Expert Rev Mol Diagn 3:153161
Kaittanis C, Santra S, Perez JM (2010)
Emerging nanotechnology-based strategies for
the identification of microbial pathogenesis.
Adv Drug Deliv Rev 62:408423
Chapter 2
Significance and Integration of Molecular Diagnostics
in the Framework of Veterinary Practice
Alicia Aranaz
Abstract
The field of molecular diagnostics in veterinary practice is rapidly evolving. An array of molecular techniques
of different complexity is available to facilitate the fast and specific diagnosis of animal diseases. The choice
for the adequate technique is dependent on the mission and attributions of the laboratory and requires
both a knowledge of the molecular biology basis and of its limitations.
The ability to quickly detect pathogens and their characteristics would allow for precise decisionmaking and target measures such as prophylaxis, appropriate therapy, and biosafety plans to control disease
outbreaks. In practice, taking benefit of the huge amount of data that can be obtained using molecular
techniques highlights the need of collaboration between veterinarians in the laboratory and practitioners.
Key words Molecular diagnostics, PCR, RT-PCR, Veterinary clinical microbiology, Pathogens
Introduction
Molecular techniques, fueled by polymerase chain reaction
(PCR), have revolutionized the diagnostics in veterinary practice.
Molecular approaches are now widely accepted for identification
of etiological agents and in many cases have replaced traditional
systems based on the more cumbersome phenotypic identification. Several assays are currently described for the detection and
identification of many pathogens of the OIE-listed diseases and
other diseases of importance to international trade. However,
compared to serological techniques, molecular assays are still officially recommended as prescribed tests only for a limited number
of diseases, when concerning the international trade and movement of animals and animal products (http://www.oie.int/en/
international-standard-setting/terrestrial-manual).
The development of molecular methods has provided new
tools for enhanced surveillance and outbreak detection, and this
may result in better implementation of infection control programs.
Benefits of using molecular diagnostics are clear in terms of time to
19
20
Alicia Aranaz
result and accuracy; however, laboratories also face several challenges

when implementing molecular diagnostic assays, related with
throughput, quality control, direct use on clinical samples, or difficulties for the definition of gold standards to assess the techniques. The aim of this chapter is to give an overview of the general
uses of molecular techniques in routine work of veterinary diagnostics and to discuss some of their limitations.
Basic Approaches in the Laboratory

In the past 20 years, international research efforts have provided an
exponential knowledge on pathogen genomic sequences and the
availability of molecular technologies of different complexity. This
knowledge has resulted in powerful tools that enable the rapid and
specific diagnosis of animal diseases [1, 2]. The practical relevance
of these techniques is directly related to the problems that the
pathogens pose in the laboratory; the more fastidious the pathogen, or noncultivable, the more useful will be the molecular technique. However, for some fast-growing pathogens, biochemical
characterization using commercial automated systems is still a valuable tool. Accordingly, molecular techniques are of paramount
importance for diagnosis of viral diseases and for some serious bacterial pathogens, such as brucellae, mycobacteria, and rickettsiae,
which take considerable time to grow in vitro and/or require specific culture media or cell culture systems, and are not adequate for
wide-scale culture-based diagnosis. Moreover, additional time is
required for the biochemical or serological identification of the isolates. It is also known that false-negative culture results may occur.
To overcome these limitations, efforts have focus on the PCR
amplification of nucleic acids directly extracted from clinical specimens or environmental samples. Extensive research and use of
these techniques have increased our knowledge of pathogens and
epidemiology of the diseases.
Molecular diagnosis of diseases caused by main pathogens of
veterinary interest can be applied following two main approaches:
1. Coupled to conventional microbiological culture to identify
bacterial or fungal isolates, or cell culture in the case of viruses,
replacing the more cumbersome biochemical or serological
identification. This requires only a step to inactivate the pathogen and to prepare the nucleic acids that will work as template
for the amplification reactions. In many instances, the suspension of the colonies in distilled sterile water and simple boiling
is enough for DNA extraction, being suited for laboratories
even with minimum resources.
2. Direct detection of the pathogens nucleic acids in clinical
specimens (e.g., tissues, feces, body fluids, and swabs). In this
case, the direct detection presents the advantage of rapidity
Significance and Integration of Molecular Diagnostics in the Framework
21
(which can mean saving up to several months) and the possibility

to work with inactivated material, so reducing the risk of laboratory hazards (important when pathogens are also zoonotic).
However, the direct detection of pathogens nucleic acids in
clinical samples requires the use of improved DNA/RNA
extraction methods. Although amplification-based assays are
extremely sensitive when used on microbial cultures, its sensitivity may drop when directly applied to samples eventually
containing inhibitors. Protocols requiring many steps involving mechanical, chemical, and enzymatic disruption of microbial
cells, or involving commercially available DNA/RNA extraction and purification kits, may be useful and efficient for
research activities but may not be adequate or be cost-prohibitive when handling a large number of samples with routine
diagnostic purposes, as during disease outbreaks (high pressure
to analyze many samples in the minimum period of time) or
surveillance (high number of samples during an extended
period of time). Furthermore, the use of automated work stations that handle several samples at a time may not be available
in resource-limited laboratories. The effectiveness of every
nucleic acid extraction protocol depends on the matrix (i.e.,
type of clinical sample) and the pathogen and needs to be
adjusted for each specific combination.
Level of Information
Most molecular diagnosis approaches currently used in the routine
veterinary laboratory rely in the PCR and its variants, such as
nested-PCR and real-time PCR. The performance of these assays
mainly depends upon the primers used, which are usually a pair
of short oligonucleotide fragments complementary to flanking
regions of the target sequence and that will specifically anneal to
the microbial genetic material present in the sample. The laboratory
can design in-house PCRs based on previously well-characterized
and validated genomic targets and primers sequences available in
scientific publications and online databases. Otherwise, the laboratory staff would need to select novel targets and to design appropriate primers (free software can be downloaded and used for this
purpose). Ideally, the primers should be 100 % specific and, at the
same time, should detect all variants that are being hunted; this
may require a balance between the use of conserved and of highly
variable genetic regions as complementary targets for those primers. Depending on the primer design strategy, molecular tests can
allow the identification of the etiological agents further than the
species level, such as distinct groups (lineages) with a characteristic
geographic spread, for instance, the Mycobacterium bovis clonal
complexes [3] or the Brucella melitensis groups [4]. The possibility
22
Alicia Aranaz
of designing own primers allows to focus diagnosis on local needs

and priorities but will require further experimental optimization of
the PCR-based reactions in every laboratory. Nevertheless, an
increasing number of commercial kits to detect pathogens have
become available; some diagnostic kits are certified by the OIE as
fit for purpose.
Regarding the number of distinct sequence targets that are
detected per amplification reaction, there are two strategies: the
use of a single target (singleplex) or of several targets (multiplex).
The latter strategy involves the use of multiple different pairs of
primers in the same PCR, usually yielding amplification products
with distinct lengths. Multiplexing allows for an increased workflow and reduced cost and has been used mainly with the two following objectives:
1. To identify pathogens to the species, or even to the strain level
using, e.g., specific genes, genetic regions, or insertion sequences,
or specific nucleotide polymorphisms, as complementary targets. Examples are the tests to distinguish the classical Brucella
species and vaccine strains [5] and to identify the biovars of
B. suis [6], using standard gel electrophoresis to assess the amplification results, or the test for ruminant Mycoplasma spp. using a
bead-based liquid suspension array [7].
2. To allow the simultaneous detection of multiple pathogens in
a same specimen. This option may be used in a syndromic
approach, i.e., to identify the etiology of diseases caused by
different pathogens but with similar clinical signs or pathological findings, such as the simultaneous detection of Chlamydia
spp., Coxiella burnetii, and Neospora caninum in abortion
material from ruminants [8]; the detection of C. burnetii and
N. caninum in equine-aborted fetuses and neonates [9]; and
the diagnosis of Brucella ovis, Actinobacillus seminis, and
Histophilus somni infection in ram semen [10, 11], among
many other examples. In combination with reverse transcription PCR (RT-PCR), this multiplex strategy is being used to
detect endemic and different transboundary porcine viruses
[1214]. There is a trend to multiplexing, aiming to develop
syndrome-specific assays targeting multiple candidate agents,
but the design of the assays needs to be evaluated experimentally in order to check that test sensitivities do not significantly
decrease when compared to singleplex testing.
Molecular techniques can be also applied to identify clones.
PCR-based techniques such as multilocus variable-number tandem
repeat analysis (MLVA) are less demanding and less time-consuming
than other previously used methods, such as the analysis of restriction fragment length polymorphisms (RFLP) or pulse-field gel electrophoresis (PFGE), and provide results that can easily be compared
between laboratories. Results obtained with the implementation of
23
these techniques (called molecular epidemiology) may be combined

with classical epidemiology to understand the dynamics of an infection and to design control measures.
These results can be worked out with phylogenetic purposes as
well. A variety of PCR-based methods have been used, involving,
e.g., the study of the presence or absence of large pieces of DNA,
called regions of difference (RD) or large sequence polymorphisms
(LSPs), which are expected to represent unidirectional evolution
events, and of single nucleotide polymorphisms (SNPs), which are
fast to test and less prone to homoplasy. As an example, these
genomic targets have been used to delineate the phylogeny of the
members of the Mycobacterium tuberculosis complex [15, 16].
Whole-genome sequencing is becoming affordable and applied
to accumulate information on the biology of known pathogens or
to disclose novel emerging pathogens. Analysis of complete
genomes, or representative parts of the genome, can reveal the
probable chain of transmission events and demonstrate the value of
such techniques in providing information useful to control programs, as it has been done with the genetic analysis of the complete
genome of the foot-and-mouth virus in the last outbreak in the
UK [17]. In a near future, application of whole-genome sequencing analysis will offer definitive information about each pathogen.
The detection of unknown pathogens has been possible using
broad-based primers with degenerate sequences. A most recent
approach consists of a combination of nonspecific amplification
and extensive sequencing. This approach requires a sound knowledge of taxonomy and genomics [18]. Furthermore, these new
technological trends provide with an enormous amount of data
that must be mined by bioinformatics. As an example, the use of a
metagenomics approach allowed to identify the Schmallenberg
virus, a novel orthobunyavirus that affected cattle in Europe in
2011 [19].
The Technique That Is Best Suited for the Laboratory

The choices for the most adequate molecular techniques and
equipments are dependent on the mission and attributions of the
laboratory. Several methods of nucleic acid amplification have
been developed, and some of them are now common in veterinary
diagnostics. Thermal cyclers to perform basic PCRs have become
compact, easy to use, and (relatively) affordable equipments present in almost every diagnostic infrastructure. PCRs are frequently
used in combination with an electrophoretic transfer cell to analyze the molecular weight of the amplified products. Additionally,
laboratories may have an imaging system and software for gel
documentation.
24
Alicia Aranaz
The success of PCR-based assays relies on its performance and

versatility but also in the ease of use and affordability. Standard
PCR requires the use of crucial reagents including dNTPs, a thermostable DNA polymerase and the respective buffer, and a pair of
well-designed primers to make millions of copies of the deoxyribonucleic acid target in a couple of hours. In theory, the number of
copies could reach 2n, where n is the number of rounds of
denaturing-annealing-extension steps. The amplified product
(amplicon) can be detected by simple electrophoresis on an agarose gel and staining with a fluorescent dye (e.g., SYBR Green)
that preferentially binds to double-stranded DNA. An internal
molecular weight ladder is run at the same time in the gel to estimate the size of the amplicons. The presence of the amplicon of
the defined size (in base pairs) indicates the presence of the target
DNA and, therefore, of the pathogen. An alternative system of
detection consists on reverse hybridization where amplicons are
denatured and allowed to hybridize with specific probes (singlestranded DNA) that are immobilized on a membrane strip.
Subsequently, bound products may be detected, e.g., using an
alkaline phosphatase reaction and a colorimetric detection assay.
This system can detect sequences and specific point mutations in a
gene and is commonly used to detect genotypes or pathogens
(species identification, presence of toxin genes and of other virulence factors), as well as resistances to drugs.
Nested PCR implies the use of two rounds of amplifications
with a second set of primers that anneal in a shorter region of the
amplicon product from the first round of amplification. This
method increases sensitivity and can also increase specificity; the
disadvantage is the increased risk of DNA carryover and subsequent potential occurrence of false-positive results.
Detection of ribonucleic acid (RNA) requires a reverse transcription reaction to synthesize a complementary DNA copy which
will be subsequently amplified using conventional PCR. Reverse
transcription PCR (RT-PCR) is used for gene expression analysis
and detection of viral RNA [20].
Real-time PCR enables the amplification and quantification of
the amount of specific nucleic acid sequences in the template sample. It has been implemented in many laboratories because the
equipment to perform real-time PCR has become reasonably
priced, taking into account the array of possibilities it offers.
Reactions are carried out in closed tubes, and results are monitored
based on fluorescence generated by intercalating dyes or by different fluorophore-labeled probes; fluorescence is proportional to
amplification with optimum performance within a defined area of
the amplification curve. Readings are detected automatically, and
analysis is performed using ad hoc software. Current apparatus can
monitor several fluorescence signals (channels) in a single tube.
This allows single-tube closed tests, so this format also decreases
25
the problem of contamination. For these reasons, this technique is

best suited for routine testing of a large number of samples.
Another benefit over conventional endpoint detection is that this
technique allows for quantification of target sequences (qPCR);
the number of amplification cycles that are required to generate
product to cross a threshold cycle (Ct) correlates with the quantity
(or copy number) of target sequences in the sample. Real time can
be combined with reverse transcription (RT-qPCR or rRT-PCR); a
major advantage of this technique is the detection of viral
RNA. Several good examples are described for livestock diseases
that are notifiable to the OIE, e.g., for foot-and-mouth disease,
bluetongue, and classical swine fever, among many others [14, 20].
In humans, this has also been used for monitoring treatment efficacy in some infections.
Microarrays can be used to detect the presence of genes or
polymorphisms from the organisms under study or used to detect
the presence of pathogens, depending on the design. This technique consists of an array of a large number of specific oligonucleotide probes (complementary to target sequences) spotted on the
surface of a solid support (microchip); complementary DNA
(usually amplified DNA) is hybridized onto it and detected with
fluorescent dyes, and then signals are measured and analyzed using
specific software. DNA arrays have been exploited to study infectious processes of pathogens, for diagnostics, and to study hostpathogen interactions [21]. This technique is still costly and not
affordable for all potential users.
Other techniques, such as fluorescence in situ hybridization
(FISH), are restricted to research and are more time-consuming,
or under study, and may become popular in the future.
Limitations of the Molecular Techniques

The main problems that can affect the performance of PCRbased technologies are the occurrence of false-positive and falsenegative results, comparison to gold standards, and interpretation
[20, 22]. Awareness of potential problems and control of the
underlying causes result in higher confidence and acceptance of
the techniques.
Regardless of the type of technique, knowledge of problems
associated to amplicon contamination and quality controls should
be established since the very beginning. The millions of copies generated by PCRs can act as carryover products and contaminate
equipments or reagents and serve as templates that generate falsepositive results. To control this pitfall, meticulous good laboratory
practices are required, and many laboratories use clearly defined
separated areas for the preparation of PCRs (clean area), amplification, and post-amplification in order to reduce cross-contamination.
26
Alicia Aranaz
Careful work reduces the need for inactivation of carryover products

using enzymatic or chemical treatments. Negative controls are also
run in every batch of samples.
False-negative results may arise from the presence of PCR
inhibitors in the sample or the presence of foreign DNA (e.g., host
eukaryotic DNA) that could interfere with performance of the test,
particularly when the amount of nucleic acid from the infectious
agent in the sample is low. PCR inhibitors are a heterogeneous
class of substances with different properties and mechanisms of
action. They are present in a large variety of sample types and may
lead to decreased PCR sensitivity or even false-negative PCR results
[23]. If this is the case, removal of PCR inhibitors during sample
preparation is needed. This problem is relevant when performing
direct DNA extraction, in special, when processing complex biological matrices. The amplification of an internal positive control is
used to detect inhibitions; these controls can be an endogenous
gene (housekeeping genes, such as mammalian beta-actin) that it is
present in the specimen or an exogenous control that is added to
each sample.
Validation of the tests requires a preliminary assessment involving a comparison to a gold standard reference method. The traditional definitive confirmation of infection has been based on
microbiological (in vitro growth on culture media, viral propagation in cell culture) or histopathological diagnosis, but these gold
standard techniques may require considerable time, and the sensitivity is not 100 %. Estimates of sensitivity and specificity in comparison with an imperfect gold standard and ancillary tests may
provide discrepant results that cause confusion [24]. Interpretation
can be specifically problematic when it leads to official or legal consequences in cases when the samples are negative by culture but
positive when tested by PCR (since PCR detects nucleic acids from
both viable and nonviable organisms).
The use of molecular tests is recommended when the presence
of a pathogen implies disease or is a part in the assessment of an
eradication program. A negative result, which would indicate the
absence of the pathogen, should be interpreted carefully according
to the epidemiological context and taking into account the limitations on sensitivity that may be related to the protocol for DNA
extraction and the molecular technique itself. On the other hand,
in some situations, the identification of pathogens nucleic acids
does not provide a clear etiological answer (e.g., latent, asymptomatic infections, carriers, presence of widespread pathogens), and
interpretation of results must be done according to other parameters (epidemiological context) or with the support of additional
laboratory diagnostic tools (e.g., serology).
Quality assurance and quality improvement programs need to
be developed for increased acceptance of the techniques for routine diagnostic purposes [22, 25]. So far, there has been limited
27
harmonization of techniques. Interlaboratory comparisons,

consisting on a same blind-coded panel of samples to be tested
simultaneously in several laboratories, are difficult to organize
because of logistics and biohazard, but they remain the best system
to assess the wide range of diagnostic techniques (commercially
available kits and in-house assays) for the specific pathogens. These
comparisons allow evaluating the proficiency of the participating
laboratories in that precise test. Some good examples are available
in the literature [26, 27].
Technologies in the Near Future

While it is not possible to foresee the platforms that will become
routine in the future, there are two technologies that are standing
out in terms of expectancies and reports.
The introduction of inexpensive platforms for massive DNA
sequencing has provided culture-independent methods for virus
discovery and characterization, surveillance, and outbreak investigation [28]. High-throughput sequencing requires sequence
acquisition and complex bioinformatics analysis to assemble the
contiguous short reads in order to obtain the correct genomic
sequence that can be compared to known microbial sequences.
There are several sequencing technologies currently available on
the market, each with intrinsic limitations and potential applications [29]. Because of specialized equipment and level of expertise
needed, these technologies are still restricted to research on pathogen discovery at highly specialized laboratories. In the future,
advancements and simplifications of the associated technology and
costs may move sequencing to the forefront position of clinical
diagnostics [28].
On the other hand, recent advancements on the use of molecular techniques on-site, at the clinics or at the farm, hold great promise, especially for low-resource scenarios. This option is known as
pen-side testing of animals, and it is a system analogous to the
point-of-care testing or alternate-site testing in human clinics. This
consists of tests performed outside the central laboratory using
devices that can be easily transported and handled in the field by
nonspecialists [30]. Regarding molecular techniques, these employ
portable cyclers based on isothermal amplification, for example,
nucleic acid sequence-based amplification (NASBA) and loopmediated isothermal amplification (LAMP). Ideally, analyses are
carried out in self-contained sample systems which integrate sample
preparation, amplification, and detection steps. This option would
be ideal when timely and accurate diagnosis of animals with suspected clinical signs is critical for urgent intervention, such as
infections with legal disastrous consequences (e.g., foot-and-mouth
disease or avian flu). This pen-site testing can also be a complement
28
Alicia Aranaz
to the use of centralized laboratories and a help in geographical

areas that do not have easy access to other traditional facilities.
Currently, these options are under development; however, other
tests, such as the lateral flow devices (immuno-chromatographic
strip tests) that can detect antigens or antibodies, seem to be simpler and rapid tools for the use in the field. A good example on the
use of these new technologies has been discussed for the diagnosis of food-and-mouth disease in sub-Saharan countries [25].
The definitive chance to replace traditional diagnostic methodologies will depend on cost-effectiveness and practicalities in every
situation.
Conclusion
The field of molecular diagnostics is rapidly evolving, with an
expanding number of techniques and assays. The advisability of
each technique depends on the purpose of use and the existing
limitations. The ability to quickly detect pathogens and their characteristics (e.g., subtypes, virulence factors, and drug-resistance
traits) would allow for precise decision-making and target measures such as prophylaxis, appropriate therapy, and biosafety plans
to promptly control disease outbreaks. New tools are needed for
diagnosis and surveillance of emergent or reemergent pathogens
that may arise from globalization of travels and trade, changes in
vector distribution, anthropological pressure on pristine areas, and
many other factors. Keeping abreast with this exponentially growing knowledge requires constant dedication. In this sense, to take
advantage of these possibilities, future veterinarians must have a
global understanding regarding the type of tests that can be applied
in the laboratory and the conclusions that can, or cannot, be drawn
from the results. In this sense, fundamentals of sequence analysis
should become an important item in the teaching program of veterinary medicine, including genes, methods, and databases that
should be accessed for sequence comparison [18]. This requirement for long-life learning is extensive to all veterinarians.
In practice, taking benefit of the huge amount of data that can
be obtained using molecular techniques highlights the need of collaboration between veterinarians in the laboratory and practitioners. The possibility to detect an extensive number of pathogens in
the laboratory does not preclude the need for adequate samples
collection and shipment, an adequate anamnesis, and a definition
of the objective of the diagnosis from the practitioner. The laboratory must provide an accurate and fast diagnosis and assistance in
the interpretation of results. The final diagnosis of the disease and
the decision to apply a treatment or a control program must be
made by the practitioner according to laboratory results but also to
other epidemiological factors.
29
Currently, the use of molecular techniques is highly variable

between countries, with a marked contrast between laboratory
facilities in developed and developing countries. Obviously, the
concept of affordable test depends on the financial availability
and cost of imports (equipment, reagents) that are limiting factors
in resource-limited countries. Development of diagnostic tests
should take into account many epidemiological scenarios, such as
endemic and/or zoonotic diseases, and highlights the benefit from
exchange of scientific expertise. Appropriate worldwide use of
these tools will contribute to the implementation of the One
World, One Health perspective.
References
1. Schmitt B, Henderson L (2005) Diagnostic
tools for animal diseases. Rev Sci Tech 24:
243250
2. Plummer PJ (2007) Molecular diagnostics for
the food animal practitioner. Vet Clin North
Am Food Anim Pract 23:481501
3. Smith NH (2012) The global distribution and
phylogeography of Mycobacterium bovis. Infect
Genet Evol 12:857865
4. Valdezate S, Navarro A, Villaln P, Carrasco G,
Saz-Nieto JA (2010) Epidemiological and
phylogenetic analysis of Spanish human
Brucella melitensis strains by multiple-locus
variable-number tandem-repeat typing, hypervariable octameric oligonucleotide fingerprinting, and rpoB typing. J Clin Microbiol 48:
27342740
5. Lpez-Goi I, Garca-Yoldi D, Marn CM, de
Miguel MJ, Muoz PM, Blasco JM, Jacques I,
Grayon M, Cloeckaert A, Ferreira AC, Cardoso
R, Corra de S MI, Walravens K, Albert D,
Garin-Bastuji B (2008) Evaluation of a multiplex PCR assay (Bruce-ladder) for molecular
typing of all Brucella species, including the vaccine strains. J Clin Microbiol 46:34843487
6. Lpez-Goi I, Garca-Yoldi D, Marn CM, de
Miguel MJ, Barquero-Calvo E, Guzmn-Verri
C, Albert D, Garin-Bastuji B (2011) New
Bruce-ladder multiplex PCR assay for the
biovar typing of Brucella suis and the discrimination of Brucella suis and Brucella canis. Vet
Microbiol 154:152155
7. Righter DJ, Rurangirwa FR, Call DR,
McElwain TF (2011) Development of a beadbased multiplex PCR assay for the simultaneous detection of multiple Mycoplasma species.
Vet Microbiol 153:246256
8. Reisberg K, Selim AM, Gaede W (2013)
Simultaneous detection of Chlamydia spp.,
Coxiella burnetii, and Neospora caninum in
abortion material of ruminants by multiplex
9.
10.
11.
12.
13.
14.
15.
real-time polymerase chain reaction. J Vet

Diagn Invest 25:614619
Leon A, Richard E, Fortier C, Laugier C,
Fortier G, Pronost S (2012) Molecular detection of Coxiella burnetii and Neospora caninum
in equine aborted foetuses and neonates. Prev
Vet Med 104:179183
Saunders VF, Reddacliff LA, Berg T, Hornitzky
M (2007) Multiplex PCR for the detection of
Brucella ovis, Actinobacillus seminis, and
Histophilus somni in ram semen. Aust Vet J 85:
7277
Moustacas VS, Silva TMA, Costa LF, Xavier
MN, Carvalho CA Jr, Costa EA, Paixo TA,
Santos RL (2013) Species-specific multiplex
PCR for the diagnosis of Brucella ovis,
Actinobacillus seminis, and Histophilus somni
infection in rams. BMC Vet Res 9:51
Giammarioli M, Pellegrini C, Casciari C, De
Mia GM (2008) Development of a novel hotstart multiplex PCR for simultaneous detection of classical swine fever virus, African swine
fever virus, porcine circovirus type 2, porcine
reproductive and respiratory syndrome virus
and porcine parvovirus. Vet Res Commun 32:
255262
Xu X-G, Chen G-D, Huang Y, Ding L, Li Z-C,
Chang C-D, Wang C-Y, Tong D-W, Liu H-J
(2012) Development of multiplex PCR for
simultaneous detection of six swine DNA and
RNA viruses. J Virol Methods 183:6974
Wernike K, Hoffmann B, Beer M (2013)
Single-tube multiplexed molecular detection of
endemic porcine viruses in combination with
background screening for transboundary
diseases. J Clin Microbiol 51:938944
Brosch R, Gordon SV, Marmiesse M, Brodin P,
Buchrieser C, Eiglmeier K, Garnier T, Gutirrez
C, Hewinson G, Kremer K, Parsons LM, Pym
AS, Samper S, van Soolingen D, Cole ST
(2002) A new evolutionary scenario for the
30
16.
17.
18.
19.
20.
21.
22.
Alicia Aranaz
Mycobacterium tuberculosis complex. Proc Natl
Acad Sci USA 99:36843689
Smith NH, Kremer K, Inwald J, Dale J, Driscoll
JR, Gordon SV, van Soolingen D, Hewinson
RG, Smith JM (2006) Ecotypes of the
Mycobacterium tuberculosis complex. J Theor
Biol 239:220225
Cottam EM, Wadsworth J, Shaw AE, Rowlands
RJ, Goatley L, Maan S, Maan NS, Mertens
PPC, Ebert K, Li Y, Ryan ED, Juleff N, Ferris
NP, Wilesmith JW, Haydon DT, King DP,
Paton DJ, Knowles NJ (2008) Transmission
pathways of foot-and-mouth disease virus in
the United Kingdom in 2007. PLoS Pathog
4:e1000050
de Lamballerie X (2009) Essential veterinary
education in modern molecular tools for the
detection of disease: what veterinarians will
need to know about genomics and molecular
biology and diagnostics (including bioterrorist
weapons) in 2025. Rev Sci Tech 28:657662
Hoffmann B, Scheuch M, Hper D, Jungblut
R, Holsteg M, Schirrmeier H, Eschbaumer M,
Goller KV, Wernike K, Fischer M, Breithaupt
A, Mettenleiter TC, Beer M (2012) Novel
orthobunyavirus in cattle, Europe, 2011.
Emerg Infect Dis 18:469472
Hoffmann B, Beer M, Reid SM, Mertens P,
Oura CA, van Rijn PA, Slomka MJ, Banks J,
Brown IH, Alexander DJ, King DP (2009) A
Ojha S, Kostrzynska M (2008) Examination of
animal and zoonotic pathogens using microarrays. Vet Res 39:04
Yang S, Rothman RE (2004) PCR-based diagnostics for infectious diseases: uses, limitations,
23.
24.
25.
26.
27.
28.
29.
30.
and future applications in acute-care settings.

Lancet Infect Dis 4:337348
Schrader C, Schielke A, Ellerbroek L, Johne R
(2012) PCR inhibitors: occurrence, properties
and removal. J Appl Microbiol 113:10141026
Fulton RW, Confer AW (2012) Laboratory test
descriptions for bovine respiratory disease diagnosis and their strengths and weaknesses: gold
standards for diagnosis, do they exist? Can Vet
J 53:754761
King DP, Madi M, Mioulet V, Wadsworth J,
Wright CF, Valdazo-Gonzlez B, Ferris NP,
Knowles NJ, Hammond J (2012) New technologies to diagnose and monitor infectious
diseases of livestock: challenges for sub-Saharan
Africa. Onderstepoort J Vet Res 79:456
Jones RM, Hertwig S, Pitman J, Vipond R,
Aspn A, Blske G, McCaughey C, McKenna
JP, van Rotterdam BJ, de Bruin A, Ruuls R,
Buijs R, Roest H-J, Sawyer J (2011)
Interlaboratory comparison of real-time polymerase chain reaction methods to detect
Coxiella burnetii, the causative agent of Q
fever. J Vet Diagn Invest 23:108111
Wernike K, Bonilauri P, Dauber M, Errington
J, LeBlanc N, Revilla-Fernndez S, Hjulsager
C, Isaksson M, Stadejek T, Beer M, Hoffmann
B (2012) Porcine reproductive and respiratory
syndrome virus: interlaboratory ring trial to
evaluate real-time reverse transcription polymerase chain reaction detection methods. J Vet
Lipkin WI, Firth C (2013) Virus surveillance
and discovery. Curr Opin Virol 3:199204
Kircher M, Kelso J (2010) High-throughput
DNA sequencing: concepts and limitations.
Bioessays 32:524536
Holland CA, Kiechle FL (2005) Point-of-care
molecular diagnostic systems: past, present and
future. Curr Opin Microbiol 8:504509
Chapter 3
Biosafety Principles and Practices for the Veterinary
Diagnostic Laboratory
Abstract
Good biosafety and biocontainment programs and practices are critical components of the successful
operation of any veterinary diagnostic laboratory. In this chapter we provide information and guidance on
critical biosafety management program elements, facility requirements, protective equipment, and procedures necessary to ensure that the laboratory worker and the environment are adequately protected in the
challenging work environment of the veterinary diagnostic laboratory in general and provide specific guidance for those laboratories employing molecular diagnostic techniques.
Key words Biosafety, Biocontainment, Laboratory biosecurity
Introduction
Veterinary diagnostic laboratories play a critical and fundamental
role in a countrys individual veterinary health and public health
systems but also act as a key component to regional and worldwide
veterinary health and public health systems. The field of biosafety
promotes safe laboratory practices, procedures, and proper use of
containment equipment and facilities; promotes responsible activities among laboratory workers; and provides advice on laboratory
design. Individuals working in veterinary diagnostic laboratories
have occupational exposure to a variety of hazardous materials in
the workplace. Diagnostic laboratories are demanding work environments where the pace is hectic, the work load is often heavy,
and the pressure to provide rapid, accurate, and reliable results is
ever present. Therefore it is of primary importance that institutions have a robust biosafety program in place which ensures that
laboratory staffs are well aware of the risks present in the laboratory but more importantly that they understand how to use the
protective equipment provided and practice those critical safety
behaviors which are based on internationally recognized, scientifically valid best practices.
31
32
Basic Elements of a Biosafety Program

All successful biosafety programs, and indeed any effective safety
and health program, will have the following key elements in
common: (1) management commitment and leadership, (2)
employee participation, (3) hazard identification and assessment,
(4) hazard prevention and control, (5) hazard communication
and training, and (6) evaluation of program effectiveness [1]. The
diagram in Fig. 1 depicts those core elements necessary for an
effective biosafety management program, and each will be further
discussed below. Biosafety has developed as a distinct and sometimes independent field from industrial safety because of the
complexity, unique work environment, and evolving nature of the
hazardbiological organisms. Therefore, management commitment must be strong and consistently demonstrable in order for a
biosafety program to be developed, implemented, sustained, and
continually improved. An organizations leadership sets the tone
for the biosafety program, and this begins with the organizational
vision and mission statements. A vision statement is the leaderships mental image of the possible and/or desirable future state of
the organization (or subcomponent of the organization). In order
for the leaderships vision to have impact on employees, it must be
communicated in a lasting and dramatic fashion; Excellent science
Mission
Statement
Program
Assessments
Biosafety
Policy
Organizational
Vision
Program
Goals
Training and
Assistance
Biosafety
Manual
(SOPs)
Risk
Assessment
(IBC)
Fig. 1 Biosafety management program core elements
Biosafety for Veterinary Diagnostic Laboratory
33
done safely would be a good example. A mission statement is an

organizations vision translated into written form. It should be a
short and concise statement of goals and priorities, such as the
below example of a mission statement for a biosafety program:
The purpose of the Biosafety Program is to prevent or minimize
employee exposures or the accidental environmental release of
hazardous biological agents through the promotion of safe laboratory
practices and procedures and proper use of containment equipment
and facilities by employees, students, visitors, and contractors.
The biosafety program vision and mission for maximum effectiveness should be able to directly link to the institutions vision
and mission statements or goals. An institutions biosafety policy is
especially critical in that it defines the roles and responsibilities for
the program at all levels, as well as the methodology for defining
program goals and how individual accountability at all levels is
measured. It is important that the biosafety policy clearly states the
intent and direction of institutional leadership, and supporting
documentation must identify a chain of responsibility for information on biosafety-related issues. It is important to note that the
written biosafety/biocontainment policy is just another mechanism of communicating the policy to the employees. Laboratory
supervisors, principal investigators, biosafety and safety professionals, and other institutional leaders attitude toward biosafety
and what they do both as individuals and collectively, or fail to do,
is a more powerful expression of the actual biosafety policy and
culture than the actual written words of the policy. In other words,
a strong biosafety culture will only be created and maintained when
all levels of management demonstrate their commitment personally by embodying and rewarding culture-supportive behaviors and
conclusively addressing behaviors in others that undermine the
culture of safety.
Following clockwise on the diagram of Fig. 1, the fourth
through seventh balloon collectively represent universal employee
participation through hazard identification and assessment, hazard
prevention and control, information and training, and evaluation
of program effectiveness. Employee participation is critical to the
success of any biosafety program. Employees from all levels within
the organization need to be engaged and provided opportunities
to actively participate within the biosafety program, such as participating on various safety committees engaged in risk assessment
and policy development, participating in active discussions of biosafety topics at regularly scheduled laboratory meetings, inclusion
of lab staff on biosafety inspection and audit teams, and, finally,
ensuring that employees are involved in determining biosafetyrelated goals and metrics for their specific work areas. Organizations
need to ensure that employees are actively encouraged to report
unsafe conditions, accidents, and near misses, as well as making
34
recommendations to improve safety and health within their

working environment. The critical components of this encouragement are the creation and enforcement of whistle-blowertype protections for those employees that report concerns at a
minimum and ideally the creation of a reward structure for
reports that encourage safe practices but discourage false or retaliated reporting. As a safety culture is established within an organization and employees adopt those critical safety behaviors as the
norm, an environment is created in which risky behaviors are no
longer tolerated among peers or management [2]. Of course, any
robust biosafety program must include a continuous formal
process of hazard identification, risk assessment, hazard prevention, and mitigation, which is conducted by the laboratory supervisor or a committee such as a biosafety committee. We will further
discuss these elements in the next section as they are closely related.
Risk Assessment for Veterinary Diagnostic Labs

The nature of veterinary diagnostic work, which involves working
with samples of unknown status that may contain strict veterinary
pathogens or zoonotic pathogens, differs from work conducted in
research laboratories where the agent risks are known and can be
incorporated into the initial risk assessment. Diagnostic workers
who work in (human) public health have a significant and known
occupational exposure risk to cultures or tissues containing pathogens that infect humans. However, the risk to those individuals
working in veterinary diagnostic laboratories for occupational
exposure to pathogens that can infect and cause disease in humans
is not negligible. Indeed 65 % of identified infectious diseases in
humans are caused by organisms which infect multiple hosts in
nature, and 75 % of emerging human infectious diseases over the
past three decades have been zoonotic in nature [3]. Accordingly,
veterinary health professional and diagnostic workers should be
familiar with the principles and practices for preventing transmission of infectious agents (collectively known as standard precautions). In 2006, the National Association of State Public Health
Veterinarians (NASPHV) Veterinary Infection Control Committee
published a compendium of veterinary standard precautions,
Zoonotic Disease Prevention in Veterinary Personnel [4], which is an
excellent review of the standard precautions one should employ
while working with animals in the field, veterinary clinic, and diagnostic labs that handle animal tissues or zoonotic agents. Another
excellent reference on standard precautions entitled Guideline for
Isolation Precautions: Preventing Transmission of Infectious Agents
in Healthcare Settings was published in 2007, by the Healthcare
Infection Control Practices Advisory Committee (HICPAC) [5].
This guide discusses worker practices and precautions to minimize
35
infectious disease transmission in patient care and diagnostic labs

and is another valuable reference for those individuals working in
both animal and human diagnostic laboratories.
In addition to occupational risks associated with potentially
zoonotic veterinary pathogens, those individuals conducting risk
assessment with veterinary pathogens in which humans are not a
relevant host must be cognizant of those risk drivers for animal
agriculture that are based primarily on the potential economic
impact on animal health associated with the release of a veterinary
pathogen, as well as the international trade implications of disease
[6]. Some agent-specific characteristics that should be evaluated as
part of a comprehensive risk assessment involving pathogens of
veterinary significance are the following:
Is the agent endemic or foreign to the region?
Is the host animal native or exotic to the area?
What is known regarding the morbidity and mortality caused

by the agent, including whether it is exclusively an animal
agent or a zoonotic agent?
Are there effective prophylaxes, treatments, or vaccines available (for animals and/or humans)?
What are the shedding and transmission patterns of the agent

in the relevant host species?
Will the agent be introduced into species for which there are
no data?
Are there active control or eradication programs for the disease?
What are the environmental stability, quantity, and concentration of the agent?
How will the agents be usedin animals (large or small scale),

in the field, or in the laboratory?
What is the host range of the agent and are there ongoing
surveillance testing programs?
Is the agent vector-borne and transmitted, and what is the

occurrence of competent vectors? [7].
A risk assessment must also review the operational elements

of the proposed work with biological hazards. Diagnostic laboratories need (at a minimum) to conduct risk assessment on the
following operational areas:
Receiving, unpacking, and transfer into the laboratory.
Initial processing of the sample.
Preparation of sample for analysis (culture, ELISA, polymerase

chain reaction (PCR), etc.) [8].
Although risk assessment methodology can be either quantitative or qualitative, it is recognized that most life science institutions
36
Fig. 2 Risk assessment and management process
favor qualitative methodology such as operational risk management,

which is a continuous process that can be broken down into the
key steps depicted in the diagram of Fig. 2. For more detailed
information on operational risks associated with specific diagnostic activities, the authors recommend that the readers review
US Centers for Disease Control and Prevention (CDC): Guidelines
for Safe Work Practices in Human and Animal Medical Diagnostic
Laboratories (www.cdc.gov/mmwr/preview/mmwrhtml/su6101a1.
htm) [9]. Finally, a risk assessment must review the training, experience, and competency of the individuals who will be conducting
the work with biohazards. The risk for exposures, laboratoryacquired infections, and the unintended release of research, clinical,
or diagnostic materials to the environment should ultimately be
reduced by ensuring the competency of laboratory workers at all
levels. Indeed, many institutions have successfully implemented a
formal training and mentoring program for individuals new to
the laboratory regardless of previous education and experience
elsewhere, and the authors believe this is a practice that should be
encouraged at all laboratories. However when working with a new
biohazard or a change to work currently performed, the level of
risk changes and an evaluation of the risk must be conducted,
which includes a review of the experience and competency of the
laboratory supervisor and staff as part of this formal risk assessment process. An MMWR supplement Guidelines for Biosafety
Laboratory Competency was published on behalf of CDC and the
Association of Public Health Laboratories (APHL) in 2011 [10].
These competencies outline the essential skills, knowledge, and
abilities required for working with biologic agents at the three
highest biosafety levels (BSLs) (levels 2, 3, and 4) as defined in the
HHS/NIH publication Biosafety in Microbiological and Biomedical
37
Laboratories, 5th edition [11]. This document can be a useful tool

in categorizing the level of laboratory competency of staff in a
diagnostic laboratory as well as for the development of competencybased biosafety training programs.
Once a valid and complete risk assessment has identified
agent hazards, operational hazards, and staff training needs, the
individual(s) conducting the risk assessment can minimize those
risks through the use of appropriate facility engineering controls,
administrative controls, personal protective equipment, and training programs designed to integrate all those factors at the level of
individual employee competence.
Biocontainment Levels
Many institutions and organizations throughout the world must
consider the risks presented by proposed research with agricultural
pathogens and make decisions regarding the placement of these
pathogens into proper biocontainment and/or biosafety categories
[6]. Many countries and international organizations such as the
World Organization for Animal Health (OIE) have published
guidance to define biocontainment and/or biosafety levels, which
provide specific combinations of facility design features, engineering controls, work practices, and personal protective equipment
(or alternative barriers) for a range of assigned risks from low to
high. The majority of guidance documents recommend that the
selection of facility design features, protective equipment, and
administrative controls must be informed by a robust, site-specific
risk assessment (as earlier described) which takes into consideration
agent characteristics, type of work to be conducted, and training
and competency of staff conducting the work. The new OIE
Manual chapter Standard for managing biorisk in the veterinary
laboratory and animal facilities was adopted at the May, 2014
OIE General Session. It has not yet been combined with the old
Manual chapter on biosafety; that still is a stand-alone chapter
although efforts are being made to combine the two in the near
future. The new chapter draws heavily from concepts articulated in
the CEN Workshop Agreement (CWA) 15793 on Laboratory
Biorisk Management which was scheduled to expire in September
2014 but has been transferred to the International Standard
Organization (ISO) to be used as the primary source for an ISO
deliverable. The new chapter moves away from the traditional
approach of describing minimal recommended biocontainment
levels to a laboratory-specific risk control measures approach. The
authors are supportive of the concepts contained within CWA
15793 and firmly believe that biorisk management programs can
be a valuable tool in facilitating good biosafety and laboratory
38
biosecurity practices and applaud OIE for including these concepts

as one of the focal points in the new Terrestrial Manual chapter.
However, the authors still see value for international organizations
in providing minimal biocontainment levels.
Minimal Facility Requirements for All Biological Laboratory Work

1. The laboratory should be easy to clean, with surfaces that are
impervious to water and resistant to chemicals. There shall be
a hand-washing basin near the exit. An emergency shower,
including an eye bath, should be present in each laboratory
suite appropriate to the risks represented by chemicals and
other hazards present.
2. Personnel access to the work area should be restricted; appropriate security measures such as controlled electronic access
may be necessary with higher risk agents.
3. The laboratory door should be closed when work is in progress
and ventilation should be provided by extracting air from the
room (where biosafety cabinets are used, care shall be taken to
balance ventilation systems).
4. No infectious materials shall be discarded down laboratory
sinks and a method for decontaminating waste materials should
be available within the facility (autoclave, etc.).
5. Laboratory windows that open to the outside are not recommended. If a laboratory has operable windows they should be
fitted with fly screens [9, 11].
Veterinary diagnostic laboratories routinely receive specimens
where a variety of diseases are possible. When the infectious nature
of the sample is unknown, it is prudent for initial processing activities to utilize facilities, procedures, and personal protective equipment as described by the World Health Organization (WHO)
( www.who.int/csr/resources/publications/biosafety/WHO_
CDS_CSR_LYO_2004_11/en) and other internationally recognized guidance as biosafety level 2. Primary containment equipment
such as a Class II biological safety cabinet should be used when
laboratory manipulations have the potential to generate aerosols
or splashes of potentially infectious materials. When the clinical
history of the specimen suggests a higher level of containment,
that level should be utilized in a similar fashion.
Operational Procedures (Emphasis on Molecular Testing)

The use of molecular procedures such as PCR and sequencing does
not preempt the need for adequate biosafety and biocontainment
procedures to work with diagnostic specimens and/or agents.
39
Biocontainment and biosafety operating procedures need to be

determined and must be based on a risk assessment [12]. Standard
operational procedures for handling diagnostic specimens and/or
agents are as follows:
1. Access to the laboratory is restricted.
2. Laboratory personnel must wash their hands after handling
infectious material and before leaving the laboratory.
3. Eating, drinking, smoking, handling contact lenses, and applying cosmetics or medicinal products are not permitted in areas
designated for work with infectious material. Food is stored
outside of laboratory work area.
4. Mouth pipetting is prohibited.
5. A policy for handling sharps must be in place.
6. Generation of aerosols must be minimized. Any procedures
that are recognized to generate aerosols should be performed
in primary containment equipment such as a Class II biological
safety cabinet.
7. Work surfaces must be decontaminated before and after manipulation of infectious material.
8. All infectious material must be decontaminated before disposal
using a method such as autoclaving.
9. Personnel protective equipment (PPE) must be used based on
risk assessment of the infectious material. Examples of PPE are
lab coat, gloves (latex, nitrile), and respirator (if a respirator is
used that individual should participate in a facility respiratory
protection program which includes medical evaluation, training and fit testing).
10. Biosafety cabinets are recommended for work with infectious
material as proper use will protect the operator and prevent
contamination of the environment [11].
6.1 Special Safety
Considerations
for Molecular Work
Laboratories performing molecular work may encounter unique

safety hazards including electrical shock, ultraviolet light, and caustic,
corrosive, carcinogenic, or mutagenic chemicals. High-voltage
power sources used in electrophoresis and sequencing equipment
should not be used near flammable liquids and gases. Power
sources should be serviced only by appropriately trained technicians. Ultraviolet light (UV) is used to visualize nucleic acid bands
in gels and to break down DNA and RNA on work surfaces. Special
care should be taken to wear eye and skin protection when there is
possible exposure to UV light. Chemicals such as phenol, chloroform, ethidium bromide, and guanidine isothiocyanate are commonly used in molecular work such as nucleic acid extraction.
Follow the material safety data sheet recommendation when using/
disposing of these and other chemicals [9].
40
6.2 Movement
of Extracted DNA/RNA
from High to Low
Containment
Laboratory Areas
A laboratory may have the need to extract RNA/DNA from

samples that may be infected with a high-consequence pathogen
and subsequently tested at a lower containment level. In these
situations, the type of pathogen should be considered with
emphasis on whether the extraction method will provide complete
inactivation.
Extraction procedures on viruses utilizing protein disruption
chemicals such as phenol and guanidine isothiocyanate (GITC)
will completely inactivate most viruses [13]. These methods may
be less effective for bacterial spores, and the worker may need to
introduce a heat treatment step [14]. After extraction, the pellet
may be tested at a lower level of biocontainment with a recommended treatment of the tube containing the pellet with a suitable
disinfectant. All developed processes should be tested and validated
with a robust isolation protocol before implementation.
6.3 Operational
Challenges
Molecular techniques such as real-time PCR have demonstrated

improved utility in disease outbreaks over conventional techniques
such as virus isolation [15]. Real-time PCR performed in a 96-well
plate format enables use of high-throughput equipment which can
dramatically increase laboratory surge capacity. Due to the speed
and accuracy of the procedure, the total number of samples tested
is practically limited primarily by the initial sample processing and
reporting steps. While use of PCR in an outbreak can decrease the
number of people needed at the bench, it is necessary to adequately
staff support positions to handle the initial sample processing and
reporting duties.
A great deal of monetary and personnel resources have been
dedicated in the last decade to establishing and implementing PCR
in low-resource countries, in particular, for avian influenza detection. While PCR is a robust diagnostic tool, this technology has
prerequisite infrastructure requirements such as a dependable
source of electricity to run specialized equipment (thermo cyclers
and analysis software). Lack of resources in low-resource countries
will be a continuing challenge to development and sustainment
of surveillance programs for animal and zoonotic diseases of
concern.
Validation and quality assurance for molecular techniques is
very similar to that required by conventional assayswith some
special considerations [16]. PCR can lend itself to the use of internal controls that can provide assurance of test performance at
several key steps, such as extraction and amplification. It is recommended that validated internal controls be utilized for quality
control purposes.
New next-generation sequencing technology is making
genomic analysis cheaper and more routinely available to laboratories of any size. From a biosafety perspective, this technology has
the same requirements as outlined previously in the chapter.
41
Conclusion
Implementing and maintaining appropriate biosafety measures is
one of the most important parts of veterinary diagnostic laboratory
operations. Robust and comprehensive risk assessments must be
conducted to determine the appropriate protection measures to be
utilized in the laboratory. The use of molecular techniques does
not preclude the application of adequate biosafety measures to
handle the biological risks of pre-extraction diagnostic samples, as
well as the general laboratory safety measures needed to address
chemical and physical hazards inherent in these procedures.
References
1. Roughton J, Mercurio J (2002) Developing an
effective safety culture: a leadership approach.
Butterworth-Heinemann, Oxford, UK
2. Gershon R, Karkashian C, Grosch J et al (2000)
Hospital safety climate and its relationship with
safe work practices and workplace exposure
incidents. Am J Infect Control 28:211221
3. American Veterinary Medical Association
(2008) One health: a new professional imperative. http://www.avma.org/onehealth. Accessed
23 Dec 2013
4. National Association of State Public Health
Veterinarians (2006) Compendium of veterinary standard precautions: zoonotic disease
prevention in veterinary personnel. http://
scav.org/Edit/uploads/compendium%20
of%20veterinar y%20standard%20precautions%202006.pdf. Accessed 23 Dec 2013
5. Siegel JD, Rhinehart E, Jackson M, Chiarello L
et al. (2007) Guideline for isolation precautions: preventing transmission of infectious
agents in healthcare settings. http://www.cdc.
gov/hicpac/pdf/isolation/isolation2007.pdf.
Accessed 23 Dec 2013
6. Heckert R, Kozlovac JP (2007) Biosafety levels
for animal agriculture pathogens. Appl Biosaf
12:168174
7. Kozlovac J, Thacker E, Ellis R (2012)
Introduction to biocontainment and biosafety
concepts as they relate to research with large
livestock and wildlife species. In: Richmond JY,
Jackman J (eds) Anthology of biosafety
XIII. Animal production and protectionchallenges, risks and best practices. American
Biological Safety Association, Mundelein, IL
8. Pauli U, Griot C, Thr B et al (2012) From the
field to the laboratory in an animal disease outbreak situation. In: Richmond JY, Jackman J
9.
10.
11.
12.
13.
14.
15.
16.
(eds) Anthology of biosafety XIII. Animal production and protection-challenges, risks and
best practices. American Biological Safety
Association, Mundelein, IL
Centers for Disease Control and Prevention
(2012) Guidelines for safe work practices in
human and animal medical diagnostic laboratories. MMWR 61(Suppl):1101
Centers for Disease Control and Prevention
(2011) Guidelines for biosafety laboratory
competency. MMWR 60(02):16
Centers for Disease Control (2009) Laboratory
facilities (secondary barriers). In: U.S. Health
and Human Services (ed) Biosafety in microbiological and biomedical laboratories, 5th
edn. p 3335
Office des Epizooties (2012) Biosafety and
biosecurity in the veterinary microbiology laboratory and animal facilities. In: Manual of
diagnostic tests and vaccines for terrestrial animals. 6th edn, Vol 1, Chapter 1.1.2, p 111
Blow JA, Dohm DJ, Negley DL et al (2004)
Virus inactivation by nucleic acid extraction
reagents. J Virol Methods 119:195198
Theriault S (2009). Advances in applied
research. Public Health Agency of Canada.
www.stcu.int/bb2009/download/download.
php?id=115. Accessed 23 Dec 2013
Crossley B, Hietala S, Shih L et al (2005)
High-throughput real-time RT-PCR assay to
detect the exotic Newcastle Disease Virus during the California 20022003 outbreak. J Vet
Office des Epizooties (2012) Principles and
methods of validation of diagnostic assays for
infectious diseases. In: Manual of diagnostic
tests and vaccines for terrestrial animals. 6th
edn, Vol 1, Chapter 1.1.5, p 116
Chapter 4
Veterinary Biobank Facility: Development and Management
for Diagnostic and Research Purposes
Tina Lombardo, Silvia Dotti, Riccardo Villa, Stefano Cinotti,
and Maura Ferrari
Abstract
Biobanking is an essential tool for ensuring easy availability of high-quality biomaterial collections that
combine essential samples and epidemiological, clinical, and research data for the scientific community.
Specimen collection is an integral part of clinical research. Indeed, every year throughout the world, millions of biological samples are stored for diagnostics and research, but in many fields the lack of biological
material and models is a major hindrance for ongoing research. A biobank facility provides suitable samples
for large-scale screening studies and database repositories. Software dedicated to biological banks simplify
sample registration and identification, the cataloging of sample properties (type of sample/specimen, associated diseases and/or therapeutic protocols, environmental information, etc.), sample tracking, quality
assurance, and specimen availability characterized by well-defined features. Biobank facilities must adopt
good laboratory practices (GLPs) and a stringent quality control system and also comply with ethical
issues, when required.
The creation of a veterinary network can be useful under different aspects: the first one is related to
the importance of animal sciences itself to improve research and strategies in the different branches of the
veterinary area, and the second aspect is related to the possibility of data management harmonization to
improve scientific cooperation.
Key words Biobanking, Biological resources, Quality controls, Cryopreservation, Veterinary medicine
Introduction
The word biobank is a little over a decade old. It has been used
since 1996 [1] to describe collections of various types of biological
samples. Biobanks have been defined in a variety of different ways
and this has been a major challenge [2]. As reported by Hallmans
and Vaught, a biobank may be defined as the long-term storage of
biological samples for research or clinical purposes [3]. In addition
to storage facilities, a biobank can comprise a complete organization,
including biological samples, data, personnel, policies, and procedures, for handling specimens and performing other services, such
43
44
Tina Lombardo et al.
as database management and scientific studies planning [3]. The

Organisation for Economic Co-operation and Development,
OECD, defines biobanks as a collection of biological material, the
associated data and information stored in an organized system for
a population or a large subset of a population [4]. Based on this
definition, these infrastructures can be seen as components of dedicated research facilities, which enable the linkage of samples, their
storage locations, and their quality assured history since their
original time of sampling with associated, well-documented, clinical data. For managing such a biobank, Yuille et al. [5] have
emphasized that an efficient information infrastructure is a critical
component in life-science research and have even created the term
biobank informatics as a discipline, with the purpose of identifying the best coding systems available for storing and retrieving
biobank information.
In veterinary medicine, the activity of a biobank should not be
limited to the collection of biomaterials, but should involve the
processing, cataloging, and distribution of samples to the scientific
community for research purposes and therapeutic applications.
The field of biobanking has evolved from a simple collection
of frozen specimens to a virtual biobank in response to regulation
changes, the advances made in biological sciences, and the advent
of the computer chip [6].
Biobanks play a pivotal role in research, diagnosis, and production, as they provide high-quality biomaterial that is otherwise
difficult or impossible to access for scientists of both human and
veterinary medicine; in fact, the availability of high-quality samples is a reported problem and samples stored in improper conditions may lack the expected quality for their use [7]. Human
biological specimens have been collected and distributed for many
decades and have played a key role in the understanding and treatment of human diseases; in fact, in human medicine, the network
of biobanks is advanced, but in veterinary medicine such networking is at a very early stage. Human specimen collections vary
widely in biological resources and structure. Furthermore, modern cryopreservation techniques allow the storage of different
types of biological samples, ready to be used upon request. The
role of biobanks is gradually increasing as they have been identified as a key source of biological tissues to be used in transplantation, tissue engineering, regenerative medicine, pharmaceuticals,
and diagnostics. One of the major objectives in Europe is to define
concerted actions aimed at developing and sharing best practices
and standardizing the procedures [8]. Currently, there is considerable variation in national laws and local practices applied to the
processing and storage of biological samples in the various countries throughout the world [2]. This variability complicates the
conditions for collaboration among scientists from different countries, reducing the future sharing of research data and samples and
Biobanking of Biological Samples for Diagnosis and Research
45
the possibility of carrying out collaborative research if regulations

are not harmonized [9]. A process to reduce this variability has
been initiated, and several sets of standards and best practices,
helpful in improving quality of standards for biobank operations
and biospecimens, have been published [10].
The Istituto Zooprofilattico Sperimentale della Lombardia e
dellEmilia Romagna (IZSLER) is a veterinarian public institution
of the Italian Ministry of Health that includes 16 off-site laboratories and has its headquarters in Brescia. In recent decades, almost
all of these laboratories involved in different areas have stored samples of animal origin, resulting from routinely diagnostic procedures and research. This activity has created several biological
resources and materials collected according to different quality criteria and without harmonized procedures, depending on the main
competence areas of the departments. In order to enhance interoperability and ensure the availability of biological material with welldefined quality features, a centralized infrastructure for storing
biological resources in Brescia has been developed. This procedure
allows the storage of samples that are controlled by standardized
processes. At the same time, within national and international biobank collaborations, studies are performed using a large number of
samples from different sources, which could be used for epidemiological researches. For such studies, it is of pivotal importance to
establish quality criteria regarding the type of samples, storage conditions, and the availability of specific information. The subsequent
paragraphs will describe the experience of IZSLER with the development of a biobank infrastructure, mainly based on biological
resources, to be used in the field of diagnosis, research, and microorganism production.
Development of a Veterinarian Biobank Infrastructure

The development of a veterinarian biobank infrastructure was
based on the following steps: sample census, data recording, quality management system and quality controls, safety and security of
the storage area, and personnel.
2.1
Sample Census
The first step consisted in the inventory of the existing resources

located in all the different facilities, the purpose of their use and
storage, and the amounts of existing aliquots; this approach was
necessary to evaluate the space and equipment required for their
preservation. In particular, the main aspects were to define the quality standards required and the various biohazard levels, storage conditions, and selection of specific tests to be performed in order to
ensure the identity, purity, and suitability of each specific sample.
The outcome of this investigation has allowed the detection of 17
different types of biological resources equivalent to 42,683 stored
46
samples. Biological resources from different animal species were

subdivided into the following sections: microbiology and parasitology (bacteria, Chlamydiaceae, fungi, metazoans, mycoplasmas,
Prototheca algae, protozoans), virology and prions (viruses, viral
pathological materials, prions), biological products (cell cultures,
field sera, hybridomas, IgG anti-immunoglobulins, immune sera),
and others (chemical compounds, histological materials). On the
basis of these findings, it was decided to proceed with the creation
of a centralized infrastructure. Biological resources included in the
biobank were selected for their suitability, depending on the type of
the sample collected and according to specific quality criteria. Due
to the presence of unique sample types, for some kind of biological
resources (i.e., bacteria, viruses), three different aliquots were considered: the base matrix (master sample) to be used for the preparation of new batches, the working batches originated from the master
to be used, and finally the backup sample as a deposit rate
(usually equal to of the amount fitted). Storage in a different
remote infrastructure is aimed at preserving samples in the event of
a technical failure or calamity. This additional mirror banking of
samples ensures that, if samples are compromised for whatever reason, replicate undamaged aliquots will still be available.
Data Recording
In order to ensure the traceability of biological samples, a database

has been developed with different data recordings, each one specific for a biological resource. All samples are identified by a code
and labeled with a bidimensional bar code. Data regarding all individual samples are collected in a software database that allows the
number and position of the sample to be traced. In particular, bar
codes ensure major reduction of errors in all specimen-handling
processes and the possibility of tracking information about manipulation activities according to standard operating procedures
(SOPs), quality control results, and loading and unloading order
management.
Standard operating procedures mean documented procedures
which describe how to perform tests or activities normally not
specified in detail in study plans or test guidelines. The database for
managing a biobank includes a web-based catalog, which lists the
access terms and conditions and the resource characteristics. The
catalog is intended to be used as a reference for scientists seeking
information about biological samples and data suitable for their
research.
2.3 Quality
Management System
and Quality Controls
Currently, biobanks must follow internationally accepted guidelines and best practices issued by ISBER (International Society for
Biological and Environmental Repositories) [11] and BBMRI
(Biobanking and Biomedical Resources Research Infrastructure).
In particular, BBMRI aims to improve biobanking accessibility
and interoperability by harmonizing similar biobanks in different
2.2
47
locations and enriching the genotypic and phenotypic data [12].

All biospecimens should be handled according to well-defined
protocols, and the whole clinical biobanking process should be
fully documented, from seeking informed consent from the donor
or patient to collecting, transporting, processing, storing, and
retrieving the biospecimens [13]. Careful documentation of the
methods and conditions used during collection and processing
will increase the future value of specimens [14]. Furthermore,
quality control programs must be established to check compliance
with the standard operating procedures for specimen collection,
handling, and analyses [15, 16].
With regard to animal biobanks, informed consent is not
required; however, all other parameters must be performed according to the same criteria. Biobanking work, including associated
laboratory handling specimens, has been performed in a standardized way. It is recommended the use of SOPs with the aim of continuously assessing the methods, materials, and equipment
employed. SOPs should consider the specific requirements of analysis platforms and the biological questions to be addressed.
However, SOPs can only be applied to prospectively collected samples, whereas for old archived samples, processing has often not
been documented in sufficient detail without following specific
SOPs, as in the past there was no application of quality management system, and storage of biological materials was performed by
scientists with no standardized procedures. In the context of quality management, the scientific use of this material therefore requires
special analyses to assess the proper preservation of biomolecules
[17]. The recommendations for biobanking activities, quality
assurance (QA), and quality control (QC) programs must be followed to ensure the high quality of samples. As described by
OECD [18], good laboratory practices (GLPs) are a quality system concerned with the organizational process and the conditions
under which non-clinical health and environmental safety studies
are planned, performed, monitored, recorded, archived and
reported. The principles of GLPs represent a managerial concept
in order to cover the whole organization process, beginning from
the planning and arriving to the reporting of the applied procedures. Furthermore, this way of management facilitates the
exchange of information and contributes to the protection of
human health and the environment. Stability of biological samples
depends on the procedures from the time of acquisition to the time
of processing and storage; in fact, the use of anticoagulants, stabilizing agents, the time from collection to storage, and the sample
handling temperature must all be controlled.
Biological samples can be stored for up to 30 years, but specific
protocols are required to reduce the damage induced by preservation techniques [19]. This issue has been widely reported with
proposals for rigorous quality controls for each step of the working
flow, including collection, processing, and storage [20].
48
These procedures aimed to assess the preserving conditions

depend on the type of biospecimen. Appropriate controls can be
applied to cell suspensions (cell viability assays, contamination
assays), to DNA and RNA (quantification and purity, function of
DNA-modifying enzymes), to tissue morphology, and to viral
batches (viral contamination tests, standard microbiological testing
methods, and real-time PCR). All strains enrolled in IZSLER collection are submitted to different cultural and molecular biology control tests, in order to evaluate their features, purity, and identity.
However, no appropriate quality controls exist for liquid biosamples (serum, plasma, urine, saliva, cerebrospinal fluid, synovial fluid).
At IZSLER, the activity of the laboratories involved in biobanking is carried out using a quality assurance system in accordance with the requirements of UNI CEI EN ISO/IEC
17025:2005 as well as ISO 9001:2008 quality system for cell cultures. Biological resources are prepared and stored according to
internal procedures.
Personnel
Laboratory activity is based on certain fundamental rules of good

microbiological practice for the safe manipulation of biological
samples.
Each operator (technician) must follow internal training
courses, specific for their activities, positions, and competencies.
The operators should have basic knowledge on various biological topics. First of all, microbiology is one of the main subjects
to know, as well as the isolation and cultivation of pathogens.
Another important aspect is represented by the information on disinfection of work surfaces, equipment, and environment. Personnel
should be aware of the need to minimize the production of aerosols and control other potential risks of contamination between
biosamples and workers.
2.5 Control, Safety,

and Security
of the Storage Area
This is one of the main points that must be monitored and controlled. In fact, it represents a potential risk in the whole storage
process. Starting from this point of view, monitoring temperature
within mechanical freezers and refrigerators is an important quality
assurance measure in addition to general building safety and security to protect against fire, unauthorized entrance, and other usual
hazards. Furthermore, all freezers must be protected by a real-time
temperature monitoring and alarm system. Alarm systems should
be in place to monitor the temperature conditions of mechanical
freezers or, for nitrogen freezers, the liquid nitrogen level (Fig. 1).
Furthermore, a well-designed biobank software system has been
developed to provide the possibility of monitoring the temperature
values with an alarm service. Such temperature logging information must be automatically transferred via electronic interface into
the biorepository management system and be linked with the
2.4
49
Fig. 1 Illustration of the real-time monitoring and alarm system of the IZSLER Veterinary Biobank facility
samples stored in the corresponding freezer. Any interruption of

electrical power should be compensated for within minutes by an
independent system, such as a generator with locally controlled
production of electrical power. Automatic data logging into a database and the alarm service are very important for quality management of a biobank. If a measured value drifts outside inner or outer
thresholds, an alarm is sent to staff members.
Sample Types and Preparation

Pre-analytical conditions are a key factor in maintaining the high
quality of biospecimens. They are necessary to achieve the highest
specificity of the laboratory test used for clinical diagnosis as well as
for accurate reproducibility of experiments in the field of biomarker
discovery. Inappropriate collection, handling, and storage of samples, as well as errors in data analysis and documentation, may all
contribute to the generation of irreproducible and unreliable data.
Preservation and optimization of biosample integrity to foster relevant research results and outcomes is a guiding principle of sample management.
The field of veterinarian research is rapidly evolving with new
technologies and new standards. Samples are collected and stored
also for a long period of time (years) before being used. For this
reason, sample handling procedures should be defined and appropriated in order to guarantee a suitable use for the technology of
tomorrow.
50
Biological samples have different storage requirements. For

this reason, various approaches can be defined in order to obtain
the most correct procedure.
3.1
Blood Samples
The routine use and collection of blood samples for diagnosis has
provided general information on optimal methodologies and
potential pitfalls.
Although procedures for collecting, processing, storing, and
shipping blood components are generally standardized and well
documented, several important factors need to be considered.
An important early decision in blood collection is whether to
collect anticoagulated blood (consisting of plasma, buffy coat, and
red blood cells) or coagulated blood (consisting of serum and red
blood cell clot). Hemolysis of the specimen affects the accuracy of
laboratory tests, particularly chemical and serological tests; therefore, it should be prevented by employing careful handling techniques according to optimum needle size, proper handling of the
tubes, and proper pipetting techniques; however, if hemolysis is
observed (pink to red tinge in sample), this information should be
recorded [21]. In fact, hemolyzed samples would not be used for
proteomics analysis, but destroying them may be unnecessary as
any sample is worth saving, unless storage space is constrained.
Annotation of all pertinent information about the samples allows
the identification of potential factors that could influence outcomes. Serum and plasma specimens are of better quality for analysis if smaller-volume aliquots are initially prepared rather than
larger ones that have to be thawed, handled, and refrozen, perhaps
several times. Indeed, the ability to provide ready-to-use (RTU)
aliquots without additional handling steps facilitates the sharing of
samples and provides multiple replicates handled in an identical
manner. It is also important to consider new or alternative methods and reagents that may offer longer-term stability or increased
efficiency in the collection and preservation of blood [22, 23].
3.2
Cell Cultures
The ability to cryopreserve and successfully recover cell lines has

been critical to the conservation of these biological samples, in
particular the preservation of stem cells and the preparation of
well-characterized cell banks. Indeed, the systematic storage and
establishment of cryopreserved banks of cells for the stem cell
research community is essential to the promotion of standardization in stem cell research and its use in clinical applications. Despite
the significant potential for the use of stem cells in research and
therapy, they are challenging to preserve and have been shown to
be unstable after prolonged culture, often resulting in permanent
alterations in their genetic background, which ultimately alters the
phenotype of the culture. The working process related to cell culture isolation, amplification, control, storage, and shipment should
be carried out in accordance with a quality management system
51
such as ISO 9001:2008. Preparation and propagation of cell cultures

are performed as indicated by international guidelines, and their
sensitivity and reproducibility have been evaluated during interlaboratory tests. Each cell culture process provides ideal conditions
for the growth of many organisms [24]; for this reason, particular
attention must be placed on quality controls that should be performed on all samples with the purpose of assessing their purity
and safety. These tests are carried out using microbiology, virology,
serology, and molecular biology methods, as reported by the
European Pharmacopoeia or other international guidelines. These
assays are mainly based on in vitro tests. However, in vivo methods
are used on laboratory animals, in the absence of validated in vitro
systems or as indicated by international guidelines. In particular,
the tests usually performed are aimed at detecting contamination
from bacteria, fungi, yeasts, and mycoplasmas as well as animal and
human viruses for human cell lines. Furthermore, bacterial endotoxin level, tumorigenicity, and cross contamination are investigated. Tests on cell cultures for detecting bacteria, fungi, and yeasts
must be performed in an isolation unit, according to the European
Pharmacopoeia.
3.3
Chlamydiaceae
3.4 Field
and Immune Sera
Serological and molecular screening focused on the identification

of chlamydial infections is routinely performed. Isolation of chlamydial species is carried out on cell culture.
Identification of the species belonging to the Chlamydiaceae is
carried out using molecular tests, i.e., real-time PCR and PCRRFLP analysis, which amplify specific genome sequences. The identification of new chlamydial species not yet classified is also
performed using new real-time PCR and specific gene sequencing.
The field sera include samples from different animal species, mainly
farmed, pets, and wildlife animals. The samples are collected by
blood, sent to IZSLER to be tested in accordance with national or
regional control programs or for specific serological tests. All these
samples can be used as positive reference due to the presence of
antibodies toward a specific pathogen, turning them very useful for
retrospective serological surveys and validation of innovative serological tests. All serum samples collected and stored in the biobank
are tested toward a panel of pathogens with the aim to know the
presence/absence of antibodies.
Different serological techniques can be used and these are
reported in specific sheets. Titers of humoral antibodies of serum
samples are also registered and values are performed at preestablished intervals. The immune sera consist in polyclonal sera obtained
from different animal species (rabbit, goat, mouse, rat, guinea pig)
and toward several bacterial and viral antigens. They have been produced with antigens mostly purified and have a specificity panel
available at the facility where they have been produced.
52
3.5
Hybridomas
The hybridomas that produce monoclonal antibodies are selected

to be used in in-house diagnostic assays. They were generated to
produce monoclonal antibodies against a wide spectrum of viruses,
bacteria, and proteins, mainly of veterinary interest, and immunoglobulin isotypes of various animal species that were shown to be
strategic tools for both research and diagnostic purposes.
Hybridoma cultures are usually collected for freezing during the
exponential growth phase and then are submitted to a double
series of cloning procedure to assure the stability of the hybridoma
and the clonality of the produced antibody. The monoclonal antibodies expressed by each hybridoma are controlled through a
series of immunological assays aimed at identifying and characterizing their reactivity profile.
3.6 Microbiological
and Parasitological
Samples
Bacterial/fungal strains are identified by either phenotypic or

genotypic tests. The former consists of microscopic observation
and isolation in specific culture media. Identification is made
through biochemical tests performed using commercial tests like
the API or the Vitek systems. Genotypic tests, mainly PCRbased, are carried out to detect genes of virulence. Moreover, the
16S rDNA gene sequence analysis can be used to confirm the identity of bacterial species.
Parasites are identified using either phenotypic or genotypic
tests. The former consists of microscopic observation and comparison with identification keys. Genotypic tests, mainly PCR-based,
are carried out to identify genus or species.
3.7
Prototheca Algae
The identification of Prototheca algae (species and eventually subspecies) is currently carried out through microscopic examination,
growth in specific culture media, and molecular assays (HMRPCR, end point PCR, or sequencing).
3.8
Tissue Samples
Tissue samples can be stored in different ways, depending on their

intended purpose. Indeed, molecular tools for tissue profiling,
such as real-time PCR and expression microarrays, generally
require collection of fresh frozen tissues as sources of high-quality
RNA. Frozen tissue sections are made from high-quality tissues
immediately snap-frozen in liquid nitrogen after being excised and
identified by a pathologist. Available tissues include normal, diseased, and tumor animal tissues. The tissues excised are immediately frozen by liquid nitrogen and then stored at 80 C. Tissue
sections of 510 m in thickness are mounted on positively charged
glass slides. Furthermore, 0.40.7 g samples of standard size could
be frozen in blocks into liquid nitrogen for 2040 min after surgical excision. Otherwise, tissues could be fixed in 10 % neutral formalin for a minimum of 24 h and stored as paraffin blocks of
0.5 1 1 cm. Formalin fixation and paraffin embedding (FFPE)
53
preserve the morphology and cellular details of tissue samples.

Thus, it has become the standard preservation procedure for diagnostic surgical pathology [25]. Historically, the archived FFPE
blocks have been successfully used for immunohistochemistry
application. However, formalin-fixed archival samples are known
to be poor materials for molecular biology applications due to the
irreversible modifications caused by formalin fixation on macromolecules. In the last ten years, there has been an exponential
increase in the development of molecular assays using FFPE blocks.
At present, when sections from FFPE blocks are to be used for
molecular extraction, focus is placed on the time of fixation in formalin in order to avoid over-fixation. The advances in the field of
molecular biology techniques have attempted to overcome the
issue of formalin cross-linking and have successfully extracted
DNA, RNA, and proteins, although fragmented.
3.9 Viruses and Viral
Pathological Materials
Cell-associated viruses that can be grown in adherent or suspension cell cultures or chorioallantoic membranes of embryonated
hens eggs can be isolated from several types of samples. The main
principle of isolating viruses is to choose the most suitable cell line
and mechanically lyse infected cells and subsequently carry out several amplification passages to increase the titer in order to produce
the master sample and then the working samples. Virus batches are
tested for potential microbiological and viral adventitious contaminations; the tests are performed using microbiology, virology,
serology, and molecular biology methods. The primary sources of
potential viral contamination come from infected animal tissues
used to prepare biological reagents and media and during laboratory manipulation. Virus detection and identification can be made
by employing several methods, mainly based on serology tests
using monoclonal antibodies and standard and real-time PCR.
These assays amplify specific viral genome sequences known to be
characteristics of a virus with a nucleotide sequence available in
database collections. Extraneous viral contaminations can be verified through tests based on molecular biology techniques that
allow the detection of viral DNA and RNA of other viruses.
Mycoplasma contamination can be detected using real-time PCR
methods. Bacterial contamination is determined through inoculation of nonselective culture media. In addition, electron microscopy
is available for viral detection and identification using negative
staining methods. Such catchall methods (able to detect even
non-suspected/unknown viruses) benefit from Airfuge ultracentrifugation, increasing the sensitivity of the detection level.
Indeed, immune electron microscopy methods (IEM and IEM
gold) based on the use of hyperimmune sera and/or monoclonal
antibodies may help viral identification and classification.
54
Fig. 2 Cryogenic area for preservation of biological resources
Storage of Biological Resources

Proper storage requires the use of cryovials and labeling systems
that will withstand the intended storage conditions: vessels, labels,
and bar codes or other printing systems are chosen for extended
storage periods.
Samples have been deposited in freezers or other appropriate
storage containers according to specific storage systems in order to
preserve several parameters known to influence the condition of
biospecimens.
In accordance with features, intended use and estimated length
of storage, specimens may be stored at: room temperature, 4 C,
20 C, 80 C, or 196 C (vapor phase nitrogen) (Figs. 2 and 3).
Temperature is a major variable in specimen management.
Moreover microorganisms and viruses can be submitted to lyophilization process that allows preserving viability for a long time.
These freeze-dried samples can be stored at 4 C or at 20 C,
reducing the necessity to have freezers with lower temperature
(80 C); for these reasons, this is a practical and efficient method
for prolonged storage, less expensive, and more available in
emerging countries.
Application of Biological Resources

Two major formats of biobanks with several subtypes can be distinguished: the population-based biobank and the disease-oriented
biobanks, each with distinct and complementary scientific value.
55
Fig. 3 Freezing area for preservation of biological resources
The most common format is the longitudinal population-based

biobank, with biological samples and data from randomly selected
individuals of a general population, used as resources for future
unspecified research [2628]. The specific strength of this format
is the assessment of the natural frequency of occurrence and progression of common diseases, with special emphasis on predisposing genetic variants and environmental risk factors. In contrast, in
disease-oriented biobanks, which may contain tissue, isolated cells,
blood, or other body fluids, specimens are collected in the context
of medical diagnosis and treatment. These biosamples allow the
comparison of different disease stages and/or forms of treatment
at a molecular level, in order to evaluate biomarkers for the diagnosis of a disease or assessment of risk/predisposition and prognosis (research purpose), monitoring the recurrence of diseases,
prediction of mortality, and response to therapy [29]. The development of precisely defined clinical data elements (CDEs) may
help to ensure that clinically relevant data are collected at each time
interval [12]. In veterinary medicine, the wide availability of biological samples stored in biobanks provides the basis for research,
leading to a better understanding of animal disease biology and the
development of new diagnostic tests that require the use of biosamples with well-defined features [13]. The European Technology
Platform for Global Animal Health (ETPGAH) has identified the
lack of biological material as one of the main gaps in the development of new effective tools for the control and prevention of animal diseases. Biobanks represent an important tool in improving
epidemiological research dependent on the availability and quality
of the biomaterials but also on the collection of associated data [6].
In particular, for retrospective studies and longitudinal designs for
56
evaluating the course of diseases, the requirements for obtaining

time-specific data are even stronger. Furthermore, biological materials are a critical resource for genetic research. Major research in
genomics is being pursued to improve the efficiency of selection
for healthier animals with disease resistance properties. Molecular
genetic tests have been developed to select farm animals with
improved traits, for example, removal of the porcine stress syndrome and selection for specific estrogen receptor alleles [30]. The
sequencing of the genome to identify new genes and unique regulatory elements holds great promise in providing new information
that can be used for livestock production. Currently, in vitro
embryo production and embryo transfer are being the preferred
means of implementing these new technologies to enhance efficiency of farm animal production. Furthermore, the possibility of
developing an integrated approach of genomics and proteomics
using bioinformatics is essential for obtaining complete use of the
available molecular genetic information. The development of this
knowledge will benefit scientists, industry, and breeders considering that the efficiency and accuracy of traditional farm animal selection schemes will be improved by the implementation of molecular
data into breeding programs.
Role of Biobanks in Veterinary Medicine

A decade ago, biobanks were simply repositories of biospecimens.
Clinical data of limited quantity and quality had to be retrieved
from hospital information systems retrospectively [31]. Nowadays,
biobanks are much more than just collections of biospecimens; in
fact, the legal entity biobank refers to the management of the
samples stored under that label, the huge amount of either clinical
or experimental data, and the requirements for their cession [32].
In human medicine the concept of storing biological material represents a consolidated aspect that involved either ethical or scientific
tools with a particular regard to both individual and community
interests [33]. The recent advances in veterinary medicine have
allowed the creation of a biobank for storing animal samples. These
resources should be useful for several different aspects. The first is
related to the role of veterinary medicine itself, as the biobank
allows more detailed information to be obtained regarding all biological resources available, for improving knowledge in several veterinary areas such as food safety, animal health, global climate
change, public health emergency, and genetic conservation of biodiversity. The second aspect is related to the possibility of crossing
traditional discipline boundaries for future interdisciplinary research,
pathogenetic studies on eubacteria and viruses, detection of emerging zoonoses, epidemiological surveys and phylogenetic trees,
and genetic evolution studies that play a key role in public health.
57
The use of biobanks for epidemiological research does not only

depend on the availability and quality of the biomaterials, but also
on the collection of associated information, such as anamnestic and
epidemiological data, purity, and identity of the samples, (testing
performed) depending on the biological resource, allowing largescale screening studies.
Furthermore, experimental investigations and the development
of diagnostic tests and vaccines could be transferred to national
and international industrial branches.
The BVR (Biobank of Veterinary Resources) of IZSLER infrastructure integrates existing and newly established animal biological
samples and data collections, resources, technologies, and expertise to facilitate high-quality medical research, improving standardization and international cooperation. Furthermore, this
infrastructure will provide the flexibility needed to facilitate growth
of the network with new members and partners. An additional service includes the possibility of storing human and animal biosamples, offering repository services, and ensuring governance systems
that provide quality assurance.
Remarks and Future Perspectives

The field of biobanks is very complex and diversified, as it deals with
the collection, treatment, storage, distribution, and computerization of biological material, not only of human, animal, and plant
material, but also that from sources such as fossils and microbes.
Biobanks and biospecimens are essential components for several
areas of clinical and basic research, and, in fact, public awareness of
biospecimens and biobanking has grown significantly [19].
The primary purposes for improving biobank networks are to
harmonize and spread quality banking practices to distribute biospecimens with well-defined features and associated data. One of
the major obstacles for developing a uniform system of regulation
across Europe is the lack of an agreed definition of biobank [2].
Biological samples collected at the IZSLER Veterinary
Biobank infrastructure could be a key resource for the scientific
community. The possibility of creating a veterinary biobanking
and biological resource infrastructure in Italy, and then in Europe,
will allow the harmonization of standards for sample collection,
storage, and techniques of analysis, data management, and preparation of a specific database. One solution to address the issues of
standardization of quality and capacity should be the creation of
biobank networks [34].
The main challenge of an international biobank network is balancing the need to centralize specimens and resources with the
reality of delocalized collection activities, especially in a clinical
context. Currently, these networks could be considered as a trade
58
union between human and veterinary medicine, which could

significantly develop a multidisciplinary approach for discovering
new frontiers within life sciences and patient care.
Interoperability in biobanking represents the key for improving national and international research collaborations [35].
Furthermore, the integration of human and veterinary biobank
initiatives should harmonize databank diagnostic and typing methods. There is a considerable variation in national laws and local
practices regarding the processing and storage of biological samples, personal information, and data recorded among countries
around the world. This variability complicates the conditions for
collaboration between scientists from different countries, reducing
future sharing of research data and samples. Furthermore, if regulations are not harmonized between nations, the possibility of carrying out collaborative research decreases [29].
Millions of biological samples are stored every year throughout the world for diagnostic and research, but in many fields the
lack of biological material and models is a major hindrance for
ongoing research. Currently, variability regards the collection, processing, storage, and relative data of the majority of biospecimens
available for research and diagnosis. Such heterogeneous practices
provide biospecimens of unknown molecular integrity and contribute to irreproducible results, impeding the development of
more effective therapeutics and diagnostics [36].
Biobanking plays a crucial role in providing access to highquality biomaterial, essential not only for human medicine, but
also for veterinary medicine. Modern techniques of cryopreservation allow the long-term storage of biological samples for clinical
or research purposes comprising a complete organization including biological samples, data, personnel, policies, and procedures
for handling specimens and performing other services, such as
managing the database and planning scientific studies.
Software dedicated to biological banks facilitate sample registration and identification, the cataloging of sample properties (type
of sample/specimen, associated diseases and/or therapeutic protocols, environmental information, etc.), sample tracking, quality
assurance, and specimen availability. Biobank facilities must adopt
good laboratory practices and a stringent quality control system
and comply with ethical issues when required [8].
The necessity for accessing high-quality specimens has increased,
along with the necessity for standards to guide the proper collection, processing, storage, and distribution of specimens.
Perhaps more importantly, it is essential to know that the sample used for research and diagnosis is accurately characterized; once
the most critical points in a biospecimen processing method have
been identified, specific tests or markers to assess the quality of the
biospecimen are needed.
59
If appropriately collected, documented, and stored, biospecimens

are a valuable resource that can help answer current and future
scientific questions, to meet the needs of emerging technologies
[37]. The lack of concerted efforts, together with heterogeneous
policy approaches and practices, jeopardizes international collaboration and the sharing of samples and data. A new attitude and
strategy for sharing data and promoting cooperation in the field of
biobanks may not only have a great impact on public health programs, but also in the development of new biomarkers and drugs.
The importance of biobank networking has been emphasized
by many authors, and there are several major biobank networking
initiatives worldwide. Currently, international initiatives are emerging in order to find ways to cooperate even in the context of heterogeneous ethical and legal frameworks in which the national
biobanks are being established.
Acknowledgments
The authors thank Dr. G. Bontempi, L.R. Scorrano, colleagues of
IZSLER, and the personnel of Biobank Infrastructure for practical
support and collaboration.
References
1. Loft S, Poulsen HE (1996) Cancer risk in oxidative DNA damage in man. J Mol Med 74:
297312
2. Kaye J (2006) Do we need a uniform regulatory system for biobanks across Europe? Eur J
Hum Genet 14:245248
3. Hallmans G, Vaught JB (2011) Best practices
for establishing a biobank. Methods Mol Biol
675:241260
4. OECD (2006) Creation and governance of
human genetic research databases. OECD
Publishing, 25 October 2006. ISBN-92-6402852-8
5. Yuille M, Van Ommen GJ, Brchot C et al
(2008) Biobanking for Europe. Brief Bioinform
9:1424
6. Prokosch HU, Beck A, Ganslandt T et al
(2010) IT infrastructure components for biobanking. Appl Clin Inf 1:419429
7. Carter A, Betsou F (2011) Quality assurance in
cancer biobanking. Biopreserv Biobank 9:
157163
8. Vgvari A, Welinder C, Lindberg H et al
(2011) Biobank resources for future patient
care: developments, principles and concepts.
J Clin Bioinforma 1:24
9. Zika E, Paci D, Schulte T et al (2010) Biobanks

in Europe: prospects for harmonisation and
networking. Seville: European Joint Research
Commission and Institute for Prospective
Technological
Studies.
http://ftp.jrc.es/
EURdoc/JRC57831.pdf. Publications Office
of the European Union, Luxembourg
10. Vaught JB, Caboux E, Hainaut P (2010)
International efforts to develop biospecimen
best practices. Cancer Epidemiol Biomarkers
Prev 19:912915
11. International Society for Biological and
Environmental Repositories (ISBER) (2012)
Best practices for biorepositories: collection,
storage, retrieval, and distribution of biological
materials for research. Biopreserv Biobank 10:
79161
12. Zielhuis GA (2012) Biobanking for epidemiology. Public Health 126:214216
13. Simeon-Dubach D, Burt AD, Hall PA (2012)
Quality really matters: the need to improve
specimen quality in biomedical research. J
Pathol 228:431433
14. Huppler Hullsieka K, Georgea M, Brownb SK
(2010) Designing and managing a flexible and
dynamic biorepository system: a 15 year per-
60
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.

spective from the CPCRA, ESPRIT, and
INSIGHT clinical trial networks. Curr Opin
HIV AIDS 5:538544
Betsou F, Barnes R, Burke T et al (2009)
Human biospecimen research: experimental
protocol and quality control tools. Cancer
Epidemiol Biomarkers Prev 18:10171025
Patiel L, Aarem J, Baekken S et al (2012)
Biospecimen quality program in the biobank of
the Norwegian Institute of Public Health. Nor
Epidemiol 21:225229
Asslaber M, Zatloukal K (2007) Biobanks:
transnational, European and global networks.
Brief Funct Genomic Proteomic 6:193201
OECD Series on Principles of Good Laboratory
Practice and Compliance Monitoring. ENV/
JM/MONO(2002)9. The OECDs World
Wide Web site. http://www.oecd.org/ehs
Vaught J, Lockhart CN (2012) The evolution
of biobanking best practices. Clin Chim Acta
413:15691575
Moore HM, Kelly A, Jewell SD et al (2011)
Biospecimen reporting for improved study
quality. Biopreserv Biobank 9:5770
Micke P, Ohshima M, Tahmasebpoor S et al
(2006) Biobanking of fresh frozen tissue: RNA
is stable in nonfixed surgical specimens. Lab
Invest 86:202211
Vaught JB (2006) Blood collection, shipment,
processing, and storage. Cancer Epidemiol
Biomarkers Prev 15:15821584
Tuck MK, Chan DW, Chia D et al (2009)
Standard operating procedures for serum and
plasma collection: early detection research network consensus statement standard operating
procedure integration working group. J
Proteome Res 8:113117
Cobo F, Stacey GN, Hunt C et al (2005)
Microbiological control in stem cell banks:
approaches to standardization. Appl Microbiol
Biotechnol 68:456466
Kokkat TJ, Patel MS, McGarvey D et al (2013)
Archived formalin-fixed paraffin-embedded
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
(FFPE) blocks: a valuable underexploited

resources for extraction of DNA, RNA, and
protein. Biopreserv Biobank 11:101106
Knoppers BM, Isasi R (2010) Stem cell banking: between traceability and identifiability.
Genome Med 2:73
Bravo E, Napolitano M, Santoro F et al (2013)
The Italian Hub of Population Biobanks as a
potential tool for improving public health stewardship. Biopreserv Biobank 11:173175
Rahm AK, Wrenn M, Carroll NM et al (2013)
Biobanking for research: a survey of patient
population attitudes and understanding.
J Community Genet 4:445450
Harris JR, Burton P, Knoppers BM et al (2012)
Toward a roadmap in global biobanking for
health. Eur J Hum Genet 20:11051111
Gerrits RJ, Lunney JK, Johnson LA et al
(2005) Perspectives for artificial insemination
and genomics to improve global swine populations. Theriogenology 63:283299
Tukas E, Korotiji A, Maros-Szabo Z et al
(2012) Model requirements for Biobank
Software Systems. Bioinformation 8:290292
Arias-Diaz J, Martin-Arribas MC, Garcia del
Pozo J et al (2012) Spanish regulatory approach
for biobanking. Eur J Hum Genet 21:708712
Meslin EM, Garba I (2011) Biobanking and
public health: is a human rights approach the
tie that binds? Hum Genet 130:451463
Watson PH, Wilson-McManus JE, Barnes RO
et al (2009) Evolutionary concepts in biobankingthe BC BioLibrary. J Transl Med 7:95
Kiehntopf M, Krawczak M (2011) Biobanking
and international interoperability: samples.
Hum Genet 130:369376
Moore HM, Compton CC, Lim MD et al
(2009) Biospecimen research network symposium: advancing cancer research through biospecimen science. Cancer Res 69:67706772
Marko-Varga G (2013) BioBanking as the central tool for translational medicine CTM issue.
Clin Transl Med 2:4
Chapter 5
Biological Specimen Collection and Processing
for Molecular Analysis
Abstract
This chapter provides a standardized best practice approach to sample collection and handling for the
purpose of nucleic acid (NA) extraction and PCR. These methods are described through text and clearly
illustrated figures. Furthermore, for those cases in which transportation of samples cannot be accomplished due to the inability to maintain the cold chain or limitations on the import of live disease agents in
diagnostic samples, the chapter describes the use of FTA cards for collection transport and NA preparation
of samples for PCR. This chapter also makes emphasis in the best safety practices for handling of samples/
tissues to avoid unnecessary disease exposures to laboratory personnel. Finally, NA extraction best practices
and methods will be briefly outlined.
Key words Tissue, Swab, Culture, Virus, Bacteria, Fungi, Protozoa, Nucleic acid, Animals, Disease,
Organs, FTA card, Polymerase chain reaction, PCR, Typing, DNA extraction, RNA extraction
Introduction
Sample collection is the first and most important step for accurate
diagnostic testing. The sample must be appropriate for the test that
is going to be performed. In this chapter, the primary focus will be
on sampling and sample preparation for molecular analyses. The
molecular analysis will most commonly be a polymerase chain reaction (PCR)-based test. Because the pathogens affecting both farm
and companion animals are varied and include viral, bacterial,
protozoal, and fungal pathogens, the processing of the samples
outlined in this chapter will allow for both DNA and/or RNA
extraction. Therefore, nucleic acid extraction (NA) will be used as
an encompassing term that will be applicable to any pathogen.
PCR requires nucleic acid extraction from the diagnostic sample.
Understanding the location of the pathogen in the host during an
infection (this may vary during the course of the disease), as well as
the duration of the infection, will improve the success of detecting
the causative agent. It is also important to note that surveillance
61
62
Table 1
Examples of clinical signs and tissue samples that should be collected from chickens
Clinical signs
Sample to submit for testing
Hepatitis
Liver
Drop in egg production
Feces/large intestines, vaginal swabs
Lameness
Synovial fluid, tendons, heart, liver
Respiratory
Tracheas, tracheal swabs, feces, cloacal swabs, vaginal swabs

(if also present with decreased egg production)
Dyspnea
Tracheal swabs, tracheas, eyelids, lungs
Nephritis, swollen kidneys,

flushing
Kidneys
Tumors
Heparinized whole blood, tumor, plasma
Immunosuppression
Bursa, thymus, spleen, bone marrow
Skin lesions
Scab
Fowlpox
Pock lesion for cutaneous disease or trachea if diphtheritic disease
Neurological signs
Brains
Enteritis, malabsorption
Intestines, duodenal loop, feces
Proventriculitis
Proventriculus
These samples will allow for accurate molecular testing of virus and bacteria
(asymptomatic animals) and diagnosis of disease (sick animals) may

call for different sample types. The methods described in detail in
this chapter are more suited for disease diagnosis than for surveillance. For example, doing surveillance of foot-and-mouth disease
in pigs can be accomplished by testing oral fluids present on rope
samples; this allows for testing of a group, while the individual sick
animal will require for confirmation the testing of the vesicular
fluid. Similar case can be made with porcine circovirus type 2 and
porcine reproductive and respiratory syndrome [13].
Many text books, commodity industries, and world organizations have published detailed information on sample selection for
attaining the best results when diagnosing the many diseases that
affect animals [410]. The intent of this chapter is not to repeat
these details, but to address the important factors of sample collection and preparation using poultry as an example that can be
applied to other animal groups (Table 1). Choosing the correct
sample to send to the laboratory will allow for a fruitful diagnosis
and a happy client.
Swabs, fluids, flushes, feces, and blood are convenient and
appropriate samples to collect from live animals as are biopsies from
affected sites. Fresh tissues or tissue scrapings are normally obtained
from dead animals at necropsy. Unfixed tissue samples are the best
Sample Preparation for Molecular Analysis
63
specimens for pathogen detection. Nevertheless, most laboratories

find them difficult to deal with due to the need for processing
before nucleic acid extraction. This tissue processing is messy and
must be performed consistently for repeatable and comparable
results. Fixed tissues are sometimes the only sample available for
analysis. The type of fixative and the time elapsed from fixation
make these samples very unreliable, although useful for pathogen
molecular detection if no other samples are available [11].
The method of choice for each laboratory must be based on
the diagnostic needs, cost/benefit, and workload.
Nucleic acid-based molecular tests are some of the most versatile, as they are capable of detecting the pathogen directly in the
sample and can be performed on a variety of sample types. Of
course, the quality and quantity of the sample are of paramount
importance for optimal results. Samples for PCR should be
obtained with care to avoid contamination from other sites, the
environment, other animals, etc., and shipped to the testing laboratory as soon as possible in sterile individual containers. The samples should be kept cold during shipping and moist with sterile
saline. After their arrival to the laboratory, fluids, swabs, and flushes
do not require processing prior to NA extraction and can be added
directly to the lysis buffer of the nucleic acid extraction kit at the
volume recommended by the manufacturer. Occasionally, these
samples may be enriched or diluted in selective or enrichment
media before processing, but in most cases this is not necessary.
Tissues, however, always require processing prior to nucleic acid
extraction.
If transport to the laboratory must be delayed, samples can be
placed in RNA Later solution (there are many different suppliers of
this product such as Ambion Inc., Austin, TX; Life Technologies,
Grand Island, NY; Qiagen, Hilden, Germany) or DNA/RNA
Shield (Zymo Research, Irvine, CA). The solutions containing
nucleic acid preservatives inactivate viruses and nucleases and allow
the storage of samples for up to a month at room temperature.
Samples can also be refrigerated overnight or frozen at 20 or
80 C for longer holding periods, until ready for shipment. The
samples should be shipped frozen with enough ice to ensure that
they arrive frozen to the testing laboratory. It is not always possible
to maintain the cold chain; however, the use of FTA cards
(Whatman, GE Healthcare, Piscataway, NJ) is a viable alternative
for sample preservation. One drawback of this method is that the
samples are then only useful for NA detection, but not culture,
cytology, direct antigen detection, etc. [1214].
The use of FTA cards has greatly facilitated the collection,
handling, and shipment of samples for nucleic acid testing worldwide. FTA is an acronym for Flinders Technology Associates and
the cards were originally developed in the 1980s by Burgoyne and
Fowl at Flinders University, in Australia, as a method for protecting
64
nucleic acid samples from degradation by nucleases and other

processes. The patented FTA cards contain proprietary chemicals,
integrated within a filter paper matrix, that lyse cells, denature proteins, and immobilize and preserve nucleic acids from just about
any sample type. Samples can be stored and shipped at room temperature without special handling. The integrity of the samples is
optimized when cards are stored in an airtight pouch with a desiccant. The cards are available in several formats including the FTA
Indicator Card with a color indicator that changes from pink to
white following sample application, making it ideal for application
of colorless samples. Nucleic acids can be purified from just a couple
of punches excised from the FTA card. We will describe later how
to apply fluids and tissues on FTA cards for preservation of NA
and shipping to the laboratory.
In this chapter, we will describe several methods to prepare tissues in a standardized manner, as well as describe the application of
several sample types to FTA cards. Finally, the chapter will address
FTA card processing for nucleic acid amplification. The Figs. 1,
2, 3, and 4 included for these processes are intended to be selfexplanatory and easy to follow and give the operator well-defined
visuals for sample processing. The figures are the result of many
years of experience in busy laboratories with a heavy caseload.
Materials
2.1 Fresh Tissue

Processing
1. Brain heart infusion broth (BHI).
2.1.1 Manual
and Mechanical Grinder
Common Materials Needed
3. Scalpel and scalpel blades.
2. Disposable weigh dish.

4. Sterile forceps.
5. Sterile pipette tips.
6. Pipette able to dispense 2 ml, 3 ml, and 200 l.
7. Gloves.
8. Laboratory dedicated wear.
2.1.2 Manual Grinder

Specific Material Needed
1. Small manual tissue grinder. Many manufacturers provide disposable grinders in sterile packages. Nevertheless, pestle and
mortar or other similar manual instruments can be used. The
advantage of the disposable is the fact that they have a plastic
sleeve that will protect the user from splashes enhancing safety
as well as minimize sample to sample contamination. See
Fig. 1b for an example of a disposable manual grinder.
2.1.3 Mechanical Grinder

Specific Material Needed
1. Mechanical grinder. There are several mechanical grinders from

different manufacturers. Some examples are Bullet Blender
(Next Advance Averill Park, USA), TissueLyser (Qiagen), and
Tissue Homogenizer (Precellys, Bertin Technologies). In our
65
Fig. 1 Solid tissue preparation for nucleic acid extraction (see Subheading 3 for further information)
laboratory we use Bullet Blender preferentially. The protocol

described here is for using this specific equipment.
2. Stainless steel beads 0.35 mm. Optimal for all tissue types of
0.1500.200 g. Other bead sizes may be necessary based on the
66
Fig. 2 FTA tissues and tissues scraping sampling (see Subheading 3 for further information)
size and type of tissue that will be processed. The manufacturer

of the blender will likely carry beads of many different sizes,
made of many materials in their catalog, available for purchase.
Decide which ones are appropriate for your application and
laboratory.
3. 5 ml sturdy tubes.
67
Fig. 3 FTA fluid and swab sampling (see Subheading 3 for further information)
2.2 Materials List

for Sample Collection
for FTA Cards
1. FTA cards (Classic or Indicating cardwww.whatman.com).

2. Whirl pack bag or similar air tight storage pouch.
3. Desiccant packet.
4. Pipette (50250 l).
5. Sterile, RNAse-/DNAse-free pipette tips.
68
Fig. 4 FTA punch processing for nucleic acid amplification (see Subheading 3 for further information)
69
6. Dacron, polyester, or flocked sterile swabs.

7. Sterile scalpel.
8. Sterile scissors and forceps.
9. Sterile petri dish.
10. Gloves.
2.3 Materials List
for FTA Card Punch
Collection (Fig. 4a)
1. Harris Uni-Core punch (or similar).

2. Cutting mat.
3. 70 % Ethanol.
4. Sterile forceps.
5. RNAse-/DNAse-free microcentrifuge tube.
6. Gloves.
Methods
1. Label a sterile bead tube with the sample identification number.
3.1 Tissues
Preparation (Fig. 1;
See Notes 1, 2, and 5)
2. Using a sterile scalpel cut a small piece (~1 cm3) of affected tissue and place in a weigh boat (Fig. 1b).
3.1.1 Manual Grinder
3. Weigh tissue to 0.150 g and no more than 0.200 g (Fig. 1c).

4. Transfer the tissue sample aseptically to the labeled tube of the
disposable pestle (Fig. 1d1).
5. Add 1 ml of BHI to the tube; place the plastic sleeve over the
top of the container (Fig. 1e1).
6. Push the pestle down the tube making sure that the tissue is at
the bottom and twist it 180 in both directions at least twice.
At this time the tissues will be mostly homogenized (Fig. 1f1).
7. Remove and discard the pestle/grinder.
8. Bring to a total volume of 3 ml by adding 2 ml of BHI to
homogenate.
9. Transfer the required amount (normally 200 l) to a microcentrifuge tube for further nucleic acid extraction processing
(Fig. 1g).
10. Grinder tubes with homogenate can be stored frozen for later
testing. Viral and bacterial cultures are possible from these
samples.
3.1.2 Mechanical Grinder
1. Label a sterile bead tube with the sample identification

number.
2. Using a sterile scalpel cut a small piece (~1 cm3) of affected tissue and place in a weigh boat (Fig. 1b).
3. Weigh tissue to 0.150 g and no more than 0.200 g (Fig. 1c).
70
4. Transfer the tissue sample aseptically to the labeled tube. Add

3.0 ml of BHI broth (Fig. 1d2).
5. Tightly screw the tube closed and place in the grinder. A minimum of three tubes have to be used in the blender, spaced so
that they are balanced. If fewer than three samples are to be
blended, water filled tubes must be used to balance. Do not
reuse the balance tubes more than five times due to the risk of
tube breakage. These instructions are specific for the Bullet
Blender, but most other equipment also requires balancing the
loads. Regardless of the equipment, all tubes will break after
multiple uses (Fig. 1e2).
6. Set the controls for speed 9 and time 4 min. Close the lid and
press the start button (speed and times mentioned here are for
the Bullet Blender; other equipment may require other speeds
and times; check manufacturers instructions and protocols).
7. After completion of grinding cycle visually inspect the samples
(Fig. 1f2). Not all tissue samples are alike. Skin samples are
usually tougher and, therefore, more difficult to homogenize.
If samples are not sufficiently homogenized, repeat grinding
process (see Note 3).
8. After homogenization is complete, transfer the required
amount (normally 200 l) to a microcentrifuge tube for further nucleic acid extraction processing (Fig. 1g).
9. Grinder tubes with homogenate can be stored frozen for later
testing. Viral and bacterial cultures are possible from these
samples.
3.2 FTA Card
Tissue Sampling
(Fig. 2; See Notes 1, 2,
and 4)
3.2.1 Solid Tissue
1. Label the FTA card with sample identification, date, and

other pertinent information (Fig. 2a).
2. Use a sterile scalpel to cut a cross section of the tissue (Fig. 2b1).
3. Make several tissue impressions with cut side of tissue to one
circle on FTA card (Fig. 2c1).
4. Close the card and place in sealed pouch with desiccant
(Fig. 2e).
5. Store at room temperature to 80 C until nucleic acid extraction or shipment.
6. For shipment of the FTA card, place the pouch containing
the FTA card and desiccant into an envelope and ship.
3.2.2 Tissue Scrapings

2. Use a sterile scalpel to scrape the surface of the tissue (Fig. 2b2).
3. Apply the tissue scrapings from the scalpel to one circle on the
FTA card (Fig. 2c2).
71
4. Allow the spot to dry completely (this can take up to 1 h)

(Fig. 2d2).
5. Close the card and place in a sealed pouch with desiccant
(Fig. 2e).
3.2.3 FTA Card Fluid
and Swab Sampling
(Fig. 3)

Fluids
3. Pipette 250 l of fluid dropwise onto the center of one circle

on the FTA card (Fig. 3c1).
2. Collect the fluid (e.g., allantoic fluid) samples (Fig. 3b1).

(Fig. 3d2).
(Fig. 3e).
Swabs

2. Use a Dacron, polyester, or flocked swab to obtain the sample
from the patient (Fig. 3b2).
3. Roll and press the swab with the sample onto the circle of the
FTA card, expressing as much sample as possible from swab
(Fig. 3c2).
(Fig. 3d2).
(Fig. 3e).
3.3 FTA Cards

Punch Collection
(Fig. 4; See Notes 1
and 2)
1. Sanitize the Harris Uni-Core punch and mat with 70 % ethanol and allow to dry prior to use (Fig. 4b1, b2).
2. Place the mat under the FTA card circle to be punched
(Fig. 4c).
72
3. Using the Harris Uni-Core punch, press down on the FTA

card circle containing the sample. The paper disc will be
retained in the core punch (Fig. 4c).
4. Repeat core sampling until the desired number of discs has
been obtained. Discs will remain within the core punch. The
punch can hold up to 810 discs (Fig. 4d).
5. Open an RNAse-/DNAse-free 1.82.0 ml microcentrifuge
tube and depress the release button on the top of the UniCore punch to dispense discs into the tube (Fig. 4e).
6. Close the cap of the microcentrifuge tube.
7. Sanitize the punch and mat again with 70 % ethanol and allow
to dry before obtaining another sample.
8. Punch is ready for PCR. Place the punch in your mastermix
(Fig. 4f). There is no need for nucleic acid extraction from the
punches. PCR is conducted suing the punch as template.
Notes
1. Safety considerations
(a) Always wear a clean laboratory outer garment when working with diagnostic samples.
(b) Wear protective glasses to avoid splashes to the eyes.
(c) Wear gloves when handling animal tissues.
(d) Fresh tissue manipulations should be carried out inside a
biosafety cabinet.
(e) Do not use the mechanical grinder if working with nonhuman primate tissues, non-captive marine mammals, and
tissues suspect of any Risk Group 3 agents. There is a small
risk that tubes may break.
2. Quality assurance
The standardization of procedures is critical for the credibility
of all diagnostic laboratories. Results should be repeatable; this
is hampered occasionally by the type and volume of the samples received. Therefore, standardizing the sample of tissue by
weighing, resuspending in standard volumes, and applying
standard amounts to FTA cards is critical for your molecular
diagnostic laboratory. Too much tissue or tissues that are not
properly homogenized can lead to false positives or negatives.
The protocols described here have been quality tested; this
means that multiple tissue samples have been serially tested to
determine the best procedure to yield positives and negatives
consistently. It is always good practice to check the quality of
73
your procedure with known positive and known tissue samples

and determine if repeated sampling yields consistent results.
3. Important considerations for mechanical grinder use
(a) If homogenization is unsatisfactory, run for another 3 min
at speed 10 (speed and times for the Bullet Blender; other
equipment may require other speeds and times; check
manufacturers instructions and protocols). As a general
rule, use more speed and less time. Be sure that lids are
screwed on tightly.
(b) Do not wash and reuse tubes.
4. Important considerations for sampling on FTA cards
(a) Always wear gloves when handling FTA cards and avoid
touching the area within the indicator circle to avoid contamination of samples.
(b) Use FTA indicator cards for colorless samples so that the
area to be sampled is easily identified by the color change
once sample is applied. If an indicator card is not available,
apply the sample to the card and circle the area of sample
application with a pencil.
(c) For tissue impressions or scrapings, allow complete absorption of sample, but do not leave additional pieces of tissue
or scrapings on the card. All of the sample should be completely absorbed by the FTA paper.
(d) Allow FTA cards to dry completely; otherwise, sample
can transfer to other portions of the paper cassette. It may
take up to 23 h for samples to dry completely on card.
(e) Store dried FTA cards in sealed pouch preferably with
desiccant pack.
5. Important considerations about nucleic acid extraction
The steps to a diagnostic PCR test are as follows: Sample collection sample processing cell disruption NA purification/concentration/inhibitor control PCR storage.
Once the correct site for sampling has been determined,
then any sample from that site collected using a swab or the
sample itself (bodily fluids, tissues, etc.), as long as they are
fresh, will be suitable for NA extraction, provided they have
been handled appropriately after collection and they are not
too old and kept at inappropriate temperature that allow for
the degradation of the pathogen NA (RNA degrades faster
than DNA). Formalin-fixed tissues can be used, but success is
more variable mostly depending on the size of the product that
will be targeted for amplification. The first step for the extraction is to break apart the bacteria, fungi, or viral target (also the
74
host cells they may be invading) to release their DNA/RNA.

Such methods vary from physical to chemical and/or combinations followed by the NA extraction through filtration/affinity columns or precipitation. Some samples such as fecal
material have high levels of inhibitors that need to be controlled (eliminated/diluted) during the NA extraction to avoid
nonspecific inhibition of the PCR tests [1518]. Although we
may think that noncommercial extractions are more economical than their commercial counterparts, they do not account
for the cost of the labor and the quality control (QC) tests that
have to be associated with making sure the extractions work
just as efficiently every time with every batch of new reagents.
Commercial tests are developed to be better than the companys previous rendition and better than their competitors [18].
They are sold as kits, where all the reagents are included, and
they all have gone through rigorous QC. Every time a box is
open, you are guaranteed that their efficiency will be the same
as the one before and the same as the next one. Furthermore,
they have been optimized for the use of high-throughput
equipment making them very suitable for testing large numbers of samples; this is a common scenario in veterinary medicine herd health [19]. Current kits from many manufacturers
decrease inhibitors, some also come with internal controls, and
are able to isolate from the same sample, both DNA and RNA
with high efficiency. The cost is relatively modest per sample,
although they are sold in large packages that may be expensive.
Nevertheless, they allow for easier validation of the extraction/
PCR protocols for each of the matrices that will be use for disease diagnosis (feces, tissue, urine, etc.). A good NA extraction
is a powerful adjunct to a good PCR test; the sensitivity of any
PCR test will be dependent on how good the NA extraction is.
No matter how well tuned your PCR is, if there are not enough
copies of NA or there are inhibitors present, the sensitivity of
the PCR will suffer. Commercial kits because they will maintain their quality across laboratories will allow for standardization across of PCR tests [20]. Much is written about NA
extraction, and we recommend to check the current literature,
check what is commercially available and you can afford, determine if you will require high throughput now or in the near
future, and validate the method you choose to use comparing
it with a gold standard for each of the matrices first and then
with known positive clinical samples. Finally, always maintain
strict quality control protocols that will allow for the reproducibility and reliability of the extraction method you decide to
use and works best for your PCR test. One extraction does
not fit all PCR or matrices.
75
Acknowledgments
Photography credits to Christopher B. Herron, Digital Media
Coordinator, College of Veterinary Medicine, The University of
Georgia, Athens, USA; art credits to Kip Carter, Chief of Medical
Illustration Services, College of Veterinary Medicine, The
University of Georgia, Athens, USA.
References
1. Vosloo W, Morris J, Davis A et al (2013)
Collection of oral fluids using cotton ropes as a
sampling method to detect foot-and-mouth
disease virus infection in pigs. Transbound
Emerg Dis. doi: 10.1111/tbed.12196
2. Prickett J, Simer R, Christopher-Hennings J
et al (2008) Detection of porcine reproductive
and respiratory syndrome virus infection in
porcine oral fluid samples: a longitudinal study
under experimental conditions. J Vet Diagn
Invest 20:156163
3. Committee on Foreign and Emerging Diseases
of the United States Animal Health Association
(2008) Foreign animal diseases, 7th edn.
USHAA, St. Joseph, MO
4. Dufour-Zavala L (ed) (2008) A laboratory
manual for the isolation, identification and
characterization of avian pathogens, 5th edn.
American Association of Avian Pathologists,
Madison, WI
5. Saif YM, Fadly AM, Glisson JR, McDougald
LR, Nolan L, Swayne DE (eds) (2008) Diseases
of poultry, 12th edn. Blackwell Publishing
Professional, Ames, IA
6. Greene CE (2012) Infectious diseases of the
dog and cat, 4th edn. Elsevier/Saunders, St.
Louis, Mo
7. Lo YMD, Chiu RWK, Chan KCA (2006)
Clinical applications of PCR, 2nd edn.
Humana, Totowa, NJ
8. Radostits OM, Done SH (2007) Veterinary
medicine: a textbook of the diseases of cattle,
sheep, pigs, goats, and horses, 10th edn.
Elsevier Saunders, New York, NY
9. Smith BP (2009) Large animal internal medicine, 4th edn. Mosby Elsevier, St. Louis, MO
10. Zimmerman JJ (2012) Diseases of swine, 10th
edn. Wiley-Blackwell, Chichester
11. Granato A, Giantin M, Ariani P et al (2014)
DNA and RNA isolation from canine oncologic
12.
13.
14.
15.
16.
17.
18.
19.
20.
formalin-fixed, paraffin-embedded tissues for

downstream -omic analyses: possible or not?
J Vet Diagn Invest 26:117124
Burgoyne LA (1996) Solid medium and methods for DNA storage. US patent 54,965,
496,562
Rogers CDG, Burgoyne LA (2000) Reverse
transcription of an RNA genome from databasing paper (FTA). Biotechnol Appl Biochem
31:219224
Seah LH, Burgoyne LA (2000) DNA databasing on FTA paper: biological assault and
techniques for measuring photogenic damage.
In: Sensabaugh GF, Lincoln PJ, Olaisen B
(eds) Progress in forensic genetics 8.
International Congress Series. 1193, 7477
Saunders NA, Lee MA (2013). Real-time PCR:
advanced technologies and applications. Caister
Academic
Schuller M, Carter IWJ, James GS et al (2010)
PCR for clinical microbiology: an Australian
and international perspective. Springer
Tang Y-W (2012) Advanced techniques in
diagnostic microbiology. Springer, New York,
NY
Yang G, Erdman DE, Kodani M et al (2011)
Comparison of commercial systems for extraction of nucleic acids from DNA/RNA respiratory pathogens. J Virol Methods 171:195199
Gaumann R, Muhlemann K, Strasser M et al
(2010) High-throughput procedure for tick
surveys of tick-borne encephalitis virus and its
application in a national surveillance study in
Switzerland.
Appl
Environ
Microbiol
76:42414249
Iker BC, Bright KR, Pepper IL et al (2013)
Evaluation of commercial kits for the extraction and purification of viral nucleic acids from
environmental and fecal samples. J Virol
Methods 191:2430
Chapter 6
Validation of Molecular Diagnostic Assays and Quality
Assurance and Control in the Veterinary Laboratory
Abstract
This chapter describes the process of validating in-house molecular assays although the principles described
are equally relevant to all diagnostic assays. The best practice principles described below are based on the
In Vitro Diagnostic Medical Devices Directive (IVDD) and associated documentation. Although compliance with these regulations is not required for diagnostic reagents used on animals, the principles are
equally relevant to validation of all diagnostic assays, whatever their purpose.
Key words Validation, In-house, Molecular assays, Quality assurance, Quality control
Introduction
The introduction of new or modified diagnostic tests for veterinary
application is associated with significant risks, and a consistent
approach to assay validation and verification is therefore a requirement (Fig. 1).
In vitro diagnostics (IVDs) for human use come under statutory regulations in most jurisdictions (e.g., the US Food and Drug
Administration (FDA), the European Commission (EC)), and
although veterinary IVDs are generally free of these controls, there
is a responsibility, and usually a commercial necessity, to ensure
that tests are fit for purpose. Both in-house and commercial assays
(commercial kits used in modified form or for off-label applications
fall within the in-house status) need to be backed by the same level
of evidence supporting their performance against a specification.
Once an assay has been introduced, systematic quality assurance (QA) activities are essential to ensure that the assay continues
to perform according to the requirements of the specification and
fulfills its purpose.
77
78
Project planning
(panel, assay
definition,
materials
sourcing) and
commercial
analysis
Post-implementation
surveillance and
exploitation
Validation
core tasks
Review
meeting
Technical transfer
including training,
final SOP, reagent
manufacture and
quality control, batch
record collection,
verification
Followup/final
tasks
Data
analysis
&
technical
report
Panel
review
OR
Sign-off
Fig. 1 Assay development and validation plan
Quality control (QC) procedures must also be applied to

maintain the uniformity of the procedures and materials used to
perform the assay. Output data monitoring using multi-rule criteria
is a useful aspect of QC.
Validation of Molecular Diagnostics

This chapter refers to all nucleic acid-based (i.e., molecular) assays
including those designed for diagnostic and reference purposes.
The World Organisation for Animal Health (OIE) has developed a register of diagnostic kits certified by the OIE as validated
as fit for purpose [1]. Examples of the most common purposes
are to:
1. Demonstrate freedom from infection in a defined population
(country/zone/compartment/herd): (1a) free with and/or
without vaccination and (1b) reestablishment of freedom after
outbreaks.
2. Certify freedom from infection or presence of the agent in
individual animals or products for trade/movement purposes.
3. Eradication of disease or elimination of infection from defined
populations.
4. Confirmatory diagnosis of suspect or clinical cases (includes
confirmation of positive screening test).
Validation, QA and QC of Molecular Methods
79
5. Estimate prevalence of infection or exposure to facilitate risk

analyses (surveys, herd health status, disease control measures).
6. Determine immune status of individual animals or populations
(post-vaccination).
These purposes are broadly inclusive of many narrower and
more specific applications of assays. Such specific applications and
their unique purposes need to be clearly defined within the context
of a fully validated assay.
The term validation is often used very loosely and can cover
a variety of different processes. From the manufacturing industry,
Validation is a quality assurance process of establishing evidence
that provides a high degree of assurance that a product, service, or
system accomplishes its intended requirements. This often involves
acceptance of fitness for purpose with end users and other product
stakeholders. Validation is an evidence-based process that requires
proper planning in order to ensure that newly developed assays
comply with laboratory standard systems. There are a number of
stages in this process, including planning and inception, assay development and optimization, assay validation, rollout and verification
(i.e., a quality control process that is used to evaluate whether the
assay complies with its specification), and finally implementation.
Method validation can be used to judge the quality, reliability, and
consistency of analytical results. It is therefore an integral part of
any good analytical practice. Annex 15 to the European Union
(EU) Guide to Good Manufacturing Practice [2] which deals with
qualification and validation provides a useful context.
Analytical methods need to be validated before their introduction into routine use and revalidated whenever the conditions under
which the original validation was done change (e.g., use of an instrument with different characteristics or samples within a different carrier matrix) and whenever the method is changed or modified
beyond the original specification. The changes to a protocol that
may be considered significant and that therefore require assay revalidation with adequate evidence for equivalent performance depend
on the specific details of the test. Validation may be extensive, for
example, in the case of a newly developed in-house assay, or narrow
in scope, for example, in the case of a commercial assay already in use
which has had minor modifications. Various situations are likely to
arise in which it is appropriate to repeat only a subset of validation
tasks. For example, if the extraction method is changed, it may not
be necessary to carry out specificity checks, but the sensitivity will
require reassessment. It is essential to provide documentary evidence
that any assay is suitable for its intended purpose.
The laboratory may already have in-house or commercial
assays in use for which no specific evidence of previously undertaken validation or verification is available. Almost certainly, this
work would have been performed, but historically there may not
80
have been a good culture of record keeping. It is important to

provide documentary evidence of fitness for purpose. It is not
normally necessary to repeat validation and verification work, and
in practice, it may not be possible to retrospectively undertake this.
It may be sufficient to prepare a file referring to existing evidence,
such as results from interlaboratory comparisons or other studies
undertaken, copies of published papers, internal quality control
(IQC) and external quality assessment (EQA) results, etc.
However, the process of reviewing validation data may highlight
factors that require confirmation.
Quality Assurance
Quality assurance is the process whereby the quality of laboratory
reports can be guaranteed and comprises all the different measures
taken to ensure the reliability of investigations. It is not limited to the
technical procedures performed in the laboratory. Therefore,
although procedures within the laboratory that ensure that the testing procedures (the analytical phase) are reliable are important, consideration must also be given to the pre- and post-analytical phases,
where the majority of the errors in the entire testing pathway occur.
The laboratory does not have control of many of the preanalytical steps, such as what and how specimens were taken, labeling
(of samples and request forms), and transportation. However, it
can influence these activities by providing guidance in the form of
a user manual. This provides details of those key factors related to
the specimen which are known to affect the performance of the
test or the interpretation of the results and instructions for transportation of samples, including any special handling needs. The
laboratory should also have a procedure which defines the criteria
for specimen rejection. It is good practice to notify the user concerning rejected specimens.
Many veterinary laboratories are accredited by the national
accreditation body to the international standard ISO 17025 [3].
Accreditation is a means of assessing the technical competence of
the laboratory and provides assurance to the laboratory and its customers that its service is fit for purpose.
The key elements of accreditation are competency of staff; use
of documented, validated procedures; appropriate management
and use of equipment and reagents; and a system of evaluation and
quality improvement, involving internal audit, recording, and
management of user complaints and nonconformities.
There is a much used saying among quality professionals, If
it isnt written down it didnt happen. Good record keeping is
essential, for audit purposes (internal and external), to aid identification of root causes when problems are identified (e.g., determining which reagents or instruments might be responsible for a poor
performing test) and evidence of due diligence if the quality of
testing is questioned by a customer.
81
The most important aspect of quality is the culture of the

organization. Some organizations regard accreditation as a tick
box exercise. For these, compliance with accreditation standards
will always be a burden. The efforts required getting ready for
assessment visits by the accreditation body, to update standard
operating procedures overdue review, to carry out audits, and to
close nonconformities that should have been dealt with weeks or
months ago, become a last minute struggle. For such organizations, the quality management system (QMS) is in place to
maintain accreditation and not to ensure best practice. Another
well-known saying is that Quality starts at the top. If senior
management recognize the value of the QMS, resource it appropriately, attend quality management meetings, and support quality
related activities, then the culture of the organization will be
enhanced as will be its performance.
Quality Control
Quality assurance of test methods will be provided by a combination of internal quality control (IQC), internal quality assessment
(IQA), and external quality assessment (EQA).
4.1 Internal Quality

Control
IQC is the analysis of material of known content in order to determine in real time if the procedures are performing within predetermined specifications. It is primarily the day-to-day monitoring of
reproducibility or precision designed to detect errors in any single
days analytical procedure. Performance of control material within
predefined limits is essential for technical validation of a diagnostic
test. The type of control used will depend on the type of assay. For
qualitative assays, controls may just consist of a positive or negative
sample. For quantitative assays, quality requirements of controls
need to be determined for high and/or low clinical decision limits,
depending on the analyte. A good understanding of the assay is
essential in order to ensure that the appropriate controls are used.
There is further discussion on the use of controls for polymerase
chain reaction (PCR) assays later in this chapter. A number of
papers have been published on the use and interpretation of controls in veterinary laboratories [4, 5].
Commercial assays will include assay controls but the laboratory should not rely on kit controls alone. Manufacturers adjust
controls from batch to batch to give consistent results although
assay sensitivity may vary between batches. This consistency is an
obvious aid to the user, but it does mean that if you only use the
controls that come with the kit, you will not detect any batch to
batch variation. Therefore, it is recommended that the laboratory also use independent internal quality control materials,
either purchased from a commercial source or prepared in-house.
82
Use of the same internal control material over an extended

period monitors batch to batch variation.
Internally prepared controls must:
Behave like real samples
Have sufficient to last for a period of time, ideally at least a year
Be stable over the period of use
Be appropriately apportioned for convenient use
Vary little in concentration between aliquots
Operate within the linear region of the assay
A series of QC results may be plotted as run charts, also known

as Levey Jennings or Shewhart charts. These show the values plotted against the mean and usually the 1, 2, and 3 standard deviation
(SD) values. Westgard rules [6, 7] may then be used to define
specific performance limits and detect both random and systematic
errors. Three of the six commonly used Westgard rules are warning
rules, the violation of which should trigger a review of test procedures, equipment calibration, and reagent performance. Three are
mandatory rules which, if broken, should result in the rejection of
results in that assay run.
It is important to note that a system of quality control is
unlikely to improve a method that is fundamentally unsound.
Performing quality control does not by itself improve the quality
of any assay. It is the interpretation of the data obtained and appropriate actions taken that will lead to quality improvement.
4.2 Internal Quality
Assessment (IQA)
IQA is the repeat testing of a percentage (typically 0.51 % of

workload) of routine test samples to determine the laboratorys
ability to obtain reproducible results. IQA is a commonly used tool
in clinical microbiology laboratories but less so in other disciplines.
Consistency is an important measure of quality assurance, so repeat
tests continually giving the same results as the original show a system that is in control. The fact that IQA is performed on so many
samples throughout the year means that the results obtained are
statistically significant.
A specimen is split in two on arrival into the laboratory, and
while one part is put through the test procedure in the normal way,
the other one is given an IQA number and a new request form is
created. The IQA sample is then tested and reported in the normal
way, except that the report is sent to a member of staff rather than
a requesting clinician. The IQA result is then compared with the
original result and any discrepancies noted. Discrepancies are normally classed as either minor or major. Minor ones show variation
but would not affect the result, whereas major discrepancies are
likely to lead to a different result. All discrepancies should be investigated and major ones are likely to require repeat testing and may
result in an amended report being issued.
83
IQA requires the repeat sample to be booked in, for tests to be

selected and then performed, results to be validated, and a report
to be produced, with interpretive comments included. Therefore,
IQA assesses important aspects of the pre- and post-analytical
phase which take place within the laboratory as well as the analytical phase itself. Although on its own, IQA does not prove that the
laboratory is actually getting the right result, it is a good test of the
system and, when combined with other quality control measures,
is helpful in evaluating process control.
4.3 External Quality
Assessment (EQA)
External quality assessment is usually an externally organized function that monitors the efficacy of quality assurance procedures. It
compares the performance of different testing sites by allowing the
analysis of an identical specimen at many laboratories, followed by
comparison of individual results with those of other sites and with
the correct answer. EQA acts as a check on the efficacy of internal
quality control procedures.
EQA is performed on a limited number of samples, and the
process is inevitably retrospective, providing an assessment of performance rather than a true control for each test performed. It
gives participants an insight into their routine performance so that
they can take action to achieve improvements. EQA is an educational tool. To achieve the greatest benefit from EQA, samples
must be treated the same way as routine samples.
The diagram in Fig. 2 is a good illustration of how to interpret
QC results in terms of assay performance. The correct EQA result
Accuracy and precision
Good precision but

poor accuracy
Poor assay,
Good operator
Poor accuracy and

precision
Poor assay,
Poor operator
Good precision and
good accuracy
Good assay,
Good operator
Fig. 2 Illustration of how to interpret quality control results in terms of assay

performance
84
could be the dart closest to the bulls eye in the first dartboard on
the left. Therefore, the correct EQA result does not show that the
laboratory is capable of getting consistent results or of getting the
correct result consistently. If IQA results are consistently the same
as the original test results, they show good precision as shown in
dart boards 2 and 3 but do not distinguish between these two
options, i.e., show good process control but not whether the assay
is good. If IQC results are consistently accurate (mean close to
expected value of the control and small SD values), then this shows
good precision and a good assay, as indicated by dartboard 3.
However, only the examination phase is assessed by IQC.
Clearly, EQA, IQA, and IQC all have their role to play. EQA
allows comparison with results obtained by all other laboratories
participating in the scheme. IQA shows whether or not the laboratory has the pre-examination, examination, and post-examination
activities in control, and IQC shows whether or not the actual
results are correct. By performing EQA, IQA, and IQC and
reviewing the data obtained, you get a powerful indication whether
or not you have a well-controlled process (and competent operator) and also a good assay.
4.4
Personnel
All personnel involved with the validation, quality assurance, and

quality control of diagnostic tests must have clearly defined lines of
accountability and be equipped with appropriate knowledge, competency, and experience. Records of their qualifications must be
available.
4.5
Equipment
All equipment used in the assay validation exercise must be maintained, serviced, calibrated, and monitored as appropriate to ensure
that it is suitable for use. This is essential to ensure that all conditions can be reproduced accurately during subsequent routine production of reagents and performance of the assay.
Planning and Inception
5.1 Establishment
of the Project
The drivers for introduction of new diagnostics are most commonly gaps in capability and capacity or opportunities for improved
service presented by new knowledge and technology. During the
planning phase, the aim is to produce a clear, agreed project plan.
A vital part of the process is to ensure that the project is properly
resourced.
5.2 Establishment
of a Review Team
A suitable panel (review team) should then be established to

review the plan. This panel will also review the progress of the validation work, evidence that the test is fit for purpose and that plans
for monitoring of test performance are in place. It is important to
note that the size and composition will depend on the complexity
85
of the project. The principle of having a review team will apply

however simple the project. However, a straightforward revalidation following a minor change may be undertaken and overseen by
just one person. However, final sign-off of the project must be
undertaken by an appropriate senior member of staff.
The project leader and project manager roles may be performed by a single individual. The project manager, who has overall responsibility for the completion of the validation project and
responsibility for signing off the completed validation file and the
documented standard operating procedure (SOP) for performance
of the assay, should, most appropriately, be at least at team leader
level (however described). The project leader has responsibility for
the project work, including laboratory activity needed for the validation, data analysis, compilation of the validation file, report writing, presentation of data to review meetings, writing and
maintaining the SOP, and training of staff to carry out the procedure described in the new SOP.
One member of the review team should be responsible for
ensuring that all documents relating to the project (i.e., the contents
of the project dossier) are brought to the attention of senior management. This person must also ensure that the management are
informed of the key project events (i.e., project inception and funding, development work successful in meeting design requirements,
project abandonment, validation study completion, declaration that
the test is fit for purpose and plans for deployment). An example of
a suitable team would be two laboratory scientists, at least one clinical representative and the local quality representative. It is highly
desirable that one or more of the members of the team should be a
potential end user of the assay, as this will be useful in providing
input to the validation parameters to ensure clinical utility. It is recommended that at least one of the members of the team has statistical
expertise, but alternatively a statistician should be consulted to give
advice on the validation study design. The project manager or project leader, but preferably not both, unless both roles are held by a
single person, may be members of the review team.
The review team has the following responsibilities:
1. To assess how the assay will improve or fill gaps in the current
testing repertoire. This should include identification of the
diagnostic need, the currently available alternatives, the end
users, and any other stakeholders.
2. To compile a register of risks associated with project success or
failure and implementation of the assay (e.g., users might use
inappropriate specimen types or misinterpret the results). The
register should specify design actions to be taken in mitigation
of the specified risks.
3. To ensure that laboratory safety issues associated with the test
and the validation program have been assessed.
86
4. To ensure that the engagement of collaborative partners to

provide expertise or share costs has been considered.
5. To ensure that training and other human resources issues are
addressed.
6. To ensure that the means for efficient project management
have been established, including the nomination of advisors
and reviewers as necessary.
7. To approve the assay validation plan and then, when complete,
to review the validation study data and decide whether the
assay is suitable for deployment.
8. To review the assay deployment and post-deployment plans.
9. To ensure that the project dossier is maintained.
Assay Validation Plan

The objective of the assay validation plan is to ensure that the assay
conforms to the required specification. The specification may be
broad, for example, requiring that the assay accurately and reliably
measures only the analyte of interest in clinical samples with the
required level of sensitivity. Ensuring test reliability will include the
need to control the uniformity of the assay procedure and reagents
over time and the maintenance of full result traceability.
The review panel and project leader should conduct planning
meetings, perform literature searches, appraise options, and, where
possible, consult with other centers that carry out the same or similar assays. The project plan documentation should be version controlled. When the project plan has been agreed, the project leader
will be responsible for performance of the laboratory tasks. When
the agreed project milestones have been reached, a review panel
meeting should be held with the project leader presenting the data.
Any follow-up work and/or analysis, if necessary, will be agreed,
following which the project lead will generate the technical report.
The technical report is then circulated to the review panel, which
will then either sign off the assay as ready for rollout for routine use
(technical transfer including training of routine diagnostic staff) or
request further work that is carried out before the assay can be
signed off as suitable.
The technological details of the proposed assay, including
information on the platforms, reagents, controls, and protocol to
be used, should be specified in the validation plan. Sample preparation methods form an integral part of the diagnostic test for validation purposes.
The plan should specify the sample types to be evaluated and
both the essential (i.e., minimum) and optimal sample volumes.
87
Validation Design
The project leader should prepare the validation plan including the
following points that are based on the STARD initiative [8] and
external literature including MIQE [9]:
1. Define the purpose and objectives of the validation study. For
example, the study may be intended to validate the performance of a new assay or may aim to demonstrate that a significantly modified assay or protocol variant gives results within
the tolerance of the original.
2. Identify any training requirements to ensure everyone involved
in the validation has suitable levels of competency. Ensure training records are up to date for procedures being carried out.
3. Identify any risk assessments which need to be reviewed or
written.
4. Identify the available standards or reference materials. These
act as controls to allow the assay to be standardized, facilitate
assay comparison, and permit stability of the assay to be determined over time.
5. Identify the assay to be used for comparison with the assay
undergoing validation. This should be the currently accepted
gold standard where one is available.
6. Design an analytical validation study to test the sensitivity and
specificity of the assay using control materials, extracts from a
wide range of strains/variants of the target organism, specimens spiked with the target organisms, and a range of unrelated strains or species that could be present in a sample, but
that should not give a positive result.
7. Design a clinical validation study appropriate to the clinical
context (e.g., surveillance, screening, clinical diagnosis).
Choose the study group including species, case definitions,
inclusion/exclusion criteria, and study settings.
8. Identify the types (i.e., specimen, method of sampling, transport and processing) and numbers of samples to be tested.
Consider the need to include known positives, known negatives, low and high positives, and samples which are known or
likely to be problematic (e.g., containing inhibitors or possibly
cross-reactive markers).
9. Select appropriate statistical tools for determination of an appropriate sample size and to avoid bias. It is essential to consider
statistical requirements to ensure that results are statistically
significant. The sample size needed to ensure statistically significant results depends on a number of variables. Some guidance is
given in Tables 1 and 2. The validation design should avoid
discrepant analysis bias. Some samples may give discordant
88
Table 1
Relationship between sample size and 95 % confidence interval
Estimated test sensitivity (or specificity)b
Number of infected (noninfected)
subjects requireda
50 %
60 %
70 %
80 %
90 %
95 %
50
13.9 %
13.6 %
12.7 %
11.1 %
8.3 %
100
9.8 %
9.6 %
9.0 %
7.8 %
5.9 %
4.3 %
150
8.0 %
7.8 %
7.3 %
6.4 %
4.8 %
3.5 %
200
6.9 %
6.8 %
6.4 %
5.5 %
4.2 %
3.0 %
500
4.4 %
4.3 %
4.0 %
3.5 %
2.6 %
1.9 %
1,000
3.1 %
3.0 %
2.8 %
2.5 %
1.9 %
1.4 %
As defined by the reference standard test

95 % confidence interval around the estimated sensitivity or specificity ( value in table)
results with the new test compared to a gold standard. If only

these samples are retested, bias is introduced as there is a probability that the second analysis will give concordant results for
some of these samples. Both concordant and discrepant samples
should be retested to avoid bias.
10. Consider documenting an assessment of assay usability including method practicability, user feedback, and barriers to
implementation.
11. Plan to review the validation study in a timely manner. The
review meetings should have minutes detailing attendees and
agreed actions.
12. Ensure that all SOPs related to the modified or new kits or
reagents are current. It may be necessary to maintain new or
revised SOPs as working drafts while their contents are being
validated, ensuring risk assessments are up to date. SOPs
should be controlled documents.
13. Where assays are designed to diagnose diseases for which relevant clinical material is hard to obtain or rare (e.g., the viral
hemorrhagic fevers), their use may be justifiable due to their
potential diagnostic value, even though the full validation criteria described here are not met. Deficiencies in assay validation should be documented in the development dossier,
together with justification for each instance where the data are
inadequate. In such cases, a plan for completion of satisfactory
validation should be outlined. For example, it may be possible
to obtain samples post-implementation, or it may be reasonable to place greater reliance on the use of carefully designed
simulated specimens.
89
Table 2
Design parameters for validation experiments
Parameter
Design
Analytical sensitivity
Four different assay runs with at least three replicates per dilution of the sample
Diagnostic sensitivity Testing of samples (that have been tested using the gold-standard or
appropriate alternative assay) from cases with the defined clinical profile(s).
The minimum numbers of samples to be tested (to give a required level of
reliability of the sensitivity measurement) will depend on the prevalence of
disease and can be calculated from the minimum sensitivity levels and the
95 % CI shown in Table 1
Analytical specificity
Testing of DNA extracted from as many variants as possible of the target

organism, genetically related organisms and organisms likely to be found in
positive and negative cases (>100) with the defined clinical profile(s)
Diagnostic specificity Testing of >50 samples that were positive and >50 samples that were negative
using the gold-standard assay
Efficiency
(quantitative
assays)
Test tenfold dilutions of a positive sample or control in triplicate. Dilution

range to give Cqs from <12 to >35 cycles
Linearity
(quantitative
assays)
Test tenfold dilutions of a positive sample or control in triplicate. Dilution

range to give Cqs from <12 to >35 cycles
Measurement range
Test tenfold dilutions of a positive sample or control in triplicate. Range to

extend from lowest practical dilution to tenfold beyond highest dilution
giving a positive result
Precision
(quantitative
assays)
Three samples (high, medium, and low positive) assayed at least four times or
more in one run and over at least four different runs on different days
Reproducibility
(quantitative
assays)
Three samples (high, medium, and low positive) assayed at least four times or
more in one run and in at least four different runs on different days. These
to be run in different laboratories or using different reagent batches or
different instruments
Analytical accuracy
(quantitative
assays)
Three analytical standards (high, medium, and low positive) assayed at least
four times or more in one run and over at least four different runs on
different days
Clinical accuracy
(quantitative
assays)
Three clinical standards (high, medium, and low positive) assayed at least four
times or more in one run and over at least four different runs on different
days
Reference intervals
Testing of >100 samples (that have been tested using the gold-standard assay)
from cases with the defined clinical profile(s)
Clinical validation
Analysis of samples from cases with the defined clinical profile(s) with
follow-up. This is on-going audit of assay performance
Shelf life
Samples from three batches stored at the designed storage temperature.

Aliquots used to assay three samples (high medium and low positive) at least
four times or more in one run and in at least two different runs on different
days
90
Performing the Validation
8.1 General
Principles
With appropriate planning, much of the data required for validation

can be collected in relatively few assay runs with, for example, the
same run used to produce data on accuracy and reproducibility in
concert.
Diagnostic accuracy can be assessed through sensitivity and
specificity, positive and negative predictive values (PPV and NPV),
or positive and negative diagnostic likelihood ratios. The determination of accuracy requires that the true condition (i.e., as determined
by a gold standard where one exists) of the sample is known as indicated in Table 3, which defines these terms. Where possible, the
study should include high, medium, and low positives (i.e., reactive
samples), as well as negative samples. It is likely that misleading
results will be produced if only high positives are used to test diagnostic sensitivity.
Table 1 gives guidance on the acceptable sample numbers used
in validation experiments. Interpretation of the acceptability of an
assay based on its validation data will necessarily depend upon the
performance relative to alternative tests and upon the diagnostic
situation, for example, a very high NPV will be required for a
screening test.
8.2
False negatives in molecular diagnostic assays, particularly the ones

based on the PCR, may arise due to problems encountered at various stages of the diagnostic cycle. Although some of the problems
are generic, also relating to other testing methods, some are specific to the design and use of diagnostic PCR. The problems of
diagnostic PCR that are most intractable in terms of false-negative
results are extraction failure and reaction inhibition.
Controls
Table 3
Definitions
Reference test results (gold standard)
New test results
Positive
Negative
Positive
TP
FP
Negative
FN
TN
TP number of true-positive specimens, FP number of false-positive specimens, FN number of false-negative specimens,

TN number of true-negative specimens
Sensitivity = TP/(TP + FN)
Specificity = TN/(TN + FP)
Diagnostic accuracy = (TP + TN)/(TP + FP + TN + FN)
Positive predictive value = TP/(TP + FP)
Negative predictive value = TN/(FN + TN)
Positive diagnostic likelihood ratio = sensitivity/(1 specificity)
Negative diagnostic likelihood ratio = (1 sensitivity)/specificity

Whole process controls
91
amoured RNAPCR controls

PCR controls
spike nucleic acid extract with
naked nucleic acid
spike with cell or capsid

with the target sequence
extraction
spike PCR mixes with

naked nucleic acid
PCR set-up
sample
Fig. 3 PCR controls
The use of an appropriate internal control aids in identifying

false-negative results and greatly reduces the risk of incorrect diagnosis and reporting. Consequently, it is best practice to include a
whole process internal control (i.e., one capable of detecting both
extraction failure and amplification inhibition). Figure 3 illustrates
the difference between whole process and amplification controls.
External controls (i.e., where reference materials are tested in
a parallel PCR reaction containing the sample) are less satisfactory
although they are simple to design and implement. The risk that
false negatives remain undetected, though greatly reduced,
remains. However, for quantitative PCR it is advantageous that the
control reaction cannot interfere with test accuracy.
It is essential to use an appropriate RNA or DNA control
depending on target amplified. Figure 4 shows a selection of control materials. The internal control should be designed so that any
adverse effect on the sensitivity of the assay is minimized. It should
also be demonstrated that the internal control and target PCRs are
similarly affected by the presence of potential inhibitory substances.
This can be achieved by spiking the PCR reaction with potential
inhibitors, such as hemoglobin or reagents, such as ethanol or phenol that may be carried over from the extraction process. The shift
in crossing threshold values can be used to assess the relative impact
of inhibition on the amplification of both the internal control and
target organism.
8.3 Determination
of Analytical
Sensitivity (Detection
Limits)
The analytical sensitivity of an assay is its ability to detect a low concentration of a given substance in a biological sample. This type of
sensitivity is expressed as a concentration (e.g., as copies, colonyforming units (cfu), plaque-forming units (pfu), or genome equivalents per ml or per g of sample material) in acceptable units. A lower
detectable concentration shows a greater analytical sensitivity.
92
ss RNA transcripts
linear dsDNA clone
plasmid clone
amoured RNA
cloned or natural
target in RNA phage
cloned or natural target in

bacterial chromosome
cloned or natural
target in DNA phage
cloned or natural target in

circular ssDNA phage
plasmid target in bacterial cell
Target sequence is shown in red and carrier nucleic acid in black

Fig. 4 Nucleic acid control targets for PCR
Analytical sensitivity is directly related to the limit of detection

(LoD), also known as the minimal detectable concentration, which
is the lowest quantity of a substance that can be distinguished from
the absence of that substance (i.e., a blank value). Conventionally,
the LoD is reported as the estimate of the detection limit that can
be achieved with 95 % confidence. This determination requires probit analysis involving testing of replicate samples around the end
point of the assay and the processing the detection rate at each level
through statistical analysis software [10].
For validation purposes it is essential that the analytical sensitivity is determined by the final version of the assay, once development and optimization are complete. When reference controls are
available, they should be used directly or indirectly via calibration
of commercial or in-house working controls. The indirect route is
only acceptable when the reference control material is derived from
93
a true biological source that has restricted availability to calibration

purposes only. When an international standard has been established, the units should be calibrated against this reagent.
Ideally, international reference standards, containing a known
concentration of analyte, are the reagents to which all assays are
standardized. Such standards are prepared and distributed by international reference laboratories. National reference standards are
calibrated by comparison with an international standard reagent
whenever possible; they are prepared and distributed by a national
reference laboratory. In the absence of an international reference
standard, a national reference standard becomes the standard of
comparison for the candidate assay. These standard reagents are
highly characterized through extensive analysis, and preferably the
methods for their characterization, preparation, and storage have
been published in peer-reviewed publications.
The analytical sensitivity should be measured over at least four
different assay runs, with three replicates per assay. If the method
is to be used to detect a range of sample types, the sensitivity with
all types must be determined.
8.4 Determination
of Analytical
Specificity
Analytical specificity is the ability of an assay to exclusively identify

a target substance or organism rather than similar but different
substances (e.g., rabies rather than another lyssavirus) in a sample
or specimen. For validation, appropriate materials (i.e., cells or virions) containing nucleic acid targets likely to be encountered in
relevant samples should be tested. The widest, feasibly obtainable,
variety of differing strains containing the target sequence should be
included. In addition, nucleic acid containing material that should
be negative or not detectable in the assay but that is likely to be
encountered in samples should be tested.
8.5 Determination
of Diagnostic
Sensitivity (DSe)
and Diagnostic
Specificity (DSp)
The diagnostic sensitivity of an assay is the ability to detect the

infection of interest in a population, expressed as a proportion or
percentage (see Table 3). Diagnostic sensitivity of the assay depends
on the ability to obtain the target substance in a processed sample
from an animal that has the condition, as well as the ability to
detect very low concentrations of a substance.
The diagnostic specificity of an assay is the ability to correctly
identify an animal that does not have the infection in question and
will ideally refer to a particular comparator group. The diagnostic
specificity is expressed as the probability that a test will produce
true negative results when used on a noninfected population.
The sampling design must be chosen to allow estimation of
DSe and DSp. The designated number of known positive and
known negative samples will depend on the likely values of DSe and
DSp of the candidate assay and the desired confidence level for the
estimates (Table 1). A rather large number of samples is required to
achieve a very high confidence for DSe and DSp when a minimal
94
amount of error in the estimate is desired. Logistical and financial

limitations may require that less than an optimal number of samples
will be evaluated. Sample size also may be limited by the fact that
reference populations and gold standards may be lacking. It may,
therefore, be necessary to use a suboptimal number of samples initially. It is, however, essential to improve the quality of the DSe and
DSp estimates by testing samples as they become available.
8.6 Quantitative
Assays
Additional criteria are relevant to the assessment of quantitative

assay performance (e.g., when using quantitative real-time PCR
assays). The slope (used to determine the PCR efficiency), the
linear range, and the X and Y intercepts of the standard curve
formed using dilutions of control material are key measures. The
coefficients of variation across the linear range should be determined based on quantitative values (i.e., target copy numbers).
Alternatively, it may be more helpful to calculate standard deviations
of the quantification cycle (Cq) values. These values are essential in
order to judge whether variation between clinical results is significant and to establish the reliable quantitative range for an assay.
International standards, where available, should be used for
the calibration of quantitative assays. The use of commercially
available quantified standards may also be appropriate, but the values assigned will not have the same standing as international standards. Quantified material can be generated synthetically (e.g., in
plasmids) or by purification from the target organism. These standards are usually quantified by spectroscopy (i.e., from absorbance
at 260 nm, A260) or, if greater sensitivity is required, by fluorometry (i.e., using intercalating fluorescent dyes).
Results should not be extrapolated beyond the established linear dynamic range of the assay. Consequently, the quantitative
range of the assay should ideally encompass the range expected
from clinical samples. The standard curve should include a minimum of four points and the upper and lower values of the standards should be within one log of the top and bottom, respectively,
of the reported quantitative range. When positive results that are
above or below the quantitative range are obtained, these should
be reported as positive, greater than xx copies/mL or positive,
less than xx copies/mL, respectively.
Appropriate quantified controls that may be used to monitor
the performance of assays should be established. The levels of target molecule within controls should be set so that the assay is reliably positive. However, the concentration should not be
significantly higher than that of a typical clinical sample (e.g., as an
indication the control might be designed to give a Cq value of
30 in a typical real-time PCR reaction). Test controls allow assay
performance to be monitored over time and assessed by Westgard
rules [6, 7].
95
Linearity
The linearity of an analytical procedure is its ability (within a given

range) to obtain test results which are directly proportional to the
concentration of analyte in the sample. Ideally a linear relationship
should be maintained across the range of the analytical procedure.
Linearity may be assessed by testing dilutions of a quantified standard and then plotting Cq values as a function of analyte concentration. Results should be evaluated by appropriate statistical methods,
for example, by calculation of a regression line by the method of
least squares.
8.8 Measurement
Range
The range of an analytical procedure is the interval between the

upper and lower limits (e.g., concentration, number of organisms
or number of DNA copies) in the sample for which it has been
demonstrated that the analytical procedure has a suitable level of
precision, accuracy, and linearity. This is normally derived from linearity studies and depends on the intended application of the procedure. It is established by confirming that the analytical procedure
provides an acceptable degree of linearity, accuracy, and precision
when applied to samples containing amounts of analyte within or
at the extremes of the specified range of the analytical procedure.
8.9
The precision of an analytical procedure can be expressed as the

variance, standard deviation, or coefficient of variation of a series of
measurements.
Precision can be determined by repeat testing of samples. The
precision of an analytical procedure expresses the closeness of
agreement (degree of scatter) between a series of measurements
obtained from multiple sampling of the same homogeneous sample under the prescribed conditions. Note: precision is not the
same as accuracy since an assay may be precise but inaccurate.
Precision may be considered at three levels: repeatability, intermediate precision, and reproducibility. Repeatability is the
agreement between replicates within and between assay runs by
the same operator over a short period of time. Intermediate precision measures variation within a laboratory to include, for example, tests performed on different days, by different analysts and
using different equipment. Reproducibility includes the agreement between replicate tests performed in different laboratories.
Reproducibility studies are necessary if the diagnostic method is to
be used in more than one laboratory.
Precision should be investigated using homogeneous, authentic samples, i.e., behaving as much like real samples as possible.
However, if it is not possible to obtain a homogeneous sample, it
may be investigated using artificially prepared samples or a sample
solution. Known positive samples should give the same acceptable
range of results if assayed four times or more in one run and over
at least four different runs on different days. This validation is not
an assessment of reproducibility, which is the closeness of agreement
8.7
Precision
96
between independent results obtained with the same method on

identical test material but under different conditions (i.e., different
operators, different apparatus, different laboratories, and/or after
different intervals of time). Reproducibility is measured as the
standard deviation qualified with the term reproducibility
(i.e., reproducibility standard deviation). Since there is less control
of possible variables when determining reproducibility compared
to repeatability, it should be expected that the reproducibility standard deviation will be higher than repeatability standard deviation.
A comparison of precision between platforms should be considered, especially if more than one platform (i.e., for extraction and/
or amplification) is an option, e.g., for contingency purposes such
as during machine breakdown or surge capacity.
8.10 Analytical
Accuracy
To assess analytical accuracy, known negative and positive samples

(i.e., with known reference or accepted reference test values)
should be extracted and assayed four or more times in one run. At
least four replicate runs should be performed to allow intra-assay
reproducibility to be measured, and these should each occur on
different days. With sensible planning, this task can be achieved
when performing analytical sensitivity testing. The acceptable
range of results will depend upon the application.
8.11 Clinical
Accuracy
The validation of clinical accuracy requires comparison of the assay

to an appropriate gold-standard method using sequential clinical
samples obtained in real clinical situations. The number of samples
tested will vary depending on the availability of suitable clinical
material. They should, wherever possible, include a wide range of
concentrations of positive samples as well as negative samples. It
may be helpful to consult a specialist statistician to determine the
appropriate treatment of the data.
8.12
The robustness of the assay may be evaluated by deliberately deviating aspects of the protocol that are perceived as being sensitive to
the outcome, for example, by simulating pipetting errors affecting
critical components, such as enzyme and Mg2+ or by extending the
storage of PCR reaction mix at room temperature or at 4 C before
amplification. Such data are likely to be useful for troubleshooting
if this is required.
Robustness
8.13 Reference
Intervals
The reference intervals, also referred to as the reference range, normal range, or reference limits, are the upper and lower levels of
analyte that you would expect to see in a normal population. Any
values above or below that range are outside normal limits.
Reference intervals are important when the purpose of the assay is
to determine whether the test subject or the sample is in or outside
the normal range. Generally, reference intervals are not relevant for
97
the quantification of infectious agents by real-time PCR since there

is no infection in the normal population.
8.14 Control
of Known
Interferences
The presence of interferences may be identified during assay development and/or validation. When it is known that samples might
contain materials that potentially interfere with the test result, the
SOP should be modified, wherever possible, to introduce a suitable sample pretreatment. However, the complete removal of
interfering substances cannot be guaranteed, and it is therefore
essential to include appropriate positive controls to ensure that this
problem is detected.
8.15 Limitations
of the Method
The limitations of the assay, whether based on general experience

or identified during validation, should be documented and made
available to users. Examples of limitations include any lack of sensitivity compared to another method, low sensitivity for certain
specimen types, and the possibility of false results in contaminated
specimens.
8.16 Clinical
Validation
and Implementation
in Diagnostic
Pathways
While analytical validation is designed to show that the test chemistry reliably detects the target, diagnostic validation ensures that
the test detects the target in clinical specimens. The clinical sensitivity and specificity of a test refer to its ability to detect the disease
accurately. Clinical validation can be carried out retrospectively or
prospectively. Often it is useful to establish an additional postimplementation prospective evaluation to add data to the file.
The next step is to integrate the test into routine as part of a
clinical diagnostic pathway. Workflows are established to ensure
that the test is performed at an appropriate point in the diagnostic
cycle, that performance is triggered by specific clinical questions,
and that the results are interpreted in a way that feeds back into the
management of disease. The validation file should include information on the situations that would trigger use of the test and the
appropriate clinical interpretation of the results in relation to identification of the pathogen. Details of appropriate reporting comments in relation to the results in particular scenarios should be
provided. High and low positives in various samples and in different clinical contexts may have different implications. Thorough
clinical validation should provide insight into the relevance of the
test results.
8.17 Shelf Life

of Materials
It is important to know how long the reagents used in diagnostic

assays remain active when stored under specified conditions. All
commercially purchase reagents have use by dates, which have
been determined though shelf-life studies. It is not common for
shelf life to be determined for in-house assays, but the same principles apply and it is best practice to do so.
98
The signal to noise ratio of the assay may decline gradually, and
this may be difficult to detect without rigorous application of
multi-rule run QC (i.e., Westgard [6]) since positive controls may
give acceptable results while the assay is performing suboptimally.
The principle of shelf-life studies is straightforward. Batches of
vials of the reagent are stored at the required temperature and samples are tested at different times using a known QC sample. The
European Standard Stability testing of in vitro diagnostic reagents
BS EN 13640 [11] recommends that shelf-life testing is performed
on samples from three batches.
While shelf-life studies determine the stability of the reagents
under specified conditions, reagents may be treated differently during their life. It is best practice to consider conditions that the
reagents might be subjected to and recreate them in the laboratory
to determine whether their performance is affected. For example, if
the reagents might be freeze-thawed several times during their life
aliquots should be subjected to freeze-thaw cycles and retested.
Samples may be tested after each cycle or collected and tested in a
single run. Where reagents are to be transferred between laboratories, they may, during transit, be stored overnight in a warm warehouse. It is recommended that easily envisaged scenarios such as this
are simulated in the laboratory to test the effect on the assay. It is
acceptable to perform stress studies on only one batch of a reagent.
If stress studies reveal that reagents are not stable under defined
conditions, then instructions for use must clearly state this. For
example, if reagents are found to be impaired following several
freeze-thaw cycles, the SOP should require that freeze-thawing is
limited to a number of cycles at which the level of impairment is
acceptable, e.g., instructions for reagents that need to be stored
frozen may need to dictate that the vial is discarded after first use.
Risk Assessment
To minimize the hazards to both users of the assay and to test subjects, a risk assessment should be performed prior to using any
reagent in a diagnostic test [12]. The risk assessment should consider the infection risk of test materials that contain biological substances and take into account all combinations for use, for example,
different platforms or ancillary reagents. The risks of an incorrect
diagnosis, either false positive or negative, should also be assessed.
Depending on what risks are identified, further action may be
required to ensure that appropriate control measures are implemented. These might include treatments to inactivate infectious
agents, a review of the scope of stress studies, a review of the
reagent storage conditions, the provision of additional information
in the instructions for use or revision of the guidance, or the interpretation of results or limitations of the assay.
10
99
Data Analysis and Composition of the Technical Report

The validation work should be completed in accordance with the
study design. The technical report and validation file should summarize assay validation, results, and recommendations. The recommendations should include the multi-rule run QC criteria
established using positive control results. For in-house assays, the
validation should be supported by the work carried out during
assay development. Workbook records can be cross-referenced in
the validation report if appropriate.
To avoid bias, validation results should be analyzed as defined
in the study design and then compared with expected values to
determine whether or not the kit or reagent is suitable for use. The
comparison of sensitivity and specificity may be with results
obtained using alternative reagents or commercial kits.
11
Review of Technical Report and Sign-Off

Although validation should be completed in a timely manner, the
need to meet deadlines must not compromise thoroughness. A report
on the validation data should be presented to the reviewers who
make the decision on whether the assay is fit for purpose guided by
the assay definition. The panels conclusion should be documented
and include, as appropriate, a formal declaration, signed by the
project leader and the project manager, that the assay is suitable for
diagnostic or reference work. Any use prior to completion of the
validation and sign-off must be reported as research use only.
12
Instructions for Use and Labeling

Assays should be supplied with clear instructions for use. These
may be in the form of an SOP or as a product information sheet
(PIS). The IVDD [13] may be a good guide to the details of what
should be included in the PIS, although some of the requirements
are less relevant for in-house reagents. A minimum requirement
for labels is that the reagent name, batch number, and expiry date
are clearly identifiable.
13
Monitoring the Performance of Assays and Maintenance of the Validation File

It is good practice to retain batch records for reagents used in
assays for an extended period of time. The international standard
ISO 13485 [14], written specifically for medical devices but equally
applicable for veterinary reagents, states that batch records must be
retained for the lifetime of the reagent and not less than 2 years
100
from the date of batch release. In practice, most laboratories retain

records for considerably longer than this.
Batch records include details of the purchase and manufacture
of every reagent, including reagent lot numbers, details of what
equipment was used, how the reagent was made, and all treatment
undertaken. All reagents must be manufactured, stored, and used
under the control of the laboratorys quality system and sufficient
records taken to allow a full audit trail to be undertaken.
Once satisfactory validation has been completed using a
defined SOP, it is essential that the assay is performed according to
the SOP. Minor changes to the method that are immaterial to the
performance specification of the assay should, as far as possible, be
accommodated within the SOP, provided evidence is available. For
example, it may be better to specify the use of distilled, deionized,
or molecular grade water rather than a particular brand of molecular grade water. Similarly, it may be reasonable to avoid specifying
the particular model of PCR instrument to be used.
When changes to the protocol that fall outside of the SOP
must be made, revalidation is required. Revalidation will vary from
a single run showing that Cq values are unchanged for a range of
reference samples (e.g., as might be appropriate for a change to a
buffer) to full revalidation (e.g., for use of an alternative sample
preparation method or primer change).
Assays that are currently in use with validation records that do
not comply with the recommendations of this guidance should be
retrospectively provided with a compliant validation file wherever
practical. It may be necessary to implement appropriate data collection from continuing use to provide supportive information.
Historical records should be reviewed and summarized to provide
evidence that the assay is fit for purpose and a validation checklist
should be used to cross-reference these documents. A conclusion
based on the information obtained from the historical data should
be documented including a formal declaration that the assay is
suitable for use.
Documents relating to assay development and performance
monitoring should be filed in a retrievable and auditable manner.
All pages of documents should be numbered. The header or footer
should show the document version number and a reference date.
14
Production of Reagents
Staff involved in the preparation of reagents must be suitably
trained and have documented evidence of competency.
Following the development of a satisfactory assay, it is essential that the procedures for production of reagents for routine use
are clearly defined to ensure that the assay continues to be fit for
purpose when further batches are made. SOPs that describe the
101
production process in detail, including specific information about

the reagents, equipment, and conditions of storage and use, are
required. Where appropriate, worksheets should be used to record
manufacturing information. A complete reconstruction of the
manufacturing process for every batch should be possible. SOPs
should include details of how any interim and final products are
quality controlled, including batch release criteria, prior to batch
release. A worksheet should be prepared to allow recording of
quality control results and should include a final batch release
sign-off by a responsible person.
15
Rollout of Assays
The collection of diagnostic validation data will necessarily involve
limited technical rollout within the developing laboratory. Full
adoption of the new assay into clinical use will include consideration of the reagent supply chain and arrangements for quality
assessment, including participation in external quality assessment
(EQA) schemes wherever appropriate. If the test is required to
meet the needs of a range of end users, rollout should be considered. A rollout plan should include the timeline, equipment, personnel, and risk management proposals.
Following rollout, an assay verification study and continuing
quality assessment should be performed. This is usually best organized by the developing laboratory. Verification should involve the
testing of validation panels or be limited in scope to a few wellcharacterized samples and standards. In some circumstances, it
may be desirable that validation materials are sourced from laboratories other than that of the developer. Round-robins may be useful in ensuring continuing attention to quality.
16
Post-Deployment Surveillance and Verification

Post-deployment is the equivalent of post-marketing, which is
the term used in the IVDD and other regulatory literature to refer
to the time following rollout. Once the assay has been validated
and put into use, information on its performance should continue
to be gathered. However, through a validation it is not possible to
include all sample types and less common problems may not be
identified. Details of any problems, e.g., poor performance and
false positives or negatives, should be documented. All problems
should be investigated and appropriate corrective action implemented. Timely communication with users of the assay or similar
assays is very important, both to make them aware of any problems
and as part of the root cause corrective action. If necessary, the
risk assessment should be reviewed in light of the new information.
102
It is possible that the assay may need to be modified to prevent the

problem recurring. All information must be included in the project
dossier with the assay development and validation documentation.
The full project dossier should be available to all laboratories performing the test.
The assay should be reviewed periodically to highlight performance compared to alternative assays, whether commercial or inhouse, and thus ensure continued improvement. Reviews should
include the relevant scientific literature which may highlight alternative assay technologies or the emergence of novel strains.
An assay validation process checklist is presented in Table 4.
Table 4
Assay validation checklist
Name of assay
Specific targets (pathogens and genes) of the assay
Project manager
Project leader
Staff performing the hands-on development work
Section: planning and inception
Subsection
Contributor
Deadline
Completion
Contributor
Deadline
Completion
Setting purpose and objective for new assay

Setting up a project risk register
Health and safety issues
Business analysis
Commercial analysis
Regulatory compliance
Human resources aspects
Project planning and initiation
Section: assay validation
Subsection
Design of validation study
Setting benchmarks and performance measures
Identification of gold standards
Identification of reference material and reagents
Preparation of specific SOPs (MIQE compliant)
Assessment of analytical performance
(continued)
103
Table 4
(continued)
Choice of study population
Choice of sample type
Sample size calculation
Performance of clinical validation
Data analysis and interpretation
Assessment of usability
Reagent stability studies
Further optimization if required
Production of documentation
Sign-off process
Section: rollout and verification
Subsection
Contributor
Deadline
Completion
Contributor
Deadline
Completion
Review of needs and users

Planning of rollout
Field verification studies
Provision of validation panels
Interlaboratory comparison
Section: implementation
Subsection
Implementation in laboratory work flows
Implementation in diagnostic pathways
Implementation in clinical pathways
Post-marketing assessment
Long-term data collection
Periodic QC/QA
Periodic proficiency testing
Production aspects of implementation
Periodic reassessment of fitness for purpose
17
Conclusions
With the advent of molecular biology, opportunities for development of new diagnostic assays have increased significantly.
Molecular assays are faster, more sensitive, and more specific than
104
we could have dreamed of even a decade ago. This has encouraged

laboratory scientists to develop new molecular assays, either to
replace existing non-molecular ones or to identify new markers.
We expect commercial assays to have been rigorously developed
and validated extensively to ensure that they meet their specification and are fit for purpose when we use them in the laboratory.
We have a responsibility for ensuring that assays developed inhouse provide the same level of assurance as commercial assays. It
is salutary to remember that if an in-house assay is not fit for purpose or there is insufficient evidence that it is, it is the laboratory
which must take legal responsibility if a diagnostic result leads to an
adverse event.
Once developed, it is equally important that rollout and routine use of newly developed assays are carefully managed. An assay
which works perfectly in the expert hands of an individual scientist
who has carefully developed it must work just as well in routine
use. Therefore, good quality assurance must be embedded at all
stages of the process, i.e., during assay development, validation,
and rollout and finally in routine use.
If the guidance provided within this chapter is followed, the
developer will gain an excellent understanding of the performance
of the new assay and should have every confidence that it is fit for
purpose.
Glossary of Terms
Fitness for purpose Fit for purpose means that the kit has to be
validated to such a level to show that the kits results can be interpreted
to have a defined meaning in terms of diagnosis or another biological property being examined (see www.oie.int/our-scientific-expertise/
certification-of-diagnostic-tests/the-register-of-diagnostic-tests).
In-house Any assay developed within the laboratory or commercial
assay which is modified or used off label, i.e., used in a different way,
for a different purpose or using a different sample type from that recommended by the manufacturer.
Validation Confirmation, through the provision of objective evidence,
that the requirements for a specific intended use or application have
been fulfilled [ISO 9000:2000]. Validation is normally performed by
the manufacturer (whether commercial or in-house).
Verification Confirmation, through the provision of objective evidence, that specified requirements have been fulfilled [ISO 9000:2000].
Verification is normally performed by the user prior to introduction of
a validated assay to determine if the assay achieves the required specification in their hands.
105
References
1. OIE (2013) Register of diagnostic kits certified
by the OIE as validated as fit for purpose.
http://www.oie.int/our-scientific-expertise/
certification-of-diagnostic-tests/the-registerof-diagnostic-tests. Accessed 30 December
2013
2. Working Party on Control of Medicines and
Inspections (2001) Annex 15 to the EU guide
to good manufacturing practice. http://ec.
europa.eu/health/files/eudralex/vol-4/pdfsen/v4an15_en.pdf. Accessed 30 December
2013
3. General requirements for the competence of
testing and calibration laboratories (BS EN
ISO/IEC 17025:2005)
4. Freeman KP, Gruenwaldt J (1999) Quality
control validation in veterinary laboratories.
Vet Clin Pathol 28:150155
5. Farr AJ, Freeman KP (2008) Quality control
validation, application of Sigma metrics, and
performance comparison between two biochemistry analyzers in a commercial veterinary
laboratory. J Vet Diagn Invest 20:536544
6. Westgard JO, Barry PL, Hunt MR, Groth T
(1981) A multi-rule Shewhart chart for quality
control in clinical chemistry. Clin Chem
27:493501
7. http://www.westgard.com/westgard-rules
8. Bossuyt PM, Reitsma JB, Bruns DE et al
(2003) Standards for Reporting of Diagnostic
Accuracy. Toward complete and accurate
reporting of studies of diagnostic accuracy: the
STARD initiative. Clin Chem 49:16
9. Bustin SA, Benes V, Garson JA et al (2009)
The MIQE guidelines: minimum information
for publication of quantitative real-time PCR
experiments. Clin Chem 55:611622
10. Burd EM (2010) Validation of laboratorydeveloped molecular assays for infectious diseases. Clin Microbiol Rev 23:550576
11. Stability testing of in vitro diagnostic reagents
(BS EN 13640. 2002)
12. Medical devices. Application of risk management to medical devices (BS EN ISO 14971.
2009)
13. Directive 98/79/EC of the European
Parliament and of the Council of 27 October
1998 on in vitro diagnostic medical devices
(1998-12-07 OJ No L 331/1). In vitro diagnostic medical devices. European Standards
1998
14. Medical devices. Quality management systems.
Requirements for regulatory purposes (BS EN
ISO 13485:2012)
Part II
Molecular Detection and Identification of Animal Pathogens
in Laboratorial Settings
Chapter 7
Molecular Approaches to Recognize Relevant
and Emerging Infectious Diseases in Animals
Fredrik Granberg, Oskar E. Karlsson, Mikael Leijon, Lihong Liu,
and Sndor Belk
Abstract
Since the introduction of the first molecular tests, there has been a continuous effort to develop new and
improved assays for rapid and efficient detection of infectious agents. This has been motivated by a need
for improved sensitivity as well as results that can be easily communicated. The experiences and knowledge
gained at the World Organisation for Animal Health (OIE) Collaborating Centre for Biotechnology-based
Diagnosis of Infectious Diseases in Veterinary Medicine, Uppsala, Sweden, will here be used to provide an
overview of the different molecular approaches that can be used to diagnose and identify relevant and
emerging infectious diseases in animals.
Key words Infectious diseases, Pathogen detection, Molecular diagnosis, Transboundary animal
diseases, Endemic diseases, Zoonoses, PCR, Isothermal amplification, Hybridization, Proximity
ligation assay (PLA), Microarrays, Nanotechnology
Introduction
The increased occurrence and emergence of devastating infectious diseases, in both domestic and wildlife animal populations,
are causing very serious socioeconomic losses at both global and
regional levels. This increase has been attributed to several contributing factors, the most prominent being the accelerated
movements of humans and animals due to increased globalization and international trade, the climatic changes, and the larger
and larger populations kept together in animal husbandry and
breeding. Some of these diseases, termed transboundary animal
diseases (TADs), such as foot-and-mouth disease and classical
swine fever, have a high capacity to spread very rapidly over countries and borders, having a devastating impact on animal productivity and trade, as well as causing other losses in the animal
husbandries and in wildlife. Other diseases, such as anthrax,
bovine tuberculosis, and rabies, have more endemic character,
109
110
Fredrik Granberg et al.
establishing themselves in limited areas and showing slower

tendency of spread. Considering their importance, many of these
infectious diseases are listed by the World Organisation for Animal
Health (OIE) as notifiable animal diseases, collectively referred
to as OIE-listed diseases. The OIE is also determining and updating the international animal disease status on a regular basis. The
current OIE-listed diseases and the latest disease status reports
are available at the OIE website (www.oie.int).
Zoonoses, veterinary, and human public health. Of special importance among the animal infectious diseases are the ones that have
the capacity to cross the species barriers and establish infections in
a wider range of hosts including humans, causing zoonotic infections. It has been estimated that approximately 75 % of the new and
emerging human infectious diseases over the past 1020 years have
been caused by pathogens originating from animals or from products of animal origin [1, 2]. Many of these diseases have the potential to spread through various means, over long distances, and to
become global problems.
Accurate and rapid diagnosis. Considering the extremely high
direct and indirect losses and other consequences caused by the
TADs and the other infectious diseases, it is very important to
develop and apply a wide range of diagnostic methods. These
should preferably allow rapid detection and identification of the
infectious agent(s), with high specificity and sensitivity, while still
being affordable and readily available. When outbreaks do occur,
rapid and accurate diagnosis is needed to screen susceptible populations and monitor the spread of the infectious pathogens, therefore helping with epidemiological investigation and implementation
of necessary control measures, such as vaccination, stamping out,
and quarantine restrictions, in order to prevent further spread.
Collection of clinical samples and sample preparation. Identification
of the relevant groups of animals, showing clinical signs or at stages
of infection when the presence of infectious agents is likely to be
sufficiently high, and correct sampling are the first two crucial steps
in the diagnostic process. The next steps of great importance are the
sample preparation procedures, such as cleanup and target enrichment, which are performed in order to reduce possible contaminants and retain concentrated materials from the target agents,
most commonly nucleic acid and/or proteins, for further analysis.
If any of these steps are not properly considered and carried out, all
diagnostic methods, even the most powerful and sensitive, will be
unable to detect and identify the infectious agents, and this is leading to false diagnosis, which could have very serious consequences.
The OIE Collaborating Centre (OIE CC) for Biotechnology-Based
Diagnosis of Infectious Diseases in Veterinary Medicine. Since the
authors institutes in Uppsala, Sweden, are well-recognized centers
Molecular Diagnostics of Infectious Diseases in Animals
111
of excellence in molecular diagnostics, the OIE has granted them

the mandate to work together as its only collaborating center
focused on biotechnology-based diagnostics (www.sva.se/en/
About-SVA/OIE-Collaborating-Centre). In this chapter, the
experiences and knowledge gained at the OIE CC will be used to
provide an overview of the molecular approaches capable of recognizing relevant and emerging infectious diseases in animals.
Detection and identification of the infectious agents. The diagnostic
laboratories can apply two basic ways for a proper diagnosis: (a)
direct detection and identification and (b) indirect detection and
identification methods. Direct detection and identification means
that the infectious agents and/or their components, such as nucleic
acids or proteins, are detected in the collected samples. Commonly
used classical diagnostic methods for direct detection include identification of microorganisms by culture techniques and immunofluorescence, and the most widely applied molecular diagnostic
methods are the various assays of nucleic acid hybridization, e.g.,
polymerase chain reaction (PCR) and isothermal amplification
methods, such as the loop-mediated isothermal amplification
(LAMP), among others. When running indirect diagnosis and
identification, the immune responses of the host are investigated,
looking for antibodies against various infectious agents, which
indicate the occurrence of the infections in the hosts. In this chapter we focus on direct diagnosis, with special regard to molecular
diagnostic methods, as well as some considerations regarding the
interpretation, understanding, and communication of the diagnostic results.
PCR-Based Approaches
Molecular approaches become increasingly important in infectious
disease diagnostics and, with the exception of isolation by culturing, may supersede all other direct detection methods. The main
reasons are that a unique signature of every microorganism is
encoded in its genome, which in principle enables perfect specificity, and that various enzymatic mechanisms can be utilized to
manipulate and amplify the genetic material, yielding an exquisite
sensitivity of the molecular DNA-based assays. While bacteria have
their genome encoded in the form of DNA, some viral genomes
are composed of RNA, and an initial reverse transcription step is
therefore required before further manipulations and amplification
can be carried out. Enzymes typically utilized are polymerases,
reverse transcriptases, ligases, glycosylases, and nucleases. Of these,
the polymerases require a pair of sequence-specific primers, which
enables selective target amplification.
112
2.1
PCR Assays
2.2 Real-Time
PCR Assays
PCR employs thermostable polymerases to enable amplification by

continuous thermocycling and is currently the most commonly
used method for amplification of genetic material [3]. The highly
charged phosphodiester backbone of DNA makes the PCR product amenable to high-resolution visualization on agarose gel electrophoresis utilizing DNA-binding fluorescent dyes such as
ethidium bromide. Electrophoresis both provides a means for
detection by band visualization and enables at least a tentative verification of specificity by estimation of the amplicon length.
Shortly after the introduction of PCR, attempts were made to
enhance sensitivity of detection of target nucleic acid sequences by
running a second PCR assay targeting the internal region of the
amplicon resulting from the first reaction, so-called nested PCR
[4, 5]. The greater sensitivity has been attributed to both a dilution
effect of any inhibitory compounds present in the sample, since
only a minor fraction of the first reaction volume is used in the
second reaction, and the fact that the primer-driven reaction is run
twice, using four specific primers, rather than two. An intermediate
situation is obtained if one of the primers from the first reaction is
retained in the second, which yields a semi-nested PCR format.
The drawback of using PCR, and in particular the nested PCR
formats, is that conserved regions must exist on the genome, and
this might be a serious problem for highly variable RNA viruses.
Although more recently the convenient and less laborious realtime PCR methods have been developed (see below) and are mostly
used today in clinical practice, nested PCR assays are still used due
to their high sensitivity and robustness.
Gel-based PCR is a heterogeneous, relatively laborious, detection
method. Furthermore, it only reflects the end point of the PCR
and, for this reason, doesnt allow the determination of the initial
quantity of the detected material, e.g., determination of the viral
load. Since it lacks specific markers for the targeted amplicon,
unspecific amplification yielding similar product sizes may lead to
false positive detection. Nested PCR has the further disadvantage
of being prone to cross-contaminations since reaction tubes with
potentially very high quantities of target DNA are opened between
the two reactions. Many of these drawbacks were solved by the
advent of real-time PCR [6]. With this technique, the PCR product is monitored in the course of the reaction using DNA-binding
moieties that alter their fluorescence upon binding to the amplified
DNA. This allows a closed tube, homogeneous assay format, which
reduces the risk for cross-contamination and also removes the
laborious gel electrophoresis step. In addition, the cycle number
where the fluorescence reaches a defined threshold level will
depend on the initial quantity of target DNA or RNA (before
reverse transcription).
113
Three main approaches have been taken to monitor fluorescence

alteration in real time due to the buildup of the PCR product,
which can be ordered according to the level of specificity the methods
provide. The simplest method is to add a fluorescent dye to the
PCR mixture with the property that the fluorescence intensity
changes upon DNA binding. Typical dyes are asymmetric cyanine
dyes, such as SYBR green or tiazole orange, that exhibit a fluorescence increase when bound to DNA [7, 8]. These types of realtime PCR have no better specificity than gel-based PCR, rather the
opposite, since no information is provided about the product
length. New possibilities are given by tethering the dye to one of
the PCR primers that are constructed so that incorporation of the
primer into the amplicon leads to an alteration of dye fluorescence.
Several chemistries have been devised to this end, for example,
scorpion primers [9], LUX primers [10], and Plexor primers [11].
Although in principle not providing a better specificity in regard to
spurious amplification than the pure dye approach, fluorescent
primers enable multiplexing by co-adding several primer pairs,
each with a distinct fluorophore. The third approach includes addition of a third fluorescently labeled oligonucleotide, located
between the primers, called a probe. The probe can also be labeled
with a quencher (dual-labeled probe) but not always, e.g., not for
the LightUp probes [7] or in the PriProET approach [12, 13].
Prominent examples of methods based on dual-labeled probes
include TaqMan [14] and molecular beacons [15].
The signal that can be obtained from a probe-based real-time
PCR experiment is often limited by the competing reannealing of
the double-stranded PCR amplicon. Asymmetric PCR can be used
to overcome this problem since it allows preferential amplification
of one strand in a double-stranded DNA template. This is achieved
by manipulating primer properties, most critically concentration,
as well as other factors influencing primer melting temperature,
such as length and nucleotide sequence. In the LATE-PCR method
[16], asymmetric PCR has been combined with molecular beacons
for readout to achieve a detection format that allows quantification
from the end-point fluorescence. This format is suitable for simpler
portable PCR instruments designed for detection in the field and
has recently been commercialized by various companies.
The application of real-time PCR techniques and other methods in molecular diagnostics in veterinary medicine have recently
been extensively reviewed [17, 18] and will be further discussed
later in this section. To conclude this subsection, it is suitable to
mention a recently developed method for the rapid molecular
pathotyping of avian influenza [19] and Newcastle disease [20]
viruses that combines several of the themes discussed here. This
technique employs a three level semi-nested PCR format that utilize
Plexor [11] fluorogenic primers as a detection mechanism.
Furthermore, the assay format allows a highly multiplex interrogation
114
of the sample by using primers in two vastly different concentration

regimes. Instead of, as hitherto has been the case, requiring nucleotide sequencing over the hemagglutinin and fusion protein genes
of avian influenza and Newcastle disease viruses, a much faster
diagnosis can be obtained by a simple PCR-based method. This
method could even be implemented on field PCR instruments for
rapid on-site diagnosis and thereby providing means for faster containment of disease outbreaks.
Isothermal Amplification
Isothermal amplification of nucleic acids is an alternative method to
PCR. The reaction is performed at a constant temperature in simple
devices, such as water baths or heating blocks, which eliminates the
need for high-end equipment and system maintenance. It can be
used to test for infections in regions where resources are limited and
logistic chains are impossible, but a rapid answer is needed.
Isothermal amplification normally takes about an hour or less to
complete, providing a fast specimen-to-result diagnosis at the point
of care (POC). To make the best use of isothermal amplification, a
system should ideally integrate the upstream sample preparation
and the downstream detection steps and be operated by personnel
without extensive training. Several platforms utilizing isothermal
technology are commercially available or close to market [21].
Recently, the field of isothermal amplification technologies has
advanced dramatically, resulting in several different amplification
systems. These have been summarized by Niemz et al. [21] and
include transcription-mediated amplification (TMA) [22], helicasedependent amplification system [23], loop-mediated isothermal
amplification (LAMP) [24], and rolling-circle amplification [25].
Of those methods, LAMP has gained the greatest interest because
of its high specificity, efficiency, and rapidity. By addition of a
reverse transcriptase in the reaction, RNA targets can also be amplified and detected by LAMP, which is referred to as RT-LAMP. The
LAMP utilizes four primers that bind to six distinct regions of the
target DNA to specifically amplify a short region and is catalyzed
by Bst DNA polymerase with strand-displacement activity [24].
Addition of loop primers may accelerate the reaction [26]. As of 8
February 2014, PubMed listed 990 publications with the search
term loop-mediated isothermal amplification. LAMP technology has been applied for the detection of viral pathogens such as
classical swine fever virus [27] and foot-and-mouth disease virus
(FMDV) [28], bacteria such as Clostridium difficile [29], and parasites such as malaria [30]. Commercial developments have progressed: a total of eight LAMP kits are approved in Japan for the
detection of SARS coronavirus, Mycobacterium tuberculosis (TB),
Mycoplasma pneumoniae, Legionella species, influenza A virus, H1
115
pdm 2009 influenza virus, H5 influenza virus, and human

papilloma virus, as reviewed by Mori et al. [31]. Future development would need to consider simplification of sample preparations,
reaction mix in a dried down formation and integration of all three
steps in a compact, disposable, and inexpensive system.
Detection by Hybridization-Based Approaches

Identification and classification of bacteria and viruses using DNA
hybridization-based approaches rely on the use of oligonucleotide
probes that selectively bind to target sequences based on the degree
of complementarity. This was early utilized in fluorescence in situ
hybridization (FISH), which became a valuable tool for localization of infectious agents in clinical samples without cultivation
[32]. However, to overcome limitations in multiplex capacity, sensitivity, and signal intensity, there has been an ongoing development of the initial approach. This has resulted in high-throughput
methods such as DNA arrays but also interesting new hybridization-based methodologies combined with signal amplification,
such as padlock probe (PLP) [33] and proximity ligation assay
(PLA) [34]. PLP belongs to the methodologies of genomic partitioning where one specific region of the genome is massively replicated, and thereby detectable, even though it normally is masked
by the presence of other genomes or in too low amount to be
detected. PLA relies on the primary detection of antigens followed
by oligonucleotide amplification and subsequent detection by fluorescent probes or by RT-PCR.
4.1 DNA Array

Technologies
With the development of DNA macro- and microarray technologies, it became possible to detect and characterize a wide variety
of bacteria and viruses through simultaneous hybridization against
large numbers of DNA probes immobilized on a solid support
[35, 36].
The probes represent known sequences that may serve as
markers for identification and/or genotyping of bacterial strains,
resistance genes, viruses, etc. These are commonly arranged in an
ordered array of spots (or features), and hybridization with a
labeled target, i.e., the sample to be investigated, will therefore
result in a hybridization profile in which individual probe results
also can be assessed. As the names imply, the main difference
between macro- and microarrays is the number and size of spots
on the support. Macroarrays typically have larger and fewer spots
and have proven particularly effective for detecting smaller subsets
of genes, such as genes involved in antibiotic resistance [37].
Microarrays can contain thousands, and even up to many hundred
thousands, of spots with different oligonucleotide probes and have
116
successfully been used for detection and genotyping of bacterial

and viral pathogens [38, 39]. The main advantages of microarray
technology are high throughput, parallelism, miniaturization, and
speed. However, microarrays are still considered to be an expensive
technology and usually require large amounts of nucleic acid targets. Furthermore, unless it has been completely automated, the
data analysis procedure might be time-consuming, and the results
can be difficult to translate into information that is clearly communicable and decision supportive.
4.2 Genomic
Partitioning
Genomic partitioning refers to the methodologies used for capture

and enrichment of target regions. Within these methodologies,
PLP has been used repeatedly for genotyping, localization, and
array-based diagnostics. The earliest version of PLP consisted of
two oligonucleotide probes of 20 nt connected by a linker region
of 40 nt [33]. As the probes hybridize towards the target, the
construct is ligated into a circular detector that can be replicated
isothermally by Phi29 polymerase [40]. The detection can then be
performed through incorporation of fluorophore tagged nucleotides. The PLP concept was further expanded with the introduction of the molecular inversion probe (MIP) technology. Where
PLP leaves no gap after hybridization to the target region, MIP
aims at leaving a single nucleotide gap. This gap is then filled in by
addition of a single type of nucleotide into the assay. This approach
enables substitutions on nucleotide level to be detected using just
four reactions easily set up in a normal lab environment. It also
provides a possibility of highly multiplexed designs of assays
[41, 42]. Building on the same principle as PLP and MIP, the connector inversion probe (CIPer) technology extends the gap up to
a few hundred nucleotides. Using DNA polymerase to fill the gap
generates a product that can be sequenced, revealing the content
of the target region [43]. Applications of PLP methodology and its
derivatives for infectious diseases in animals include detection of all
hemagglutinin and neuraminidase subtypes of AIV [44], as well
as multiplex detection of FMDV, swine vesicular disease virus
(SVDV), and vesicular stomatitis virus (VSV) [45]. In addition, by
designing different probes for the genomic and replicative form of
the virus, it is possible to not only detect a virus but also localize it
in relation to the host cells and perform semiquantitative analysis
of the amount of replicative viruses, as demonstrated with porcine
circovirus type 2 [46].
4.3 Proximity
Ligation Assay
Although PLA is designed for detection of protein interactions and

localization using antibodies for target recognition, hybridization
events are required to generate a detectable signal [34]. Two sets
of antibodies are designed: one targets the protein/s of interest
and the other target the first set. The antibodies in the second set
carry short oligonucleotide strands that can hybridize with special
117
connector oligonucleotides and thereby enable the formation of

circular DNA constructs. These are amplified and detected by PCR
and fluorescent probes. The methodology combines dual antibody
specificity with the signal amplification power of DNA amplification to produce a versatile and sensitive method for detection of
very low amounts of targets. It also enables in situ localization
studies of protein targets within cells [47]. Furthermore, PLA
requires little to no sample preparation, making it ideally suitable
for screening of massive amounts of samples, and can be used with
a solid support to capture antigens for detection, similar to ELISA.
The use of a solid support may also facilitate the removal of contaminants from the sample, thereby enabling PCR-based detection
without the problem of inhibition. By combining the solid-support approach with RT-PCR detection, great sensitivity was demonstrated in a study of avian influenza virus [48]. Other applications
of PLA technology include detection of several viruses, among
them FMDV, with detection levels close to those of RT-PCR and
100-fold more sensitive than ELISA [49], as well as localization of
influenza virus proteins within cells [50].
Further Trends, New Tools in Molecular Diagnostics

In the development of new molecular diagnostic methods, there has
been a continuous effort to enable efficient and rapid detection of
infectious agents from ever-smaller volumes of complex fluids without the need for a skilled operator. As a result, microfluidic analysis
systems and nanotechnology-based detection devices have gained
increased popularity, as previously reviewed [51, 52]. These systems
and devices have been employed to construct a wide range of
integrated tools, capable of semiautomated complex diagnostic
procedures, which also allow rapid, portable field-based testing [53].
5.1 Microfluidic
Analysis Systems
Several sequential laboratory procedures are usually required to

detect infectious agents in clinical samples, such as concentration,
lysis, extraction, purification, amplification, and product detection.
Recent progress in microfluidic technology has allowed multiple
procedures to be incorporated in sequence for one-step sensing or
in parallel for high-throughput screening [54, 55]. These integrated systems with use in molecular diagnostics are more commonly known as biochip or lab-on-a-chip (LOC) devices. Since
they usually consist of fluid channels and sensing chambers with
dimensions of a few to hundreds of microns, very small amounts of
sample can be analyzed, requiring only low consumption of
reagents. The use of materials that can be easily functionalized,
such as glass and plastic, allows the inner surfaces to be coated with
different capture and sensing agents, e.g., antibodies and nucleic
acids. Although this makes microfluidic analysis systems versatile
118
tools for pathogen detection, the main application involves systems

based on the recognition of target nucleic acids.
As discussed above, the detection of target nucleic acid from a
pathogenic microorganism or virus can be achieved either by direct
probing or by first introducing an amplification step. Amplificationbased detection usually gives higher sensitivity and has successfully
been implemented on microfluidic chips using both PCR and
alternative amplification methods, such as nucleic acid sequencebased amplification (NASBA) [56]. However, regardless of amplification method, it is first necessary to concentrate and lyse the
sample material to extract and purify the nucleic acid. As described
in the review by Heo et al. [57], a variety of alternative solutions
have been developed to perform these sequential steps on a microfluidic chip. Popular strategies for sample concentration include
magnetic beads [58] and dielectrophoresis [59]. The lysis of
enriched samples can then be achieved by various methods, such as
thermal energy, optothermal energy, mechanical force, and chemicals [60]. For the purification of extracted nucleic acid, packed
silica beads, microfabricated structures, and magnetic beads have
all proved to be useful solutions [61]. After amplification, the
detection of products is most commonly performed with fluorescence or electrochemical methods, which easily can be miniaturized. A classification into three categories was suggested for
microfluidic chips that use amplification-based detection by
Mairhofer et al. [52]. These categories included microfluidic chips
with (1) a stationary chamber as nano-/picoliter reservoir for conventional thermocycling, (2) a continuous flow where the sample
is moved between individual temperature zones at different locations for cycling, and (3) a droplet-based system where each amplicon is individually amplified within a water-in-oil droplet. Examples
of fully implemented amplification-based systems include devices
for detection of different viruses, such as dengue virus and enteroviruses [62], as well as various bacteria, most notably Bacillus
anthracis [63, 64].
5.2 NanotechnologyBased Detection
Nanotechnology has extended the limits of molecular diagnostics

to the nanoscale (one-billionth of a meter), allowing diagnostic
assays to take advantage of the unique electrical, magnetic, luminescent, and catalytic properties of nanomaterials. This has contributed to the development of innovative assays that provide
rapid detection of infectious agents with improved sensitivity and
limit of detection (LOD) [65]. Because of the small scale, nanotechnology can also be used to create high-density arrays of sensors for high-throughput detection without increased sample
requirements. Moreover, the use of sensitive nanoscale sensors
has the potential to eliminate the need for sample preparation
and target amplification, making it possible to construct assays
for direct detection in opaque media, like blood and milk [51].
119
There has also been a special focus to develop affordable

nanotechnology-based devices that provide fast and reliable
results in simple and user-friendly formats for use even in rural
areas of developing nations [66].
Most sensor systems for diagnostic use are comprised of two
components, one receptor for target recognition by specific binding and one transducer that convert receptor readings into a signal
that can be measured, such as an electronic or optical signal [67].
Nanoscale sensors are usually comprised of biological recognition
elements coupled to different nanomaterials for signal transduction and detection. These nanomaterials include noble metal
nanoparticles, nanobarcodes, quantum dots, and magnetic
nanoparticles [6871]. Nanowires and nanotubes can also be
coated with biological recognition elements to be used as nanosensors, and binding events are measured as a change in their electrical
conductance [72]. Another example is silicon-based cantilever sensors functionalized with biomolecules such as DNA for target recognition. These sensors are often combined into high-density
arrays for high-throughput screening [73]. Applications of
nanoscale sensors for detection of infectious agents include multiplex detection of both viruses and bacteria [74, 75].
Summary and Final Remarks

As detailed above, numerous molecular methods have been developed for the detection and characterization of infectious agents in
the field of veterinary and human medicine. Among them, PCR
has been the most commonly used technology. When considering
the development of new technologies, a general trend can be
observed towards robust and affordable automatic systems that
also integrate sample preparation steps for rapid and highly sensitive multiplex detection of an easily enlarged panel of pathogens,
both bacterial and viral. Although few, if any, of the novel systems
have successfully incorporated all of these properties, they still represent important technological advancements towards more sensitive and efficient detection. Even so, only a limited number have so
far been developed into commercial diagnostic kits, and only a few
molecular tests are offered by veterinary diagnostic laboratories.
The full potential and impact of molecular diagnosis is therefore
yet to be realized. A possible explanation may be that most new
published assays are only analytical validated and not properly evaluated in accordance with the appropriate criteria for field validation. New molecular tests might also not comply with current
accreditation standards.
For the interpretation and understanding of the diagnostic
results, it is very important to put the molecular diagnostic methods in the context of the complex scenario of infectious diseases,
i.e., to follow not only the technical rules and procedures of the
120
molecular methods but also simultaneously acquire sufficient

medical understanding in order to gain a more complete picture.
A PCR positive result by itself, without analyzing the complex
scenario, can be unreliable, even misleading, and may cause serious
problems for the veterinary and human medical health authorities
during implementation of eradication programs. To avoid such
problems and to provide a reliable diagnosis, it is important to
obtain a complete medical understanding of the disease scenario.
Reliable diagnoses can be reached, of course, even on the basis of
single PCR assays, if they are raising the right questions and the
results are professionally communicated. On the other hand, there
are many cases of infectious diseases where the diagnosis is more
reliable if a range of various methods, both direct and indirect
approaches, are applied simultaneously. It should therefore be
emphasized that in certain cases, the simultaneous application of
novel molecular diagnostic methods and classical approaches, such
as isolation by culturing, is required for a fully reliable diagnosis.
Another important, but often neglected, aspect is the communication of diagnostic results. The successful control and eradication of infectious diseases is strongly accelerated and enhanced if
the diagnostic laboratories are able to communicate the results rapidly and properly towards the practitioners and the health authorities. It is very important to pay sufficient attention even to this
task, because a rapid and clear two-way communication between
the laboratories and the practitioners, as well as the decisionmaking authorities, is essential in order to assure the success of the
control and eradication programs.
The authors institutes that constitute the OIE CC have been
early developers and adopters of new diagnostic technologies and
approaches, from the first PCR-based assays until todays plethora
of various molecular methods, closely following and participating
in the ongoing effort to develop improved tests. More recently,
this has resulted in the adaptation and evaluation of PLP and PLA
for detection of veterinary important pathogens, as well as a new
PCR-based multiplex platform for molecular pathotyping of
viruses, among other contributions. The OIE CC has had an
important role in the development of novel molecular diagnostic
methods, in international standardization and validation, as well as
in international dissemination of results, outreach, and training.
These activities are done with the support of the OIE, our home
institutes SVA and SLU, and in collaboration with large international and national consortia of various EU projects, such as LABON-SITE, ASFRISK, CSFV_goDIVA, AniBioThreat, RAPIDIAFIELD, and Epi-SEQ. National grant agencies are also supporting
this work, such as the Formas BioBridges Strong Research
Environment project No. 2011-1692, which is supporting the
diagnostic developments for the improved diagnosis of a wide
range of poultry pathogens, many of which have zoonotic features,
in the spirit of the One World, One Health concept.
121
Acknowledgments
This work was supported by Epi-SEQ, a research project under
the 2nd joint call for transnational research projects by EMIDA
ERA-NET (FP7 project nr. 219235), the European Union FP7
project RAPIDIA-FIELD (FP7-289364), the Formas Strong
Research Environments BioBridges project (No. 2011-1692),
the Award of Excellence (Excellensbidrag) provided to SB by the
Swedish University of Agricultural Sciences (SLU), and executed
in the framework of the EU-project AniBioThreat (Grant
Agreement: Home/2009/ISEC/AG/191) with the financial
support from the Prevention of and Fight against Crime
Programme of the European Union, European Commission,
Directorate General Home Affairs. This publication reflects the
views only of the authors, and the European Commission cannot
be held responsible for any use, which may be made of the information contained therein. The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
1. Cleaveland S, Laurenson MK, Taylor LH
(2001) Diseases of humans and their domestic
mammals: pathogen characteristics, host range
and the risk of emergence. Philos Trans R Soc
Lond B Biol Sci 356:991999
2. Taylor LH, Latham SM, Woolhouse ME
(2001) Risk factors for human disease emergence. Philos Trans R Soc Lond B Biol Sci 356:
983989
3. Saiki RK, Gelfand DH, Stoffel S et al (1988)
Primer-directed enzymatic amplification of
DNA with a thermostable DNA polymerase.
Science 239:487491
4. Gouvea V, Glass RI, Woods P et al (1990)
Polymerase chain reaction amplification and
typing of rotavirus nucleic acid from stool specimens. J Clin Microbiol 28:276282
5. Kemp DJ, Smith DB, Foote SJ et al (1989)
Colorimetric detection of specific DNA segments amplified by polymerase chain reactions.
6. Higuchi R, Fockler C, Dollinger G, Watson R
(1993) Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Bio/
Technology (N Y) 11:10261030
7. Leijon M, Mousavi-Jazi M, Kubista M (2006)
LightUp probes in clinical diagnostics. Mol
Aspects Med 27:160175
8. Zipper H, Brunner H, Bernhagen J, Vitzthum
F (2004) Investigations on DNA intercalation
9.
10.
11.
12.
13.
14.
and surface binding by SYBR Green I, its

structure determination and methodological
implications. Nucleic Acids Res 32:e103
Whitcombe D, Theaker J, Guy SP, Brown T,
Little S (1999) Detection of PCR products
using self-probing amplicons and fluorescence.
Nat Biotechnol 17:804807
Nazarenko I, Lowe B, Darfler M et al (2002)
Multiplex quantitative PCR using selfquenched primers labeled with a single fluorophore. Nucleic Acids Res 30:e37
Sherrill CB, Marshall DJ, Moser MJ et al
(2004) Nucleic acid analysis using an expanded
genetic alphabet to quench fluorescence. J Am
Chem Soc 126:45504556
McMenamy MJ, McKillen J, Hjertner B et al
(2011) Development and comparison of a
Primer-Probe Energy Transfer based assay and
a 5 conjugated Minor Groove Binder assay for
sensitive real-time PCR detection of infectious
laryngotracheitis virus. J Virol Methods 175:
149155
Rasmussen TB, Uttenthal A, de Stricker K,
Belk S, Storgaard T (2003) Development of a
novel quantitative real-time RT-PCR assay for
the simultaneous detection of all serotypes of
foot-and-mouth disease virus. Arch Virol 148:
20052021
Holland PM, Abramson RD, Watson R,
Gelfand DH (1991) Detection of specific poly-
122
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.

merase chain reaction product by utilizing the
5'-3' exonuclease activity of Thermus aquaticus
DNA polymerase. Proc Natl Acad Sci U S A
88:72767280
Tyagi S, Kramer FR (1996) Molecular beacons:
probes that fluoresce upon hybridization. Nat
Sanchez JA, Pierce KE, Rice JE, Wangh LJ
(2004) Linear-after-the-exponential (LATE)PCR: an advanced method of asymmetric PCR
and its uses in quantitative real-time analysis.
Belk S, Thorn P, LeBlanc N, Viljoen G
(2009) Advances in viral disease diagnostic and
molecular
epidemiological
technologies.
Hoffmann B, Beer M, Reid SM et al (2009) A
Leijon M, Ullman K, Thyselius S et al (2011)
Rapid PCR-based molecular pathotyping of
H5 and H7 avian influenza viruses. J Clin
Yacoub A, Leijon M, McMenamy MJ et al
(2012) Development of a novel real-time PCRbased strategy for simple and rapid molecular
pathotyping of Newcastle disease virus. Arch
Virol 157:833844
Niemz A, Ferguson TM, Boyle DS (2011)
Point-of-care nucleic acid testing for infectious
diseases. Trends Biotechnol 29:240250
Hofmann WP, Dries V, Herrmann E et al
(2005) Comparison of transcription mediated
amplification (TMA) and reverse transcription
polymerase chain reaction (RT-PCR) for detection of hepatitis C virus RNA in liver tissue. J
Clin Virol 32:289293
Jeong YJ, Park K, Kim DE (2009) Isothermal
DNA amplification in vitro: the helicasedependent amplification system. Cell Mol Life
Sci 66:33253336
Notomi T, Okayama H, Masubuchi H et al
(2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28:E63
Johne R, Mller H, Rector A, van Ranst M,
Stevens H (2009) Rolling-circle amplification
of viral DNA genomes using phi29 polymerase.
Trends Microbiol 17:205211
Nagamine K, Hase T, Notomi T (2002)
Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell
Probes 16:223229
Zhang XJ, Sun Y, Liu L, Belk S, Qiu HJ
(2010) Validation of a loop-mediated isothermal
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
amplification assay for visualised detection of

wild-type classical swine fever virus. J Virol
Methods 167:7478
Yamazaki W, Mioulet V, Murray L et al (2013)
Development and evaluation of multiplex
RT-LAMP assays for rapid and sensitive detection of foot-and-mouth disease virus. J Virol
Methods 192:1824
Lalande V, Barrault L, Wadel S et al (2011)
Evaluation of a loop-mediated isothermal amplification assay for diagnosis of Clostridium difficile infections. J Clin Microbiol 49:27142716
Polley SD, Mori Y, Watson J et al (2010)
Mitochondrial DNA targets increase sensitivity
of malaria detection using loop-mediated isothermal amplification. J Clin Microbiol 48:
28662871
Mori Y, Kanda H, Notomi T (2013) Loopmediated isothermal amplification (LAMP):
recent progress in research and development. J
Infect Chemother 19:404411
Amann RI, Ludwig W, Schleifer KH (1995)
Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev 59:143169
Nilsson M, Malmgren H, Samiotaki M et al
(1994) Padlock probescircularizing oligonucleotides for localized DNA detection.
Science 265:20852088
Fredriksson S, Gullberg M, Jarvius J et al
(2002) Protein detection using proximitydependent DNA ligation assays. Nat Biotechnol
20:473477
Garaizar J, Rementeria A, Porwollik S (2006)
DNA microarray technology: a new tool for
the epidemiological typing of bacterial pathogens? FEMS Immunol Med Microbiol 47:
178189
Hacia JG (1999) Resequencing and mutational
analysis using oligonucleotide microarrays. Nat
Genet 21(1 Suppl):4247
Zhang SL, Shen JG, Xu PH et al (2007) A
novel genotypic test for rapid detection of
multidrug-resistant Mycobacterium tuberculosis
isolates by a multiplex probe array. J Appl
Ballarini A, Segata N, Huttenhower C, Jousson
O (2013) Simultaneous quantification of multiple bacteria by the BactoChip microarray
designed to target species-specific marker
genes. PLoS One 8:e55764
Wang D, Coscoy L, Zylberberg M et al (2002)
Microarray-based detection and genotyping of
viral pathogens. Proc Natl Acad Sci U S A
99:1568715692
Banr J, Nilsson M, Mendel-Hartvig M,
Landegren U (1998) Signal amplification of
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
padlock probes by rolling circle replication.

Nucleic Acids Res 26:50735078
Akhras MS, Thiyagarajan S, Villablanca AC
et al (2007) PathogenMip assay: a multiplex
pathogen detection assay. PLoS One 2:e223
Novais RC, Borsuk S, Dellagostin OA,
Thorstenson YR (2008) Molecular inversion
probes for sensitive detection of Mycobacterium
tuberculosis. J Microbiol Methods 72:6066
Akhras MS, Unemo M, Thiyagarajan S et al
(2007) Connector inversion probe technology:
a powerful one-primer multiplex DNA amplification system for numerous scientific applications. PLoS One 2:e915
Gyarmati P, Conze T, Zohari S et al (2008)
Simultaneous genotyping of all hemagglutinin
and neuraminidase subtypes of avian influenza
viruses by use of padlock probes. J Clin
Banr J, Gyarmati P, Yacoub A et al (2007)
Microarray-based molecular detection of footand-mouth disease, vesicular stomatitis and
swine vesicular disease viruses, using padlock
probes. J Virol Methods 143:200206
Henriksson S, Blomstrm AL, Fuxler L et al
(2011) Development of an in situ assay for
simultaneous detection of the genomic and
replicative form of PCV2 using padlock probes
and rolling circle amplification. Virol J 8:37
Soderberg O, Gullberg M, Jarvius M et al
(2006) Direct observation of individual endogenous protein complexes in situ by proximity
ligation. Nat Methods 3:9951000
Schlingemann J, Leijon M, Yacoub A et al
(2010) Novel means of viral antigen identification: improved detection of avian influenza
viruses by proximity ligation. J Virol Methods
163:116122
Nordengrahn A, Gustafsdottir SM, Ebert K
et al (2008) Evaluation of a novel proximity
ligation assay for the sensitive and rapid detection of foot-and-mouth disease virus. Vet
Munir M, Zohari S, Berg M (2011) Nonstructural protein 1 of avian influenza A viruses
differentially inhibit NF-kappaB promoter activation. Virol J 8:383
Kaittanis C, Santra S, Perez JM (2010)
Mairhofer J, Roppert K, Ertl P (2009)
Microfluidic systems for pathogen sensing: a
review. Sensors (Basel) 9:48044823
Yager P, Edwards T, Fu E et al (2006)
Microfluidic diagnostic technologies for global
public health. Nature 442:412418
123
54. Cady NC, Stelick S, Kunnavakkam MV, Batt

CA (2005) Real-time PCR detection of Listeria
monocytogenes using an integrated microfluidics
platform. Sens Actuators B Chem 107:
332341
55. Easley CJ, Karlinsey JM, Bienvenue JM et al
(2006) A fully integrated microfluidic genetic
analysis system with sample-in-answer-out
capability. Proc Natl Acad Sci U S A 103:
1927219277
56. Compton J (1991) Nucleic acid sequencebased amplification. Nature 350:9192
57. Heo J, Hua SZ (2009) An overview of recent
strategies in pathogen sensing. Sensors (Basel)
9:44834502
58. Beyor N, Seo TS, Liu P, Mathies RA (2008)
Immunomagnetic bead-based cell concentration microdevice for dilute pathogen detection.
Biomed Microdevices 10:909917
59. Lapizco-Encinas BH, Simmons BA, Cummings
EB, Fintschenko Y (2004) Dielectrophoretic
concentration and separation of live and dead
bacteria in an array of insulators. Anal Chem
76:15711579
60. Kim J, Johnson M, Hill P, Gale BK (2009)
Microfluidic sample preparation: cell lysis
and nucleic acid purification. Integr Biol 1:
574586
61. Wen J, Legendre LA, Bienvenue JM, Landers
JP (2008) Purification of nucleic acids in
microfluidic devices. Anal Chem 80:
64726479
62. Lien K-Y, Lee WC, Lei HY, Lee GB (2007)
Integrated reverse transcription polymerase
chain reaction systems for virus detection.
Biosens Bioelectron 22:17391748
63. Belgrader P, Benett W, Hadley D et al (1998)
Rapid pathogen detection using a microchip
PCR array instrument. Clin Chem 44:
21912194
64. Higgins JA, Nasarabadi S, Karns JS et al (2003)
A handheld real time thermal cycler for bacterial pathogen detection. Biosens Bioelectron
18:11151123
65. Jain KK (2003) Nanodiagnostics: application
of nanotechnology in molecular diagnostics.
66. Hauck TS, Giri S, Gao Y, Chan WC (2010)
Nanotechnology diagnostics for infectious diseases prevalent in developing countries. Adv
Drug Deliv Rev 62:438448
67. Vo-Dinh T, Cullum B (2000) Biosensors and
biochips: advances in biological and medical
diagnostics. Fresenius J Anal Chem 366:
540551
68. Gu H, Xu K, Xu C, Xu B (2006) Biofunctional
magnetic nanoparticles for protein separation
124
and pathogen detection. Chem Commun

2006(9):941949
69. Li Y, Cu YT, Luo D (2005) Multiplexed detection of pathogen DNA with DNA-based fluorescence nanobarcodes. Nat Biotechnol 23:
885889
70. Medintz IL, Uyeda HT, Goldman ER,
Mattoussi H (2005) Quantum dot bioconjugates for imaging, labelling and sensing. Nat
Mater 4:435446
71. Thaxton CS, Georganopoulou DG, Mirkin CA
(2006) Gold nanoparticle probes for the detection of nucleic acid targets. Clin Chim Acta
363:120126
72. Stoltenberg RM, Woolley AT (2004) DNAtemplated nanowire fabrication. Biomed

Microdevices 6:105111
73. Ziegler C (2004) Cantilever-based biosensors.
Anal Bioanal Chem 379:946959
74. Yang L, Li Y (2006) Simultaneous detection of
Escherichia coli O157:H7 and Salmonella
Typhimurium using quantum dots as fluorescence labels. Analyst 131:394401
75. Shanmukh S, Jones L, Driskell J et al (2006)
Rapid and sensitive detection of respiratory
virus molecular signatures using a silver
nanorod array SERS substrate. Nano Lett 6:
26302636
Chapter 8
Real-Time Reverse Transcriptase PCR for the Detection
of Bluetongue Virus
Carrie Batten, Lorraine Frost, and Chris Oura
Abstract
In recent years, real-time reverse transcription polymerase chain reaction (rRT-PCR) has become one of
the most widely used methods for the diagnosis of infectious pathogens. The combined properties of high
sensitivity, specificity, and speed, along with a low contamination risk, have made real-time PCR technology a highly attractive alternative to more conventional diagnostic methods. Numerous robust rRT-PCR
systems have been developed and validated for important epizootic diseases of livestock, and in this chapter
we describe an rRT-PCR protocol for the detection of bluetongue virus. The assay uses oligonucleotide
primers to specifically amplify target regions of the viral genome and a dual-labeled fluorogenic (TaqMan)
probe which allows for the assay to be performed in a closed-tube format, thus minimizing the potential
for cross-contamination.
Key words Bluetongue virus, Molecular biology, Real-time reverse transcriptase PCR, TaqMan,
Diagnosis
Introduction
Techniques based on the amplification of specific nucleic acid
sequences by polymerase chain reaction (PCR) are highly sensitive
and specific. Real-time polymerase chain reaction (rPCR) is currently one of the most widely used methods in the field of molecular diagnostics and research. The rPCR technique avoids the use
of agarose gel electrophoresis, thus reducing the risks of contamination, and enables the amplification of nucleic acids and the
detection of the amplified products in real time. The technique
is fast and simple to perform and can be carried out in a 96-well
format, making it suitable for large-scale testing and epidemiological screening. Portable real-time PCR machines are now available, enabling the application of molecular technologies in the
field with prospects for radically changing diagnostic approaches
in the future.
125
126
Carrie Batten et al.
In real-time PCR, the detection of amplified target sequences is

carried out by monitoring the fluorescence generated by intercalating
dyes, fluorophore-labeled primers, or sequence-specific probes.
Target sequences can be quantified by determining the number of
amplification cycles required to reach the fluorescence threshold at
the beginning of the exponential phase of the PCR. This is known of
as the threshold cycle or Ct value.
The real-time reverse transcription PCR (rRT-PCR) protocol
described in this chapter for the detection of bluetongue virus
(BTV) uses a sequence-specific hydrolysis probe (commercially
called TaqMan probes) to generate fluorescence. Hydrolysis
probes are dual-fluorophore-labeled oligonucleotides with a fluorescent reporter at one end and a quencher of fluorescence at the
opposite end of the probe. The close proximity of the reporter to
the quencher prevents detection of its fluorescence. The probe has
a high melting temperature (Tm) and hybridizes to complementary sequences present on the amplicon prior to the extension step
of the PCR. During primer extension, both fluorophores are subsequently released as a result of the 5 to 3-exonuclease activity of
a suitable DNA polymerase (e.g., Taq polymerase). Once the labels
are separated, the increase in reporter fluorescence that arises due
to the lack of the adjacent quencher is monitored by a real-time
PCR instrument. An increase in the product targeted by the probe
at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the
reporter [13].
Recent outbreaks of bluetongue (BT) in northern Europe
have highlighted the necessity to develop high-throughput, sensitive, and specific assays in order to rapidly detect BTV. When
designing group-specific primers and probes for the detection of
BTV, it is important to select regions of the genome that are sufficiently conserved to enable the detection of all known BTV serotypes and related topotypes but also sufficiently divergent from
other orbiviruses so there are no cross-reactions between closely
related viral species. This is not a simple task due to the high diversity of BTV which is evolving continuously by genetic drift, recombination, and gene reassortment. Many different rRT-PCR assays
for the detection of BTV have been developed in recent years [4];
however, the World Organization for Animal Health (OIE) and
European Union Reference Laboratory (EURL) for BTV at the
Pirbright Institute consider that the assay described in this chapter
[5, 6] is currently the group-specific BTV assay of choice as it is
able to detect all recognized serotypes of BTV that are currently
known to be circulating.
Bluetongue Virus Real-Time RT-PCR
127
Table 1
Primers and probe sequences
Oligo name
Sequence (53)
Working concentration (M)
Primer Hofm_BTV_IVI_F2
TGG AYA AAG CRA TGT CAA A
20
Primer Hofm_BTV_IVI_R2
ACR TCA TCA CGA AAC GCT TC
20
FAM-ARG CTG CAT TCG CAT

CGT ACG C-Tamra
Probe Hofm_BTV_IVI_P
a
Probe labeled with FAM (carboxyfluorescein) fluorophore and Tamra quencher
Materials
2.1 Reagents
and Consumables
1. Optical reaction plates and caps, 96-well PCR plate, or PCR

strips/tubes.
2. DNA decontamination solution (e.g., DNAZap solutions 1
and 2, Invitrogen).
3. Microcentrifuge tubes.
4. Disposable gloves.
5. Nuclease-free water.
6. Appropriate one-step reverse transcriptase real-time PCR kit
(we describe the use of the Invitrogen Superscript III RT-PCR
kit; however, the assay can be adapted to use other manufacturers commercial systems).
7. Forward primer, reverse primer, and fluorogenic probe
(Table 1; see Note 1). Primers and probes must be diluted to
a working concentration (Table 1) in nuclease-free water and
kept at 18 C. Stock primers and probe (and additional aliquots of working concentrations of primers) are stored at 5
to 30 C.
8. Aerosol-resistant pipette tips.
9. Adhesive PCR film.
10. Marker pens (waterproof) and adhesive labels.
2.2
Equipment
1. PCR cabinet.
2. Calibrated pipettes.
3. Freezer (5 to 30 C).
4. Refrigerator (18 C).
5. Ice bucket with ice.
6. Large capacity centrifuge.
7. Real-time PCR machine.
128
Table 2
Composition of the master mix for one-step real-time RT-PCR
Master mix composition
Volume for 1 reaction (l)
2 Superscript III RT-PCR reaction mix
12.5
Primer Hofm_BTV_IVI_F2 (20 M)a
0.5
Primer Hofm_BTV_IVI_R2 (20 M)
0.5
Probe Hofm_BTV_IVI_P (5 M)
1.0
RNase-free water
2.5
2.5 M ROX l
0.5
50 mM MgSO4
1.0
Superscript III RT/Platinum Taq
0.5
Total volume
19
The final concentration of the primers and probe per reaction is 0.4 M and 0.2 M,
respectively
a
Methods
3.1 Sample
Preparation
1. dsRNA from BTV test samples should be prepared as per standard methods (e.g., Qiagen/Roche viral nucleic acid extraction kits) and stored at 50 to 90 C. BTV negative and
positive control samples of known origin should also be prepared (see Note 2).
3.2
1. In a PCR clean room, prepare the one-step real-time RT-PCR

reaction master mix according to Table 2. Sufficient volume of
the master mix should be prepared to allow for testing of the
required number of samples (see Note 3).
Assay Setup
2. Working in a clean laminar flow cabinet (see Note 4), add all
reagents to a suitable container (e.g., microcentrifuge tube)
allowing for the total volume of reagents (see Note 5). Mix the
reagents gently with a pipette. Once outside the PCR clean
room, maintain the master mix on ice and shielded from light.
3. In a class II safety cabinet, carefully aliquot 6 l of extracted
RNA for both samples and controls into an optical reaction
PCR plate following a planned layout (see Note 6). Alternatively,
use PCR strips/tubes that are suitable for a real-time PCR
machine.
4. Seal the PCR plate containing the aliquoted RNA with a PCR
adhesive film (or carefully close the caps on the PCR plate/
strips/tubes, hereinafter referred to as PCR plate), and heat
denature the RNA (see Note 7) for 5 min at 95 C using a
129
Table 3
Thermal cycling program
Step
Temperature
Duration
Number of cycles
Reverse transcription
48 C
30 min
Reverse transcriptase inactivation/Taq activation
95 C
2 min
PCR
95 C
15 s
45
56 C
30 s
72 C
30 s
thermocycler as a heating block. Label the remaining RNA

samples and store at 50 to 90 C.
5. When the denaturation is complete, ensure that the samples are
not condensed on the adhesive film/optical cap/lids, hereinafter referred to as seal. If so, centrifuge the plate for 1 min at
approx. 150 g to collect the sample at the bottom of the plate.
6. Working in a class II safety cabinet, carefully remove the PCR
seal (see Note 8) and change gloves to avoid contamination.
7. Pipette 19 l of the master mix (a multichannel pipette can be
used) into the wells of the PCR plates containing the denatured RNA samples and controls. Cover each well of the PCR
plate containing the reaction components firmly with a new
seal (see Note 9).
8. Centrifuge for 1 min at approx. 150 g in a benchtop
centrifuge.
3.3 Amplification
and Detection
1. For instructions to set up the real-time PCR machine and how

to use the software refer to the relevant manufacturers manual.
Amplification should be performed using the thermal profile
outlined in Table 3.
2. Negative test controls should have No Ct as their final result
(see Note 10).
3. All positive control values should fall within a predefined range
(see Notes 2, 11, and 12).
4. Samples with Ct values are considered positive (see Note 11).
Samples with Ct values of No Ct are considered negative.
Notes
1. The primer and probe set described target BTV genome segment 10 and are specific for BTV. This primer and probe set
will detect BTV serotypes 126 [5, 6]. Primers and probe
130
arrive from a supplier in a solution or lyophilized state; all

primers and probes should be HPLC purified. All primers and
probes will be accompanied by a Technical Data Sheet which
gives detailed information for the individual primers and probe.
This information will also detail the volume of RNase-free
water to be added to the lyophilized primer and probe in order
to resuspend it to a concentration of 100 M. In the case of a
reagent in solution, the concentration of the solution will be
given. Once resuspended, this solution should be considered
the stock solution of primers and probe. Aliquots should be
made and labeled appropriately (with the name, batch number,
and concentration) to prevent repetitive freeze-thaw. Aliquots
should not be freeze-thawed more than approximately five
times. Stock solution of primers and probes should be stored
at 30 to 5 C. From the stock solution, a working concentration of primer and probe should be prepared by resuspending in RNase-free water. Those should be appropriately labeled
with the name, batch number, concentration, and date and
stored at 18 C for no longer than six months.
2. Where possible, RNA should be extracted from known BTV
negative and positive samples to act as controls. If feasible, a
single batch of negative and positive control samples should be
prepared and aliquoted for this purpose. Negative and positive
samples should be extracted with each test. The Ct value for
the positive control should be recorded and monitored
between runs. Ideally a positive control should have a Ct value
of approximately 28.
3. Generally, when preparing the master mix, make enough volume for the number of samples being tested plus 10 % to allow
for possible pipetting errors.
4. All laminar flow cabinets, pipettes, and work surfaces should be
cleaned regularly using a DNA contamination solution such as
DNAZap solutions 1 and 2, Invitrogen, or other similar
product. This will ensure that there is no contamination from
other master mix preparations, reducing the risk of false-positive results.
5. When using real-time RT-PCR kits, the Taq polymerase should
be added to the master mix last, as the enzymes are labile at
room temperature.
6. Great care should be taken to avoid the creation of aerosols
and other potential routes of contamination. Use barrier
pipette tips and change tip for each sample.
7. BTV has a dsRNA genome; therefore, the dsRNA needs to
be separated to ssRNA prior to reverse transcription and
PCR amplification in order for the reverse transcriptase enzyme
to function. This is achieved by heat denaturation for 5 min
at 95 C.
131
8. Placing the plate in a 96-well rack stabilizes the plate and makes
it easier to remove the seal. The bottom of the plate should be
free from moisture, as this can evaporate leaving calcium
deposits on the bottom of the plate during thermocycling.
Calcium fluoresces, and this may interfere with the fluorescence captured during amplification. The same applies when
using PCR strips/tubes.
9. A roller can be used to aid in sealing the PCR plate. Touching
the seal with gloves or fingers may leave marks which affect the
fluorescence detection.
10. A late Ct in a negative control with a sigmoidal character may
indicate cross-contamination.
11. Positive controls and positive samples should generate clean,
sigmoidal curves.
12. Raw data should be inspected if there are any samples/controls
generating a non-sigmoidal curve. This may indicate a problem with the computer selecting a baseline, inhibition from
inefficiencies during the extraction phase, or a fault with the
real-time PCR machine.
References
1. Gibson UEM, Heid CA, Williams PM (1996)
A novel method for real time quantitative RT
PCR. Genome Res 6:9951001
2. Heid CA, Stevens J, Livak KJ, Williams PM
(1996) Real time quantitative PCR. Genome
Res 6:986994
3. Livak KJ, Flood SJA, Marmaro J, Giusti W,
Deetz K (1995) Oligonucleotides with fluorescent dyes at opposite ends provide a quenched
probe system useful for detecting PCR product
and nucleic-acid hybridization. PCR Methods
Appl 4:357362
review of RT-PCR technologies used in veterinary
virology and disease control: sensitive and specific

diagnosis of five livestock diseases notifiable to the
World Organisation for Animal Health. Vet
Microbiol 139:123
5. Hofmann M, Griot C, Chaignat V, Perler L,
Thur B (2008) Bluetongue disease reaches
Switzerland. Schweiz Arch Tierheilkd 150:
4956
6. Chaignat VGW, Scherrer N, Hilbe M et al
(2009) Toggenburg orbivirus, a new bluetongue virus: initial detection, first observations
in field and experimental infection of goats and
sheep. Vet Microbiol 138:1119
Chapter 9
Nested and Multiplex Real-Time PCR Using Dual-Labeled
Probes: Detecting and Discriminating Mycobacterium
tuberculosis Complex Members in Cultures and Animal
Tissues
Pedro Costa, Isabel Couto, Miguel Viveiros, and Joo Incio
Abstract
Members of the Mycobacterium tuberculosis complex (MTC) are causative agents of tuberculosis (TB) in
both humans and animals. In the last two decades, the accumulating knowledge of the nucleotide sequences
of several genes, and of the whole genomes, of MTC members has allowed the development of novel
molecular assays able to detect and discriminate between these species. However, despite the significant
advances in the development of molecular assays for detecting MTC members in human samples, only a
few assays have been described for detecting these agents in animal tissues. In this chapter we describe the
use of two TaqMan-based real-time PCR approaches, highly sensitive and specific and easy to perform, to
detect and identify veterinary-relevant MTC species in both animal tissue samples and cultures.
Key words Mycobacterium tuberculosis complex, Mycobacterium bovis, Bovine tuberculosis,
Real-time PCR
Introduction
Members of the Mycobacterium tuberculosis complex (MTC) are
causative agents of tuberculosis (TB) in both humans and animals.
This complex encompasses several closely related pathogenic species,
notably M. tuberculosis, the main agent of human TB, M. bovis, primarily linked to bovine TB but also often isolated from a wide range
of other domestic and wild animals, and M. caprae, mostly associated to caprine TB [13]. Other less frequently found MTC species
associated to TB disease in animals are M. pinnipedii, M. microti, M.
mungi, and M. orygis [410]. Finally, M. canetti and M. africanum
complement the known list of MTC species, being these last two
closely related with M. tuberculosis and almost always restricted to
human tuberculosis, in spite of some sporadic reports of infections
caused by M. tuberculosis also in domestic and wild animals [1, 8].
133
134
Pedro Costa et al.
Bacteriological culture, followed by biochemical and/or

molecular identification, remains the gold-standard method to
confirm MTC infection, a time-consuming process due to the
extremely fastidious growth of these mycobacteria. Also, the conventional laboratory diagnosis does not routinely differentiate
between the species of the MTC.
In the last two decades, the accumulating knowledge of the
nucleotide sequences of several genes, and of the whole genomes,
of MTC members has allowed the development of novel molecular
assays able to detect and discriminate between these species [1117].
For example, the insertion element IS6110 has become one of the
most used DNA targets for developing molecular diagnostic tools
for the detection of MTC species, since it is found exclusively
within the members of this complex [18]. Comparative genomic
analysis also evidenced that modern MTC species probably evolved
from a common ancestor through the accumulation of sequential
and irreversible genomic deletions, named regions of difference
(RDs) [1, 2, 1922]. The pattern of the presence or absence of
these RDs in the genome of MTC members provides a highly specific molecular signature that can accurately discriminate among
these mycobacteria [1, 2, 8, 18, 23].
In spite of the significant advances in the development of
molecular assays for the detection of MTC species in human samples, only a few assays have been described for detecting these
agents in animal tissues, particularly in fresh tissues from livestock
[2428]. Most of these PCR-based assays only yield a moderate
sensitivity, particularly when testing tissues without the characteristic TB lesions or detectable acid-fast bacilli [2426, 29, 30].
This limitation is most probably related to the inefficiency of
mycobacterial DNA extraction procedures from affected animal
tissues [18, 24, 30].
In this chapter we describe the use of two TaqMan-based
real-time PCR assays to detect and identify veterinary-relevant
MTC species. These two approaches can be used complementarily
to improve the laboratorial diagnosis of TB in animals, particularly
of bovine TB. In the first approach an IS6110-targeted nested
real-time PCR allows the direct detection of MTC members in
fresh animal tissue samples with very high sensitivity and specificity. In the second approach, multiplex real-time PCR assays allow
the identification of the MTC members most commonly associated with TB in livestock and other animals, based on genomic
deletion analysis. Both approaches can be incorporated at the veterinarian mycobacteriology routine diagnostic algorithm or can
be used for specific purposes in particular situations to obtain
accurate confirmation of MTC infections and species
identification.
Detection of Mycobacterium tuberculosis Complex Species
135
Materials
1. Animal tissue samples (e.g., lymph nodes, liver, spleen, or lung
tissue samples from TB-suspect animals such as bovine, wild
boar, or deer).
2. Reference strains (e.g., M. tuberculosis ATCC 25177; M. bovis
AN5; M. bovis BCG ATCC 27291) and clinical isolates of MTC.
3. Materials for homogenization and DNA extraction from tissues: pestle and mortar; zirconium beads; DNA extraction kit
(e.g., the QIAamp DNA Mini Kit, Qiagen).
4. Phosphate-buffered saline (PBS) buffer: 137 mM of NaCl,
2.7 mM of KCl, 8 mM of Na2HPO4, 1.5 mM of KH2PO4,
pH 7.2. Weigh all components into a glass beaker and dissolve
in 800 ml water. Adjust the pH to 7.2 with HCl and NaOH
solutions. Add distilled water to a total volume of 1 l, dispense
the solution into aliquots, and sterilize by autoclaving (20 min,
121 C). Store at room temperature.
5. TE buffer: 10 mM of TrisHCl, pH 8.0, 1 mM of EDTA.
6. TaqMan probes and primers (Table 1) (see Note 1).
7. Reagents for standard PCR amplification: Taq DNA polymerase and respective 10 reaction buffer; deoxynucleotide
triphosphates (dNTPs); MgCl2.
8. Reagents for real-time PCR amplification (e.g., the SsoFast
supermix, BioRad).
9. Homogenizer/bead shaker (e.g., the FastPrep FP120 Bio101,
Savant Instruments Inc., Holbrook, NY).
10. Centrifuge.
11. Standard and real-time PCR equipment (e.g., the CFX96 realtime PCR instrument, BioRad).
Methods
To prevent the risk of human infection, the manipulation of MTC
cultures and TB-suspect tissues must be performed in a confined
biosafety level 3 laboratory.
3.1 DNA Extraction

from Reference
and Clinical MTC
Cultures
The culture supernatants can be processed using a rapid and simple

boiling-based DNA extraction procedure.
1. Grow the MTC strains using standard liquid culture media and
procedures for these organisms.
2. After incubation, centrifuge 10 ml of culture at 3,800 g for
30 min.
136
Pedro Costa et al.
Table 1
Sequences of primers and probes
Primer/probe
Sequence (53)
Complementary target
F_Actin
GGC TCY ATY CTG GCC TC
-actin gene of mammalsa
R_Actin
b
GCA YTT GCG GTG SAC RAT G
P_Actin
Cy5.5-TAC TCC TGC TTG CTG ATC CAC

ATC-BHQ2
F_IS6110
GGG TCG CTT CCA CGA TG
FN_IS6110
CTC GTC CAG CGC CGC TTC GG
R_IS6110
GGG TCC AGA TGG CTT GC
P_IS6110d
FAM-CGC GTC GAG GAC CAT GGA GGT-BHQ1
F_16SrDNA
CCG CAA GGC TAA AAC TCA AA
R_16SrDNA
TGC ACA CAG GCC ACA AGG GA
P_16SrDNAf
TET-TCG ATG CAA CGC GAA GAA CCT TAC-BHQ1
F-esat6
AGG CGT ACC AGG GTG TC
R-esat6
P-esat6
IS6110 element of MTC

speciesc
Mycobacterial 16S rDNAe
RD1 (Rv3875 locus,

esat6 gene)
CGA AGC CAT TGC CTG ACC

Cy5.5-ACAACGCGCTGCAGAACC TGG-BHQ2
F-Rv1510
CCT GCA AGA AAC GAC CCG
R-Rv1510
GCGACGGTGCCAATCATC
P-Rv1510f
TET-CCATCGTACCCATCCGCT GCG-BHQ1
F-Rv2073c
AGTCGGTGTGCACGATGG
R-Rv2073c
CGC TCG TTG CCG AGC AC
P-Rv2073cg
Texas Red-CTG GTC GCC GAG TAT CCC GAA

G-BHQ2
RD4 (Rv1510 locus)
RD9 (Rv2073c locus)
Probes and primers described by Costa et al. [18]

Probe labeled with Cy5.5 fluorophore and BHQ-2 quencher
c
Probes and primers described by Restrepo et al. [33] and Costa et al. [18]
d
Probe labeled with carboxyfluorescein (FAM) fluorophore and BHQ-1 quencher
e
Probes and primers described by Richardson et al. [34], Kirschner et al. [35], and Costa et al. [18]
f
Probe labeled with TET (tetrachlorofluorescein) fluorophore and BHQ1 quencher
g
Probe labeled with Texas red fluorophore and BHQ2 quencher
b
3. Discard the supernatant, wash the pellet in 10 ml of PBS, and

centrifuge again at 3,800 g for 30 min.
4. Discard the supernatant and suspend the pellet in 250 l of TE
buffer.
5. Heat the suspension in a water bath at 95 C for 25 min.
6. Centrifuge at 15,000 g for 5 min.
137
7. Transfer a 150 l aliquot of the supernatant (containing the

DNA) to a sterile microtube and store at 20 C until further use.
8. Stock DNA suspensions are diluted ten times in distilled water
before its use as template for PCR assays.
3.2 DNA Extraction
from Animal Tissue
Samples
1. Homogenize the tissue sample using a clean, sterilized pestle

and mortar (the addition of a small volume of PBS buffer and
sterilized powdered glass, silica, or sand can help the homogenization process).
2. Transfer 450 l of tissue suspension to screw-cap microcentrifuge tubes.
3. Inactivate the tissue sample in a water bath at 100 C for 5 min.
4. Centrifuge the samples in a bench centrifuge at 15,000 g for
2 min.
5. Discard the supernatant and add 80 l of PBS buffer and an
equivalent volume of 100 l of zirconium beads.
6. Proceed to the mechanical disruption of the mycobacterial
cells (e.g., FastPrep FP120 Bio101 bead shaker at 6.5 m/s for
45 s, three times).
7. Cool the suspensions on ice for 15 min.
8. Proceed to the DNA extraction using a commercially available
kit, according to the manufacturers instructions (e.g., the tissue protocol of the QIAamp DNA Mini Kit).
9. Store the genomic DNA suspensions at 20 C until further use.
10. Stock DNA suspensions are diluted ten times in distilled sterile
water before its use as template for PCR assays.
3.3 Detection of MTC

in Tissue Samples by
Nested Real-Time PCR
The nested IS6110-targeted real-time PCR assay consists of two

steps: (1) a first standard PCR using primers FN_IS6110 and R_
IS6110 and (2) a second duplex real-time PCR using the previous
amplification product as template and a mixture of IS6110 and
-actin gene-targeted TaqMan probes (P_IS6110 and P_Actin,
respectively) and the corresponding flanking primers (F_IS6110/R_
IS6110 and F_Actin/R_Actin, respectively) (Table 1) (see Notes 2
and 3).
1. For the first standard PCR, each amplification reaction is
prepared for a final volume of 25 l, including the addition of
5 l of template DNA sample.
2. Prepare a reaction mixture for all the DNA samples to test,
including the positive (DNA from a reference strain culture)
and negative (distilled sterile water) amplification controls,
containing 400 M of dNTPs, 1 U of Taq DNA polymerase
and 1 of the respective buffer, 3.5 mM of MgCl2, and 0.8 M
138
Pedro Costa et al.
of each primer (FN_IS6110 and R_IS6110), completing to

80 % of the final volume with PCR-grade water (see Note 4).
3. Distribute 20 l of the reaction mixture by individual 0.2 ml
microtubes.
4. Label each tube and add 5 l of the correspondent DNA sample and controls.
5. Proceed to the amplification step using the following program:
(a) initial denaturation step at 95 C for 10 min; (b) 45 cycles
of 30 s at 95 C, 30 s at 65 C, 30 s at 72 C; and (c) a final
extension step of 10 min at 72 C.
6. Store the products at 4 C until their use for the second duplex
real-time PCR step (see Note 5).
7. For the second nested duplex real-time PCR, each amplification reaction is prepared for a final volume of 20 l, including
the addition of 5 l of the previous amplification product
(including for the correspondent positive and negative amplification controls).
8. Prepare a reaction mixture for all the DNA samples to test
containing: 1 SsoFast supermix, 0.4 M of each primer (F_
IS6110, R_IS6110, F_Actin, and R_Actin), and 0.15 M of
each TaqMan probe (P_IS6110 and P_Actin), completing to
75 % of the final volume with PCR-grade water.
microtubes.
10. Label each tube and add 5 l of the correspondent DNA sample (product of step 6) and controls.
1 cycle at 95 C for 2 min, followed by 45 cycles at 95 C for
5 s, and 60 C for 10 s. The increase of fluorescence and amplification curves for each sample should be recorded and assessed
according to the instructions of the manufacturer of the realtime PCR instrument. Only samples containing MTC DNA
should yield positive amplification results with the IS6110targeted probe (see Note 2 and Fig. 1).
3.4 Identification
of MTC Strains
by a Two-Step
Multiplex Real-Time
PCR Algorithm
The identification algorithm of MTC strains consists of two steps:

(1) a first duplex real-time PCR targeting the mycobacterial 16S
rDNA and the MTC-specific IS6110 and (2) a second triplex realtime PCR targeting the Rv3875-esat6 (RD1), Rv1510 (RD4), and
Rv2073c (RD9) genomic regions of MTC (see Notes 3, 68).
1. For the first duplex real-time PCR, each amplification reaction
is prepared for a final volume of 20 l, including the addition
of 5 l of template DNA sample.
2. Prepare a reaction mixture for all the DNA samples to test
(extracted from MTC cultures to identify), including the positive
139
Tissue sample
Bacteriological culture
DNA extraction from tissues (3.2)
DNA extraction from cultures (3.1)
Detection of MTC by nested real time PCR (3.3)
Identification of MTC by multiplex real-time PCR (3.4)
1st
1st reaction
standard PCR
(targeting 16S rDNA and IS6110)
(primers targeting IS6110)
nested real time PCR
16S rDNA
IS6110
(targeting IS6110 and mammal b-actin gene)

-actin
IS6110
-actin +
IS6110
-actin +
IS6110 +
Inconclusive
Not infected
with MTC
Infected with
MTC
16S rDNA +
IS6110 +
Not
Mycobacterium
16S rDNA +
IS6110
Non-tuberculous
mycobacteria
2nd reaction
3400
RD1 +
RD4 +
RD9 +
RFU
2700
2000
1300
600
-100
(targeting RD1, RD4 and RD9)
11
16
21
26
Cycles (Ct)
31
36
41
46
RD1 +
RD4 +
RD9
M. tuberculosis M. caprae
M. canettii M. africanum
M. pinnipedii
M. orygis
RD1 +
RD4
RD9
RD1
RD4
RD9
M. bovis
M. bovis BCG
Fig. 1 Schematics of the detection and identification algorithm for MTC species most commonly associated
with TB in livestock and other animals. DNA directly extracted from tissues can be used as template for the
detection of MTC by nested real-time PCR targeting the IS6110 (left dashed box). The amplification of the
mammal -actin gene is used as control for the occurrence of inhibitors of the reactions. The inset in the bottom illustrates the amplification results usually obtained by the nested duplex real-time PCR assay of an MTCinfected (black lines) and non-infected (gray lines) tissues samples for the amplification targeting the IS6110
(solid lines) and the mammal -actin gene (dashed lines) (RFU-relative fluorescence units). DNA extracted
from cultures can be used as template for the identification of MTC by multiplex real-time PCR (right dashed
box). The DNA extracted directly from tissues can be also used as template for these multiplex assays, but the
sensitivity for the detection of MTC is lower than when using the nested real-time PCR assay. In the first amplification step, the isolate will be assigned as an MTC member (by detecting the presence of the IS6110 element) or, alternatively, as a non-MTC Mycobacterium species. The subsequent RDs-targeted triplex PCR allows
the identification of the most veterinary-relevant MTC members to the species level as M. bovis (or M. bovis
BCG), M. caprae, or M. tuberculosis, according to their distinct patterns of presence or absence of RD1, RD4,
and RD9. Other MTC members such as M. canettii, M. africanum, M. pinnipedii, and M. orygis may present
similar RDs profiles, but these species are rarely found in domestic (particularly livestock) and big game animals. Due to specific deletions spanning at least part of the region RD1, other less frequently found MTC species of M. microti and M. mungi present the alternative profile RD1 (), RD4 (+), and RD9 ()
140
Pedro Costa et al.
and negative (water) amplification controls, containing 1

SsoFast supermix, 0.4 M of each primer (F_16SrDNA,
R_16SrDNA, F_IS6110, and R_IS6110), and 0.15 M of each
TaqMan probe (P_16SrDNA and P_IS6110), completing to
75 % of the final volume with PCR-grade water.
microtubes.
according to the instructions of the manufacturer of the realtime PCR instrument (see Note 9).
6. For the second triplex real-time PCR, each amplification reaction is prepared for a final volume of 20 l, including the addition of 5 l of template DNA sample.
including the positive and negative (water) amplification controls, containing 1 SsoFast supermix; 0.25 M of F-esat6,
R-esat6, F-Rv1510, and R-Rv1510 primers; 0.4 M of
F-Rv2073c and R-Rv2073c primers; 0.15 M of P-esat6 and
P-Rv1510 TaqMan probes; and 0.25 M of P-Rv2073c
TaqMan probe, completing to 75 % of the final volume with
PCR-grade water.
microtubes.
according to the instructions of the manufacturer of the realtime PCR instrument.
11. The interpretation of the amplification results should be performed according to Fig. 1 (see Note 10).
Notes
1. Probes and primers are frequently delivered lyophilized and
need to be diluted with sterile water according to the manufacturers instructions. Stock solutions can be prepared at a
standard concentration of 100 pmol/l and stored at 20 C.
141
Aliquots of working solutions of each probe and primer are

prepared from stock solutions in water and stored also at
20 C. Prepare small aliquots of working solutions (up to
100 l) and avoid continuous freeze and thaw of the solutions. Keep labeled probes protected from light.
2. The amplification of the -actin gene serves as control to

detect inhibition of the PCR reactions when using DNA
extracted from tissues as template [18].
3. The MTC-specific IS6110-targeted primers and probe used
were shown to be highly efficient for detecting tuberculous
mycobacteria in animal tissue samples [18]. It has recently
been found that IS6110-like elements may be present in other
non-MTC mycobacteria such as M. smegmatis [31]. However,
the probe and respective flanking primers used show no relevant complementary regions with these IS6110-like nucleotide
sequences [18].
4. The use of a nested amplification assay for MTC detection
presents an associated increased risk of cross contamination of
samples. Therefore, we should emphasize the need of working
in a laboratory harboring good practice standard conditions
for molecular analysis, which include working in separate clean
rooms and the use of positive and negative controls.
5. The standard PCR step amplifies an MTC-specific 199 bp fragment of the IS6110. The amplified products can be analyzed in
a 2 % agarose gel electrophoresis, according to standard
protocols.
6. The complementary regions of the P-esat6, F-esat6, and
R-esat6 probe and flanking primers, respectively, are located in
the 6 kDa early secretory antigenic target gene (esat6, Rv3875
locus), included in the RD1 genomic region, which is present
in most MTC members with the exception of the vaccine M.
bovis BCG strains.
7. The complementary regions of the P-Rv1510, F-Rv1510, and
R-Rv1510 probe and flanking primers, respectively, are located
in the Rv1510 locus, coding a conserved probable membrane
protein, included in the RD4 genomic region, which is present
in all MTC members with the exception of M. bovis. However,
a recent study reported that RD4 may be also absent, at least
in part, from some M. caprae isolates [32].
8. The complementary regions of the P-Rv2073c, F-Rv2073c,
and R-Rv2073c probe and flanking primers, respectively, are
located in the Rv2073c locus coding a probable short chain
dehydrogenase, included in the RD9 genomic region, which is
present in M. tuberculosis but absent from M. bovis and other
MTC species.
142
Pedro Costa et al.
9. The first step allows the identification of the cultures as MTC

members, by targeting their IS6110 element, or as a mycobacterial species, if only a 16S rDNA product is detected in the
duplex amplification reaction.
10. The second amplification step allows assessing the presence or
absence of the Rv3875-esat6 (RD1), Rv1510 (RD4), and
Rv2073c (RD9) loci in the MTC strains. The correspondent
pattern allows inferring the species of the isolate as M. tuberculosis, if all loci are present, as M. caprae, if only the Rv3875esat6 (RD1) and Rv1510 (RD4) loci are present, as M. bovis, if
only Rv3875 (RD1) locus is present, and as M. bovis BCG, if
all the previous loci are absent.
Acknowledgments
This work was partially funded by the project PTDC/CVT/
111634/2009 from Fundao para a Cincia e a Tecnologia.
References
1. Brosch R, Gordon SV, Marmiesse M et al
(2002) A new evolutionary scenario for the
Mycobacterium tuberculosis complex. Proc Natl
Acad Sci U S A 99:36843689
2. Mostowy S, Cousins D, Brinkman J, Aranaz A,
Behr MA (2002) Genomic deletions suggest a
phylogeny for the Mycobacterium tuberculosis
complex. J Infect Dis 186:7480
3. Michel AL, Mller B, van Helden PD (2010)
Mycobacterium bovis at the animal-human
interface: a problem, or not? Vet Microbiol
140:371381
4. van Soolingen D, de Haas PE, Haagsma J et al
(1994) Use of various genetic markers in differentiation of Mycobacterium bovis strains from
animals and humans and for studying epidemiology of bovine tuberculosis. J Clin Microbiol
32:24252433
5. Aranaz A, Cousins D, Mateos A, Dominguez L
(2003) Elevation of Mycobacterium tuberculosis
subsp. caprae Aranaz et al. 1999 to species rank
as Mycobacterium caprae comb. nov., sp. nov.
Int J Syst Evol Microbiol 53:17851789
6. Cousins DV, Bastida R, Cataldi A et al (2003)
Tuberculosis in seals caused by a novel member
of the Mycobacterium tuberculosis complex:
Mycobacterium pinnipedii sp. nov. Int J Syst
Evol Microbiol 53:13051314
7. Mostowy S, Cousins D, Behr MA (2004)
Genomic interrogation of the dassie bacillus
reveals it as a unique RD1 mutant within the
8.
9.
10.
11.
12.
13.
Mycobacterium tuberculosis complex. J Bacteriol

186:104109
Huard RC, Fabre M, de Haas P et al (2006)
Novel genetic polymorphisms that further
delineate the phylogeny of the Mycobacterium
tuberculosis complex. J Bacteriol 188:
42714287
Alexander KA, Laver PN, Michel AL et al
(2010) Novel Mycobacterium tuberculosis complex pathogen, M. mungi. Emerg Infect Dis
16:12961299
van Ingen J, Rahim Z, Mulder A et al (2012)
Characterization of Mycobacterium orygis as M.
tuberculosis complex subspecies. Emerg Infect
Dis 18:653655
Niemann S, Harmsen D, Rusch-Gerdes S,
Richter E (2000) Differentiation of clinical
Mycobacterium tuberculosis complex isolates by
gyrB DNA sequence polymorphism analysis. J
Clin Microbiol 38:32313234
Parsons LM, Brosch R, Cole ST et al (2002)
Rapid and simple approach for identification of
Mycobacterium tuberculosis complex isolates by
PCR-based genomic deletion analysis. J Clin
Huard RC, Lazzarini LC, Butler WR, van
Soolingen D, Ho JL (2003) PCR-based
method to differentiate the subspecies of the
Mycobacterium tuberculosis complex on the
basis of genomic deletions. J Clin Microbiol
41:16371650

14. Djelouadji Z, Raoult D, Daff M, Drancourt
M (2008) A single-step sequencing method for
the identification of Mycobacterium tuberculosis
complex species. PLoS Negl Trop Dis 2:e253
15. Pinsky BA, Banaei N (2008) Multiplex realtime PCR assay for rapid identification of
Mycobacterium tuberculosis Complex members
to the species level. J Clin Microbiol 46:
22412246
16. Costa P, Amaro A, Botelho A, Incio J, Baptista
PV (2010) Gold nanoprobe assay for the identification of mycobacteria of the Mycobacterium
tuberculosis complex. Clin Microbiol Infect
16:14641469
17. Halse TA, Escuyer VE, Musser KA (2011)
Evaluation of a single-tube multiplex real-time
PCR for differentiation of members of the
Mycobacterium tuberculosis complex in clinical
specimens. J Clin Microbiol 49:25622567
18. Costa P, Ferreira AS, Amaro A et al (2013)
Enhanced detection of tuberculous mycobacteria in animal tissues using a semi-nested probebased real-time PCR. PLoS One 8:e81337
19. Mahairas GG, Sabo PJ, Hickey MJ, Singh DC,
Stover CK (1996) Molecular analysis of genetic
differences between Mycobacterium bovis
BCG and virulent M. bovis. J Bacteriol 178:
12741282
20. Brosch R, Gordon SV, Billault A et al (1998)
Use of a Mycobacterium tuberculosis H37Rv
bacterial artificial chromosome library for
genome mapping, sequencing, and comparative genomics. Infect Immun 66:22212229
21. Gordon SV, Brosch R, Billault A et al (1999)
Identification of variable regions in the
genomes of tubercle bacilli using bacterial artificial chromosome arrays. Mol Microbiol
32:643655
22. Behr MA, Wilson MA, Gill WP et al (1999)
Comparative genomics of BCG vaccines by
whole genome DNA microarray. Science
284:15201523
23. Warren RM, Gey van Pittius NC, Barnard M
et al (2006) Differentiation of Mycobacterium
tuberculosis complex by PCR amplification of
genomic regions of difference. Int J Tuberc
Lung Dis 10:818822
24. Parra A, Garca N, Garca A et al (2008)
Development of a molecular diagnostic test
applied to experimental abattoir surveillance on
bovine tuberculosis. Vet Microbiol 127:315324
25. Taylor MJ, Hughes MS, Skuce RA, Neill SD
(2001) Detection of Mycobacterium bovis in
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
143
bovine clinical specimens using real-time

fluorescence and fluorescence resonance
energy transfer probe rapid-cycle PCR. J Clin
Taylor GM, Worth DR, Palmer S, Jahans K,
Hewinson RG (2007) Rapid detection of
Mycobacterium bovis DNA in cattle lymph
nodes with visible lesions using PCR. BMC Vet
Res 3:12
Coetsier C, Vannuffel P, Blondeel N et al
(2000) Duplex PCR for differential identification of Mycobacterium bovis, M. avium, and M.
avium subsp. paratuberculosis in formalinfixed paraffin-embedded tissues from cattle. J
Roring S, Hughes MS, Skuce RA, Neill SD
(2000) Simultaneous detection and strain differentiation of Mycobacterium bovis directly
from bovine tissue specimens by spoligotyping.
Thacker TC, Harris B, Palmer MV, Waters WR
(2011) Improved specificity for detection of
Mycobacterium bovis in fresh tissues using
IS6110 real-time PCR. BMC Vet Res 7:50
Libana E, Aranaz A, Mateos A et al (1995)
Simple and rapid detection of Mycobacterium
tuberculosis complex organisms in bovine tissue
samples by PCR. J Clin Microbiol 33:3336
Coros A, DeConno E, Derbyshire KM (2008)
IS6110, a Mycobacterium tuberculosis complexspecific insertion sequence, is also present in
the genome of Mycobacterium smegmatis, suggestive of lateral gene transfer among mycobacterial species. J Bacteriol 190:34083410
Domogalla J, Prodinger WM, Blum H et al
(2013) Region of difference 4 in alpine
Mycobacterium caprae isolates indicates three
variants. J Clin Microbiol 51:13811388
Restrepo BI, Gomez DI, Shipley GL,
McCormick JB, Fisher-Hoch SP (2006)
Selective enrichment and detection of mycobacterial DNA in paucibacillary specimens. J
Microbiol Methods 67:220229
Richardson ET, Samson D, Banaei N (2009)
Rapid identification of Mycobacterium tuberculosis and nontuberculous mycobacteria by multiplex, real-time PCR. J Clin Microbiol 47:
14971502
Kirschner P, Springer B, Vogel U et al (1993)
Genotypic identification of mycobacteria by
nucleic acid sequence determination: report of
a 2-year experience in a clinical laboratory. J
Chapter 10
A Real-Time PCR Assay for the Diagnosis
of Gastrointestinal Nematode Infections
of Small Ruminants
Florian Roeber, Aaron R. Jex, and Robin B. Gasser
Abstract
The diagnosis of gastrointestinal nematode infections in small ruminants is central to studying the biology
and epidemiology of these parasites and underpins their control. Traditional methods of diagnosis are inaccurate, time-consuming and laborious. Here, we describe a step-by-step protocol for the molecular-based
diagnosis of infections by real-time PCR.
Key words Livestock parasites, Strongylid nematodes, Diagnosis, PCR, Real-time PCR
Introduction
Parasitic worms of livestock cause diseases of major socioeconomic
impact worldwide. The current financial losses caused by parasites
to agriculture have a substantial impact on farm profitability around
the world [1, 2]. Parasitic roundworms (nematodes) of livestock
animals are mainly controlled by treatment with antiparasitic drugs
(anthelmintics) [3]. Even with optimally timed, strategic treatments, this type of control is expensive. The excessive and uncontrolled use of anthelmintics has resulted in substantial and
widespread problems with resistance in nematodes against these
compounds [4, 5]. Given the significant problems with parasitic
diseases and drug resistance, there is an urgent need for an increased
focus on integrated control, which includes the use of diagnostic
methods. Unfortunately, traditional parasitological methods of
diagnosis are often unreliable and/or time-consuming to carry
out [6]. These limitations relate to their inability to accurately
identify parasite stages (eggs or larvae) from fecal samples to species and also to the time that it takes to allow eggs to develop to
larvae (via coproculture) for subsequent microscopic identification [7]. Recently, a DNA approach was developed to overcome
145
146
Florian Roeber et al.
these limitations. Using genetic markers in the second internal

transcribed spacer (ITS-2) of nuclear rRNA genes, we established
a rapid and highly effective real-time PCR assay for the specific
diagnosis of infections by nematodes, including Haemonchus contortus, Teladorsagia circumcincta, Trichostrongylus spp., Chabertia
ovina and Oesophagostomum venulosum, of sheep [8]. This realtime PCR involves the incorporation of a specific fluorescent dye
(SYTO-9) into the PCR, which binds to produced doublestranded molecules and enables the detection of accumulating
DNA. The change of fluorescence during the thermocycling is
directly related to the initial starting number of target sequences.
The fewer the cycles required to produce a detectable fluorescence,
measured as cycle threshold or Ct value, the greater the number of
target sequences present. Published evidence [9, 10] shows clearly
that this assay outperforms traditional methods used for the diagnosis of gastrointestinal nematode infections in small ruminants,
and can be employed for routine diagnostic application or as an
epidemiological tool. Here we describe a step-by-step protocol for
this PCR assay (Fig. 1).
Fig. 1 Step-by-step protocol for the molecular diagnosis of strongylid nematode infections from small
ruminant fecal samples. Following coproscopy (1). the fecal suspension is washed and nematode parasite
eggs are recovered (2). Genomic DNA is isolated from eggs (3). and regions within the second internal transcribed spacer of nuclear ribosomal DNA specifically amplified by real-time PCR (4). After completion of PCR
and melting-curve analysis (5). an estimate of the contribution of individual nematode species or genera to the
egg count is estimated
Diagnosis of Gastrointestinal Nematode Infections
147
Materials
2.1 For Fecal

Flotation and the
Enumeration of
Nematode Eggs
1. Saturated sodium nitrate flotation solution: Fill a beaker with

1 l of hot water and add 400 g of sodium nitrate salt.
Continuously stir the suspension until the salt is fully dissolved.
Check specific gravity of 1.300 with a hydrometer (see Note 1).
2. McMaster parasite egg counting chambers.
3. Metal spatula.
4. Metal sieve (aperture of 250 m).
5. 60 ml plastic container.
6. Pipette with sieve top.
7. Weight (0.05 g accuracy).
8. 50 ml tubes with conical bottom.
2.2 For the Isolation

of Nucleic Acids
from Nematode Eggs
1. Standard pipettes and tips (1 ml, 200 l and 20 l).

2. Vortex.
3. RNase/DNase-free microcentrifuge tubes (1.5 ml).
4. Refrigerator (4 C).
5. Centrifuge for 50 ml tubes; minimum of 2,000 g at room
temperature.
6. Microfuge.
7. Adequate DNA extraction kit (e.g., PowerSoil DNA Isolation
Kit, MO BIO Laboratories Inc., USA).
2.3 For
the Amplification
of Nucleic Acids by
Real-Time PCR
1. Oligonucleotide primers targeting the ITS-2 region of the

most relevant nematode parasites (Table 1) and the conserved
primers NC1 (5-ACG TCT GGT TCA GGG TTG TT-3) and
NC2 (5-TTA GTT TCT TTT CCT CCG CT-3) [8, 11].
2. Real-time PCR thermal cycler and respective software
(see Note 2).
3. Commercial PCR mixture containing standard reaction buffer,
heat-activated DNA polymerase, dNTPs, and 6 mM MgCl2
(see Note 3).
4. SYTO9 green fluorescent nucleic acid stain (Life Technologies,
USA) (see Note 4).
Methods
3.1 Preparation
of Fecal Samples
and Enumeration
of Nematode Eggs
1. Collect feces from the rectum of sheep using a disposable plastic glove. Invert the glove to capture the sample, expel air, tie
a knot in the glove and label with a permanent marker (see
Note 5).
148
Table 1
Parasite-specific primers used in the real-time PCR assays
Melting temperaStart position
Amplicon
ture of target
in ITS-2 regionb length (bp)c sequence (C)
Target species
Primera Sequence (53)

HAE
CAA ATG GCA TTT

GTC TTT TAG
41
265
78.81
H. contortus
TEL
TAT GCA ACA TGA

CGT ACG ACG G
98
218
78.15
Te. circumcincta
TRI
TCG AAT GGT CAT

TGT CAAA
40
267268
77.87
Trichostrongylus
spp.
CHO
GTG ATG ACC TCG 143

TTG TCA CCG TG
162
82.12
C. ovina
OEV
TGA AAT GAG ACA

ACC GTA GTC G
105
79.38
O. venulosum
222
According to Bott et al. [8]

Using the sequences with the GenBank access numbers for H. contortus (accession no. X78803), Te. circumcincta
(accession no. X86026), Trichostrongylus axei, Tr. colubriformis, Tr. vitrinus, Tr. rugatus (accession nos. X78065,
X78063, X78064 and Y14818) Oe. venulosum (accession no. Y10790) and C. ovina (accession no. Y10789) as
references
c
When combined with the conserved NC2 reverse primer at the 5 axei end of the large subunit of rDNA
b
2. Homogenize the entire fecal sample and transfer 4 g to a 60 ml

container (see Note 6).
3. Add 50 ml of sodium nitrate solution and homogenize
(see Note 7).
4. Pour suspension through a sieve and collect run-through in a
clean container.
5. Pour suspension into a 50 ml tube and make up to 50 ml with
sodium nitrate solution. Close the tube and invert three times.
Immediately open the tube, aspirate 1.5 ml with a sieve-top
pipette and fill three chambers of the McMaster slide.
6. Count thin-shelled strongylid nematode eggs (i.e., <100 m in
length and <50 m in width) in each of the three chambers and
calculate the mean number from the three counts. Every egg
counted equates to 30 eggs per gram in a 4 g sample.
3.2 Concentration
of Nematode Eggs
from the Fecal Sample
1. Centrifuge the suspension at 1,000 g at 2224 C for 5 min

to float the eggs to the top of the suspension.
2. Decant 5 ml from the supernatant into a fresh 50 ml tube and
fill with tap water. Centrifuge again at 2,000 g for 5 min to
pellet the eggs in the bottom of the tube (see Note 8).
3. Discard the supernatant without dislodging the pellet.
Completely resuspend the pellet in 5 ml of water by vortexing,
add 45 ml of water and then centrifuge again at 2,000 g for
5 min.
149
4. Discard the supernatant. Add 250 l of water and aspirate

using a pipette and transfer the suspension (0.51.5 ml) to a
1.5 ml microcentrifuge tube, freeze (20 C) or use directly
for genomic DNA isolation.
3.3 DNA Isolation
from Fecal Pellet
1. Transfer 250 l of the suspension to a PowerSoil DNA isolation tube and perform isolation of nucleic acids according to
the manufacturers instructions.
2. Use DNA samples immediately for molecular analysis or store
frozen (70 C).
3.4 Real-Time PCR,

Melting Curve,
and Analyses
of Results
1. Five primer pairs HAE-NC2, TEL-NC2, TRI-NC2,

CHO-NC2 and OEV-NC2 are used in separate reactions for
the specific amplification of the ITS-2 region of H. contortus,
Te. circumcincta, Trichostrongylus spp., C. ovina and O. venulosum, respectively, from strongylid egg DNA from fecal samples. In addition, primer pair NC1-NC2 [8, 11] is used to
assess inhibition in, and amplification efficiency for, individual
genomic DNA samples.
2. Perform each PCR reaction in a volume of 25 l, containing
12.5 l Sensimix dT Mastermix, 0.2 M of forward and reverse
primer and 8 M of SYTO-9 fluorescent dye [9, 10]. Samples
without genomic DNA (no-DNA controls) are included in
each PCR run. Also included in each run is a serial titration
(1 ng, 100 pg, 10 pg and 1 pg) of ITS-2 sequences of each H.
contortus, Te. circumcincta, T. vitrinus, C. ovina and O.
venulosum, cloned into the vector pGEM-T (Promega), as calibrated reference positive controls (to provide standard
curves) (see Note 9).
3. PCR is performed under the following conditions: 95 C for
10 min, followed by 35 cycles of 95 C for 15 s (denaturation),
55 C for 30 s (annealing) and 72 C for 5 s (extension). To
verify their specificity, all amplicons are subjected to meltingcurve analysis (7585 C at 0.1 C/s) (see Note 10).
4. Test-positive samples are identified on the basis of a single melt
peak, which is consistent with that of the homologous control
for each PCR (see Note 11). The specificity of the amplicons
can also be verified by selective sequencing, employing an
established approach [11] (see Note 12).
Notes
1. It is critical to use a salt solution of this specific gravity to
achieve maximum flotation of nematode eggs.
2. We use the Rotor-Gene 3000 thermal cycler (Qiagen, USA)
and the respective software.
150
3. We use the Sensimix dT Mastermix (Bioline, UK).

4. SYTO9 is light sensitive, and exposure to light must be minimized. It is supplied in 100 l volumes and can be made up to
a stock solution (1 ml) by mixing 19 l of dye with 981 l of
molecular grade water. From this stock solution, use 2 l in a
25 l PCR reaction to achieve a final dye concentration of
8 M. Repeated thawing of the stock solution and exposure to
light can result in reduced signal in real-time PCR assays and
should therefore be kept to a minimum.
5. Fill sampling jar or bag as much as possible and seal airtight to
provide oxygen-poor environment (to delay development and
hatching of eggs). Store samples refrigerated (4 C) and send
for diagnosis within 1 day [12]. Development and hatching of
eggs may have impact on the quantification of nematode eggs
and should therefore be reduced.
6. If feces are dry, add 0.5 ml of water to facilitate homogenization. Thorough homogenization of fecal matter is essential to
release the nematode eggs from the fecal mass and helps to
disperse the eggs evenly throughout the sample.
7. If a spatula is used for homogenization, clean with bleach solution (3 %) [13] to avoid possible transfer of eggs from sample
to sample.
8. If the supernatant contains a significant amount of debris (e.g.,
fecal and plant), sieve through one layer of surgical gauze.
9. To prepare a standard curve for quantification in real-time
PCR, the concentration of the reference DNA sample has to
be determined spectrophotometrically. Typically, a DNA concentration of 25100 ng/l can be expected from a single
nematode. From this stock solution, take a specific volume
(e.g., 4 l) and mix into molecular grade water (e.g., 96 l) to
prepare a dilution of 1 ng/l. This solution can be further
diluted in tenfold dilution steps (using 10 l of the previous
dilution and mixing it into 90 l of water) to obtain reference
controls of 1 ng, 100 pg, 10 pg and 1 pg. Instead of using
parasite DNA as reference controls, target sequences can be
cloned into a plasmid vector (pGEM-T-Easy, Promega, USA)
and then grown in Escherichia coli, according to the manufacturers protocol. In brief, 8 l of purified amplicon containing
the insert sequence are ligated into the vector and incubated at
4 C overnight. The ligation product is mixed with competent
E. coli and cultured on Luria Bertani agar plates at 37 C for
1216 h. Screening and selection can be performed by PCR
using primers specific to the cloned insert. Successfully transformed colonies can be further grown in a liquid broth and
preserved frozen as 30 % glycerol stocks. The cloned DNA
inserts can be serial titrated with molecular grade water, to
determine the dilution or concentration of template required
151
to achieve the same or a similar amplification characteristic and

standard curves as for genomic DNA reference samples.
10. We use Rotor-Gene v.1.7.87 software, and apply the normalization option and a confidence threshold of 96 %.
11. Any suspected inhibition in PCR, likely linked to fecal components (e.g., humic acids, phenolic compounds and/or polysaccharides) can be assessed. In brief, aliquots (2 l) of samples
that are test negative by PCR but shown to contain strongylid
eggs by coproscopic examination are spiked with a limiting
amount (1 pg) of genomic DNA from H. contortus or an alternative strongylid nematode. The amplification from spiked
sample aliquots is compared directly (in the same experiment)
with that from 1 pg of H. contortus DNA alone and a sample
without DNA (no-template control).
12. Based on the findings from previous studies [9, 10], this PCR
assay can replace inaccurate and time-consuming classical diagnostic procedures. This assay achieves specific or generic diagnosis and takes less than 1 day to perform, compared with at
least 1 week for larval culture, thus significantly reducing delays
and response times for the treatment or control of clinical cases
of parasitic disease. The assay has high diagnostic performance
(i.e., sensitivity and specificity) [9, 10] and has broad applicability, in that it can be used to conduct large-scale epidemiological studies, to support the diagnosis of drug resistance and
will be applicable or adaptable to other parasites and/or hosts.
This PCR tool has the potential to replace the conventional
technique of larval culture and can be extended to include the
testing of other parasites or pathogens, depending on where
the assay is to be deployed. Current evidence [14] shows that
this assay is adaptable to an automated PCR platform (EasyPlex, AusDiagnostics Pty. Ltd.), allowing the development of a
range of next-generation diagnostic tools to underpin the control of socioeconomically important infectious diseases of animals. The routine application of such automated diagnostic
platforms for pathogens of veterinary importance provides
major scope for better disease surveillance, detailed epidemiological or ecological studies, and shorter response times to
tackle and control disease outbreaks.
Acknowledgments
This research was supported through funds from the Australian
Research Council (RBG and ARJ). Other support from Melbourne
Water Corporation, the National Health and Medical Research
Council, and the Alexander von Humboldt Foundation is gratefully acknowledged (RBG). FR was the recipient of scholarships
from the University of Melbourne.
152
References
1. Perry BD, Randolph TF (1999) Improving
the assessment of the economic impact of parasitic diseases and of their control in production
animals. Vet Parasitol 84:145168
2. Sackett D, Holmes P (2006) Assessing the
economic cost of endemic disease on the
profitability of Australian beef cattle and
sheep producers. Meat and Livestock
Australia, Report No. ISBN: 1741910021,
Sydney, Australia
3. Hoste H, Torres-Acosta JF (2011) Non chemical control of helminths in ruminants: adapting solutions for changing worms in a changing
world. Vet Parasitol 180:144154
4. Wolstenholme AJ, Fairweather I, Prichard R,
Samson-Himmelstjerna GV, Sangster NC
(2004) Drug resistance in veterinary helminths. Trends Parasitol 20:469476
5. Kaplan RM (2004) Drug resistance in nematodes of veterinary importance: a status report.
Trends Parasitol 20:477481
6. Gasser RB, Bott NJ, Chilton NB, Hunt P,
Beveridge I (2008) Towards practical, DNAbased diagnostic methods for parasitic nematodes of livestock-bionomic and biotechnological implications. Biotechnol Adv
26:325334
7. Roeber F, Jex AR, Gasser RB (2013) Nextgeneration molecular-diagnostic tools for gastrointestinal nematodes of livestock, with
emphasis on small ruminants: a turning point?
Adv Parasitol 83:267333
8. Bott NJ, Campbell BE, Beveridge I, Chilton
NB, Rees D, Hunt PW et al (2009) A combined
9.
10.
11.
12.
13.
14.
microscopic-molecular method for the diagnosis of strongylid infections in sheep. Int J

Parasitol 39:12771287
Roeber F, Jex AR, Campbell AJD, Campbell
BE, Anderson GA, Gasser RB (2011) Evaluation
and application of a molecular method to assess
the composition of strongylid nematode populations in sheep with naturally acquired infections. Infect Genet Evol 11:849854
Roeber F, Larsen JWA, Anderson N, Campbell
AJD, Anderson GA, Gasser RB et al (2012) A
molecular diagnostic tool to replace larval culture in conventional faecal egg count reduction testing in sheep. PLoS One 7:e37327
Gasser RB, Hu M, Chilton N, Campbell BE,
Jex AR, Otranto D et al (2006) Single-strand
conformation polymorphism (SSCP) for the
analysis of genetic variation. Nat Protoc 1:
31213128
Taylor MA, Coop RL, Wall RL (2007) The
laboratory diagnosis of parasitism. Chapter 15.
In: Taylor MA, Coop RL, Wall RL (eds)
Veterinary parasitology, 3rd edn. Blackwell,
Oxford, UK, p 798
Kemp B, Smith D (2005) Use of bleach to
eliminate contaminating DNA from the surface of bones and teeth. Forensic Sci Int
154:5361
Roeber F, Jex AR, Campbell AJ, Nielsen R,
Anderson GA, Stanley KK et al (2012)
Establishment of a robotic, high-throughput
platform for the specific diagnosis of gastrointestinal nematode infections in sheep. Int J
Chapter 11
Improved Detection of Mycobacterium bovis in Bovine
Tissues Using Immunomagnetic Separation Approaches
Abstract
Immunomagnetic separation (IMS) represents a simple but effective method of selectively capturing and
concentrating Mycobacterium bovis, the causative agent of bovine tuberculosis (bTB), from tissue samples.
It is a physical cell separation technique that does not impact cell viability, unlike traditional chemical
decontamination prior to culture. IMS is performed with paramagnetic beads coated with M. bovis-specific
antibody and peptide binders. Once captured by IMS, M. bovis cells can be detected by either PCR or
cultural detection methods. Increased detection rates of M. bovis, particularly from non-visibly lesioned
lymph node tissues from bTB reactor animals, have recently been reported when IMS-based methods were
employed.
Key words Mycobacterium bovis, Lymph node tissue, Immunomagnetic separation (IMS), Isolation,
Detection, IMS-PCR, IMS-culture
Introduction
Bovine tuberculosis (bTB), caused by Mycobacterium bovis, continues to be a significant animal health issue in many countries of the
world [1]. The single intradermal comparative cervical tuberculin
(SICCT) test, more commonly known as the tuberculin skin test,
is used in many countries to identify bTB reactor animals, which
are then compulsorily slaughtered. At the time of slaughter, meat
inspectors look for visible lesions typical of bTB in the lymph nodes
of the head and chest and in the lungs of these animals and excise
tissue samples to be sent to the bTB testing laboratory to allow confirmation of M. bovis infection status. Tissues are also taken from
bTB reactor animals displaying no visible lesions (NVL). Currently,
confirmation of diagnosis of bTB is reliant on successful isolation of
M. bovis by culture, but this approach can be problematic for a variety of reasons. There may be small numbers of mycobacteria present
in the selected tissues, at or below the detection limit of culture, so
153
154
false-negative culture results may be obtained. Chemical decontamination of the tissues (typically with oxalic acid) prior to culture on
solid and liquid media is known to significantly reduce the viability
of M. bovis in vitro [2], which may also lead to false-negative culture
results. The time to confirm the presence or absence of M. bovis in
clinical samples by culture can be up to 8 weeks, and any delay in
confirmation, as well as false-negative culture results for NVL tissues, has consequences for disease control programs [3].
Immunomagnetic separation (IMS) is a sample preparation
technique that aids the selective separation and concentration of
target bacterial cells from complex food and veterinary sample
matrices such as milk, feces, blood, and tissues [4]. It effectively
selects the desired bacterium out of the sample background microflora and sample components by use of microscopic paramagnetic
beads coated with antibodies (or other appropriate binders) specific for the bacterium of interest. Numbers of target bacterial cells
may also be concentrated from the test sample by resuspending
beads in a smaller volume after IMS. IMS has a longer history of
being employed for food testing [5] than in the veterinary diagnostic laboratory context, but it is becoming more widely used for
veterinary testing. Several IMS methods for M. bovis have been
published in recent years [69]. However, Stewart et al. [9]
attempted to optimize the IMS method by evaluating a range of
novel M. bovis binders (polyclonal and monoclonal antibodies, as
well as phage display-derived 12-mer M. bovis-specific peptide
binders) they had produced, in order to identify the best beadbinder combination to achieve maximal M. bovis cell capture
(Fig. 1). Dynabeads MyOne Tosylactivated dually coated with a
Fig. 1 Mycobacterium bovis cells captured by monoclonal antibody and biotinylated 12-mer peptide-coated Dynabeads MyOne Tosylactivateda large clump
of M. bovis cells and an individual cell are clearly seen attached to the beads. Bead
suspension after IMS was stained by auramine O fluorescent acid-fast stain
Immunomagnetic Separation of Mycobacterium bovis
155
monoclonal IgM antibody and a biotinylated 12-mer peptide was

found to perform best [9]. The optimized M. bovis IMS protocol
was subsequently used to test a large number of bovine lymph
node tissues from bTB reactor animals demonstrating either visible
lesions (VL) or non-visible lesions (NVL), and M. bovis cells captured on the magnetic beads were subsequently detected by touchdown PCR targeting IS6110 and MGIT liquid culture [10].
Results of this survey indicated that the IMS-based approaches
confirmed M. bovis infection in more lymph node samples, particularly in NVL tissues from bTB skin test reactor animals, than the
existing oxalic acid decontamination and solid and liquid culture
approach. Here, the optimized IMS approaches for isolation and
detection of M. bovis in bovine tissues will be described.
Materials
1. Purified mouse anti-Mycobacterium bovis IgM monoclonal
antibody (11G3) (see Note 1).
2. N-terminally biotinylated 12-mer peptide (EEA302) with
amino acid sequence NFRVSIDVVKSR (10 mg/ml in sterile
distilled water), custom synthesized by any peptide synthesis
company.
3. Dynabeads MyOne Tosylactivated (Life Technologies):
bead diameter 1.08 m, bead concentration 100 mg beads/
ml (approx. 1012 beads/g), surface area 8 m2/g (see Note 2).
4. Coating buffer: 0.1 M sodium borate buffer pH 9.5, prepared
by dissolving 6.183 g H3BO3 (MW 61.83) in 800 ml distilled
water, adjusting pH to 9.5 using 5 M NaOH and then adjusting volume to 1,000 ml with distilled water.
5. 3 M ammonium sulfate: prepared in coating buffer by dissolving 39.6 g (NH4)2SO4 (MW 132.1) in 0.1 M sodium borate
(pH 9.5), adjusting pH (if necessary) and then adjusting volume to 100 ml.
6. Phosphate buffered saline pH 7.4 (PBS): 0.01 M phosphate
buffered saline composed of 0.138 M sodium chloride and
0.0027 M potassium chloride, pH adjusted to 7.4.
7. Washing and storage buffer for beads (PBS/BSA/T20): phosphate buffered saline pH 7.4 (PBS) with 0.1 % (w/v) bovine
serum albumin and 0.05 % (w/v) Tween 20 added.
8. Wash buffer for IMS (PBS/T20): phosphate buffered saline
pH 7.4 (PBS) with 0.05 % (w/v) Tween 20 added.
9. Tris-EDTA buffer (pH 8.0): 10 mM TrisHCl and 1 mM
disodium EDTA, pH adjusted to 8.0.
10. Reagents for conventional PCR reactions (for post-IMS detection of M. bovis by PCR): DNA polymerase enzyme and
156
respective 10 buffer, primers INS1 (5-cgt gag ggc atc gag

gtg gc-3) and INS2 (5-gcg tag gcg tcg gtg aca aa-3) [11],
MgCl2 (25 mM), dNTPs (25 mM), and distilled PCR-grade
water. In this protocol, a PCR SuperMix is employed for PCR
reactions (Platinum Blue PCR SuperMix, Life Technologies).
11. BBL MGIT culture tubes for M. bovis previously supplemented with BBL MGIT OADC and BBL MGIT
PANTA supplements (Becton Dickinson) (for post-IMS
detection of M. bovis by culture).
12. Equipment and other supplies: centrifuge; magnetic rack;
Stuart rotator mixer (or similar); Dynal BeadRetriever and
respective tube and tip strips (Life Technologies) (not necessary if using the manual IMS procedure); thermal cycler, electrophoresis apparatus, and UV transilluminator (for post-IMS
detection of M. bovis by PCR); MGIT 960 instrument (Becton
Dickinson) (for post-IMS detection of M. bovis by culture);
sterile mortar, sterile sand, and pestle.
Methods
3.1 Coating
Dynabeads MyOne
Tosylactivated
with Phage DisplayDerived Peptide
and Monoclonal IgM
Antibody
This coating procedure is essentially as described in the pack insert

accompanying Dynabeads MyOne Tosylactivated (see Note 2).
1. Transfer 250 l of uncoated Dynabeads
Tosylactivated to a sterile microcentrifuge tube.
MyOne
2. Wash beads twice with 1 ml of coating buffer, separating on a

magnetic rack for 2 min between washes.
3. Resuspend beads in 100 l of coating buffer and vortex
thoroughly.
4. Premix 50 l of N-terminally biotinylated 12-mer peptide and
50 l of purified mouse anti-M. bovis monoclonal IgM antibody (see Notes 1 and 3); add to activated beads and mix by
vortexing.
5. Add a further 735 l of coating buffer and mix again by
vortexing.
6. Add 415 l of 3 M ammonium sulfate and mix by vortexing.
7. Incubate overnight at 37 C with end-to-end mixing on a
Stuart rotator mixer (or similar) at 10 rpm.
8. Wash freshly coated beads twice with 1 ml of washing buffer,
separating on a magnetic rack for 2 min between washes.
9. Resuspend coated beads in 500 l storage buffer, which is
twice the original volume of uncoated beads used. This final
volume is sufficient for 50 IMS reactions when 10 l of coated
beads are used per 1 ml test sample.
157
10. The Dynabeads MyOne Tosylactivated are now coated and

ready for use. They should be stored at 28 C until required
(see Note 4).
3.2 Lymph Node

Preparation for IMS
For health and safety reasons all procedures involving bovine tissues containing, or potentially containing, M. bovis must be carried
out in a class 1 biological safety cabinet located in a containment
level 3 laboratory facility.
1. Transfer approx. 3 g of cubed lymph node material to a sterile
mortar, add sterile sand, and grind thoroughly with pestle.
2. Add 4.5 ml of sterile phosphate buffered saline pH 7.4 (PBS)
and grind further (=1:1.5 dilution).
3. Transfer sample to centrifuge tube and centrifuge at 300 g for
3 min to sediment sand and tissue particulates.
4. Make a 1:10 dilution of clarified lymph node tissue supernatant in sterile PBS (see Note 5) and use 1 ml of this dilution
(=1:15 dilution of original lymph node sample) for immunomagnetic separation (IMS).
3.3 Immunomagnetic Separation

3.3.1 Automated
Immunomagnetic
Separation (IMS) Using
Dynal BeadRetriever
1. Add 10 l of dually coated (Mab 11G3 and biotinylated peptide EEA302) Dynabeads MyOne Tosylactivated to first
well of BeadRetriever tube strip, 1 ml of PBS/T20 buffer in
the next 2 wells, and an appropriate volume of buffer, depending on subsequent endpoint detection method (PCR or culture; see later), to 4th well.
2. Transfer 1 ml of the 1:10 dilution of the clarified lymph node
tissue supernatant to the 1st well of the BeadRetriever tube
strips. Fifteen samples can be processed at the same time.
3. Transfer tube rack containing samples to BeadRetriever
machine.
4. Pre-wet BeadRetriever tip strips (magnet covers) by dipping
each tip briefly in PBS/T20 and slide into place in
BeadRetriever machine (see Note 6).
5. Perform automated IMS using environmental program.
This preloaded IMS program consists of a 35-min incubation
period in well 1 of the bead retriever strip with mixing at a
medium speed throughout. The beads are then captured and
transferred to well 2 and washed for 1 min at a medium speed.
During the next stage, the beads are transferred to well 3 and
washed again for 1 min at medium speed. Finally, the beads are
transferred to well 4 (see Note 7) where they are released using
a 10-s high-speed mix into an appropriate buffer, depending
on which endpoint detection method is going to be applied
(see below).
158
3.3.2 Manual IMS Using

Magnetic Rack
In the absence of a Dynal BeadRetriever, IMS may be performed

manually (see Note 8) using 1.5 ml microcentrifuge tubes and a
suitable magnetic rack (see Note 9).
1. Distribute 10 l of dually coated (Mab 11G3 and biotinylated
peptide EEA302) Dynabeads MyOne Tosylactivated into
sufficient sterile microcentrifuge tubes for the number of samples to be tested (see Note 10).
2. Dispense 1 ml of 1:10 dilution of clarified lymph node tissue
supernatant into tubes containing beads, vortex briefly, and
then place on Stuart rotator mixer (or similar rotating mixer)
at room temperature for 30 min at 10 rpm.
3. Transfer tubes to a suitable magnetic rack and separate beads
for 10 min before removing supernatants carefully with
pastettes and discarding into suitable disinfectant. Keep magnet in place throughout and be careful to avoid loss of beads
with sample (see Note 11).
4. Dispense 1 ml PBS/T20 into each tube, remove magnet from
rack, and shake samples thoroughly.
5. Replace magnet for 2 min to capture beads then remove and
discard spent PBS/T20.
6. Repeat steps 4 and 5 again (=second wash step).
7. Resuspend beads in a buffer appropriate for subsequent detection by PCR or culture (see below).
3.4 M. bovis
Detection Options
Post-IMS
3.4.1 Touchdown IS6110
PCR (See Note 12)
1. Resuspend beads after IMS in 100 l Tris-EDTA buffer

(pH 8.0), transfer bead suspension from well 4 of tube strip to
screw-capped microcentrifuge tube, and boil for 25 min at
100 C in a water bath to inactivate bound M. bovis cells and
release DNA. Centrifuge tubes briefly to sediment cell debris
and beads and use supernatant as template DNA.
2. Each PCR reaction consists of 45 l Platinum Blue PCR
SuperMix (see Note 13) plus 1 M of primers INS1 and INS2
[11], 2 mM MgCl2, and 5 l of template DNA.
3. Perform touchdown PCR amplification on a thermal cycler
with an initial denaturation step of 96 C for 3 min, followed
by 8 cycles of denaturation at 96 C for 1 min, annealing temperatures starting at 72 C for 1 min (decreasing by 1 C/
cycle), and 72 C for 1 min for extension. This step is followed
by 30 cycles of 96 C for 1 min, 65 C for 1 min, 72 C for
2 min, and a final extension at 72 C for 8 min before holding
at 4 C.
4. Visualize PCR products using 2 % agarose gel electrophoresis
and ethidium bromide staining.

3.4.2 MGIT
(Mycobacteria Growth
Indicator Tube) Culture
159
1. Resuspend beads after IMS in 100300 l (see Note 14) of

PBS and inoculate into a BBL MGIT tube previously supplemented with BBL MGIT OADC and BBL MGIT
PANTA as per usual practice for M. bovis culture.
2. Incubate MGIT culture tubes in MGIT 960 instrument for
up to 8 weeks at 37 C.
3. Examine any IMS-MGIT culture that indicates growth positive on the MGIT system throughout the incubation period
for the presence of acid-fast bacteria typical of M. bovis by ZiehlNeelsen (ZN) staining. A subsample of each acid-fast positive
IMS-MGIT culture should be sent for genotyping (by spoligotyping) after boiling in a screw-capped microcentrifuge tube
for 25 min at 100 C in a water bath (to render samples safe to
be taken out of containment level 3 laboratory).
4. At the end of the 8-week incubation period, a subsample
(100 l) of all IMS-MGIT cultures that have not indicated
growth positive on the MGIT 960 system, or have indicated
growth positive but tested ZN negative (see Note 15), is transferred to screw-capped microcentrifuge tubes and boiled for
25 min at 100 C in a water bath (to render samples safe to be
taken out of containment level 3 laboratory) and then subjected to touchdown IS6110 PCR (as described above) in
order to detect the presence of low numbers of viable M. bovis
which may not have reached detection threshold of either
MGIT system or ZN staining.
Notes
1. The monoclonal antibody (11G3) was jointly produced by
Queens University Belfast and the Agri-Food and Biosciences
Institute for Northern Ireland [9]. Other anti-M. bovis polyclonal or monoclonal antibodies may be available commercially
or may have been generated in-house by other research groups.
Any such antibody could potentially be used to coat Dynabeads
MyOne Tosylactivated for IMS purposes; however, there is
no guarantee that capture of M. bovis will be as good as when
monoclonal antibody 11G3 is used in conjunction with the
12-mer peptide. An experiment to assess the detection sensitivity of such coated beads should be carried out, as described by
Stewart et al. [9], to verify good M. bovis capture capability
before adoption of an alternative IMS protocol.
2. Other types and sizes of surface-activated magnetic beads are
commercially available. If a different type of bead is employed,
then the bead coating protocol may differ, so follow the manufacturers instructions accordingly.
160
3. This combination of M. bovis binders with Dynabeads

MyOne Tosylactivated was empirically shown to be the best
bead-binder combination for maximal capture of M. bovis from
buffer and animal tissue homogenates [9].
4. If the coated beads are not used within 23 weeks, it is recommended to refresh the storage buffer by separating beads on
magnetic rack, removing spent storage buffer, and adding
freshly prepared storage buffer.
5. This 1:10 dilution of the clarified lymph node supernatant
proved necessary to permit beads to associate freely with M.
bovis cells within the tissue sample during capture phase of IMS.
6. This is an important step because if not pre-wetted, the beads
tend to stick to the plastic tips which may reduce the number
of beads recoverable.
7. Automated IMS achieves greater cleanup of beads because
beads move from well to well, leaving original sample behind
in well 1.
8. Manual IMS achieves capture of target bacterium but, as beads
stay in same tube throughout all steps in the process, the same
degree of cleanup of beads is not achieved as when automated
BeadRetriever protocol is used.
9. Larger sample volumes (1050 ml) could be tested if magnetic
racks for 10 ml or 50 ml tubes are available; however, in our
experience larger sample volumes and racks are more difficult
to work with. Beads tend not to be held as securely at the magnet interface when using the larger volume racks, so there is
more risk of losing them and hence bound M. bovis cells during
the washing steps.
10. Vortex and coated beads thoroughly immediately before use to
ensure uniform dispersal and equal numbers of beads added
per test sample.
11. The beads may visibly slide down back of tube and could easily
be aspirated (and any bound M. bovis lost) when initial removal
of sample takes place, so care must be exercised at this point.
However, as washing steps proceed, the beads will be observed
to be more tightly held by the magnet.
12. A published touchdown PCR specific for M. tuberculosis complex [11] was employed by Stewart et al. [10]. However, any
M. bovis-specific PCR method, such as Taylor et al. [12], could
potentially substitute the touchdown PCR described here.
13. A PCR SuperMix was used because, when so many samples
were being processed, we found it easier and quicker than
pipetting out each component of the PCR reaction.
14. Volume of buffer to resuspend beads in will be dictated by
whether only a MGIT tube is being inoculated or a MGIT
161
tube plus two slopes of a solid culture medium. Remember,

only if you resuspend beads in a smaller volume after IMS will
concentration of the M. bovis cells from the original sample be
achieved (e.g., 1 ml of sample volume subjected to IMS and
beads resuspended in 100 l of buffer or broth = 10 concentration of M. bovis numbers).
15. Stewart et al. study [10] demonstrated that if only ZN staining
is relied upon to confirm presence of M. bovis in MGIT cultures, then some samples containing low numbers of viable M.
bovis will be missed (false-negative culture result). Hence, we
advocate that all MGIT cultures should undergo final PCR
check before disposal. There was also some suspicion that the
presence of the beads may have interfered with the MGIT
960 detection system, although this is not proven currently.
Acknowledgement
This work was supported by a grant from the UK Department of
Environment, Food and Rural Affairs (Project SE3262).
References
1. Office International des Epizooties (2011)
Chapter 2.4.7. Bovine tuberculosis. Manual of
diagnostic tests and vaccines for terrestrial animals 2009. https://www.oie.int/fileadmin/
Home/eng/Health_standards/tahm/2.04.07_
BOVINE_TB.pdf. Accessed 15 Aug 2013
2. Corner LA, Trajstman AC, Lund K (1995)
Determination of the optimum concentration
of decontaminants for the primary isolation of
Mycobacterium bovis. N Z Vet J 43:129133
3. de la Rua-Domenech R, Goodchild T,
Vordermeier M et al (2006) Ante mortem
diagnosis of Bovine Tuberculosis: the significance of unconfirmed test reactors. Gov Vet J
16:6571
4. Stevens KA, Jaykus LA (2004) Bacterial separation and concentration from complex sample
matrices: a review. Crit Rev Microbiol 30:724
5. Benoit PW, Donahue DW (2003) Methods for
rapid separation and concentration of bacteria
in food that bypass time-consuming cultural
enrichment. J Food Prot 66:19351948
6. Sweeney FP, Courtenay O, Ul-Hassan A et al
(2006)
Immunomagnetic
recovery
of
Mycobacterium bovis from naturally infected environmental samples. Lett Appl Microbiol 2:460462
7. Sweeney FP, Courtenay O, Hibberd V et al (2007)
Environmental monitoring of Mycobacterium
8.
9.
10.
11.
12.
bovis in badger feces and badger sett soil by

real-time PCR, as confirmed by immunofluorescence, immunocapture, and cultivation. Appl
Environ Microbiol 73:74717473
Garbaccio SG, Cataldi AA (2010) Evaluation
of an immunomagnetic capture method followed by PCR to detect Mycobacterium bovis in
tissue samples from cattle. Rev Argent
Microbiol 42:247253
Stewart LD, McNair J, McCallan L et al (2012)
Production and evaluation of antibodies and
phage-display derived peptide ligands for
immunomagnetic separation of Mycobacterium
bovis. J Clin Microbiol 50:15981605
Stewart LD, McNair J, McCallan L et al (2013)
Improved detection of Mycobacterium bovis
infection in bovine lymph node tissue using
immunomagnetic separation (IMS)-based
methods. PLoS One 8:e58374
Zumrraga MJ, Meikle V, Bernardelli A et al
(2005) Use of touch-down polymerase chain
reaction to enhance the sensitivity of
Mycobacterium bovis detection. J Vet Diagn
Invest 17:232238
Taylor GM, Worth DR, Palmer S et al (2007)
Rapid detection of Mycobacterium bovis DNA
in cattle lymph nodes with visible lesions using
PCR. BMC Vet Res 3:12
Chapter 12
Detection of Fish Pathogens by Loop-Mediated Isothermal
Amplification (LAMP) Technique
Hatem Soliman, Mona Saleh, and Mansour El-Matbouli
Abstract
Rapid detection of fish pathogens is mandatory for applying the crucial preventive and control measures to
reduce fish losses and, consequently, minimize the economic impact of diseases on the fish farm owners. The
currently used molecular diagnostic tools of fish infectious agents, such as PCR and RT-PCR, are sensitive
and specific but still have some drawbacks. These tools are usually time consuming and laborious, need
skilled persons, and require sophisticated devices to be performed. Therefore, next-generation tools for
rapid diagnosis of fish infectious diseases were developed to conquer these shortages. One of these novel
tools is the loop-mediated isothermal amplification (LAMP) technique. LAMP is considered a more advantageous tool than PCR because it needs only a heating block or a thermostatically controlled water bath as
a source of constant temperature. It is considered to be more specific than the PCR assay as it uses 46
primers, which may diminish the occurrence of false-positive results. The time required for the amplification
process by LAMP is ranging from 30 min to 1 h comparing to 35 h in the case of PCR. The visual detection methods coupled with the LAMP assay eliminates the post-run processing for detection of the amplification products. Its sensitivity is either comparable with the PCR or better than it. A variety of LAMP
assays were developed for simple and rapid detection of a diversity of fish pathogens. Herein, we describe
how to perform a LAMP assay and troubleshoot any potential problem arising during the process.
Key words Diagnosis of fish infectious diseases, Bst polymerase enzyme, Visual detection, Lateral flow
strips, Loop primers, SYBR Green I stain, Fluorescent detection reagent (FDR), FITC-labeled DNA
probe, Biotin-labeled primer
Introduction
In the past centuries, diagnosis of fish infectious diseases was conventional and based on clinical signs, postmortem examination,
and isolation of the etiological agents, followed by phenotypic and
serological confirmation or histopathological investigations [1, 2].
However, these techniques have some drawbacks, such as lack of
specificity and inadequate sensitivity to detect pathogens present in
low numbers or in the absence of the disease clinical signs [3].
Therefore, a new generation of diagnostic techniques was in
163
164
Hatem Soliman et al.
request. By discovery of nucleic acid amplification technologies,

diagnosis of infectious diseases became more specific, rapid, and
sensitive [4]. These techniques, as leading methods in detecting
small quantities of nucleic acids, improved the detection of various
kinds of pathogens [5]. Molecular research has demonstrated not
only the ability to identify pathogenic species but also to identify
particularly virulent strains [6]. The most extensively used tool for
nucleic acid amplification of infectious agents is the polymerase
chain reaction (PCR) [7]. However, PCR-based methods have
some drawbacks, such as the need of thermal cycling sophisticated
instruments for the amplification process, they are relatively time
consuming, and usually request complicated post-run analysis for
the detection of the amplified products [8]. A next-generation
nucleic acids amplification technique was recently developed to
overcome the PCR disadvantages and to offer an isothermal assay
for the detection of infectious agents [9]. Loop-mediated isothermal amplification (LAMP) was developed as a simple, rapid technique for efficient amplification of nucleic acids using a heating
block or a thermostatically controlled water bath, to provide a constant temperature, with high specificity and sensitivity [10]. LAMP
is based on auto-cycling strand displacement activity of the Bst
DNA polymerase large fragment for DNA synthesis [10, 11]. The
assay is carried out at a constant temperature between 60 and
65 C, usually within 1 h. Four specially constructed primers are
necessary to perform LAMP assays [10]. The use of these primers
improves the specificity of the assay as it recognizes six distinct
regions on the target DNA [10]. By the use of one or two additional primers (loop primers), not only the duration of the assay
will be reduced but also the specificity of the assay will be increased;
as in this case the six primer sets will recognize eight different
sequences on the target DNA, which may aid in the elimination of
any false-positive results [12]. A valuable advantage of LAMP is
the possibility of amplification of RNA templates through reversetranscription loop-mediated isothermal amplification (RT-LAMP).
In addition to the LAMP reagent mixture, a reverse transcriptase
enzyme will be used under the same temperature and within the
same time range [13]. The sensitivity of the LAMP assay is either
comparable to that of PCR or sometimes is superior to it [14].
More recently, LAMP technology has been developed into commercial kits for detection of a variety of pathogens [15]. Detection
of infectious agents with LAMP comprises three steps: sample
preparation, amplification and detection of the amplified products.
While the amplification step is already optimized to be carried out
in 30 min to 1 h, still the sample preparation and detection steps
may be time consuming. We tried to simplify the sample preparation step and reduce its processing time by using immunocapture
and direct binding approaches to replace the DNA extraction
procedures [16]. These new techniques reduced not only the
LAMP as a Diagnostic Technique of Fish Pathogens
165
processing time to 1530 min but also the cost of the sample preparation step as there is no need for nucleic acid extraction kits.
LAMP yields a large amount of DNA and a pyrophosphate byproduct, which enabled the development of simple visual detection
methods of the amplicons without costly specialized equipments
[17]. In addition to SYBR Green I, fluorescent detection reagent,
and cationic polymers, nucleic acid lateral flow assays have been
used for the visual detection of the LAMP products [14, 18].
LAMP and RT-LAMP have thus been used successfully for the
detection of a variety of fish pathogens. Herein, we describe how
can LAMP and RT-LAMP assays be performed correctly in order
to help the veterinarians to reach a rapid and accurate field diagnosis with reduced costs.
2
2.1
Materials
Primers
1. LAMP uses a mixture of 46 primers, depending on the use of

one or two additional loop primers (see Note 1). The primer
designations are usually outer forward primer (F3), outer backward primer (B3), forward inner primer (FIP), backward inner
primer (BIP), forward loop primer (FLP), and backward loop
primer (BLP). See Table 1 for examples of LAMP primer sets
that we have recently described for the detection of viral hemorrhagic septicemia virus (VHS), of infectious pancreatic necrosis virus (IPNV), and of Cyprinid herpesvirus-3 (CyHV-3).
2. Primers stock solutions: primers are ordered and come from
the synthesis company with a specification sheet that usually
contains all the information required to rehydrate the primers.
For each of the LAMP primers, add the recommended amount
of PCR-grade water and mix it well to get a primer stock solution of 100 pmol/l. Prepare several aliquots from these stocks
to avoid degradation by repeated freezing and thawing, and
keep it at 20 C until used.
3. Primers working solutions: the working concentrations of
LAMP primers solutions may be as following10 pmol/l of
F3 and B3; 80 pmol/l of FIP and BIP; and 40 pmol/l of
FLP and BLP. Prepare 100 l of each LAMP primer working
solution as indicated below.
Primers F3 and B3: mix 10 l from the correspondent
100 pmol/l primer stock solution with 90 l of
PCR-grade water.
Primers FIP and BIP: mix 80 l from the correspondent
PCR-grade water.
Primers FLP and BLP: mix 40 l from the correspondent
PCR-grade water.
166
Table 1
Sequences of LAMP primers targeting relevant viral fish pathogens
Target virus
Primer sequences (53)
References
VHSa
F3GGS AAG CAA GGA YCA CGA G
[13]
B3CAG GTG TCC YTC TAG TGT TTC

FIPGAT CCA CCG ATA CTG TTT TTG GGG TTT TCC CGT TCT
TCC CTG AAC CC
BIPARG GGG TYT GCA CAR CCT CGC TTT TCG ACK YGG
GRC AAK GGG C
FLPGTT ATG TCC TTA TGG ACA TTG
BLPGTC AAA CTC ATT GGC AGG G
IPNVb
F3CCA ATC TGC GGT GTA GAC AT
[14]
B3CAT CAG CTC TCC CAG GTA CT

FIPCCT CCT CGT CCA CTC CTG GTT TTT CCA TCG CAG
CCC ATG AAC
BIPTGC GAA ACA CAT CCC TGG CCT TTT TCT TGT TGG AGC
CCT TTG C
FLPCGA TGA GTG GCA GCC CTT
BLPGAT CCA GAC CGG AAC CCT G
CyHV-3c
F3TGC AGC AGC CCT TCA AG
[16, 18]
B3GAC ACA CCG CCT GGT AAG

FIPTGC ACA CCG CCG TCA GCT CAG GTG ACG GCG TTG GT
BIPGAA GTG CAA GAT GCG CGA CGA CTC GGC GCC TCC AA
FLPGTC CAG CTT GTC CGC CAT G
BLPCAC CCT TCA CCG TCA GAA TCT C
a
Viral hemorrhagic septicemia virus

b
Infectious pancreatic necrosis virus
c
Cyprinid herpesvirus-3
Primer mix: prepare the primer mix by thorough mixing

of equal volumes from each LAMP primer working
solution in a new microcentrifuge tube, and keep it at
20 C until used (see Note 2).
2.2 Reagents
and Other Materials
for LAMP Reactions
and Direct Product
Detection
1. 10 LAMP reaction buffer: 20 mM TrisHCl, pH 8.8, 10 mM

KCl, 1.5 mM MgSO4, 10 mM (NH4)2SO4, 0.1 % Triton
X-100 (e.g., 10 Thermopol reaction buffer, New England
BioLabs, GmbH, Frankfurt, Germany).
2. 5 M betaine solution.
167
3. 100 mM dNTPs mix solution.

4. 25 mM MgSO4 (see Note 3).
5. Bst DNA polymerase, large fragment (New England BioLabs,
GmbH, Frankfurt, Germany).
6. PCR-grade water.
7. Enhanced Avian Myeloblastosis Reverse Transcriptase (eAMV)
(SigmaAldrich, GmbH, Schnelldorf, Germany).
8. SYBR Green I nucleic acid stain, 10,000 concentrate in
DMSO. To prepare the working dilution (1:10 in DMSO),
mix 1 l of SYBR Green I nucleic acid stain 10,000 concentrate with 9 l DMSO, and then make aliquots of 1 l each and
keep it at 20 C until used.
9. Fluorescent detection reagent (FDR) (Eiken Chemical Co. Ltd.,
Japan).
2.3 Detection
of LAMP Products
Using Lateral
Flow Strips
1. Lateral flow strips for nucleic acid detection (Milenia GenLine

HybriDetect, Milenia Biotec GmbH, Bad Nauheim,
Germany). It contains dipsticks and assay buffer.
2. 5 end biotin-labeled FIP primer (prepared as in Subheading 2.1).
3. 5 end FITC-labeled DNA probe (see Note 4).
Methods
LAMP reaction mixtures should be prepared on ice. After thawing,
LAMP reagents and primers should be thoroughly mixed by vortexing and then spin-down and kept on ice until used. Carefully
follow all waste disposal regulations when disposing waste
materials.
3.1 Amplification
of DNA Templates
by LAMP
1. LAMP reactions are usually carried out in a total volume of

25 l.
2. Prepare the master mix, which consists of all the reagents
needed for one sample multiplied by the number of samples to
test plus the positive and no-template controls and one additional sample to overcome eventual pipetting errors.
3. The reagents needed for one LAMP reaction are 2.5 l of 10
reaction buffer, 8 l of 5 M betaine solution, 0.7 l of 100 mM
dNTPs solution (see Note 5), 3 l of primer mix (see Note 6),
2 l of 25 mM MgSO4 solution (see Note 3), 1 l (8 units) of
Bst DNA polymerase, and 5.8 l PCR-grade water to complete
the volume to 23 l.
4. After mixing the reagents of the master mix, dispense 23 l in
each tube labeled with the sample number.
168
5. Add 2 l of sample DNA to each tube (see Note 7). In the

positive control tube, add 2 l of the relevant DNA solution,
while in the no-template control, add 2 l of PCR-grade water.
6. Incubate the reaction tubes in a water bath or heating block at
65 C for 1 h.
7. After incubation, inactivate the enzyme at 85 C for 3 min and
proceed to the products detection methods.
3.2 Amplification
of RNA Template
by RT-LAMP
1. Perform as described previously for the amplification of DNA

templates (in Subheading 3.1) with the following modifications: the reaction mixture will contain 2.5 l of 10 reaction
buffer, 8 l of 5 M betaine solution, 0.7 l of 100 mM dNTPs
solution (see Note 5), 3 l of primer mix (see Note 6), 2 l of
25 mM MgSO4 solution (see Note 3), 1 l (20 units) of eAMV
reverse transcriptase (see Note 8), 1 l (8 units) of Bst DNA
polymerase, and 4.8 l PCR-grade water to complete the volume to 23 l.
2. After dispensing 23 l of the master mix in each tube, add 2 l
of sample RNA (see Note 7). In the positive control tube, add
2 l of the relevant RNA solution, while in the no-template
control, add 2 l of PCR-grade water.
3.3 Detection
of LAMP Products
3.3.1 Using SYBR Green
I Nucleic Acid Stain
Visual inspection is the simplest and fastest method for detection

of the LAMP products. Herein, we describe the close-to-field
methods that may be used for this purpose.
1. After termination of the LAMP reaction, spin-down the reaction tubes (see Note 9).
2. Add 1 l of 1:10 diluted SYBR Green I stain to each reaction
tube, mix by pipetting, and observe the results.
3. The reaction mixture will turn green in the presence of LAMP
products while it will remain orange in their absence (Fig. 1).
4. The positive control must be green in color and the notemplate control must be orange.
3.3.2 Using Fluorescent

Detection Reagent (FDR)
1. During the preparation of the master mix, add 1 l of FDR to

the reaction mixture and reduce the amount of the PCR-grade
water to 4.8 l in the case of DNA amplification or 3.8 l in
the case of RNA amplification.
2. After completion of the LAMP reaction, expose the reaction
tubes to the UV illumination (wavelength of 254 nm).
3. Samples containing LAMP products will yield a green fluorescence while negative samples will not yield any green fluorescence (Fig. 2).
4. The positive control must yield a green fluorescence and the
no-template control will not produce any green fluorescence.
169
Fig. 1 Visual detection of LAMP products using SYBR Green I nucleic acid stain.
In tube A, the color of the reaction mixture changed to green, indicating the presence of the LAMP product (positive reaction). In tube B, the color of the reaction
mixture remained orange, indicating the absence of LAMP products (negative
reaction)
Fig. 2 Visual detection of LAMP products using fluorescent detection reagent

(FDR). In tube A, the reaction mixture is emitting a green fluorescence under UV
light (wavelength of 254 nm) indicating the presence of LAMP products (positive
reaction). In tube B, the reaction mixture is not emitting green fluorescence, indicating absence of the LAMP products (negative reaction)
170
Fig. 3 Detection of LAMP products using nucleic acid lateral flow strips. The strip
labeled as pos is the positive control showing two purple bands (positive reaction). Strips 16 correspond to positive samples, demonstrating two purple
bands at both the control and test lines. Strips 79 correspond to negative samples showing only one purple band on the control line. Strip labeled as neg is
the no-template control (Color figure online)
3.3.3 Using Lateral Flow

Dipsticks
1. Replace the unlabeled FIP primer with the biotin-labeled FIP

version in the preparation of the primer mix.
2. After finishing of the LAMP reaction, add 10 pmoles of the
FITC-labeled DNA probe to the LAMP products (see Note
10), denature at 95 C for 1 min, and then incubate at 60 C
for 5 min (see Note 11).
3. Mix 8 l of the hybridized products with 150 l of the assay
buffer in a new tube, dip the lateral flow strip into the mixture,
and observe the result.
4. Samples that produce two purple bands in the strip (see Note
12) are considered to be positive, meaning that specific LAMP
products were amplified, while negative samples produce only
one purple band, correspondent to the control line (Fig. 3).
5. The positive control must also produce two purple bands while
the no-template control must produce one band.
Notes
1. Usually, four primers (F3, B3, FIP, and BIP) must be used to
perform the LAMP assay. No LAMP products will be produced in the absence of these primers. One or two additional
loop primers (FLP and BLP) may be used, depending on the
target sequence used to construct the primers. Sometimes the
target sequence does not enable the design of any loop primer
or will enable the design of one (forward or reverse) or two
loop primers. These primers, if present, will usually accelerate
171
the amplification process and increase its specificity. LAMP

primers may be designed from target sequences using the
software program (PrimerExplorer V4, Net Laboratory,
Tokyo, Japan) from Eiken Chemical (https://primerexplorer.
jp/e/). The program generates a huge number of primer sets
(may reach 1,000 primer sets). Generated primer sets should
be selected avoiding the potential formation of primer dimers
and according to the stability of the primers ends which should
be below 4 kcal/mol.
2. The preparation of a primer mix containing all of the 46
LAMP primers in only one solution will reduce pipetting procedures and potential errors and will make the preparation of
the master mix easier.
3. MgSO4 concentration is a key factor in the LAMP assay and
must be optimized for each primer set. If the amount of MgSO4
is not optimized in the reaction mixture, no LAMP products
will be produced. As stated in the composition of the
ThermoPol reaction buffer, it contains already 1.5 mM of
MgSO4. To adjust the final MgSO4 concentration in the reaction mixture, we know that the addition of 1 l of the 25 mM
MgSO4 will increase its concentration by 1 mM, when the end
volume of the reaction mixture is 25 l. For example, for a final
MgSO4 concentration of 4.5 mM, we will have to add 3 l of
the 25 mM MgSO4 solution to the reaction mixture.
4. One of the loop primers (FLP or BLP), if present, can be used
as a probe, after labeling it with FITC at the correspondent 5
end. In this case, the selected loop primer (unlabeled) should be
omitted from the LAMP reaction mixture. This means that for
a LAMP reaction if we have 6 primers (F3, B3, FIP, BIP, FLP,
and BLP) and we select the FLP primer to be labeled at its 5
end and used it as a probe so, the primer mix will be performed
using the rest 5 primers only (F3, B3, FIP, BIP, and BLP).
5. The concentration of the dNTPs in the reaction mixture is
much higher than in standard PCR reactions and may need to
be optimized for each LAMP assay.
6. The amount of primer mix will depend on the number of primers included in the mix (see Note 1). If it contains 6 primers
(when including both loop primers), 3 l will be added to the
reaction mixture; if it contains 5 primers (with only one loop
primer), 2.5 l will be added; finally, if it contains 4 primers
(without loop primers), only 2 l of the primer mix will be
added to the reaction mixture. The amount of added PCRgrade water must be adjusted accordingly. Primers concentrations in the reaction mixture will be 0.2 M of F3 and B3,
1.6 M of FIP and BIP, and, if present, 0.8 M of FLP and/or
172
BLP. The primer concentrations in the reaction mixture may

need to be optimized for different primer sets. It is found that
increasing the concentration of the FIP and BIP, and of the loop
primers if present, may improve the sensitivity of the LAMP
assays. However, increasing the concentrations of the F3 and B3
primers should have no effect on the sensitivity since these outer
primers are only used for initiating the amplification reaction.
7. The full description of viral nucleic acid extraction procedures
from biological fish samples is out of the scope of this chapter but several in-house and commercial approaches are
available and widely described in the literature. Please also
refer to our previous published work for examples of RNA
and DNA extraction procedures from clinical fish samples
[13, 14, 16, 18].
8. eAMV reverse transcriptase is preferable as it works under high
temperatures (up to 65 C), which is the same temperature of
the LAMP reaction.
9. This procedure is needed to remove any droplets from the
inner side of the lid, to prevent any contamination when
opening the tubes.
10. The amount of added FITC-labeled DNA probe will have to
be optimized for each LAMP reaction [18]. When setting up a
new assay, the optimum amount of the probe can be determined by testing different concentrations. The hybridization
of the probe with the amplification products may also be optimized under different temperatures and incubation times. The
probe concentration that yields the highest intensity of the
purple color band on the lateral flow strip, at the selected incubation temperature and time, will be chosen as the optimum
concentration.
11. This incubation is for the hybridization between the probe and
the complementary LAMP products.
12. This type of strips contains two marked lines (control and test
lines). The control line (on top of the strip) should always yield
a purple color, since it confirms that the capillary lateral flow of
the products was correctly performed and that the strips are
not expired. The test line will yield a purple color only in the
presence of specific LAMP products. If the strip develops only
a purple band in the test line, but without the correspondent
control band, nonspecific reactions may have occurred and the
assay did not performed correctly.
173
References
1. Bernardet JF, Campbell AC, Buswell JA (1990)
Flexibacter maritimus is the agent of black
patch necrosis in Dover sole in Scotland. Dis
Aquat Org 8:233237
2. Pazos F, Santos Y, Macas AR et al (1996)
Evaluation of media for the successful culture
of Flexibacter maritimus. J Fish Dis 19:
193197
3. Ambrosia RE, De Wall DT (1990) Diagnosis
of parasitic disease. Rev Sci Tech 9:759778
4. Craw P, Balachandran W (2012) Isothermal
nucleic acid amplification technologies for
point-of-care diagnostics: a critical review. Lab
Chip 12:24692486
5. Gill P, Ghaemi A (2008) Nucleic acid isothermal
amplification technologies: a review. Nucleosides
Nucleotides Nucleic Acids 27:224243
6. Cunningham CO (2002) Molecular diagnosis
of fish and shellfish diseases: present status and
potential use in disease control. Aquaculture
206:1955
7. Walker P, Subasinghe R (2000) DNA-based
molecular diagnostic techniques: research
needs for standardization and validation of the
detection of aquatic animal pathogens and diseases. In: Report and proceedings of the joint
FAO/NACA/CSIRO/ACIAR/DFID expert
workshop, Bangkok, Thailand, 79 February
1999. FAO fisheries technical paper, no. 395.
FAO, Rome, pp 93
8. Parida M, Sannarangaiah S, Dash PK et al
(2008) Loop mediated isothermal amplification (LAMP): a new generation of innovative
gene amplification technique; perspectives in
clinical diagnosis of infectious diseases. Rev
Med Virol 18:407421
9. Tomita N, Mori Y, Kanda H et al (2008) Loopmediated isothermal amplification (LAMP) of
gene sequences and simple visual detection of
products. Nat Protoc 3:877882
10. Notomi T, Okayama H, Masubuchi H et al

(2000) Loop mediated isothermal amplification of DNA. Nucleic Acids Res 28:e63
11. Nagamine K, Watanabe K, Ohtsuka K et al
(2001) Loop-mediated isothermal amplification reaction using a nondenatured template.
Clin Chem 47:17421743
12. Nagamine K, Hase T, Notomi T (2002)
Accelerated reaction by loop mediated isothermal amplification using loop primers. Mol Cell
Probes 16:223229
13. Soliman H, El-Matbouli M (2006) Reverse
transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viral
hemorrhagic septicaemia virus (VHS). Vet
14. Soliman H, Midtlyng P, El-Matbouli M (2009)
Sensitive and rapid detection of infectious pancreatic necrosis virus by reverse transcription
loop mediated isothermal amplification. J Virol
Methods 158:7783
15. Mori Y, Notomi T (2009) Loop-mediated isothermal amplification (LAMP): a rapid, accurate,
and cost-effective diagnostic method for infectious diseases. J Infect Chemother 15:6269
16. Soliman
H,
El-Matbouli
M
(2009)
Immunocapture and direct binding loop mediated isothermal amplification simplify molecular diagnosis of Cyprinid herpesvirus-3. J Virol
Methods 162:9195
17. Mori Y, Nagamine K, Tomita N et al (2001)
Detection of loop-mediated isothermal amplification reaction by turbidity derived from
magnesium
pyrophosphate
formation.
Biochem Biophys Res Commun 289:150154
18. Soliman H, El-Matbouli M (2010) Loop mediated isothermal amplification combined with
nucleic acid lateral flow strip for diagnosis of
cyprinid herpes virus-3. Mol Cell Probes
24:3843
Chapter 13
Direct Detection of Theileria annulata in Bovine
Blood Samples Using Standard and Isothermal
DNA Amplification Approaches
Abstract
Tropical theileriosis is a tick-borne disease responsible for important health problems in cattle, caused by
the hemoprotozoan Theileria annulata. Traditionally, detection of Theileria pathogens in infected animals
requires the microscopic examination of stained-blood smears and serological methods. Molecular diagnostic
assays have been developed for the detection of Theileria parasites, including PCR-based and reverse line
blotting approaches, but these methods usually demand qualified personnel, complex instrumentation,
and expensive materials. Loop-mediated isothermal amplification (LAMP) can facilitate the design of
molecular assays independent of the use of sophisticated equipment. In this chapter we describe the application of two molecular assays for the direct detection of T. annulata in bovine blood samples, based in
real-time PCR and LAMP, both targeting the Tams1-encoding gene of this parasite.
Key words Theileria annulata, Theileriosis, Molecular diagnostics, Real-time PCR, Loop-mediated
isothermal amplification
Introduction
Tropical theileriosis is a tick-borne hemoprotozoan disease
responsible for important health problems in cattle (Bos taurus and
Bos indicus) and in Asian buffalo (Bubalus bubalis). The etiological
agent is the apicomplexan parasite Theileria annulata, which
occurs around the Mediterranean basin, Middle East, and Southern
Asia [13]. The animals that survive the acute disease become carriers of T. annulata piroplasms and play an important role as a
reservoir for the maintenance of the parasite life cycle [4].
Traditionally, detection of Theileria pathogens in infected animals
requires the microscopic examination of stained-blood smears,
which has low sensitivity and specificity. Serological methods are
also available, but cross-reactions are common, current infections
and previous exposures are not generally distinguished, and
antibodies tend to disappear in long-term animal carriers [2, 5].
175
176
Molecular diagnostic assays have been developed for the detection

of Theileria parasites, including PCR-based and reverse line
blotting approaches [1, 4, 69]. However, these molecular assays
usually demand qualified personnel, complex instrumentation, and
expensive materials. For an effective and wider use in the routine
diagnosis of animal diseases, especially in low-resource settings,
these technologies should be simpler, standardized, affordable,
field deployable, and disposable. Isothermal DNA amplification
processes, such as loop-mediated isothermal amplification (LAMP)
[10], could facilitate the integration of DNA-based methodologies
into bench molecular diagnostics kits independent of the utilization of sophisticated equipments. LAMP relies upon an autocycling strand displacement DNA synthesis and is more tolerant to
the presence of inhibitory substances such as blood, serum, plasma,
or heparin [10]. The reaction runs very rapidly in the presence of
template DNA and deoxynucleoside triphosphates, usually in less
than 90 min at a constant temperature (e.g., 6065 C). LAMP
provides high amplification efficiency and shows a detection limit
and specificity comparable to those of standard PCR. The high
potential of LAMP for the development of improved molecular
diagnostic assays fully justifies the increasing number of reports on
its application, including for the detection of Theileria parasites
[1115], namely, of T. annulata [16, 17].
In this chapter we describe the use of two molecular assays
for the direct detection of T. annulata in bovine blood samples,
based in standard real-time PCR and LAMP, both targeting the
Tams1-encoding gene of this parasite.
Materials
1. Genomic DNA extracted from bovine blood samples to test
(see Note 1).
2. Positive control of amplification: DNA extracted from a
T. annulata positive sample (see Note 2).
3. PCR specific primers for T. annulata targeting the Tams1encoding gene: Tams1_forw (5-CAA ATT CGA GAC CTA
CTA CGA TG-3) and Tams1_rev (5-CCA CTT RTC GTC
CTT AAG CTC G-3) (see Notes 35) [9].
4. LAMP specific primers for T. annulata targeting the Tams1encoding gene: Tams1_F3 (5-CCG TTA ATG CTG CAA
ATG AGG-3), Tams1_B3 (5-CCA CTT ATC GTC CTT
AAG CTC G-3), Tams1_FIP (5-GCT TAA GTT TGA ATG
CCT KTA CTG GCC CTT AAG GTC GGA GAC AAG-3),
and Tams1_BIP (5-GAT GTT CAA GAA GAA GGG AGA
CAA GCC CTT GAA CAA GAC WTC ATC G-3) (see Notes
3, 6, and 7) (Fig. 1).
177
Direct Detection of Theileria annulata

5
5
3
F3
F3c
F1c
F3 primer
FIP
F2
F2c
3
F1c
B1
B2
B3
B1c
B2c
B3c
Target
DNA
F3
F2
F1
B2
B1c
BIP
B3
B3 primer
Fig. 1 Generic location of the six segments in the target DNA used to design
LAMP primers. Forward (F3) and backward (B3) outer primers and forward (FIP)
and backward (BIP) inner primers are indicated. The specially designed FIP and
BIP primers contain two distinct sequences (F1c plus F2 and B1c plus B2,
respectively) corresponding to sense and antisense segments of the target DNA,
one for priming in the first stage and the other for self-priming in a subsequent
amplification reaction stage
5. Reagents for performing real-time PCR amplifications (e.g.,

SsoFast Evagreen Supermix, Bio-Rad, CA, USA).
6. Reagents for performing LAMP: Bst DNA polymerase large
fragment and respective 10 reaction buffer (New England
Biolabs), 25 mM of MgCl2, 20 mM of dNTPs, and 5 M of
betaine.
7. Reagents for performing gel electrophoresis: agarose, ethidium bromide, and 1 TBE buffer.
8. Standard and real-time PCR equipments (e.g., CFX96 RealTime PCR Detection System, Bio-Rad, CA, USA).
9. Standard equipment for performing agarose gel electrophoresis and the respective detection of the products under UV
light.
Methods
3.1 Detection of
T. annulata with
Real-Time PCR
1. Each amplification reaction is prepared for a final volume of

20 l, including the addition of 5 l of template DNA
sample.
including the positive and negative (water) amplification controls,
containing 1 SsoFast Evagreen Supermix, 0.3 M of
Tams1_forw primer and 0.15 M of Tams1_rev primer, completing to 75 % of the final volume with PCR-grade water.
178

microtubes.
4. Label each tube and add 5 l of the correspondent DNA
sample and controls.
(1) one initial denaturing step for 2 min at 95 C and (2) 45
cycles of denaturation for 15 s at 95 C, annealing for 30 s at
55 C and extension for 30 s at 72 C (see Note 8). The
increase of fluorescence and amplification curves for each
sample should be recorded and assessed according to the
instructions of the manufacturer of the real-time PCR instrument. Only samples containing T. annulata DNA should yield
positive amplification results.
6. After the amplification step, an additional control step for the
determination of the melting curve of the amplified fragments can be performed (if the real-time PCR instrument
used has that feature). For this, at the end of the amplification
program, add an additional step consisting of a 1 C temperature increase every 5 s (beginning at 55 C and ending at
95 C) (see Note 9).
3.2 Detection of
T. annulata with LAMP
1. Each isothermal amplification reaction is prepared for a final

volume of 15 l, including the addition of 5 l of template
DNA sample.
including the positive and negative (water) amplification
controls, containing 4.8 U of the Bst DNA polymerase large
fragment and 1 of the respective hybridization buffer, 6 mM
of MgCl2, 1,400 M of each dNTP, 0.8 M of betaine, 1.6 M
of each Tams1_FIP and Tams1_BIP primers, and 0.2 M of
each Tams1_F3 and Tams1_B3 primers, completing to 66.7 %
of the final volume with PCR-grade water (see Note 10).
microtubes.
4. Label each tube and add 5 l of the correspondent DNA sample and controls (see Note 11).
5. Proceed to the amplification step by incubating the tubes at
63 C during 90 min (see Note 12).
6. Finalize the amplification step with an incubation at 80 C during 2 min, to inactivate the enzyme.
7. Confirm the occurrence of positive amplification results by
analyzing the products in a 1.5 % (w/v) agarose gel electrophoresis (in 1 TBE buffer, at 90 V for 90 min; with ethidium
bromide staining) and visualization under UV light, using
standardized protocols (see Notes 1316) (Fig. 2).
179
Fig. 2 Characteristic ladderlike appearance of LAMP products in an agarose gel

electrophoresis. Lanes 14 correspond to positive amplification results and lane
5 corresponds to the non-template negative control. Mlog scale 100 bp DNA
Ladder (Jena Bioscience)
Notes
1. Blood samples may be collected from animals into sterile tubes
with EDTA and the total genomic DNA extracted using
commercially available kits or automated systems (e.g., we use
a BioSprint96 automated workstation and the BioSprint96
Blood kit, Qiagen) [9]. The average total DNA yield in samples is around 3540 ng/l. Extracted DNA should be stored
at 20 C until further use.
2. As positive controls of amplification, we may use DNA samples
extracted from T. annulata-infected macrophage cultures or
directly from bovine blood samples for which T. annulata
DNA was detected using other molecular tests such as reverse
line blotting [9].
3. Primers are frequently delivered lyophilized and need to be
diluted with sterile water according to the manufacturers
instructions. Stock solutions can be prepared at a standard
concentration of 100 pmol/l and stored at 20 C. Aliquots
of working solutions of each primer are prepared from stock
solutions in water and stored also at 20 C. Prepare small aliquots of working solutions (up to 100 l) and avoid continuous freeze and thaw of the solutions.
180
4. These primers were designed with complementary targets in

conserved segments of the Tams1 gene, allowing the amplification of a fragment with about 319 bp. Alignments containing
tens of Tams1 gene sequences were analyzed for detecting
these conserved nucleotide segments within T. annulata, providing also enough nucleotide differences when compared to
homologous genes from other closely related species [9]. The
homologous genes of the closely related species T. lestoquardi,
T. parva, and T. taurotragi all present several mismatches in
the complementary target region for both primers, rendering
it highly specific for T. annulata.
5. Tams1 is a T. annulata-specific gene encoding an immunodominant major merozoite/piroplasm surface antigen of this
parasite. This gene is commonly used as genomic target for
detecting this parasite [4, 8, 9, 18, 19].
6. LAMP uses a minimum of four primers (two inner primers,
FIP and BIP, and two outer primers, F3 and B3) that recognize six distinct regions flanking the amplified DNA target
sequence (Fig. 1). An adequate design of these primers is the
most important key for the success of the LAMP approach. It
may be necessary to design several primer sets before finding
one that works efficiently in the LAMP reaction [20, 21].
Some useful tips when designing LAMP primers are as follows:
(1) 5 and 3 ends of FIP and BIP inner primers should not be
adenine and thymine (AT)-rich and the Tm for each domain
(F1c, F2, B1c, and B2) should be between 55 and 65 C; (2)
the distance between the 5 end of F2 and the 5 end of F1
domains should be 4060 bp (the same for the distance
between the 5 end of B2 and the 5 end of B1 domains); (3)
the distance between the F2 and F3 domains (as well as
between the B2 and B3 domains) should be 020 bp; and (4)
the total length of the amplified DNA segment (from F2 to B2
domains, including both these domains) should be <200 bp.
Primers should be designed so as not to easily form secondary
structures. Dedicated software for designing LAMP primers
is freely available online: PrimerExplorer (http://primerexplorer.jp/e/).
7. The purity of the LAMP primers is important for obtaining
reproducible amplification results. The use of HPLC-purified
primers is recommended.
8. In order to improve the detection of lower levels of T. annulata in blood samples, we use 45 cycles in real-time PCR assays.
9. This step of melting temperature curve analysis allows confirmation that the detection of fluorescence is related to the
181
amplification of specific DNA targets from T. annulata

(presenting melting temperatures between 79 C and 83 C),
and not with the formation of artifacts such as primer dimmers (with melting temperatures around 73 C). The distinct
melting temperatures of Tams1 gene fragments, amplified
from different bovine blood samples, suggest that several
T. annulata genotypes may be circulating in a region [9].
10. The reagents are stored at 20 C and the preparation of the
reaction mixtures should be conducted on ice. Mix well all
reagents by pipetting or tapping with the cap closed, avoiding
the formation of bubbles, and then spin down. Avoid violent
mixing of the reagents as it may inactivate the Bst DNA
polymerase.
11. LAMP is possible when using nondenatured DNA templates.
Nevertheless, for attaining higher sensitivities, the use of prior
denatured DNA template targets is recommended (e.g., by
heating at 95 C for 5 min) [20].
12. For incubation we may use, e.g., a thermoblock or a water bath.
13. To confirm the specificity of the amplified products, the
DNA fragments may be digested with the restriction enzyme
RsaI, at 37 C for 1 h, and subject to a 1.5 % (w/v) agarose
gel electrophoresis and posterior visualization under UV light,
after staining with ethidium bromide, using standardized
protocols.
14. We use ethidium bromide to stain the LAMP amplified products when performing gel electrophoresis. We notice the
occurrence of migration artifacts during the gel electrophoresis step of these complex mixtures of products when using
alternative fluorescent dyes (e.g., SYBR Safe DNA Gel Stain,
Life Technologies). Ethidium bromide is a known mutagen
and should be handled as a hazardous chemical.
15. The final amplification products present stem-loop DNA structures, encompassing alternate inverted repeats of the target
sequence with multiple loops, and appear with a ladderlike pattern in agarose gel electrophoresis (Fig. 2).
16. Due to the very high yield of DNA amplification and to the
high sensitivity of LAMP, this method also presents a very high
risk for contamination when handling amplified products.
Therefore, opening and closing of the reaction tubes should be
conducted in a different room from where the reaction mixtures are prepared, and the DNA extraction from samples is
performed.
182
References
1. Gubbels JM, de Vos AP, van der Weide M et al
Theileria and Babesia species by reverse line
blot hybridization. J Clin Microbiol
37:17821789
2. Garca-Sanmartn J, Nagore D, Garca-Prez
AL, Juste RA, Hurtado A (2006) Molecular
diagnosis of Theileria and Babesia species
infecting cattle in Northern Spain using
reverse line blot macroarrays. BMC Vet
Res 2:16
3. Gomes J, Soares R, Santos M et al (2013)
Detection of Theileria and Babesia infections
amongst asymptomatic cattle in Portugal. Tick
Tick Borne Dis 4:148151
4. DOliveira C, van der Weide M, Habela MA,
Jacquiet P, Jongejan F (1995) Detection of
Theileria annulata in blood samples of carrier
cattle by PCR. J Clin Microbiol 33:
26652669
5. Altay K, Aydin MF, Dumanli N, Aktas M
(2008) Molecular detection of Theileria and
Babesia infections in cattle. Vet Parasitol
158:295301
6. Criado-Fornelio A, Buling A, Asenzo G et al
(2009) Development of fluorogenic probebased PCR assays for the detection and quantification of bovine piroplasmids. Vet Parasitol
162:200206
7. Georges K, Loria GR, Riili S et al (2001)
Detection of haemoparasites in cattle by reverse
line blot hybridisation with a note on the distribution of ticks in Sicily. Vet Parasitol
99:273286
8. Bilgic HB, Karagen T, Shiels B et al (2010)
Evaluation of cytochrome b as a sensitive target
for PCR based detection of T. annulata carrier
animals. Vet Parasitol 174:341347
9. Santos M, Soares R, Costa P et al (2013)
Revisiting the Tams1-encoding gene as a
species-specific target for the molecular detection
of Theileria annulata in bovine blood samples.
Tick Tick Borne Dis 4:7277
10. Notomi T, Okayama H, Masubuchi H et al
(2000) Loop mediated isothermal amplification of DNA. Nucleic Acids Res 28:e63
11. Alhassan A, Thekisoe OM, Yokoyama N et al
(2007) Development of loop-mediated isothermal amplification (LAMP) method for
diagnosis of equine piroplasmosis. Vet Parasitol
143:155160
12. Wang LX, He L, Fang R et al (2010) Loopmediated isothermal amplification (LAMP)

assay for detection of Theileria sergenti infection targeting the p33 gene. Vet Parasitol
171:159162
13. Liu A, Guan G, Du P et al (2013) Rapid
identification and differentiation of Theileria
sergenti and Theileria sinensis using a loopmediated isothermal amplification (LAMP)
assay. Vet Parasitol 191:1522
14. Thekisoe OM, Rambritch NE, Nakao R et al
(2010) Loop-mediated isothermal amplification (LAMP) assays for detection of Theileria
parva infections targeting the PIM and p150
genes. Int J Parasitol 40:5561
15. Salih DA, Ali AM, Liu Z et al (2012)
Development of a loop-mediated isothermal
amplification method for detection of Theileria
lestoquardi. Parasitol Res 110:533538
16. Liu A, Guan G, Du P et al (2012) Loopmediated isothermal amplification (LAMP)
assays for the detection of Theileria annulata
infection in China targeting the 18S rRNA and
ITS sequences. Exp Parasitol 131:125129
17. Salih DA, Liu Z, Bakheit MA et al (2008)
Development and evaluation of a loopmediated isothermal amplification method for
diagnosis of tropical theileriosis. Transbound
Emerg Dis 55:238243
18. Almeria S, Castell J, Ferrer D et al (2001)
Bovine piroplasms in Minorca (Balearic Islands,
Spain): a comparison of PCR-based and light
microscopy
detection.
Vet
Parasitol
99:249259
19. Aktas M, Altay K, Dumanli N (2006) A molecular survey of bovine Theileria parasites among
apparently healthy cattle and with a note on the
distribution of ticks in eastern Turkey. Vet
20. Incio J, Flores O, Spencer-Martins I (2008)
Efficient identification of clinically relevant
Candida yeast species by use of an assay
combining panfungal loop-mediated isothermal amplification with hybridization to speciesspecific oligonucleotide probes. J Clin
Microbiol 46:713720
21. Enosawa M, Kageyama S, Sawai K et al (2003)
Use of loop-mediated isothermal amplification
of the IS900 sequence for rapid detection of
cultured Mycobacterium avium subsp. paratuberculosis. J Clin Microbiol 41:43594365
Chapter 14
Reverse Line Blot Hybridization with Species-Specific
Oligonucleotide Probes: Application to Piroplasm Detection
Ana Hurtado
Abstract
Reverse line blot (RLB) hybridization has become a well-established and widely used method for the
multiplex identification of several Babesia and Theileria species in hosts and tick vectors. The procedure is
based on the simultaneous PCR amplification of a polymorphic region of the 18S rRNA gene from different piroplasms followed by identification of the individual species by hybridization to species-specific
oligonucleotide probes covalently linked to a nylon membrane in a macroarray format.
Key words PCR, RLB hybridization, Babesia, Theileria, Piroplasms, Ticks, Tick-borne disease
Introduction
Piroplasmosis are worldwide-distributed diseases caused by tickborne intracellular apicomplexan parasites of the genera Theileria
and Babesia [1, 2]. These diseases are of serious health and economic concern in extensive or semi-extensive production systems
where livestock spend most of the year grazing in mountain pastures in contact with ticks. Specific and sensitive identification of
piroplasms in infected animals and ticks is crucial in disease investigations and epidemiological surveys.
Reverse line blot (RLB) allows the simultaneous detection and
identification of piroplasms in three steps: DNA purification (not
described here), simultaneous PCR amplification of a polymorphic
region of the 18S rRNA gene from the different piroplasm species,
and identification of the individual species by hybridization to
species-specific oligonucleotide probes bound to a nylon membrane. Simultaneous PCR amplification of the different Babesia
and Theileria species is achieved by using generic primers (one of
them biotinylated) that target conserved regions of the 18S rRNA
gene. Species-specific oligonucleotide probes designed within variable regions of the amplicons are covalently linked to the carboxyl
groups of a negatively charged nylon membrane through a C6
183
184
Ana Hurtado
amino linker using a line-blotter apparatus. The membrane is then

rotated 90 before adding the biotin-labeled PCR amplicons so
that they come into contact with all the probes in a macroarray
format. Biotin-labeled PCR products specifically hybridized to the
oligoprobes are visualized by chemiluminescence; streptavidinhorseradish peroxidase (HRP) conjugate binds to the biotinlabeled amplicons and, after washing, bound conjugate acts on a
chemiluminescent substrate (e.g., ECL or SuperSignal West Dura)
to produce light that can be captured using an autoradiography
film. A schematic representation of the process along with an
example of the hybridization signal obtained is shown in Fig. 1.
Amplicons can be stripped away and the entire blot used again in a
new hybridization assay.
RLB hybridization is a highly specific and sensitive diagnostic
tool that can be used to identify piroplasms in different sample
types like blood and tissues from different animal hosts and ticks,
both as single and mixed infections [3]. The use of generic 18S
rRNA gene primers and the inclusion of a catchall Theileria and
90
Chemiluminescence
ECL
Probes
HRP
Streptavidin
Biotin
Probes
PCR product
PCR products
Probe
PCR products
Membrane
Fig. 1 Schematic representation of the RLB hybridization process. (a) Oligoprobes are covalently coupled to the
membrane in lines using a line-blotter apparatus; (b) the membrane is then rotated 90; (c) the PCR amplicons
are added perpendicularly to the probes; (d) amplicons come into contact with all the probes in a macroarray
format; (e) schematic representation of the hybridization and detection reactions; (f) example of the RLB
hybridization signal on an autoradiography film
Piroplasms Detection by Reverse Line Blotting
185
Babesia control probe allow for the discovery of novel species or

genotypes; a generic hybridization signal with the catchall probe in
the absence of species-specific hybridization signals would indicate
that a new species or genotype is present. Sequencing analysis of
the amplicon would then be needed to characterize it, and, if
required, a new specific probe could be designed and added to the
panel of probes used in the array. In fact, this strategy has helped in
the description of novel species/genotypes [46].
RLB hybridization methods were first used for bovine piroplasm detection in 1999 [3] and soon extended to other piroplasm
species [4, 5, 7, 8]. Nowadays, RLB hybridization has become the
molecular technique of choice for the simultaneous detection and
identification of several Babesia and Theileria species in hosts and
tick vectors [915]. More recently, the piroplasm RLB membranebased assay for bovine piroplasm detection has been transferred to
a DNA bead-based suspension array test using the Luminex
xMAP technology that provides higher throughput screening and
more flexibility in array preparation [16].
2
2.1
Materials
Equipment
1. PCR thermocycler.
2. Miniblotter 45 line-blotter apparatus and foam cushions.
3. Hybridization oven, glass cylinders, and hybridization mesh
sheets.
4. Shaking water bath.
5. Centrifuge.
6. Vacuum pump.
7. Orbital shaker.
8. Exposure cassette.
9. Plastic container (e.g., Tupperware).
2.2
PCR
1. Primer RLB-F2 [7]: 5-GAC ACA GGG AGG TAG TGA

CAA G-3.
2. Primer RLB-R2 [7]: 5-CTA AGA ATT TCA CCT CTG ACA
GT-3 (5 biotin-labeled).
3. PCR Buffer, MgCl2, and Taq polymerase.
4. dNTPs.
5. Molecular grade ultrapure water.
2.3
RLB
1. Negatively charged nylon membrane (e.g., Biodyne C, Pall

Corporation, NY, USA).
2. 16 % EDAC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide,
hydrochloride): Weight 3.2 g of EDAC and add 20 ml of ultrapure water.
186
Ana Hurtado
3. 20 SSPE: Weight and mix 175.3 g of NaCl, 27.6 g of

NaH2PO4, and 7.4 g of EDTA. Add 800 ml of water, adjust
the pH to 7.4 with 10 M NaOH, and bring volume to 1 L
with water. Sterilize in the autoclave for 15 min at 121 C.
4. 2 SSPE: Dilute 100 ml of 20 SSPE into 900 ml water.
5. 100 mM NaOH: Weight 4.2 g of NaOH and bring volume to
1 L with water.
6. 10 % SDS: Weight 100 g of SDS, add 800 ml of water, mix
well, and bring volume to 1 L with water.
7. 1 % SDS: Dilute 100 ml of 10 % SDS into 900 ml of water.
8. 2 SSPE/0.1 % SDS: Mix 495 ml of 2 SSPE and 5 ml of 10 %
SDS.
9. 2 SSPE/0.5 % SDS: Mix 950 ml of 2 SSPE and 50 ml of
10 % SDS.
10. 0.5 M EDTA: Weight 46.5 g of EDTA-Na2 and bring volume
to 250 ml with water.
11. 20 mM EDTA: Mix 960 ml of water and 40 ml of 0.5 M
EDTA, and adjust pH to 8.0 with NaOH.
12. Indian ink: Make up a 1/100 dilution in 2 SSPE.
13. 500 mM NaHCO3: Weight 4.2 g of NaHCO3, add 90 ml of
water, adjust pH to 8.4 with NaOH, and bring volume to
100 ml with water.
14. Streptavidin-horseradish peroxidase (HRP) conjugate.
15. Chemiluminescent substrate (e.g., ECL or SuperSignal West
Dura): The substrate consists of two solutions to be mixed
prior to incubation.
16. Film developer and fixer: Dilute with distilled water following
manufacturers instructions.
17. Autoradiography films 18 24 cm.
18. Oligonucleotide probes (see Table 1), containing a
N -(trifluoroacetamidohexyl-cyanoethyl- N , N -diisopropylphosphoramidite [TFA])-C6 amino linker.
Methods
3.1 Generic PCR

Targeting the V4
Region of the 18S
rRNA Gene of Theileria
and Babesia Species
1. PCR reaction mix: Reactions are performed in a final volume

of 25 l containing 50100 ng of genomic DNA, 200 nM of
each primer (RLB-F2 and 5-biotin-labeled RLB-R2), 1
PCR buffer, 1.5 mM of MgCl2, 200 M of each dNTP, 1 U of
Taq polymerase, and PCR-grade water to complete the volume
(see Notes 1 and 2).
187
Table 1
Sequence and concentration of oligonucleotide probes used for piroplasm species identification
by RLB
Target species
Sequence (53)a
Concentration
(M)
References
Catchall probe (Theileria TAA TGG TTA ATA GGA (A/G)C(A/G)

spp. + Babesia spp.)
GTT G
[7]
B. bigemina
CGT TTT TTC CCT TTT GTT GG
[3]
B. bovis
CAG GTT TCG CCT GTA TAA TTG AG
[3]
B. caballi (genotype B)
GTT GCG TTG TTC TTG CTT TTT GCT T
32
[5]
B. caballi (genotype A)
CGG GTT ATT GAC TTC GCT TTT TCT T
[5]
B. canis subsp. canis
CGT TGA CGG TTT GAC CAT TTG GT
[11]
B. canis subsp. vogeli
GTG TTC GAG TTT GCC ATT CGT T
[11]
B. crassa
TTA TGG CCC GTT GGC TTA T
[8]
B. divergens
GTT AAT ATT GAC TAA TGT CGA G
[3]
B. gibsoni
TTG CCC GAC TCG GCT ACT TG
32
[11]
B. major
TCC GAC TTT GGT TGG TGT
[7]
B. microti
ATC TCG CTT CCG AGC GTT TTT T
16
[11]
B. motasi
ATT GGA GTA TTG CGC TTG CTT TTT
16
[4]
B. occultans
GTG TGC CTC TTT TGG CCC ATC
16
[17]
B. ovis
GCG CGC GGC CTT TGC GTT ACT
32
[4]
T. annae
CCG AAC GTA ATT TTA TTG ATT TGG C
[11]
T. annulata
CCT CTG GGG TCT GTG CA
[7]
T. buffeli
GGC TTA TTT CGG (A/T)TT GAT TTT
[3]
T. equi
TGG TTT TAG GAG CC(A/G) GAG
10
[18]
T. equi (genotype A)
GTT TCG ATT ATT CGT TTC CCG G
16
[5]
T. equi (genotype B)
GGG GCA TGT TTT CAT GAC TCG A
[5]
T. lestoquardi
ATT GCT TGT GTC CCT CCG
[8]
T. luwenshuni/OT1
ATC TTC TTT TTG ATG AGT TGG TGT
[4]
T. ovis
TTT TGC TCC TTT ACG AGT CTT TGC
[4]
Theileria sp. OT3
ATT TTC TCT TTT TAT ATG AGT TTT
32
[4]
Theileria sp. 3185/02
CGG TTA TAA AAT TTA TTT TAT TTC CG
32
[12]
Note: cross-reaction between the T. lestoquardi probe [8] and the amplicon generated from T. annulata and between
the T. annulata probe [7] and the amplicon generated from T. lestoquardi can occur since targeted sequences in both
species differ only in one nucleotide within the sequence of the probes
a
Oligonucleotide probes contain a N-(trifluoroacetamidohexyl-cyanoethyl-N,N-diisopropyl phosphoramidite [TFA])C6 amino linker at 5 end
188
Ana Hurtado
2. Cycling conditions: PCR conditions consist of an enzyme activation step of 4 min at 94 C and 40 cycles of 30 s at 94 C,
35 s at 51 C, and 35 s at 72 C.
3. Gel electrophoresis (optional): Run 5 l of the PCR product in a
1.5 % agarose gel to visualize bands of 385450 bp.
3.2 Covalent
Coupling
of Oligonucleotide
Probes
to the Membrane
1. Dilute the probes to the concentration indicated in Table 1 in

160 ml of 500 mM NaHCO3 pH 8.4 (see Note 3).
2. Cut a piece of negatively charged nylon membrane to a suitable size and activate it for 10 min at room temperature (RT)
in 20 ml of freshly prepared 16 % EDAC (see Note 4).
3. Rinse the membrane in water.
4. Place a foam cushion on the miniblotter bottom part and place
the membrane on top of it. Assemble the blotter tightening it
with the screws and remove all remaining water from the slots
by aspiration using the vacuum pump.
5. Fill the slots with ca. 150 ml of the diluted oligoprobes and
incubate at RT for 5 min (see Notes 5 and 6).
6. Remove the oligoprobes from the slots by aspiration using the
vacuum pump.
7. Remove the membrane from the blotter, place it into a plastic
container, and incubate it at RT in 100 mM NaOH for 67 min
to inactivate it (see Note 7).
8. Wash the membrane in 2 SSPE/0.1 % SDS at 60 C for 5 min
using a shaking water bath (see Note 8). The membrane is now
ready for hybridization, but if it is to be stored at this point,
follow next step.
9. Wash the membrane with 20 mM EDTA pH 8.0 for 15 min at
RT with shaking using an orbital shaker before storage at 4 C
(see Note 9).
3.3 RLB
Hybridization
with the PCR
Products
and Detection
1. Add 130 l of 2 SSPE/0.1 % SDS to the PCR products (see

Note 10).
2. Denature the diluted PCR products by heating at 100 C for
10 min and immediately cool on ice (see Note 11).
3. Incubate the membrane for 5 min at room temperature in 2
SSPE/0.1 % SDS in a plastic container.
4. Place the membrane onto the cushion in the miniblotter
(rotated 90 so that the slots of the miniblotter are perpendicular to the oligoprobe lines) and aspirate remaining liquid
from the slots with the vacuum pump.
189
5. Fill the slots with the denatured PCR products avoiding air
bubbles (see Note 12) and incubate at 42 C for 1 h in the prewarmed hybridization oven (do not shake).
6. Remove the PCR products from the slots by aspiration using
the vacuum pump before removing the membrane from the
miniblotter.
7. Cover the membrane (DNA side up) with the hybridization
mesh and gently roll them into the shape of a cylinder. Place
the covered membrane inside a hybridization glass cylinder.
8. Wash the membrane with 2 SSPE/0.5 % SDS into the glass
cylinder while rotating it in the hybridization oven at 52 C for
10 min (see Note 13).
9. Do a second wash.
10. Incubate the membrane with streptavidin-peroxidase in 2
SSPE/0.5 % SDS into the glass cylinder while rotating it in the
hybridization oven at 42 C for 30 min (see Note 14).
11. Wash the membrane with 2 SSPE/0.5 % SDS into the glass
cylinder while rotating it in the hybridization oven for 10 min
at 42 C twice.
12. Remove the membrane from the glass cylinder, place it in a
plastic container, and wash it with 2 SSPE for 5 min at RT
twice agitating the fluid gently using an orbital shaker.
13. Blot the edge of the membrane against filter paper to remove
excess liquid and add the mix of chemiluminescent substrate
as per manufacturers instructions. Incubate for 1 min
(see Note 15).
14. Wrap the membrane in plastic wrap and place it in the expose
cassette (see Note 16).
15. In the dark room place an autoradiography film on top of the
membrane (see Note 17) and expose it as desired (see Note 18).
16. Develop the film.
3.4 Stripping
of Hybridized
Amplicons
1. Place the membrane in a closed plastic container.

2. Wash the membrane in 1 % SDS at 90 C for 30 min in a shaking water bath.
3. Do a second wash in 1 % SDS at 90 C for 30 min in a shaking
water bath.
4. Incubate in 20 mM EDTA, pH 8.0 for 5 min at RT twice in an
orbital shaker.
5. Store in 20 mM EDTA, pH 8.0 at 4 C, and reuse it up to
810 times (see Notes 9 and 19).
190
Ana Hurtado
Notes
1. Units of Taq polymerase can vary according to type and brand
used.
2. Extraction controls and PCR negative (water) controls are
included in each PCR run as negative controls.
3. Oligonucleotide
probes
are
synthesized
with
a
N -(trifluoroacetamidohexyl-cyanoethyl- N , N -diisopropylphosphoramidite [TFA])-C6 amino linker at the 5 end.
Resuspend lyophilized oligoprobes in water at a concentration
of 100 M upon arrival and store the stock solutions at 20 C.
4. Always prepare fresh EDAC before use and incubate the membrane for just 10 min, not more.
5. Fill slots 1 and 45 with Indian ink diluted 1/100 in 2 SSPE
for membrane orientation reference; the ink will indicate the
direction of probes in the membrane.
6. To avoid membrane drying never leave empty slots, fill with 2
SSPE all the slots that are not filled with probes or ink.
7. Incubations longer than 10 min will produce weaker signals.
8. Pre-warm the 2 SSPE/0.1 % SDS at 60 C in the oven or
water bath before using it for membrane inactivation.
9. Seal membrane in plastic wrap or keep it in a closed container
to avoid dehydration while stored.
10. Always include PCR negative and positive controls, the former
to control contamination and the latter to control the
process.
11. Quick spin the tubes after denaturing to pull down
condensation.
12. To avoid membrane drying, never leave empty slots; fill empty
slots with 2 SSPE/0.1 % SDS.
13. Make sure to set oven temperature in advance as required in
each step and keep solutions pre-warmed at the required
temperature.
14. When using ECL (Amersham) as chemiluminescent substrate,
mix 3.8 l streptavidin-peroxidase with 15 ml of 2 SSPE/0.5 %
SDS (1:4,000 dilution); if using SuperSignal West Dura
(Pierce), mix 1 l streptavidin-peroxidase with 75 ml of 2
SSPE/0.5 % SDS (1:75,000 dilution).
15. Warm both detection reagents to room temperature before
mixing them as per manufacturers instructions. Make sure the
membrane is well covered. This step does no need to be carried
out in the dark.
191
16. Overhead transparency sheets can be used instead of wrapping

paper for easier handling; however, if longer exposure times are
to be used, wrapping paper is preferable to avoid membrane
drying.
17. Place the film on top of the membrane in one quick and single
movement, particularly if using SuperSignal West Dura (Pierce)
which gives a very strong signal in the first minutes; otherwise,
a moved image will be obtained.
18. Exposure time will depend on the number of uses of the
membrane and the chemiluminescent substrate used. Use the
positive controls to estimate the most adequate times.
19. Amplicons can be stripped and the membrane reused several
times in a new hybridization assay; positive controls can be
used to make sure that sensitivity is not compromised by
re-hybridization.
Acknowledgments
This work was supported by the Department of Agriculture of the
Basque Country Government, the Spanish National Institute for
Agricultural and Food Research and Technology (INIA), and the
European Regional Development Fund (ERDF).
References
1. Preston PM (2001) Theilerioses. In: Service
MW (ed) Encyclopedia of arthropodtransmitted infections of man and domesticated animals. CABI Publishing, Wallingford,
UK, pp 487502
2. Uilenberg G (2001) Babesiosis. In: Service
MW (ed) Encyclopedia of arthropodtransmitted infections of man and domesticated animals. CABI Publishing, Wallingford,
UK, pp 5360
3. Gubbels JM, de Vos AP, van der Weide M et al
Theileria and Babesia species by reverse line blot
hybridization. J Clin Microbiol 37:17821789
4. Nagore D, Garca-Sanmartn J, Garca-Prez
AL et al (2004) Identification, genetic diversity
and prevalence of Theileria and Babesia species
in a sheep population from Northern Spain.
Int J Parasitol 34:10591067
5. Nagore D, Garca-Sanmartn J, Garca-Prez
AL et al (2004) Detection and identification of
equine Theileria and Babesia species by reverse
line blotting: epidemiological survey and phylogenetic analysis. Vet Parasitol 123:4154
6. Oosthuizen MC, Allsopp BA, Troskie M et al

(2009) Identification of novel Babesia and
Theileria species in South African giraffe
(Giraffa camelopardalis, Linnaeus, 1758) and
roan antelope (Hippotragus equinus, Desmarest
1804). Vet Parasitol 163:3946
7. Georges K, Loria GR, Riili S et al (2001) Detection
of haemoparasites in cattle by reverse line blot
hybridisation with a note on the distribution of
ticks in Sicily. Vet Parasitol 99:273286
8. Schnittger L, Yin H, Qi B et al (2004)
Simultaneous detection and differentiation of
Theileria and Babesia parasites infecting small
ruminants by reverse line blotting. Parasitol
Res 92:189196
9. Altay K, Dumanli N, Aktas M (2007) Molecular
identification, genetic diversity and distribution of Theileria and Babesia species infecting
small ruminants. Vet Parasitol 147:161165
10. Garca-Sanmartn J, Nagore D, Garca-Prez
AL et al (2006) Molecular diagnosis of Theileria
and Babesia species infecting cattle in Northern
Spain using reverse line blot macroarrays. BMC
Vet Res 2:16
192
Ana Hurtado
11. Garca-Sanmartn J, Barandika JF, GarcaPrez AL, Hurtado A (2008) Distribution and
molecular detection of Theileria and Babesia in
questing ticks from Northern Spain. Med Vet
Entomol 22:318325
12. Garca-Sanmartn J, Aurtenetxe O, Barral M
et al (2007) Molecular detection and characterization of piroplasms infecting cervids and
chamois in Northern Spain. Parasitology
134:391398
13. Kouam MK, Kantzoura V, Masuoka PM et al
(2010) Genetic diversity of equine piroplasms
in Greece with a note on speciation within
Theileria genotypes (T. equi and T. equi-like).
Infect Genet Evol 10:963968
14. Oura CA, Bishop RP, Wampande EM et al
(2004) Application of a reverse line blot assay
to the study of haemoparasites in cattle in
Uganda. Int J Parasitol 34:603613
15. Silva MG, Marques PX, Oliva A (2010)

Detection of Babesia and Theileria species
infection in cattle from Portugal using a reverse
line
blotting
method.
Vet
Parasitol
174:199205
16. Ros-Garca A, Juste RA, Hurtado A (2012) A
highly sensitive DNA bead-based suspension
array for the detection and species identification of bovine piroplasms. Int J Parasitol
42:207214
17. Ros-Garca A, Mghirbi Y, Bouattour A,
Hurtado A (2011) First detection of Babesia
occultans in Hyalomma ticks from Tunisia.
Parasitology 138:578582
18. Ros-Garca A, Mghirbi Y, Hurtado A,
Bouattour A (2013) Prevalence and genetic
diversity of piroplasm species in horses and
ticks from Tunisia. Infect Genet Evol
17:3337
Chapter 15
DNA Microarray-Based Detection of Multiple Pathogens:
Mycoplasma spp. and Chlamydia spp.
Abstract
Rapid detection of slow-growing or non-culturable microorganisms, such as Mycoplasma spp. and
Chlamydia spp., is still a challenge to diagnosticians in the veterinary field. In addition, as epidemiological
evidence on the frequency of mixed infections involving two and more bacterial species has been emerging,
detection methods allowing simultaneous identification of different pathogens are required. In the present
chapter, we describe DNA microarray-based procedures for the detection of 83 Mollicutes species
(Mycoplasma assay) and 11 Chlamydia spp. (Chlamydia assay). The assays are suitable for use in a routine
diagnostic environment, as well as in microbiological research.
Key words DNA microarray, Rapid detection, Mycoplasma spp., Chlamydia spp., Multiple-species
infection
Introduction
1.1 Mycoplasmas:
Etiological Importance
and Diagnosis
Microorganisms of the class Mollicutes commonly referred to as

mycoplasmas exhibit a number of unique properties. These include
the absence of a rigid cell wall, the capability of surface antigen
variation and a small genome size, which is associated with a
reduced number of metabolic pathways. These characteristics render the organisms well-adapted inhabitants of mucosal cell surfaces
of mammals, birds, and other vertebrates. Their parasitic life style
results in a balanced equilibrium with their hosts without causing
clinical disease. However, several Mycoplasma species are significant pathogens and cause or contribute to infections of the respiratory or urogenital tracts. Mycoplasmoses typically take a chronic
course with high morbidity and low mortality rates. The four economically most important mycoplasmoses are listed as notifiable
diseases by the World Organization of Animal Health (OIE) [1]
and include (1) contagious bovine pleuropneumonia (CBPP)
caused by Mycoplasma (M.) mycoides subsp. mycoides and endemic
in Sub-Saharan Africa, (2) contagious caprine pleuropneumonia
193
194
(CCPP) caused by M. capricolum subsp. capripneumoniae, (3)

contagious agalactia caused by M. agalactiae, and (4) avian mycoplasmosis caused by M. gallisepticum or M. synoviae. Other relevant
syndromes include mastitis in cows and pneumonia in calves (M.
bovis), which predominantly occur in industrial cattle production
in North America [2] and Europe [3]. Also ocular and respiratory
infections in small ruminants caused by M. conjunctivae and M.
ovipneumoniae, respectively, as well as enzootic pneumonia, arthritis, and anemia in swine caused by M. hyopneumoniae, M. hyorhinis,
and M. suis, respectively, are of economic importance.
Sixteen different mycoplasmas have been found in humans [4].
While the majority of them represent commensals, M. pneumoniae
in the oropharynx as well as M. hominis, M. genitalium, and
Ureaplasma spp. in the urogenital tract are of clinical significance.
Furthermore, mycoplasma contamination of cell culture is a
persistent problem in research laboratories and the pharmaceutical
industry, because the unwanted presence of Acholeplasma laidlawii, M. orale, M. arginini, M. fermentans, and others affect
growth and development of cell culture and can distort the results
of in vitro tests [5].
The broad spectrum of mycoplasmas either directly involved in
pathogenic processes or acting as commensals and interfering with
detection assays presents a particular diagnostic challenge that is
only insufficiently solvable through individual PCR tests (see
Subheading 1.3). Therefore, in the last decade, a number of
advanced tests based on generic PCR amplification and subsequent
specific product analysis were developed, such as 16S rRNA-PCR/
denaturing-gradient gel electrophoresis [6], PCR/high-resolution
melting curve analysis [7], and PCR/microarray assay [810].
1.2 Chlamydiae:
Etiological Importance
and Diagnosis
A unique feature of the obligate intracellular bacteria commonly

known as chlamydiae is their biphasic developmental cycle. As a
result, permanent cell lines or embryonated chicken eggs are necessary to culture the strains. The procedure is laborious and
requires experienced staff. In addition, some of the strains are
extremely difficult to grow. A description of current state-of-theart diagnostic assays is given in the OIE Manual [11, 12] and in a
recent review [13].
Among the major pathogens are Chlamydia (C.) psittaci, the
causative agent of avian chlamydiosis, which is transmissible to
humans; C. abortus (ovine and human abortion); as well as the
human pathogens C. trachomatis (genital and ocular diseases) and
C. pneumoniae (community-acquired pneumonia).
Until recently, the taxonomy of the family Chlamydiaceae was
the subject of controversy. The division into two genera Chlamydia
and Chlamydophila as proposed by Everett at al. [14] did not find
universal acceptance [15] and was finally reversed to the single
genus Chlamydia [16].
DNA Microarray for Mycoplasmas and Chlamydiae
195
Avian chlamydiosis (also known as psittacosis or ornithosis) is

widespread and represents a major factor of economic loss to the
poultry industry, as well as a permanent risk for zoonotic transmission to man [17]. The disease is notifiable in most European countries, as well as in Australia and the USA. Depending on the
chlamydial strain and the avian host involved, the infection leads to
pneumonia, air sacculitis, pericarditis, hepatitis, and/or splenitis,
occasionally with fatal outcome, the major signs being fever,
anorexia, lethargy, and diarrhea. Subclinical infection often leads to
recurring manifestations and chronicity. Even in the absence of
clinical signs, intermittent shedding of C. psittaci by carriers represents an important source of infection and also a challenge for
diagnosticians [18, 19]. Apart from birds, the agent can also be
encountered in cattle, goats, swine, and cats [20], as well as in
sheep [21] and horses.
As a result of several studies in Germany, France, and Italy in
the past 7 years, the list of chlamydial species is about to be
extended. Phylogenetic studies of ribosomal RNA genes from 11
isolates and analysis of the first genome sequences led to the proposal of two new species [22]. Chlamydia avium sp. nov. has been
found in pigeons and psittacine birds, some of which were cases of
severe disease. Chlamydia gallinacea sp. nov. has been identified in
domestic poultry hosts, so far from asymptomatic chicken, guinea
fowl, and turkey. A zoonotic potential cannot be ruled out.
Ovine chlamydiosis or enzootic abortion of ewes is caused by
C. abortus. Outbreaks of the disease result in major economic
losses for the sheep industry. The abortion typically occurs in the
last 23 weeks of pregnancy with the appearance of stillborn
lambs and inflamed placentas [23]. Chlamydial abortion also
occurs in goats and, less frequently, cattle, pigs, horses, and deer
may be affected.
The main hosts of C. pecorum are cattle and small ruminants,
where it may cause enteritis, pneumonia, polyarthritis, and abortions [24]. The agent also frequently occurs in swine.
C. suis is typically encountered in swine. Infections mostly
remain asymptomatic, but an association with respiratory disease,
diarrhea, and conjunctivitis seems likely under certain environmental and epidemiological conditions. The recent emergence of antibiotic resistance in this agent [25] deserves further attention.
C. caviae and C. felis are largely but not exclusively confined to
their specific host, i.e., guinea pig and cat, respectively, eliciting
conjunctivitis.
Besides being the most prevalent sexually transmitted human
pathogen, C. trachomatis can also be found occasionally in animals
[26, 27]. Likewise, certain biovars of C. pneumoniae can also be
encountered in animals, such as horses, frogs, and koalas, where
they are capable of causing respiratory disorders.
196
1.3 DNA Microarray

Detection Assays:
Principle and Potential
Rapid detection of bacterial pathogens remains a challenge to diagnosticians in veterinary medicine, particularly when slow-growing
or non-culturable microorganisms are involved, as is the case with
Mycoplasma spp. and Chlamydia spp. Early diagnosis of infection is
crucial for the effectiveness of control measures to contain the
spread of the infectious agent and prevent economic losses.
In the past two decades, the most significant advances in diagnostic technology were due to the broad application of nucleic acid
amplification techniques, notably the polymerase chain reaction
(PCR). Now that demands on quality, quantity, and rapidity of
microbiological diagnosis are steadily increasing, the inherent limitations of PCR are becoming evident. The parallelity of PCR assays
is very limited, i.e., usually a single agent is targeted, and even in
multiplex assays the number of targets is lower than 10. This is a
serious drawback as diagnosticians are increasingly becoming aware
of dual and multiple infections. Furthermore, as soon as one has to
deal with more subtle differences between species or strains, such
as minor sequence variations up to single-nucleotide polymorphisms or multi-locus sequence features, PCR alone cannot provide the necessary resolution.
In this situation, a DNA microarray-based approach, which is
capable of verifying the exact nucleotide sequence of a target
region through hybridization, appears a promising alternative.
Moreover, a DNA microarray assay can be designed to target a
large number of genomic loci (limited only by the size of the array)
to ensure discrimination between microbial species, strains, genotypes, serotypes, resistance types, etc.
The commercially available ArrayStrip (AS) platform represents an efficient system for processing low- and high-density DNA
arrays (Alere Technologies, http://alere-technologies.com/products). An AS unit consists of eight connected plastic vessels in
microtiter format, each one carrying a microarray chip of 3 3 mm
size with an active area of 2.4 2.4 mm on the bottom.
Hybridization and analysis can be conducted in an easy, rapid, and
parallel fashion, largely using standard laboratory equipment (see
Fig. 1 and Note 1).
Validated protocols for differentiation among 37 Mollicutes
species [10] and nine Chlamydia spp. [28] have been published by
our group. Other applications based on AS assays include DNA
serotyping of Salmonella enteric [29], genotyping of methicillinresistant Staphylococcus aureus [30], enterohemorrhagic Escherichia
coli [31], and many more.
In the present chapter, we describe the procedure for detection
of 83 Mollicutes species (Mycoplasma assay, see Table 1) and 11
Chlamydia spp. (Chlamydia assay). Basic principles of assay design
and experimental features are given in Notes 2 and 3.
Fig. 1 General workflow and timeline of the Mycoplasma and Chlamydia assays
Table 1
Selection of important pathogenic animal and human mycoplasmas and cell culture contaminants
that can be identified using the Mycoplasma microarray assay
Animal mycoplasmas
Human mycoplasmas
Mycoplasmas in cell culture
M. agalactiae
M. genitalium
A. laidlawii
M. bovigenitalium
M. hominis
M. arginini
M. bovis
M. pneumoniae
M. fermentans
M. californicum
U. parvum
M. hyorhinis
M. capricolum subsp. capripneumoniaea
U. urealyticum
M. orale
M. conjunctivae
M. salivarium
M. dispar
M. felis
M. gallisepticum
M. hyopneumoniae
M. mycoides subsp. mycoidesa
M. ovipneumoniae
M. suis
M. synoviae
a
Members of the M. mycoides cluster are identified at species but not at subspecies level
198
Materials
2.1
DNA Extraction
2.2
Biotinylation PCR
Commercial DNA extraction kit, e.g., High Pure PCR Template

Preparation Kit (Roche Diagnostics, Mannheim, Germany) suitable for cultured strains and a wide range of tissue samples, e.g.,
nasal, vaginal and conjunctival swabs, mucus, bronchoalveolar
lavage, organs, feces, and milk.
1. PCR-grade water.
2. PCR reagents. We use DyNAmo Flash SYBR Green qPCR
Mastermix (Finnzymes Vantaa, Finland) for pre-hybridization
amplification of mycoplasmal DNA and conventional Taq
DNA polymerase, e.g., Native Taq Polymerase (Fermentas, St.
Leon-Rot, Germany) or Phusion Green High-Fidelity DNA
Polymerase (Thermo Scientific, Dreieich, Germany) with the
corresponding buffer system and a dNTP mixture (2 mM of
each nucleotide) for chlamydial samples.
3. Primers. The sequences of primer oligonucleotides are given in
Table 2. The concentration of stock solutions is 100 pmol/l
and of working solutions 10 pmol/l.
4. Internal amplification control pGEM-EGFP2rev [33].
Commercially available as INTYPE IC-DNA from Qiagen
Leipzig, Germany.
Table 2
Primers for biotinylation PCR
Name
Sequence 53a
Target gene
Amplicon size
References
F1388
5Bio-GTT TCC TGG GCA

AGG TTC G-3
Mycoplasma
23S rDNA
594 bp
[10]
R1982
5Bio-CCG TTA TAG TTA CGG

CCG CC-3
tuf-064F
5Bio-ATG CCN CAA ACW

MGW GAA CAC-3
Mycoplasma tuf
614 bp
[10]
tuf-681R
5Bio-TRT GAC KWC CAC CTT

CWT CTT-3
U23F-19
5Bio-ATT GAM AGG CGA WGA

AGG A-3
Chlamydia
23S rDNA
171 bp
[28]
23R-22
5Bio- GCY TAC TAA GAT GTT

TCA GTT C-3
EGFP-11F
5Bio-CAG CCA CAA CGT CTA

TAT CAT G-3
Internal
control
276 bp
[33]
EGFP-10R
5Bio-CTT GTA CAG CTC GTC

CAT GC-3
All primers are labeled with biotin at their 5 end
2.3
Electrophoresis
199
1. Agarose, molecular biology grade: 1.5 % (w/v) gels.

2. Tris-borate EDTA electrophoresis buffer (TBE): 0.09 M of
Tris-borate, 0.002 M of EDTA, pH 8.0. For 1 L of 10 TBE,
mix 108 g of Tris-base, 55 g of boric acid, and 80 mL of
0.25 M EDTA, make up with water. Dilute 1:10 before use.
3. Gel loading buffer (GLB): 20 % (v/v) of glycerol, 0.2 M of
EDTA, 0.01 % (w/v) of bromophenol blue, 0.2 % (w/v) of
Ficoll 400.
4. Ethidium bromide stock solution: 1 % (10 mg/mL) solution
in water. Caution: the substance is presumed to be mutagenic.
Avoid direct contact with skin. Wear gloves when preparing
solutions and handling gels.
5. DNA size marker. We mostly use the ORangeRuler (100-bp
ladder) (Fermentas, St. Leon-Rot, Germany).
2.4 DNA Microarray

Hybridization
2.5 General
Equipment and
Consumables
The Identibac Hybridisation Kit (Alere Technologies, Jena,

Germany) is the most efficient and convenient option and contains
all necessary reagents: hybridization buffer (C1), washing buffers
(C2, C5), streptavidin-peroxidase conjugate (C3 + C4), and TMB
substrate (D1). Alternatively, buffers can be prepared manually
according to the protocol published previously [32].
1. Benchtop centrifuge, e.g., 5402 (Eppendorf, Hamburg,
Germany).
2. Vortex shaker, e.g., Vortex 1 (IKA Labortechnik, Staufen,
Germany).
3. Set of pipettes covering the volume range from 0.1 to 1,000 l
and aerosol-resistant filter tips.
4. Sterile, DNAse and RNAse-free plastic tubes.
5. Thermal cycler. We use the Mx3000P with MxPro 4.10.
software (Agilent, Waldbronn, Germany) for Mycoplasma assay
and Mastercycler personal (Eppendorf, Hamburg, Germany)
for Chlamydia assay.
6. Apparatus for horizontal gel electrophoresis.
7. UV transilluminator, 254 nm and/or 312 nm.
8. Video documentation or photographic equipment.
9. ArrayStrip or ArrayTube reaction vessels (Alere
Technologies, Jena, Germany) with integrated DNA microarray chips for the Mycoplasma assay (layout Myc_05 or higher)
or the Chlamydia assay (layout Chlam_gesamt_4_AS or
higher). These arrays are commercially available from Alere.
The company also has a service for ordering customized arrays.
The sequences of the oligonucleotide probes immobilized on
these arrays were previously published in Sachse et al. [32]
(Chlamydia assay) and Schnee et al. [10] (Mycoplasma assay).
200
10. Heatable horizontal tube shaker. We recommend the BioShake

iQ (Quantifoil Instruments, Jena, Germany; see Note 4).
11. ArrayMate transmission reader (Alere Technologies, Jena,
Germany).
12. Iconoclust software, version 2.3 or higher (Alere Technologies,
Jena, Germany).
3
3.1
Methods
DNA Extraction
3.2 Pre-hybridization
Biotinylation PCR
3.2.1 Mycoplasma Assay
Follow the protocol given by the commercial supplier of the DNA

extraction kit.
The two genomic targets in the 23S rRNA and tuf genes are amplified independently in two separate real-time PCRs. The former is
amplified in a simplex reaction, and the latter is co-amplified with
the internal control template, i.e., plasmid pGEM-EGFP2rev [33]
(see Note 5).
1. Prepare master mixtures according to Table 3 as a multiple of
20 l depending on sample numbers.
Table 3
Composition of the reaction mixtures for pre-hybridization real-time PCR in the Mycoplasma assay
Target
Components
Working
concentration
Volume per reaction

(total 20 l)
Final
concentration
23S rDNA
PCR-grade water
7 l
DyNAmoq PCR
Mastermix
10 l
Primer F1388
10 pmol/l
1 l
500 nM
Primer R1982
10 pmol/l
1 l
500 nM
DNA template
1 l
PCR-grade water
5.9 l
DyNAmoq PCR
Mastermix
10 l
Primer tuf-064F
10 pmol/l
1 l
500 nM
Primer tuf-681R
10 pmol/l
1 l
500 nM
ctrl primer EGFP-11F
10 pmol/
0.5 l
250 nM
ctrl primer EGFP-10R
10 pmol/l
0.5 l
250 nM
IC: pGEM-EGFP2reva
105 copies/l
0.1 l
104 copies/rxn
DNA template
1 l
tuf
IC internal control
201
2. Add template to each reaction vessel: 1 l of DNA extract from

your sample. If the DNA contents of the extract is low, up to
4 l of sample DNA can be used and the amount of water be
reduced accordingly.
3. In each series, include external amplification controls that
contain DNA of mycoplasma reference strains, e.g., M. bovis
PG45, as positive control, and water, instead of sample extract,
as negative control.
4. Run real-time PCR under the following conditions: initial
denaturation at 95 C for 10 min, 40 cycles of denaturation at
95 C for 30 s, annealing at 52 C for 30 s, and elongation at
72 C for 40 s.
5. For PCR product evaluation, proceed with dissociation curve
analysis at real-time PCR cycler, from 55 C to 95 C with
continuous recording of fluorescence. Melting curves of
mycoplasma-specific tuf amplicons typically show peaks
between 78 and 82 C and 23S rDNA amplicons between 82
and 86 C (see Note 6).
The chlamydia-specific target in the 23S rDNA is amplified alongside the internal control template pGEM-EGFP2rev in a conventional duplex PCR.
3.2.2 Chlamydia Assay
1. Prepare master mixtures according to Table 4 as a multiple of

20 l depending on the number of samples.
Table 4
Composition of reaction mixtures for pre-hybridization PCR in the Chlamydia assay
Components
Working
concentration
Volume per reaction

(total 20 l)
Final concentration
PCR-grade water
11.1 l
PCR buffer
10
2 l
MgCl2
50 mM
0.6 l
1.5 mM
dNTP
2 mM each
2 l
200 nM
Primer U23F-19
10 pmol/l
1 l
500 nM
Primer 23R-22
10 pmol/l
1 l
500 nM
ctrl primer EGFP-11F
10 pmol/l
0.5 l
250 nM
ctrl primer EGFP-10R
10 pmol/l
0.5 l
250 nM
IC: pGEM-EGFP2reva
105 copies/l
0.1 l
104 copies/rxn
Taq DNA polymerase
5 U/l
0.2 l
2U
DNA template
1 l
IC internal control
202
2. Add template to each reaction vessel: 1 l of DNA extract from

your sample. If the DNA contents of the extract is low, up to
4 l of sample DNA can be used and the amount of water be
reduced accordingly.
3. In each series, include external amplification controls that contain DNA of a chlamydial reference strain, e.g., C. psittaci
6BC, as positive control, and water, instead of sample extract,
as negative control.
4. Run PCR at conventional thermal cycler according to the following temperature-time profile: initial denaturation at 95 C
for 15 min, 40 cycles of denaturation at 94 C for 30 s, primer
annealing at 50 C for 90 s, primer extension at 72 C for 90 s,
and final extension at 72 C for 10 min.
5. Analyze PCR products by standard agarose gel electrophoresis. Expected fragment sizes are 171 bp for chlamydial DNA
and 276 bp for internal control (see Note 6).
3.3 DNA Microarray
Hybridization
1. For mycoplasma: transfer 0.5 l of each PCR product from

Subheading 3.2.1 into a 0.2 mL plastic tube and add 99 l of
hybridization buffer (buffer C1).
For chlamydia: transfer 1 l of the PCR product from
Subheading 3.2.2 into a 0.2 mL plastic tube and add 99 l of
hybridization buffer (buffer C1).
2. Denature DNA by heating at 95 C for 5 min. Cool down
immediately by putting the tube on ice for 1 min. Spin down
the liquid by centrifugation for 10 s.
3. Condition ArrayStrip by adding 100 l of water to each well.
Pipette the liquid up and down 4 times, and then discard it. Be
careful not to touch the array chip surface.
4. Add 100 l of C1 buffer to each well; shake on BioShake iQ at
50 C and 550 rpm for 5 min. Remove liquid.
5. Hybridization. Add the hybridization mix (100 l each) from
step 2 to AS wells. Incubate on BioShake iQ at 50 C
(Mycoplasma assay) or at 58 C (Chlamydia assay) at 550 rpm
for 60 min. Remove supernatant and discard it.
6. Add 200 l of washing buffer C2 to each well; wash at 45 C
(Mycoplasma assay) and at 43 C (Chlamydia assay) and
550 rpm for 10 min. Remove liquid and discard it.
7. Repeat step 6.
8. Combine 792 l of C4 and 8 l of C3 solutions (horseradish
peroxidase conjugated with streptavidin) in a plastic tube, vortex and spin down. The amount is for a single AS, i.e., 8 wells.
Add 100 l of this mix to each well. Incubate at 30 C and
550 rpm for 10 min. Remove supernatant.
203
9. Wash wells by adding 200 l of washing buffer C5 and 4 times

up-and-down pipetting at room temperature. Remove all the
liquid thoroughly and completely.
10. Add 100 l of D1 solution (peroxidase substrate) to each well;
incubate at room temperature for 5 min.
11. Remove liquid and put the AS assay into the ArrayMate reader.
3.4 Data Processing
and Interpretation
1. Conduct the reading process according to the instructions for

the ArrayMate equipment.
2. Transfer the image files (bmp format) to your computer and
process the data using the Iconoclust software.
3. Check signals of control probes: for a valid result, the signal of
the biotinylated staining control probe should be higher than
0.7. Only negative results are validated with the internal amplification/hybridization control. The hybridization signal of at
least one amplification/hybridization control probe should be
higher than 0.6.
4. Identify Mycoplasma or Chlamydia species using the
PatternMatch algorithm or perform manual species assignment as follows (see Note 7).
3.4.1 Manual
Identification
of Mollicutes Species
The following criteria need to be considered.

1. The intensity of all relevant signals must be higher than 0.2
(cutoff).
2. At least two species-specific hybridization signals at one target
gene and, at least, one species-specific hybridization signal at the
second target gene are required for a valid species assignment.
3. If two signals appear only at one target gene, the identification
is regarded as ambiguous or doubtful.
4. Some species are only differentiable at one target gene and
share a signal pattern with a sister species at the second target
gene: M. bovis/M. agalactiae, M. imitans/M. gallisepticum,
and M. yeatsii/M. cottewii.
5. The Mycoplasma mycoides cluster members can be differentiated only at species and not at subspecies level using the 23S
rRNA and tuf target genes.
3.4.2 Manual
Identification
of Chlamydia spp.
A typical bar diagram of a sample examined with the Chlamydia

assay is shown in Fig. 2. The following general rules will apply.
1. If all probes of a species show a hybridization signal intensity
higher than 0.07 (cutoff), the assignment to this species is
valid.
2. Species-specific and genus-specific signals must logically fit.
This means that signals of probes chlamydophila_1 + 2 have
204
Fig. 2 Examination of a cell culture sample using the Chlamydia assay. The species C. psittaci was identified.
The bar diagram reveals the following specific hybridization signals (from left to right ): family Chlamydiaceae
(two probes reacting), genus Chlamydia (Chlamydophila probes reacting), species C. psittaci (all four probes
reacting). Control reactions on the right-hand margin: background control for spotting buffer negative, internal
amplification/hybridization controls positive (three probes reacting), staining control positive. All other signals
represent cross-hybridization or are below cutoff. As the microarray carries three more sectors of spotted
Chlamydia probes, only the relevant parts are shown here
to appear alongside the species-specific signals of C. abortus, C.

caviae, C. felis, C. psittaci, C. pecorum, C. pneumoniae, C.
avium, or C. gallinacea, respectively. On the other side, the
signal of probe chlamydia_1 must appear together with the
species-specific signals of C. trachomatis, C. suis, or C. muridarum, respectively. Please note that the designation of the
genus-specific probes is historic and all three of them recognize the recently recombined genus Chlamydia.
205
3. If all relevant probes of two species show a reaction, one has to

assume a mixed (dual) infection.
4. A sample will be regarded as negative when all signal intensities
are below 0.07 or when the signal distribution contradicts the
logical fit in point 2.
Notes
1. The AS technology is easy to handle as it mainly involves standard laboratory equipment and, unlike in more expensive
microarray platforms, no sophisticated devices, such as hybridization chamber and fluorescence reader, are needed. In a
positive reaction, oligonucleotide probes covalently linked to a
glass surface will form a duplex with complementary target
DNA strands carrying a biotin label. To visualize the hybridization signal, a streptavidin-horseradish peroxidase conjugate
is added and allowed to cleave a tetramethylbenzidine-like substrate. As a result, dark blue precipitates will be formed at each
reactive spot.
The expenses for consumables are moderate, particularly
when the high degree of parallelity is taken into account. This
means that, for instance, a single AS test for Chlamydia spp. is
equivalent to 11 different PCR tests for the individual species.
Detection of mycoplasmas or chlamydiae using the AS assay
can be accomplished within a working day (68 h). This technology is manageable in a high-throughput environment, with
up to 40 samples per day and technician.
2. For mycoplasma identification, the 23S ribosomal (r) RNA
and elongation factor Tu (tuf) gene loci were shown to be suitable target regions with a high discriminatory potential at species level but also with high intraspecific stability [10, 34]. The
necessary discriminatory capacity and robustness of the assay
have been attained through this combinatorial two-target
approach. The current version of the mycoplasma microarray
(no. 5) carries five genus-specific (Mycoplasma and Ureaplasma)
and 142 species-specific oligonucleotide probes derived from
the 23S rDNA target, as well as 157 species-specific probes
from the tuf site, thus enabling identification of 83 Mollicutes
species from animals, birds, man, and cell cultures. The major
selection criterion for the hybridization probes was the specificity of the target sequence, i.e., at least two nucleotides difference to the second-best matching target. In rare cases where
this criterion is not fulfilled, species assignment will be possible
at the alternative target or by a combinatorial approach via analysis of more complex hybridization patterns. The selected oligonucleotides are sized between 20 and 36 nt, have an average
206
melting temperature of 59.2 C and an average G + C content

of 40 %, and are spotted twofold on the microarray glass surface. The array further includes three probes for the detection
of the internal amplification and hybridization control (pGEMEGFP2rev), a biotinylated oligonucleotide as staining control
and spotting buffer as background control.
3. For differentiation among Chlamydia spp., we identified a discriminating site in domain I of the 23S rRNA gene [32] and
derived all probes from there. The currently available version (no.
4) of the chlamydia array covers 11 different species of Chlamydia
and includes four family-specific probes (Chlamydiaceae), three
genus-specific (Chlamydia/Chlamydophila), and 38 probes for
11 Chlamydia spp. and the nearest relatives, i.e., Waddlia chondrophila and Simkania negevensis. In addition, 11 probes for
some of the chlamydia-like organisms outside the family
Chlamydiaceae are present. The oligonucleotides are sized
between 19 and 32 nt (mean 25), the average Tm is 56.4 C, and
G + C is 41 %. Control probes are equivalent to those on the
mycoplasma array. As an example, Fig. 2 shows the graphical output of a sample tested positive for C. psittaci.
4. For the sake of high specificity and stringency of the hybridization reaction, it is extremely important to ensure that the prescribed temperatures are actually attained in the AS vessel itself.
This requires heat transfer from the heatable shaker to the liquid contents of the AS vessel to be very rapid and efficient.
Most of the commercially available shakers are too slow, so that
too much time is lost until the necessary in-tube temperature
has been reached. In our hands, the BioShake iQ fulfills the
criteria to be used in the hybridization process.
5. The pre-hybridization PCR is the crucial step of agent detection and identification in terms of sensitivity. While 23S rDNA
primers were designed to exclusively amplify mycoplasmal or
chlamydial DNA, tuf primers are not completely specific for
the targeted Mollicutes species. They may also align to other
bacterial sequences in clinical samples leading to a competition
for PCR resources between mycoplasmal DNA and alternative
targets and lowering the sensitivity for mycoplasma detection.
6. We recommend agarose gel electrophoresis of PCR products
and, in the Mycoplasma assay, also dissociation curve analysis as
control methods to check amplification products. Nevertheless,
it is worth noting that samples exhibiting faint amplicon bands
and ambiguous dissociation curves may also produce clear
hybridization signals and valid hybridization patterns. As a rule
of thumb, samples showing Ct < 33 reliably give valid hybridization signals, while those with Ct 3336 will only occasionally produce positive signals.
207
7. The PatternMatch algorithm compares the experimentally

obtained signal pattern with those of reference strains representing 83 different Mollicutes species or 11 Chlamydia spp.,
respectively. It provides combined bar diagrams of sample and
reference, as well as two numerical parameters to assess the
similarity of two patterns and the accuracy of identification.
The matching score (MS) represents the sum of numerical differences between corresponding signal intensities of sample
and theoretical and/or practical reference hybridization patterns. Thus, the MS value is a measure of the overall dissimilarity between two hybridization patterns. An ideal match of two
patterns based on the same set of oligonucleotide probes will
yield MS = 0, whereas values greater than 45 in the Mycoplasma
assay or seven in the Chlamydia assay represent a poor match
that does not allow reliable species assignment (note: these
numerical limits may change when updated software versions
will appear in the future). The arithmetic difference between
best and second-best match, termed Delta MS, indicates the
reliability of a given species assignment. Values of Delta
MS 0.5 are regarded as representing a sufficient degree of
distinction between best and second-best matches. Manual
data interpretation and species assignment is possible, if
PatternMatch software is not available, and is recommended
for cases of dual- or multiple-species infection.
References
1. OIE (2013) OIE-Listed diseases, infections
and infestations in force in 2013. http://www.
oie.int/en/animal-health-in-the-world/
oie-listed-diseases-2013
2. Maunsell FP, Woolums AR, Francoz D et al
(2011) Mycoplasma bovis infections in cattle.
J Vet Intern Med 25:772783
3. Pfutzner H, Sachse K (1996) Mycoplasma bovis
as an agent of mastitis, pneumonia, arthritis
and genital disorders in cattle. Rev Sci Tech
15:14771494
4. Waites KB, Xiao L, Paralanov V, Viscardi RM,
Glass JI (2012) Molecular methods for the
detection of Mycoplasma and Ureaplasma
infections in humans: a paper from the 2011
William Beaumont Hospital Symposium on
molecular pathology. J Mol Diagn 14:
437450
5. Volokhov DV, Graham LJ, Brorson KA,
Chizhikov VE (2011) Mycoplasma testing of
cell substrates and biologics: review of alternative non-microbiological techniques. Mol Cell
Probes 25:6977
6. McAuliffe L, Ellis RJ, Lawes JR, Ayling RD,
Nicholas RA (2005) 16S rDNA PCR and
7.
8.
9.
10.
denaturing gradient gel electrophoresis; a single generic test for detecting and differentiating Mycoplasma species. J Med Microbiol
54:731739
Rebelo AR, Parker L, Cai HY (2011) Use of
high-resolution melting curve analysis to identify Mycoplasma species commonly isolated
from ruminant, avian, and canine samples.
Volokhov DV, George J, Liu SX et al (2006)
Sequencing of the intergenic 16S-23S rRNA
spacer (ITS) region of Mollicutes species and
their identification using microarray-based
assay and DNA sequencing. Appl Microbiol
Tonelli A, Sacchini F, Krasteva I et al (2012)
One test microbial diagnostic microarray for
identification of Mycoplasma mycoides subsp.
mycoides and other Mycoplasma species. Mol
Schnee C, Schulsse S, Hotzel H et al (2012) A
novel rapid DNA microarray assay enables
identification of 37 Mycoplasma species and
highlights multiple Mycoplasma infections.
PLoS One 7:e33237
208
11. OIE (2012) Avian chlamydiosis. World organisation for animal health: manual of diagnostic
tests and vaccines for terrestrial animals (chapter
2.3.1), vol. 1, 7th edn. Paris
12. OIE (2012) Enzootic abortion of ewes (ovine
chlamydiosis). World organisation for animal
health: manual of diagnostic tests and vaccines
for terrestrial animals (chapter 2.7.7), vol. 1,
7th edn. Paris
13. Sachse K, Vretou E, Livingstone M et al
(2009) Recent developments in the laboratory
diagnosis of chlamydial infections. Vet
Microbiol 135:221
14. Everett KD, Bush RM, Andersen AA (1999)
Emended
description
of
the
order
Chlamydiales, proposal of Parachlamydiaceae
fam. nov. and Simkaniaceae fam. nov., each
containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including
a new genus and five new species, and standards for the identification of organisms. Int J
Syst Bacteriol 49:415440
15. Stephens RS, Myers G, Eppinger M, Bavoil
PM (2009) Divergence without difference:
phylogenetics and taxonomy of Chlamydia
resolved. FEMS Immunol Med Microbiol
55:115119
16. Kuo C-C, Stephens RS, Bavoil PM, Kaltenboeck
B (2011) Genus Chlamydia Jones, Rake and
Stearns 1945, 55. In: Krieg NR, Staley JT,
Brown DR, Hedlund BP, Paster BJ, Ward NL,
Ludwig W, Whitman WB (eds) Bergeys manual of systematic bacteriology, vol 4, 2nd edn.
Springer, Heidelberg, pp 846865
17. Anonymous (2002) Avian chlamydiosis as a
zoonotic disease and risk reduction strategies.
SCAHAW (Scientific Committee on Animal
Health and Animal Welfare) European
Commission, Health & Consumer Protection
Directorate-General, SANCO/AH/R26/2002
18. Kaleta EF, Taday EM (2003) Avian host range
of Chlamydophila spp. based on isolation, antigen detection and serology. Avian Pathol
32:435461
19. Andersen AA, Vanrompay D (2000) Avian
chlamydiosis. Rev Sci Tech 19:396404
20. Pantchev A, Sting R, Bauerfeind R, Tyczka J,
Sachse K (2010) Detection of all Chlamydophila
and Chlamydia spp. of veterinary interest
using species-specific real-time PCR assays.
Comp Immunol Microbiol Infect Dis 33:
473484
21. Lenzko H, Moog U, Henning K et al (2011)
High frequency of chlamydial co-infections in
clinically healthy sheep flocks. BMC Vet Res
7:29
22. Sachse K, Laroucau K, Riege K et al (2014)

Evidence for the existence of two new members
of the family Chlamydiaceae and proposal of
Chlamydia avium sp. nov. and Chlamydia gallinacea sp. nov. Syst Appl Microbiol 37:7988
23. Buxton D, Anderson IE, Longbottom D et al
(2002)
Ovine
chlamydial
abortion:
characterization of the inflammatory immune
response in placental tissues. J Comp Pathol
127:133141
24. Reinhold P, Sachse K, Kaltenboeck B (2011)
Chlamydiaceae in cattle: commensals, trigger
organisms, or pathogens? Vet J 189:257267
25. Di Francesco A, Donati M, Rossi M et al
(2008) Tetracycline-resistant Chlamydia suis
isolates in Italy. Vet Rec 163:251252
26. Michel R, Daraoui A, Gorny M et al (2012)
Iodine-129 and iodine-127 in European seawaters and in precipitation from Northern
Germany. Sci Total Environ 419:151169
27. Kauffold J, Melzer F, Berndt A et al (2006)
Chlamydiae in oviducts and uteri of repeat
breeder pigs. Theriogenology 66:18161823
28. Borel N, Kempf E, Hotzel H et al (2008)
Direct identification of chlamydiae from clinical samples using a DNA microarray assay: a
validation study. Mol Cell Probes 22:5564
29. Braun SD, Ziegler A, Methner U et al (2012)
Fast DNA serotyping and antimicrobial resistance gene determination of Salmonella
enterica with an oligonucleotide microarraybased assay. PLoS One 7:e46489
30. Monecke S, Coombs G, Shore AC et al (2011)
A field guide to pandemic, epidemic and sporadic
clones
of
methicillin-resistant
Staphylococcus aureus. PLoS One 6:e17936
31. Geue L, Schares S, Mintel B et al (2010) Rapid
microarray-based genotyping of enterohemorrhagic
Escherichia
coli
serotype
O156:H25/H-/Hnt isolates from cattle and
clonal relationship analysis. Appl Environ
32. Sachse K, Hotzel H, Slickers P, Ellinger T,
Ehricht R (2005) DNA microarray-based
detection and identification of Chlamydia and
Chlamydophila spp. Mol Cell Probes 19:4150
33. Hoffmann B, Depner K, Schirrmeier H, Beer
M (2006) A universal heterologous internal
control system for duplex real-time RT-PCR
assays used in a detection system for pestiviruses. J Virol Methods 136:200209
34. Kamla V, Henrich B, Hadding U (1996)
Phylogeny based on elongation factor Tu
reflects the phenotypic features of mycoplasmas better than that based on 16S rRNA. Gene
171:8387
Chapter 16
In Situ Hybridization with Labeled Probes: Assessment
of African Swine Fever Virus in Formalin-Fixed
Paraffin-Embedded Tissues
Abstract
In situ hybridization (ISH) has become a very valuable molecular diagnostic tool to detect specific DNA
or RNA sequences in biological samples through the use of complementary DNA- or RNA-labeled probes.
Here, we describe an optimized in situ hybridization protocol to detect African swine fever virus (ASFV)
DNA in formalin-fixed, paraffin-embedded tissues using digoxigenin-labeled probes.
Key words In situ hybridization, Nucleic acid, Formalin-fixed paraffin-embedded tissues, Digoxigenin,
Molecular diagnostic tool, African swine fever virus
Introduction
In situ hybridization is a method that allows the precise location
and/or quantification of specific DNA or RNA sequences in morphologically preserved chromosomes, tissues, or cell preparations.
The principle of the technique is based on the remarkable stability
of the double DNA helix through the hydrogen bonding of complementary strands, which can be broken (DNA denaturation or
melting) with heat or chemicals and rejoined (DNA hybridization)
under normal conditions. Thus, specific nucleotide-labeled probes
are annealed to complementary sequences and visualized using different detection systems depending on the type of label used to tag
the probe [1].
Since the first ISH experiment in the late 1960s [2], in which
the method was applied to localize DNA/RNA hybrids in cytological preparations, the method has undergone many improvements to become an important tool for both research and diagnostic
purposes.
Nowadays, there are a variety of ISH procedures with different
applications [35] although the main steps are basically the same.
209
210
The purpose of this chapter is to describe an ISH protocol to detect

African swine fever virus (ASFV) genome in formalin-fixed,
paraffin-embedded tissues [6]. For this purpose, a double-stranded
DNA-digoxigenin-labeled probe isolated from purified virions was
used. The different steps of the protocol (probe preparation, permeabilization, hybridization, post-hybridization washes, and
detection) have been adapted to lead to higher specificity and sensibility of virus detection in different tissues.
Materials
Prepare all the stock solutions using ultrapure water- and analyticalgrade reagents and store them at room temperature (unless otherwise indicated). Please follow the lab security issues governed by
your national regulations on good laboratory practices, check how
to securely work with the chemicals described in this protocol, and
follow all waste disposal regulations diligently.
2.1
Probes
1. Restriction enzyme: MboI (see Note 1).

2. Purification kit for small dsDNA fragments (see Note 2).
3. Digoxigenin DNA labeling system (see Note 3).
4. Competitor DNA (see Note 4).
5. 3 M sodium acetate, pH 5.5: Dissolve 24.609 g of sodium
acetate trihydrate in 80 ml of water. Mix and adjust pH with
glacial acetic acid and add water to 100 ml. Sterilize by
autoclaving.
6. Absolute ethanol. Dilute with water to prepare also 70 % of
ethanol.
7. Hybridization buffer: 50 % (v/v) of formamide (see Note 5),
2 of SSC, 10 % (w/v) of dextran sulfate, 1 % (v/v) of Tween20. Prepare 1 L of 20 SSC, pH 6.3 stock solution by dissolving 175.3 g of NaCl, and 88.2 g of sodium citrate dihydrate in
800 ml of water. Adjust the pH with HCl and add water to
1 L. Sterilize by autoclaving. The final concentrations of the
ingredients are 3 M of NaCl and 0.3 M of sodium citrate. To
prepare 20 ml of hybridization buffer, use 10 ml of formamide,
2 ml of 20 SSC, 4 ml of 50 % (w/v) dextran sulfate solution,
and 2 ml of 10 % (v/v) Tween-20 and make up with water to
20 ml. Store in small aliquots at 20 C.
2.2
ISH
1. Automation buffer: 1 automation buffer was prepared in

water from a 10 stock solution (GeneTex) (see Note 6).
2. Protease solution: 0.25 mg/ml of proteinase K in 2 SSC (see
Note 7).
3. Denaturation solution: 70 % (v/v) of formamide in 2 SSC
(see Note 5).
Non-radioactive ISH to detect ASFV DNA in tissue sections
211
4. Humidified chamber or box (see Note 8).

5. Rubber cement.
6. Buffer 1: 100 mM of TrisHCl, pH 7.5, 150 mM of NaCl.
Prepare 1 L of buffer 1 by dissolving 12.11 g of Tris base and
8.765 g of NaCl in 900 ml of water and adjust the pH to 7.5
with HCl. Make up with water to 1 L. Sterilize by
autoclaving.
7. Buffer 2: 100 mM of TrisHCl, pH 9.5, 100 mM of NaCl,
50 mM of MgCl2. Prepare 1 L of buffer 2 by dissolving 12.11 g
of Tris base, 5.84 g of NaCl, and 10.17 g of magnesium chloride hexahydrate in 900 ml of water and adjust the pH to 9.5
with HCl. Make up with water to 1 L. Sterilize by
autoclaving.
8. Buffer 3: 10 mM of TrisHCl, pH 8, 1.27 mM of EDTA.
Prepare 1 L of buffer 3 by dissolving 1.211 g of Tris base
and 0.372 g of EDTA in 900 ml of water and adjust the pH
to 8 with HCl. Make up with water to 1 L. Sterilize by
autoclaving.
9. Wash solution 1: 0.5 SSC, 0.4 % (v/v) of Tween-20, 0.25 %
of Brij-35. To prepare 50 ml of wash solution 1, add 200 l of
Tween-20, 125 l of Brij-35, and 1250 l of 20 SSC and
make up with water to 50 ml (see Note 9).
10. Wash solution 2: 0.25 SSC, 0.4 % (v/v) of Tween-20, 0.25 %
of Brij-35. To prepare 50 ml of wash solution 2, add 200 l of
Tween-20, 125 l of Brij-35, and 625 l of 20 SSC and make
up with water to 50 ml (see Note 9).
11. Wash solution 3: 0.4 % (v/v) of Tween-20, 0.25 % of Brij-35.
To prepare 50 ml of wash solution 3, add 200 l of Tween-20
and 125 l of Brij-35 and make up with buffer 2 to 50 ml (see
Note 9).
12. Blocking solution: 1 % (v/v) of sheep serum, 0.3 % (v/v) of
Triton X-100. To prepare 50 ml of blocking solution, add
500 l of sheep serum, available commercially, and 150 l of
Triton X-100 and make up with buffer 1 to 50 ml (see Note 9).
2.3 Detection
System and
Counterstain
1. Anti-DIG solution: Anti-digoxigenin antibody conjugated

to alkaline phosphatase diluted in blocking solution (see
Note 10).
2. NBT/BCIP solution: Dilute 55 l of NBT/BCIP stock solution (18.75 mg/ml of nitro blue tetrazolium chloride and
9.4 mg/ml of 5-bromo-4-chloro-3-indolyl phosphate, toluidine salt, in 67 % (v/v) of dimethyl sulfoxide; available commercially) in 2 ml of Wash solution 3.
3. Fast Green solution: To prepare 250 ml of Fast Green solution, add 3.75 g of Fast Green FCF dye and make up with
water to 250 ml.
212
2.4 Special
Equipment
Several ISH steps (post-hybridization washes and detection) can

be performed in an automated workstation (e.g., MicroProbe
Staining Station, Fisher Scientific) to handle the slides and minimize reagent consumption. However, all the steps can also be
performed manually in coplin jars.
Methods
Carry out all the procedures at room temperature unless otherwise
specified.
3.1 Probe
Preparation
1. Digest total viral DNA, isolated from purified virions, with the
appropriate restriction enzyme following the manufacturer
instructions (see Note 11).
2. Purify the DNA after digestion using a DNA purification kit
and quantify the concentration of digested DNA (see Note 12).
3. Run an agarose gel to assure the complete digestion of viral
DNA by determining the length of the DNA fragments (Fig. 1)
(see Note 13).
4. Label the DNA fragments using a DNA labeling system,
following the instructions of the fabricant (see Note 14).
5. After DNA labeling, purify probes using a DNA purification
kit and quantify the concentration of the labeled DNA (see
Note 12).
6. Mix 300 ng of DNA-labeled probes (see Note 15) with 30 g
of competitor DNA and add water to obtain a precipitable
volume (minimum volume of 30 l).
Fig. 1 ASFV viral DNA digested with restriction enzyme. (a) Lane 1: DNA ladder.
Lane 2: two microliters (400 ng) of non-digested ASFV viral DNA. (b) Lane 1: DNA
ladder. Lane 2: ten microliters (763 ng) of MboI digested ASFV viral DNA
213
7. Precipitate the mixed DNA using a standard ethanol precipitation protocol (see Note 16).
8. Resuspend the DNA probes in 33 l of hybridization buffer
(see Note 17) and store at 20 C (see Note 18).
3.2 In Situ
Hybridization
1. Dewax paraffin-embedded tissue sections 3 times in xylene,

6 min each time (see Note 19).
2. Rehydrate the tissue sections through an ethanol series (2 times in
absolute ethanol, twice in 96 % ethanol, and once in water, 3 min
each time) and wash in 1 automation buffer (see Note 20).
3. Digest the tissue sections with 2530 l of protease solution
for 10 min at 37 C (see Note 21) in a humidified box. Cover
the sections with parafilm (see Note 22).
4. After the pretreatment with protease solution, wash all sections
with 1 automation buffer.
5. Denature the DNA probes at 75 C for 10 min and pre-anneal
them at 37 C for 90 min (see Note 23).
6. Denature the tissue sections at 75 C for 10 min in denaturation solution (see Notes 23 and 24).
7. Following tissue sections denaturation, distribute the 33 l of
each DNA probe preparation over each section, cover them
with coverslips, seal with rubber cement, and incubate in a
humidified box at 37 C overnight (see Note 25).
8. Following the overnight hybridization step, immerse the preparations in 2 SSC to allow the coverslips to drop off.
9. Wash the slides 2 with wash solution 1, 5 min each time.
10. Wash the slides with wash solution 2 at 37 C for 5 min.
11. Block the slides 2 with blocking solution, 5 min each time
(see Note 26).
12. Add anti-DIG solution and incubate for 1 h at 37 C (see
Note 27).
13. Rinse the slides 23 times with blocking solution.
14. Rinse the slides 34 times with 1 automation buffer.
15. Wash the slides with wash solution 3 for 5 min.
16. Add NBT/BCIP solution and incubate during 1520 min at
37 C in the dark (see Notes 28 and 29).
17. Rinse the slides 12 times with buffer 3 to stop the color reaction and deep the preparations into buffer 3 until the Fast
Green counterstaining step.
18. Counterstain the preparations with Fast Green solution for
10 min.
19. Wash with distilled water.
20. Mount sections and examine by light microscopy (Fig. 2) (see
Notes 30 and 31).
214
Fig. 2 ASFV-DNA detection using DIG-labeled probes in formalin-fixed paraffin-embedded tissues. (a) Negative
lymph node. (bf) Positive tissues, where dark-blue dots in the preparation correspond to the presence of viral
nucleic acids (examples of positive labeling are indicated with arrows). (b) Spleen. Intense positive detection
in red pulp macrophages and trabecular medullary areas. (c) Lymph node. Moderate positive detection in
perifollicular macrophages (marginal zone). (d) Liver. Moderate to intense positive detection in sinusoidal and
alveolar macrophages and Kupffer cells. (e) Kidney. Intense positive detection in circulating macrophages and
renal endothelium. (f) Lung. Intense positive detection in pulmonary alveolar, vascular, and parenchymal
macrophages
Notes
1. ISH experiments can be performed with different types of
probes (DNA, cDNA, RNA, oligonucleotides, etc.). One of
the limitations to overcome during the ISH procedure is the
probe size. When using probes of dsDNA, the optimal probe
size is between 200 and 500 bp. In our case, we are using all
the ASFV viral genome (approx. 180 kb) and, for that reason,
we choose a restriction enzyme, MboI, with a recognition site
equal to 4 bases long (GATC) to cut ASFV genome very frequently. This enzyme generates medium ASFV-DNA fragment
lengths of 300500 bp (Fig. 1).
2. Any method or commercial kit which recovers small dsDNA
fragments can be used here. We use Qiagen Nucleotide
Removal Kit (Qiagen).
3. dsDNA probes prepared by random priming present higher
yield of labeled probe compared with nick-translation method.
We use DIG-High Prime system (Roche) for labeling dsDNA
probes.
215
4. To avoid unspecific hybridization of labeled probes in the

cellular cytoplasm or slides, add unlabeled competitor
DNA. Usually, we use competitor DNA from different species,
available from commercial companies, such as fish sperm DNA
(100 g of competitor DNA for each microgram of DNA
probe).
5. Use deionized formamide. Wear appropriate gloves and safety
glasses when handling solutions containing formamide.
Formamide should be handled in a fume hood.
6. Alternatively, a PBS-Tween-20 buffer can be used: 1 PBS,
0.1 % (v/v) Tween-20. Add 1 ml of Tween-20 (take slowly) to
1 L of 1 PBS and stir for some time.
7. Prepare fresh solution immediately before use.
8. The humidified box consists of a closed plastic container (e.g.,
slide box) with paper towel at the bottom. Before use, humidify the paper towel with distilled water.
9. Prepare fresh solution and mix with a magnetic stirrer at low
speed for 15 min before use.
10. We use anti-digoxigenin antibody conjugated to alkaline phosphatase (Fab fragments from sheep, Roche) diluted 1:500.
11. As stated in Note 1, there are different types of probes.
Oligonucleotide probes have been successfully used to detect
small viruses [7, 8], but it depends on some viral characteristics
such us genome size, replication cycle, and/or the presence of
envelope. For pathogens with large DNA genomes, we recommend the use of longer probes (up to 500 bp) which will cover
more target sequences. We have previously tested three types of
DIG-labeled probes (a pool of three oligonucleotide probes, a
18.5 kb restriction enzyme viral DNA fragment, and a complete viral genome probe) to detect ASFV in formalin-fixed
paraffin-embedded tissues, and the genome full-length probe
was the most sensitive one [6]. The description of the culture
procedures and preparation of the purified virions is out of the
scope of this chapter but can be assessed in Carrascosa et al. [9].
12. A spectrophotometric or any other available method can be
used here for DNA quantification.
13. This step is very important to obtain probes with good penetration properties. If there is no available restriction enzyme,
DNA can be digested with DNase or disrupted by sonication.
14. It is important to test different quantities of template DNA to
obtain the highest yield of labeled probe. The amount of newly
synthesized labeled DNA depends on the purity of the template DNA and varies also depending on the starting template
DNA amount and the incubation time. We obtained the higher
yield of DIG-labeled probe from 100 ng of template DNA and
20 h of incubation.
216
15. Test different quantities of DNA-labeled probes to obtain the

optimal signal without increasing background. We have previously tested 150, 300, and 500 ng of DIG-labeled probes.
While the former led to weak signals, we obtained the same
sensitivity with the other two absolute quantities.
16. Add 1/10 volume of sodium acetate, 3 M, pH 5.5, and vortex.
Next, add 2.5 volumes of absolute ethanol and vortex.
Centrifuge at maximum speed (20,000 g) for 15 min at
4 C. Discard supernatant and rinse with 70 % ethanol.
Centrifuge again for 5 min at 4 C. Finally, discard supernatant
and allow the DNA pellet to dry in air for 10 min.
17. Vortex and allow the pellet of DNA to be homogenously resuspended at room temperature for 90 min. Vortex the sample
every 1015 min during the incubation.
18. You can prepare and stock several DNA-labeled probes. They
can be stored at 20 C during several months.
19. In our experiments, tissues were fixed in 10 % neutral buffered
formalin for 2 weeks. Prolonged fixation time is a critical step.
20. Tissue preparations can be maintained in 1 automation buffer
during the preparation of the protease solution.
21. This pretreatment step is crucial to increase the efficiency of
hybridization by increasing the target accessibility. The concentration of proteinase K and incubation time depend on tissue type and length of fixation. However, it is also important
to consider the virus isolate, which may present different virulence, and the target infected tissues, when performing the
protease treatment, because too much proteinase K can disintegrate the tissue totally. We recommend testing different
concentrations and incubation times of proteinase K before
performing the complete ISH protocol.
Although other protease treatments such as the use of pepsin has been proved to be very efficient in formalin-fixed
paraffin-embedded tissues, in our ISH experiments we obtained
a higher and more intense signal with better tissue integrity
and lower background using the proteinase K treatment [6].
22. Pre-warm the humidified box at 37 C. Cut small pieces of
parafilm and cover the tissue sections without pressing them.
23. Calculate the time of denaturation and pre-annealing to have
the DNA probes ready to use after the tissue section denaturation step.
24. We perform this step in a closed coplin jar in a water bath. As
the denaturation solution temperature is lower than the water
bath temperature, it is necessary to increase the water bath
temperature several degrees (510 C) to reach the desired
denaturation solution temperature. To assure no variations in
the hybridization temperature, we measure directly the tem-
217
perature of the denaturation solution. Do not open and close

the coplin jar very frequently to avoid temperature variations.
25. Before inserting the slides in the pre-warmed humidified box,
let the rubber cement dry completely. This step is very important to facilitate the contact of the DNA-labeled probes with
their target sequences.
26. This step can be done in the workstation by immersing the
whole slides in blocking solution or adding a drop (100
150 l) of blocking solution onto the slides.
27. This step can be done in the workstation filling by capillarity
the interspace existing between two slides or adding a drop
(100 l) of anti-DIG solution onto the sections and incubating
them in the humidified box following the same indications
pointed out in Note 22.
28. This step can be done in the workstation filling by capillarity
the interspace existing between two slides or adding a drop
(100150 l) of NBT/BCIP solution onto the sections.
29. A positive signal may be seen after a few minutes depending of
viral replication. The reaction time may be evaluated by checking microscopically the signal/noise ratio.
30. We use DPX mounting medium. Preparations are dehydrated
through an ethanol series (once in 70 % ethanol, once in 96 %
ethanol, and twice in absolute ethanol, 3 min each time) and
1 acetone-xylene (50:50) for 6 min, cleared twice for 6 min
each in xylene and mounted in DPX.
31. Prepare negative controls by omitting the specific probes in the
hybridization mix, using the specific probes in noninfected tissues or by using unrelated probes in infected tissues.
Acknowledgment
This work has been fully supported by the AGL2010-22229-C03-01
Project from the Ministerio de Economa y Competitividad,
Spanish Government.
References
1. Jin L, Lloyd RV (1997) In situ hybridization:
methods and applications. J Clin Lab Anal
11:29
2. Gall JG, Padue ML (1969) Formation and
detection of RNA-DNA hybrid molecules in
cytological preparation. Proc Natl Acad Sci U S
A 63:378383
3. Ballester M, Rodrguez-Cario C, Prez M et al
(2011) Disruption of nuclear organization dur-
ing the initial phase of African Swine Fever

Virus infection. J Virol 85:82638269
4. Jehan Z, Uddin S, Al-Kuraya KS (2012) In-situ
hybridization as a molecular tool in cancer diagnosis and treatment. Curr Med Chem
19:37303738
5. Wheeler G, Valoczi A, Havelda Z et al (2007)
In situ detection of animal and plant microRNAs. DNA Cell Biol 26:251255
218
6. Ballester M, Galindo-Cardiel I, Gallardo C et al

(2010) Intranuclear detection of African swine
fever virus DNA in several cell types from
formalin-fixed and paraffin-embedded tissues
using a new in situ hybridization protocol.
J Virol Methods 168:3843
7. Cubie HA, Grzybowski J, da Silva C et al
(1995) Synthetic oligonucleotide cocktails as
probes for detection of human parvovirus B19.
J Virol Methods 53:91102
8. Rosell C, Segals J, Plana-Duran J et al

(1999) Pathological, immunohistochemical,
and in-situ hybridization studies of natural cases
of postweaning multisystemic wasting syndrome (PMWS) in pigs. J Comp Pathol 120:
5978
9. Carrascosa AL, del Val M, Santarn JF et al
(1985) Purification and properties of African
swine fever virus. J Virol 54:337344
Chapter 17
Fluorescence InSitu Hybridization fortheTissue Detection
ofBacterial Pathogens Associated withPorcine Infections
HenrikElvangJensen, LouiseKruseJensen, KristianeBarington,
SusanneElisabethPors, ThomasBjarnsholt, andMetteBoye
Abstract
Fluorescence in situ hybridization (FISH) is an efficient technique for the identification of specific bacteria
in tissue of both experimental and spontaneous infections. The method detects specific sequences of
nucleic acids by hybridization of fluorescently labeled probes to complementary target sequences within
intact cells. FISH allows direct histological localization of the bacteria in the tissue and thereby a correlation between the infection and the histopathological changes present. This chapter presents protocols for
FISH identification of bacterial pathogens in fixed deparaffinized tissue samples mounted on glass slides.
Two different methods are presented: one is illustrated with the use of peptide nucleic acid (PNA) that is
carried out directly on glass slides (Method I), whereas the other is exemplified by using a DNA probe in
a Shandon rack (Method II). In the two methods, both PNA and DNA probes can be used.
Key words Bacteria, DNA, PNA, FISH, Fluorescence, Hybridization, In situ, Porcine, rRNA, Tissue
1 Introduction
Fluorescence in situ hybridization (FISH) has proven effective for
detecting specific species of bacteria in both experimental and
spontaneous infections in pigs (Table1). The method detects specific sequences of nucleic acids by hybridization of fluorescently
labeled oligonucleotide probes to complementary target sequences
within intact cells (Figs.1 and 2) [1]. FISH can be used for the
detection of DNA and RNA sequences [2]. For the identification
of bacteria by the FISH technique, ribosomal RNA (rRNA)-
targeting probes are most commonly applied because of the natural amplification of rRNA molecules [3]. Bacterial rRNA is present
in all cells and highly conserved between species, but still contains
variable sequences which serve as the target for identification at
species level. Bacterial 70S ribosomes consist of a 50S subunit and
a 30S subunit. The 50S subunit consists of two RNA molecules
219
GTCATTCCATCGAAACATA
CTCACGATGAACCTTCGAC
CCGCCTTACGGCAAACCT
GCTCATCGTGAAGCGAAA
TGGTTGAATGATGATGCC
TGTACTGGCTCACCTTTG
CTTTCCGCCTACACGCCC
TAGCTGATATCACATAGA
CTAACTTTCCTTTCCGCC
GTGTCTTCCACATTTCGT
L-G-Serp-1410-a-A-19
L-S-S.hyo-1210-a-A-19
L-S-B.murdoc-1219-a-A-18
S-S-S.pilo-0209-a-A-18
S-S-Cperfring-0185-a-A-18
S-S-Cl.diff-0193-a-A-18
S-O-Chls-0523-a-A-18
S-F-Cla-0574-a-A-18
S-G-Chla-0232-a-A-18
S-G-Chlph-0583-a-A-18
L-S-Efaecium-0347-a-A-18
Intestine
Intestine
Intestine
Intestine
Intestine
Intestine
Intestine
Intestine
Intestine
Intestine
Intestine
Genus Brachyspira
Brachyspira
hyodysenteriae
Brachyspira
murdochii
Brachyspira pilosicoli
Clostridium
perfringens
Clostridium difficile
Chlamydiales
Chlamydiaceae
Chlamydia
Chlamydophila
Enterococcus faecium
CCTCCGTATTACCGCAGC
CCCACCCTTTAATCCATAG
S-S-Ap-0185-a-A-19
Lung, ear, joints,

bone, brain
Actinobacillus
pleuropneumoniae
Probe sequence (53)
Systematic namea
Tissue sample
Target species
[20]
[21]
[21]
[21]
[21]
[19]
[19, 20]
[1517]
[17]
[15, 17,
18]
[1517]
[1114]
References
Table 1
Panel of rRNA-targeting probes used for the detection of pathogenic bacteria by fluorescence in situ hybridization in porcine tissue samples
220
Henrik Elvang Jensen et al.
CCCAGTCCTCATGACCAG
S-G-Leptospira-1414-a-A-18
S-S-L.intrac-1148-a-A-20
S-S-M.hyop-0466-a-A-18
S-S-M.hyos-0466-a-A-18
S-S-M.hyor-0193-a-A-18
S-S-Pmul-0449-a-A-20
L-S-Sal-1713-a-A-18
S-S-S.suis-0183-a-A-18
S-S-Treponema-0833-a-A-18
Intestine
Intestine
Lung, heart
Lung, heart,
joints
Lung, heart
Lung, heart,
kidney
Intestine
Heart, brain
Intestine
Leptospira
interrogans
Lawsonia
intracellularis
Mycoplasma
hyopneumoniae
Mycoplasma
hyosynoviae
Mycoplasma
hyorhinis
Pasteurella
multocida
Salmonella spp.
Streptococcus suis
Treponema spp.
According to Alm etal. [35]
CCATGCGGTAAATACTGT
L-S-Kpneu-1705-a-A-18
Intestine
Klebsiella
pneumoniae
AATCACTTCACCTACGTG
CTATTTAACAACATCCCTTC
GCTGTGAAGCTCCTTTCT
CCGTCAGTTCAGTTGCAT
CCGTCAAGACTAGAGCAT
AACCGGAGCAGTCTCTCTAG
CGGGTGCTCCCCACTCAG
TACACACCAGCGTGCCTT
CACCGTAGTGCCTCGTCATCA
L-S-Eco-1531-a-A-21
Intestine
Escherichia coli
TCCCTCTTCCTATCGTTC
S-S-E.rhusiopathiae-0449-a-A-18
Heart
Erysipelothrix
rhusiopathiae
[24]
[22, 34]
[32, 33]
[30, 31]
[29]
[29]
[29]
[6, 2528]
[24]
[20]
[23]
[22]
FISH for the Detection of Bacterial Infections

221
Fig. 1 FISH using oligonucleotide probes. FISH probes can be classified as DNA or PNA probes depending on
the structure of the backbone. PNA probes are non-charged which allow a tighter and more specific binding to
RNA nucleic acid targets. DNA probes must overcome a destabilizing electrostatic repulsion during hybridization. The fluorescently labeled probes target RNA of the bacterial ribosomes (rRNA). The 16S and 23S rRNA
gene sequences contain hyper variable regions that can provide species-specific signature sequences useful
for bacterial identification, which most often is utilized in FISH. A adenine, T thymine (DNA specific), G guanine,
C cytosine, and U uracil (RNA specific)
Fig. 2 Visualization of Lawsonia intracellularis (red) by in situ hybridization within

a cross section of a porcine ileum. The tissue is green due to autofluorescence.
From: Mlbak etal., 2008, Vet Microbiol, 128, 96107 [25], with permission
223
Fig. 3 A bone with osteomyelitis is fixated in formalin and afterward embedded in paraffin. The block of paraffin
is cut with a microtome and the tissue is mounted on glass slides. It is necessary to remove the paraffin before
the application of the FISH probe. Following hybridization, it is possible to see the fluorescent bacteria within
the tissue using a microscope or a scanner equipped for fluorescence
(5S and 23S), while the 30S subunit consists of a single RNA
molecule (16S). The 16S rRNA is the preferred target for the identification of specific bacteria due to its combination of conserved
sites and variable regions [4]. The 23S rRNA subunit may be used
as well; however, as it has not been sequenced in a number of bacteria, most probes are targeting specific 16S rRNA.The FISH
technique is easy to apply and of a low cost [1]. When the probes
have been designed and evaluated, the FISH technique can be
completed in a few hours [5]. In addition, the technique allows the
direct localization of the bacteria in the tissue and thereby a histological correlation between the bacteria the tissue morphology and
the pathological changes present (Fig.2). Predominantly, viable
cells are detected as rRNA is fragile and rapidly disintegrates if the
cell has suffered irreversible damage [6]. Because the identification
of bacteria by FISH is dependent on the sequence of the probe, the
technique will not identify unknown species [4]. However, universal (pan-bacterial) probes are useful for the initial screening of sections for contents of bacteria [1].
The FISH technique consists of four steps: (1) fixation and
permeabilization of the sample, (2) hybridization, (3) removing
unbound probe, and (4) detection of labeled cells (Figs.2 and 3).
224
Fig. 4 (a) Direct labeling of the 3 tail of the probe. (b) Direct labeling of the 5 tail
of the probe. (c) Labeling of the probe with a reporter molecule which is detected
by a fluorescent antibody. (d) Labeling of the probe with horseradish peroxidase
(HRP) using a substrate for an enzymatic signal amplification
Tissue samples must be fixed and permeabilized prior to hybridization

to preserve nucleic acids and ensure that the fluorescently labeled
probes can enter the cells. At hybridization, the probe binds to a
specific sequence of rRNA inside the bacterial cells (Fig.1). After
removing any unbound probe by briefly rinsing, the tissue sample
is ready for screening for reacting cells by fluorescence microscopy
[3, 7].
The classical DNA probes consist of fluorescently labeled oligonucleotides or polynucleotides, targeting a specific sequence of
microbial rRNA (Fig.1) [3]. Moreover, peptide nucleic acid (PNA)
probes have been developed (Fig.1). The PNA probes, which are
oligomers of single bases linked by a peptide backbone, are more
stable to degradation and hybridize to complementary sequences
with a higher affinity compared to the classical probes [1, 3, 7].
Probes can be labeled directly or indirectly (Fig.4). Direct labeling
of probes does not require further procedures after hybridization.
Indirect labeling of probes uses a reporter molecule or an enzyme
bound to the probe and will often result in a brighter signal (Fig.4).
225
Fig. 5 Visualization of Bifidobacterium spp. (green) and Megasphaera elsdenii

(red) by in situ hybridization in a formalin-fixed porcine colon tissue sample
After hybridization, a fluorescent antibody or substrate for enzymatic

signal amplification is added depending on the type of labeling of
the probe [1]. Identification of different bacterial species in a single
tissue sample can be carried out by the application of different fluorophores labeled to each type of probe (Fig.5).
A number of genus- and species-specific probes have successfully been designed and applied for the detection of bacteria of
importance in the pig (Table1), some being available commercially, e.g., Staphylococcus aureus [8].
In the following sections of materials and methods, two different methods (I and II) for FISH are included (Subheadings2.4
and 3.5 for Method I and Subheadings2.5 and 3.6 for Method
II). Both methods require fixation of tissue (Subheadings2.1
and 3.1; Fig.3), deparaffinization (Subheadings2.2. and 3.2;
Fig.3), and preparation of the probe solution (Subheadings2.3,
3.3, and 3.4).
2 Materials
2.1 Fixation
ofTissue (Fig.3)
1. Tissue sample.
2. 10% neutral-buffered formalin, pH6.8 (formaldehyde,
3740%: 100mL/L; distilled water 900mL/L; sodium
phosphate, monobasic 4.0g/L; sodium phosphate, dibasic
(anhydrous) 6.5g/L).
3. 70%, 96%, and 99% ethanol.
4. Xylene.
226
5. Paraffin wax.
6. Bowl of water.
7. Plastic container with a tight-fitting lid.
8. Tissue cool plate.
9. Microtome.
10. Adhesive glass slides, e.g., SuperFrost Plus slides (Gerhard
Menzel GmbH, Braunschweig, Germany), poly-l-lysine-coated
glass (Ted Pella, Inc., Redding, CA, USA), or Biobond Tissue
Section Adhesive (AX-LAB, Copenhagen, Denmark).
2.2 Deparaffinization
(Fig.3)
1. Paraffin-embedded tissue sections on glass slides.

2. Xylene.
3. 96% and 99.9% ethanol.
4. Sterile water.
5. Incubator (60C).
2.3 Probe Solution
1. Probe in stock, PNA or DNA probes (see Table1 for examples

of probe sequences).
2. Hybridization buffer, 50mL of 1M TrisHCl (pH7.2),
90mL of 5M NaCl, 5mL of 10% (w/v) sodium dodecyl
sulfate (SDS), and H2O up to total volume of 500mL (the
final composition of the hybridization buffer is 100mM of
TrisHCl (pH7.2), 0.9M of NaCl, and 0.1% of SDS).
3. Crushed ice.
4. Styrofoam box.
5. Microcentrifuge tubes (1.5mL).
2.4 Method I:
Hybridization
withPNA or DNA
Probes onTissue
Sections Mounted
onGlass Slides (Fig.3)
1. Tissue sections on glass slides (deparaffinized).

2. Probe solution.
3. Coverslips, thickness 0.15mm.
4. Pencil.
5. Heating block (55C) with a lid (see Note 1).
6. Washing buffer (55C), 50mL of 1M TrisHCl (pH7.2),
90mL of 5M NaCl, and H2O up to total volume of 500mL
(the final composition of the washing buffer is 100mM of
TrisHCl (pH7.2) and 0.9M of NaCl) (see Note 1).
7. Antifading mounting media, e. g., VECTASHIELD mounting
media with 4,6-diamidino-2-phenylindole (DAPI) (Vector
Labo
ra
tories, Burlingame, CA, USA) or ImmunoSelect
Antifading Mounting Medium (Dianova Gmbh, Hamburg,
Germany).
227
8. Fluorescence microscope equipped with a 40100 oil objective

and a 100W mercury lamp or similar, camera for fluorescence,
and the correct filter sets for the chosen fluorescent-labeled
probes to be used.
9. Nonfluorescent immersion oil for microscopy.
2.5 Method II:
Hybridization withDNA
or PNA Probes
onTissue Sections
Mounted onGlass
Slides Using aShandon
Rack (Fig.6)
1. Tissue sections on glass slides (deparaffinized).

2. Probe solution.
3. Shandon rack (Thermo Shandon, Cheshire, United Kingdom).
4. Deionized water.
5. Washing buffer, 55C (see Subheading2.4 and Note 1).
6. Tinfoil.
7. Incubator.
8. Hybridization buffer, 55C (see Subheading2.3 and Note 1).
9. Coplin jar.
10. Clean lab napkin or open slide box.
11. MilliQ water.
12. Coverslips, thickness 0.15mm.
13. Antifading mounting media (see Subheading2.4).
14. Fluorescence microscope (see Subheading2.4).
15. Nonfluorescent immersion oil for microscopy.
3 Methods
3.1 Fixation
ofTissue (Fig.3)
1. Fix the tissue samples by immersion in 10% neutral-buffered

formalin for 13days in a plastic container with a tight-fitting
lid (see Note 2).
2. After fixation, process the tissues through graded concentrations of ethanol (70%, 96%, and 99%) and xylene and finally
embed in paraffin wax.
3. Place the paraffin-embedded tissue blocks on a tissue cool plate
(5C) for a minimum of 5min.
4. Cut sections at 45m thickness using a microtome and gently transfer to a bowl of water.
5. Mount the tissue sections on adhesive glass slides (by placing
the slide beneath the tissue while it is still on the water surface
and lifting it out of the water) (see Note 3).
6. Let the slides dry at room temperature (1822C).
228
Fig. 6 Detection of bacteria with FISH in tissue mounted on glass slide using a
Shandon rack
3.2 Deparaffinization
(Fig.3)
Prior to hybridization, paraffin wax must be removed and tissue

sections rehydrated by completing the following six steps of
deparaffinization:
1. Incubate the paraffin-embedded tissue sections on glass slides
at 60C for 1h.
2. Immerse the slides in xylene 2 times for 25min.
3. Immerse the slides in 99.9% ethanol 12 times for 23min.
4. Immerse the slides in 96% ethanol 12 times for 23min.
229
5. Immerse the slides in sterile water 3 times for 3min.

6. Air-dry the slides at room temperature (1822C).
7. After deparaffinization, slides are ready for hybridization
3.3 Selecting
aProbe
3.4 Probe Solution
Nucleotide sequences of DNA and RNA can be found in online

databases as, e.g., GenBank (http://www.ncbi.nlm.nih.gov/genbank/), DNA DataBank of Japan (http://www.ddbj.nig.ac.jp/),
the European Molecular Biology Laboratory (http://www.embl.
de/), SILVA rRNA database project (http://www.arb-silva.de/), and
Greengenes (http://greengenes.secondgenome.com/). Complete
nucleotide sequences of rRNA from various porcine pathogenic
bacteria are available. Species-specific probes are designed by applying software such as ARB (Technische Universitt Mnchen,
Munich, Germany, http://www.arb-home.de/) on gene databases
as those mentioned above. Labeled probes can be ordered by
providing the nucleotide sequence of the specific sequence of
rRNA at, e.g., GenScript USA Inc., Piscataway, NJ, USA; Tag
Copenhagen, Copenhagen, Denmark; Eurofins MWG Operon
AG, Ebersberg, Germany; and AdvanDx Inc., Woburn,
Massachusetts, USA (see Note 6). Although a probe seems specific
according to the software used, it is mandatory to have the specificity verified on a panel of well-characterized mono-bacterial tissue
infections. One limiting issue when designing probes for FISH is
that not all sites within the rRNA molecules are readily accessible
for hybridization [9].
The method should be repeated with EUB338 and non-EUB338
as positive and negative controls, respectively, in hybridization experiments [10].
1. PNA probes are typically received ready for use and are stored
at 4C (see Note 7).
2. DNA probes are stored at 20C or 80C (see Note 7).
If the probe is delivered as lyophilized, it should be dissolved
in nuclease-free sterile water, e.g., to a stock concentration of
500ng/L.
3. Thaw the probes and keep them on ice within a Styrofoam box
in the dark until preparing the probe solution. For each slide,
100L solution of probe should be used. Calculate with one
extra slide in each hybridization solution. Calculate the total
volume (Vtotal) of probe solution needed by using the following
formula (where nslide=number of slides):
V total = 100 m L (1 + nslide )
230
4. The concentration of the probe in the solution should be

5ng/L for each probe. To calculate the volume needed from
the probe in stock (Vprobe in stock), use the following formulas:
m probe = V total 5ng / m L
V probe in stock =
m probe
C probe in stock
The mprobe is the mass of the probe needed in ng, while the Cprobe in
stock is the concentration of the probe in stock in ng/L.Calculate
the volume of hybridization buffer (Vhybridization buffer) by using the
following formula:
V hybridization buffer = V total - V probe in stock
The calculated volumes of hybridization buffer (Vhybridization buffer)
and probe in stock (Vprobe in stock) are mixed in a microcentrifuge
tube.
For example, preparing a probe solution for four slides and an
extra slide:
V total = 100 m L (1 + 4 ) = 500 m L
The concentration of the probe solution should be 5ng/L.If the
concentration of the probe solution in stock is 13.5ng/L:

m probe = 500 m L 5ng / m L = 2, 500 ng

V probe in stock =
2, 500 ng
= 185.2 m L
13.5ng / m L
V hybridization buffer = 500 m L - 185.2 m L = 314.8 m L.
185.2 L of the probe solution in stock should be mixed with

314.8L of hybridization buffer to get at total volume of 500L
with a concentration of 5ng of probe per L.
3.5 Method I:
Hybridization
withPNA or DNA
Probes onTissue
Sections onGlass
Slides (Fig.3)
1. Place the slides with the tissue sections on a flat surface.

2. Add 50L (1 droplet) of the probe solution to each slide.
3. Place a coverslip on top of the material. Gently spread the
probe under the slide and remove any bubbles by pressing the
coverslip using a pencil.
4. Place the slide and coverslip on a heating block for hybridization
at 55C for 90min covered by a lid (see Notes 1, 7, and 8).
5. Remove the coverslip by dipping the slide in washing buffer.
6. Wash slides for 30min at 55C in washing buffer (see Notes 1
and 9).
231
7. Apply antifading mounting media and add a coverslip to each

slide. Gently press the slide with a pencil to spread the antifading mounting media and to remove bubbles.
8. Inspect slides by using a fluorescence microscope equipped
with a camera and the appropriate filters for fluorescein isothiocyanate (FITC) (excitation/emission: 492495nm/520
525nm), a Texas Red (excitation/emission: 591596nm/
608620nm), and a DAPI (excitation/emission: 340
359nm/461488nm). Also a dual FITC/Texas Red and a
dual DAPI/Texas Red filter may be used (see Notes 10 and 11).
3.6 Method II:
Hybridization
withDNA or PNA
Probes onTissue
Sections onGlass
Slides Using
aShandon Rack
(Fig.6)
1. Open the Shandon rack by lifting the top rack. Pour 23mL
deionized water in the bottom container (see Note 12).
2. Place the rack lid bottom up on the bench. Lay the cover plate
horizontally across the rack lid, front side up. Place a few drops
of washing buffer on the cover plate.
3. Place the tissue slide on the cover plate; tissue section must
face the front of the cover plate (see Note 13).
4. The tissue slide should be placed within the six stop notches on
the cover plate. A hybridization chamber of about 80L is
thereby formed between the cover plate and the slide.
5. Place the hybridization chamber upright in the Shandon rack
chamber slot so that the rectangular stop notch in the slot fits
exactly (clicks in place) into the rectangular hole in the middle of the spring clamp.
6. Apply 100L of probe solution to the hybridization chambers top well.
7. Place the lid on the Shandon rack, wrap it in tinfoil, and incubate overnight at 55C.Place the buffers in the incubator
together with the Shandon rack in order to equilibrate them to
the washing temperature of 55C (see Notes 1 and 9).
8. On the second day, remove the tinfoil and the lid from the rack
and place it back in the incubator. Apply warm (55C) hybridization buffer to the hybridization chambers top well
(see Notes 1 and 14). Let the buffer run through and repeat
the procedure two times. Repeat this with the washing buffer.
9. Fill a Coplin jar with MilliQ water, remove the slide from the
cover plate, and place it in the jar for 12min at room
temperature.
10. Remove the slides from the Coplin jar and place them in the
incubator 55C on a clean lab napkin or in an open slide box
until they air-dry (see Note 1).
11. Apply antifading mounting media and add a coverslip to each
slide. Gently press with a pencil to spread the antifading
mounting media under the slide and to remove bubbles.
232
12. Inspect slides by using a fluorescence microscope equipped with

a camera and the appropriate filter sets for fluorescein isothiocyanate (FITC) (excitation/emission: 492495nm/520525nm),
a Texas Red (excitation/emission: 591596nm/608620nm),
and a DAPI (excitation/emission: 340359nm/461488nm).
Also a dual FITC/Texas Red and a dual DAPI/Texas Red filter
set may be used (see Notes 10 and 11).
4 Notes
1. The temperature of the hybridization buffer, washing buffer,
heating block, and incubator when using DNA probes depends
on the melting temperature (Tm) of the probe. This may vary
from 35C to 60C.Preliminary specificity tests should be
carried out at 10C below the Tm of the actual probe. PNA
probes are always run at 55C.
2. Formalin is carcinogenic; therefore, only handle it when wearing nitrile gloves and in a fume hood. For ensuring maximum
retention of nucleic acids, fixation should be carried out
promptly. Apart from formalin, which is a cross-linking fixative, a number of other fixation techniques may be used, e.g.,
freezing, formaldehyde based on paraformaldehyde, and Carnoys
fixative, but also acetic acid and ethanol can be used before
cryostat sectioning.
3. Paraffin-embedded tissue sections must not be folded when
mounted on a glass slide. Changing the temperature of the
water in the bowl can help unfold the tissue sections. For most
tissues, 47C is optimal, but5C may solve folding problems. When mounting brain and skin tissue, a lower temperature of approximately 37C is often required.
4. Slides with tissue sections treated through steps 1 to 3 in the
deparaffinization process can be removed directly from 99.9%
ethanol (deparaffinization step 3) and left to air-dry on a clean
paper napkin before hybridization.
5. In order to facilitate the penetration of the probe, pretreatment
is necessary for some Gram-positive species before the FISH procedure. Lysozyme is used on streptococci and on staphylococci
in FISH.This enzyme helps the oligonucleotide with the fluorescent dye molecule to enter the bacterial cell. Lysozyme pretreatment is done on the slide. We routinely use 3mg/ml lysozyme
solution in 100mM TrisHCL, 50mM EDTA, pH7.2, for
10min. Lysozyme treatment is done after the ethanol series.
6. When a probe has been designed in silico, its specificity should
be verified by looking up the sequence in other databases
afterward.
233
7. Whenever possible, protect the probe solution and the glass

slides with tissue samples from light. Fluorescent probes are
degraded by light. If PNA probes are not received ready for
use, the probe solution to be used can be prepared as described
for the DNA probe.
8. The use of a coverslip may be omitted.
9. Make sure that you have enough hybridization (only for
Method II) and washing buffers for the washing procedure.
You will need 1012mL of each buffer per slide.
10. If there is green fluorescent protein (GFP), the sample should
preferably be visualized immediately after it is prepared.
11. Autofluorescence may appear; make sure that the fluorescent
signal is correlated to the size and morphology of the investigated cells (Fig.2). The fluorescent signal should only appear
when using the correct filter set, not in other spectra.
12. The Shandon rack must never contain more deionized water
than the maximum volume marker on the inside of the container indicates.
13. In order to avoid air bubbles, moisten the tissue section with
washing buffer before placing it on the cover plate.
14. A squirt flask can be used to apply warm (55C, see Note 1)
hybridization buffer to the hybridization chambers top well
when using a Shandon rack.
References
1. Moter A, Gobel UB (2000) Fluorescence in
situ hybridization (FISH) for direct visualization of microorganisms. J Microbiol Methods
41:85112
2. Levsky JM, Singer RH (2003) Fluorescence in
situ hybridization: past, present and future.
J Cell Sci 116:28332838
3. Bottari B, Ercolini D, Gatti M etal (2006)
Application of FISH technology for microbiological analysis: current state and prospects.
Appl Microbiol Biotechnol 73:485494
4. Fraher MH, OToole PW, Quigley EM (2012)
Techniques used to characterize the gut microbiota: a guide for the clinician. Nat Rev
Gastroenterol Hepatol 9:312322
5. Wagner M, Haider S (2012) New trends in
fluorescence in situ hybridization for identification and functional analyses of microbes. Curr
Opin Biotechnol 23:96102
6. Jensen TK, Christensen BB, Boye M (2006)
Lawsonia intracellularis infection in the large
intestines of pigs. APMIS 114:255264
7. Amann R, Fuchs BM (2008) Single-cell identification in microbial communities by improved

fluorescence in situ hybridization techniques.
Nat Rev Microbiol 6:339348
8. Johansen LK, Koch J, Frees D etal (2012)
Pathology and biofilm formation in a porcine
model of staphylococcal osteomyelitis. J Comp
Pathol 147:343353
9. Behrens S, Rhland C, Incio J etal (2003)
In situ accessibility of small-subunit rRNA of
members of the domains Bacteria, Archaea and
Eucarya to Cy3-labeled oligonucleotide probes.
Appl Environ Microbiol 69:17481758

10. Wallner G, Amann R, Beisker W (1993)
Optimizing fluorescent in situ hybridization
with rRNA-targeted oligonucleotide probes
for flow cytometric identification of microorganisms. Cytometry 14:136143
11. Jensen TK, Boye M, Hagedorn-Olsen T etal
(1999) Actinobacillus pleuropneumoniae osteomyelitis in pigs demonstrated by fluorescent in
situ hybridization. Vet Pathol 36:258261
234
12. Madsen L, Boye M, Jensen TK etal (2001)

Actinobacillus pleuropneumoniae demonstrated
in situ in exudative meningitis and nephritis.
Vet Rec 149:746747

13. Kvist P, Jensen E, Aalbaek B etal (2002)
Evaluation of the pathology, pathogenesis and
aetiology of auricular elephantiasis in slaughter
pigs. J Vet Med A 49:517522
14. Soerensen C, Holmskov U, Aalbaek B etal
(2005) Pulmonary infections in swine induce
altered porcine surfactant protein D expression
and localization to dendritic cells in bronchial-
associated lymphoid tissue. Immunology 115:
526535
15. Boye M, Jensen TK, Moller K etal (1998)
Specific detection of the genus Serpulina,
S. hyodysenteriae and S. pilosicoli in porcine
intestines by fluorescent rRNA in situ hybridization. Mol Cell Probes 12:323330
16. Jensen TK, Moller K, Boye M etal (2000)
Scanning electron microscopy and fluorescent
in situ hybridization of experimental Brachy
spira (Serpulina) pilosicoli infection in growing
pigs. Vet Pathol 37:2232
17. Jensen TK, Christensen AS, Boye M (2010)
Brachyspira murdochii colitis in pigs. Vet Pathol
47:334338
18. Jensen TK, Boye M, Moller K etal (1998)
Association of Serpulina hyodysenteriae with
the colonic mucosa in experimental swine dysentery studied by fluorescent in situ hybridization. APMIS 106:10611068
19. Sangild P, Siggers R, Schmidt M etal (2006)
Diet- and colonization-dependent intestinal
dysfunction predisposes to necrotizing enterocolitis in preterm pigs. Gastroenterology
130:17761792
20. Cilieborg MS, Boye M, Molbak L etal (2011)
Preterm birth and necrotizing enterocolitis
alter gut colonization in pigs. Pediatr Res
69:1016
21. Pollmann M, Nordhoff M, Pospischil A etal
(2005) Effects of a probiotic strain of
Enterococcus faecium on the rate of natural
chlamydia infection in swine. Infect Immun
73:43464353

22. Jensen HE, Gyllensten J, Hofman C etal
(2010) Histologic and bacteriologic findings
in valvular endocarditis of slaughter-age pigs.
23. Gustavo Hermes R, Molist F, Francisco Perez J
etal (2013) Casein glycomacropeptide in the
diet may reduce Escherichia coli attachment to
the intestinal mucosa and increase the intestinal
lactobacilli of early weaned piglets after an
enterotoxigenic E. coli K88 challenge. Br J Nutr
109:10011012

24. Molbak L, Klitgaard K, Jensen TK etal
(2006) Identification of a novel, invasive, not-
yet-cultivated Treponema sp. in the large intestine

of pigs by PCR amplification of the 16S rRNA
gene. J Clin Microbiol 44:45374540
25. Boye M, Jensen TK, Moller K etal (1998)
Specific detection of Lawsonia intracellularis
in porcine proliferative enteropathy inferred
from fluorescent rRNA in situ hybridization.
Vet Pathol 35:153156
26. Molbak L, Johnsen K, Boye M etal (2008)
The microbiota of pigs influenced by diet texture and severity of Lawsonia intracellularis
infection. Vet Microbiol 128:96107
27. Boutrup TS, Boesen HT, Boye M etal (2010)
Early pathogenesis in porcine proliferative
enteropathy caused by Lawsonia intracellu
laris. J Comp Pathol 143:101109
28. Jensen TK, Boesen HT, Vigre H etal (2010)
Detection of Lawsonia intracellularis in
formalin-fixed porcine intestinal tissue samples:
comparison of immunofluorescence and in-situ
hybridization, and evaluation of the effects of
controlled autolysis. J Comp Pathol 142:18
29. Boye M, Jensen TK, Ahrens P etal (2001)
In situ hybridisation for identification and differentiation of Mycoplasma hyopneumoniae,
Mycoplasma hyosynoviae and Mycoplasma hyor
hinis in formalin-fixed porcine tissue sections.
APMIS 109:656664

30. Mbuthia P, Christensen H, Boye M etal
(2001) Specific detection of Pasteurella
multocida in chickens with fowl cholera and
in pig lung tissues using fluorescent rRNA
in situ hybridization. J Clin Microbiol 39:
26272633
31. Pors SE, Hansen MS, Bisgaard M etal (2011)
Occurrence and associated lesions of Pasteurella
multocida in porcine bronchopneumonia. Vet

32. Nordentoft S, Christensen H, Wegener H
(1997) Evaluation of a fluorescence-labelled
oligonucleotide tide probe targeting 23S rRNA
for in situ detection of Salmonella serovars in
paraffin-embedded tissue sections and their
rapid identification in bacterial smears. J Clin
33. Martin-Pelaez S, Costabile A, Hoyles L etal
(2010) Evaluation of the inclusion of a mixture
of organic acids or lactulose into the feed of
pigs experimentally challenged with Salmonella
Typhimurium. Vet Microbiol 142:337345
34. Boye M, Feenstra A, Tegtmeier C etal (2000)
Detection of Streptococcus suis by in situ hybridization, indirect immunofluorescence, and
peroxidase-
antiperoxidase assays in formalin-
fixed, paraffin-embedded tissue sections from
pigs. J Vet Diagn Invest 12:224232
35. Alm E, Oerther D, Larsen N etal (1996) The
oligonucleotide probe database. Appl Environ
Chapter 18
Identification of Animal Pasteurellaceae
by MALDI-TOF Mass Spectrometry
Abstract
Species of the family Pasteurellaceae play an important role as primary or opportunistic, predominantly
respiratory, pathogens in domestic and wild animals. Some of them cause severe disease with high economic losses in commercial animal husbandry. Hence, rapid and accurate differentiation of Pasteurellaceae
is important and signifies a particular challenge to diagnostic laboratories. Identification and differentiation of Pasteurellaceae is mostly done using phenotypic tests or genetic identification based on sequence
similarity of housekeeping genes, such as the rrs gene encoding the 16S ribosomal RNA (16S rRNA). Both
approaches are time consuming, laborious, and costly, therefore often delaying the final diagnosis of disease or epidemics. Matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry represents an alternative rapid and reliable method for the differentiation of most members of the
family Pasteurellaceae. It is able to differentiate within a few minutes the currently known 18 genera and
most of the over 60 species and subspecies of Pasteurellaceae including many members encountered in
veterinary diagnostic laboratories. A few closely related species and subspecies that cannot be discriminated
by MALDI-TOF are easily identified further by complementary simple tests, such as hemolysis done simultaneously or routinely during pathogen isolation.
Key words MALDI-TOF MS, Bacterial identification, Veterinary diagnostics, Molecular identification, Pasteurellaceae, New taxa, Rapid diagnosis
Introduction
The family Pasteurellaceae represents Gram-negative, aerobic, coccoid- or rod-shaped, nonspore-forming, and nonmotile bacteria,
currently consisting of 18 genera and more that 60 validly named
species (J.P. Euzeby, www.bacterio.net) [13]. While most taxa
appear as commensal bacteria on mucosal surfaces of animals, several species are of particular concern, either as persistent opportunistic or as primary pathogens in farm animals, such as Actinobacillus
pleuropneumoniae in pigs, Pasteurella multocida and Avibacterium
paragallinarum in poultry, Mannheimia haemolytica in cattle, or
Actinobacillus equuli subsp. haemolyticus in horses. Phenotypic
identification based on special growth media, detection of
235
236
metabolites, and biochemical tests, combined with knowledge of

host specificity that is generally encountered for most pathogenic
Pasteurellaceae, are normally used in routine diagnostics [4].
Commercial phenotypic identification systems frequently lack animal pathogens in their databases, where Pasteurellaceae typically
are underrepresented. More recently, DNA sequence-based identification methods are applied in veterinary diagnostics [5, 6].
Although these latter methods are highly discriminatory, they
request qualified personnel and are time consuming and costly.
Matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (MALDI-TOF MS; shortly MALDI-TOF) has newly
entered in the identification procedures of bacteria in research as
well as in routine diagnostic laboratories [79]. Briefly, the sample
to be analyzed, which may be composed of whole bacterial cells, is
mixed with a matrix solution, applied onto a metal plate target
slide, and irradiated with a laser. The matrix along with the sample
analytes absorbs the laser light and vaporizes. Thereby, the various
proteins gain an electrical charge (ionization), which enables electrical fields to accelerate them into the time-of-flight mass spectrometer where they are separated according to their mass to
charge ratio and the respective abundance is measured, yielding a
characteristic spectrum (Fig. 1). Differentiation of bacterial genera
and species is mainly based on time-of-flight mass spectra of ribosomal proteins, which generate characteristic fingerprints. This is
possible because ribosomes are highly abundant in bacteria at
20,000 copies in the average, and hence ribosomal proteins
Fig. 1 MALDI-TOF spectrum of Actinobacillus pleuropneumoniae type strain S4074T
Identification of Animal Pasteurellaceae by MALDI-TOF
237
contribute with the strongest signals to the MALDI-TOF spectra

that can be resolved and finally constitute the fingerprints. The
composition of ribosomal proteins also reflects evolutionary relations of bacterial species and hence mirrors to a large extent the
phylogeny established with ribosomal RNA sequences. Moreover,
the composition of ribosomal proteins in bacteria is stable under
any conditions and represents the most characteristic biomarkers
accessible in the analysis of intact organism without extraction,
separation, or amplification. In this respect, ribosomal proteins are
also to be considered as essential phenotypic markers as requested
for taxonomic differentiation. MALDI-TOF represents a universal,
fast, and cost-effective alternative to classical phenotypic and
genetic identification assays. It is an open system that can constantly be updated with reference data produced in the laboratories
themselves depending on their needs.
The MALDI-TOF mass spectrometers designed for microbial
identification purpose generally are equipped with databases for the
identification of bacteria of primary clinical importance in human
medicine and hence lack data for many animal pathogens or opportunists such as species of the family Pasteurellaceae. A comprehensive database of MALDI-TOF spectra has recently been developed
using a well-characterized strain collection representing type strains
and field isolates of a large range of species and also subspecies of
Pasteurellaceae that are of current relevance in veterinary infectious
disease diagnostics [10]. The data obtained revealed that MALDITOF is able to discriminate most of Pasteurellaceae species tested,
while only a few closely related species or subspecies needed additional tests for accurate identification. The current chapter describes
the establishment of a MALDI-TOF spectrum database of
Pasteurellaceae and the method for rapid bacterial identification to
be used in diagnostic laboratories. The method is basically adaptable to any other bacterial family, which might be lacking in the
commercial databases provided with the MALDI-TOF instruments. Note that MALDI-TOF databases are adapted to the specific mass spectrometers and are not normalized and are applicable
to the specific instrument only. Therefore there are currently no
online databases for MALDI-TOF-based identification of bacteria
available. Spectra are electronically transferable from one instrument to another of the same brand, but adjustments are necessary
as there are minor differences from one instrument to another.
Materials
Prepare all solutions using ultrapure water and analytical grade
reagents. Preparation and storage of reagents is at room temperature unless otherwise indicated.
238
2.1
Chemicals
1. 0.9 % (w/v) NaCl (=154 mM).

2. Ethanol, absolute.
3. 70 % (v/v) formic acid.
4. Acetonitrile.
5. Organic solvent (OS): 50 % acetonitrile, 2.5 % trifluoroacetic
acid (TFA) in H2O.
6. Matrix solution (10 mg/ml): dissolve 10 mg of -cyano-4hydroxycinnamic acid in 1 ml of OS and vortex thoroughly.
The matrix solution should be saturated, i.e., some crystals
might still be visible even after a few minutes. It can be kept in
the dark at room temperature up to 1 week. Aliquots of preweighted powder can be kept at 20 C and be supplemented
with OS just prior to use.
7. Appropriate growth medium for species to be included in database or to be analyzed, e.g., trypticase soy agar supplemented
with 5 % sheep erythrocytes or chocolate agar (see Note 1).
2.2
Equipment
1. MALDI-TOF mass spectrometer for biotyping, such as Bruker

Daltonik Microflex LT or Shimadzu AXIMA Microorganism
Identification System.
2. General laboratory equipment such as micro-centrifuge.
Methods
Procedures can be carried out at room temperature unless otherwise specified. They are given for the Bruker Daltonik Microflex
LT (Bruker Daltonik GmbH, Bremen, Germany), using the Flex
control software, and might vary slightly with other instruments.
3.1 Generation
of Reference Spectra
for the Establishment
of a New or
for Upgrading
a Database
1. For each species of Pasteurellaceae family, grow the type strain

and three to four confirmed field strains on appropriate
medium, at the appropriate temperature (generally 37 C)
under suitable conditions, such as aerobic, microaerophilic, or
capnophilic conditions. Ideally, use field strains for which the
species has been confirmed by sequence analysis of the 16S
rRNA and housekeeping genes [5, 6].
2. Suspend a few colonies in 300 l deionized H2O in an
Eppendorf 1.5 ml tube.
3. Add 900 l of absolute ethanol and mix well.
4. Centrifuge for 2 min in a micro-centrifuge at full speed
(15,000 g).
5. Discard liquid and centrifuge again for 2 min at full speed.
239
6. Remove all liquid with a pipette and air-dry the bacterial pellet
for 2030 min. Suspend the pellet in 50 l of formic acid 70 %
and verify the full suspension of the bacteria.
7. Add 50 l of acetonitrile and mix well.
8. Centrifuge for 2 min in a micro-centrifuge at full speed.
9. Keep the supernatant for the production of MALDI-TOF
spectra.
10. Spot 1 l aliquots of the supernatant onto the steel target support of the MALDI-TOF mass spectrometer in eight replicas
(see Note 2).
11. Let the samples on steel target support air-dry (25 min).
12. Cover each dried sample with 1 l of -cyano-4hydroxycinnamic acid matrix solution (see Notes 2 and 3).
13. Let the samples on steel target support air-dry (25 min).
14. Include a calibration with a bacterial test standard (BTS),
which is, in general, a specific strain of Escherichia coli provided by the supplier of the MALDI-TOF instrument.
15. Produce reference spectra with the MALDI-TOF mass spectrometer by measuring each spot three times with standard
settings resulting in a total of 24 spectra for each strain (Fig. 1).
Run one to three BTS calibration spots with each plate read.
16. Import the spectra into the Flex analysis software and process it according to the manufacturers recommendations.
17. Check the quality of the 24 spectra, generate a main spectrum
(MSP), and register this as reference for the species in the
database of the MALDI-TOF mass spectrometer according to
the manufacturers instructions (see Notes 4 and 5).
18. Use the MSP (reference spectra) to compile a dendrogram as
shown in Fig. 2 using the Biotyper 3.0 software (Bruker) and
the correlation distance measure with the average linkage
algorithm.
3.2 Diagnostic
Identification
of Colonies by Direct
Transfer
1. Take a single colony from culture medium with a toothpick

(see Note 1).
2. Smear the bacteria on the steel target support (see Note 6)
(Fig. 3).
3. Overlay the bacterial smear with 1 l of -cyano-4hydroxycinnamic acid matrix solution (see Notes 2 and 3).
4. After air-drying, analyze with the MALDI-TOF mass spectrometer, using standard settings in the Flex control software
according to the manufacturers instructions (see Notes 712).
5. Compare the query spectra in the Biotyper 3.0 software against
the internal commercial database in combination with the library
database generated from additional in-house reference spectra.
240

MSP Dendrogram
Phocoenobacter uteri NCTC12872T
[Pasteurella] testudinis CCUG19802T
Chelonobacter oris CCUG55632T
[Haemophilus] haemoglobinophilus CCUG3714T
Volucribacter psittacicida CCUG47536T
Volucribacter amazonae CCUG47537T
Necropsobacter rosorum CCUG28028T
[Pasteurella] aerogenes ATCC27883T
[Pasteurella] mairii CCUG27189T
[Actinobacillus] seminis CCUG27187T
Pasteurella dagmatis CCUG12397T
Pasteurella stomatis CCUG17979T
Pasteurella oralis P683T
Pasteurella canis CCUG12400T
Pasteurella multocida subsp. septica CCUG17977T
Pasteurella multocida subsp. multocida CCUG17976BT
Pasteurella multocida subsp. gallicida CCUG17978T
[Pasteurella] bettyae DSM23000T
Basfia succiniciproducens DSM22022T
Histophilus somni ATCC43625T
[Actinobacillus] rossii ATCC27072T
Haemophilus influenzae DSM4690T
Gallibacterium anatis DSM16844T
Avibacterium gallinarum DSM17481T
Avibacterium volantium DSM18578T
Avibacterium endocarditidis DSM18224T
Avibacterium avium DSM18557T
Lonepinella koalarum ATCC700131T
Aggregatibacter actinomycetemcomitans DSM8324T
[Actinobacillus] delphinicola DSM11374T
Bisgaardia hudsonensis CCUG43067T
Bisgaardia Genomospecies 1 CCUG59551
Otariodibacter oris Baika1T
Mannheimia varigena CCUG38462T
Mannheimia granulomatis ATCC49244T
Mannheimia haemolytica ATCC33396T
Mannheimia ruminalis HPA92T
Mannheimia glucosida P925T
Mannheimia caviae T138021-75T
[Haemophilus] parasuis CCUG3712T
Haemophilus pittmaniae HK85T
Bisgaard Taxon 16 JF2221
Bisgaard Taxon 16 CCUG17204
Nicoletella semolina CCUG43639T
Bibersteinia trehalosi CCUG27190T
Actinobacillus ureae DSM5568T
Actinobacillus suis ATCC33415T
Actinobacillus equuli subsp. haemolyticus JF4291
Actinobacillus equuli subsp. equuli JF4284
Actinobacillus equuli subsp. haemolyticus CCUG19799T
Actinobacillus equuli subsp. equuli ATCC19392T
Actinobacillus capsulatus CCUG12396T
'Actinobacillus porcitonsillarum' CCUG46997
Actinobacillus minor NM305T
Actinobacillus pleuropneumoniae S4074T
Actinobacillus pleuropneumoniae S1421
Actinobacillus lignieresii NCTC4189T
Actinobacillus pleuropneumoniae WF83
Actinobacillus pleuropneumoniae S1536
Actinobacillus pleuropneumoniae 13039
1000
800
600
400
Distance Level
200
Fig. 2 Dendrogram derived from similarity matrices based on MALDI-TOF MS reference spectra from species
of the family Pasteurellaceae that are relevant in diagnostics of animal infectious diseases or represent important genera of this family. The distance level is normalized to a maximum value of 1,000. Type species of the
currently 18 genera are indicated in bold. Species misclassified in the corresponding genus are indicated
informally in brackets [11]
241
Fig. 3 Simple application of material from individual bacterial colonies onto the
steel target support for MALDI-TOF mass spectrometry
Notes
1. If using growth liquid media, removal of the media components from the bacterial samples may be important for successful MALDI-TOF analysis. Cell suspension may be centrifuged,
and the pellet washed several times with water before performing the analysis.
2. When spotting MALDI-TOF plates, allow the wicking action
to pull the sample or matrix solution aliquots off from the
pipette rather than touching the surface with the pipette tip, in
order to achieve a better homogeneity of the spot.
3. Samples are overlaid with a matrix solution and air-dried. The
crystallized organic acid forms the matrix, consisting of laserabsorbing small organic molecules in large excess over the bacterial proteins to be analyzed. Several organic acids are suitable
for the matrix solution, but cinnamic acid is adequate for
examining proteins (usually -cyano-4-hydroxycinnamic acid,
which enables highly sensitive MALDI-TOF measurement of
peptides and proteins from 0.7 to 20 kDa). The solvent acetonitrile leads to co-crystallization of matrix and sample molecules when evaporating.
4. Reference spectra databases can also be transferred from one
instrument to another, if the instruments are compatible.
However, best results are obtained with reference spectra generated on the proper instrument.
5. For certain bacterial species, reference spectra created on
the proper instrument might show differences compared to
242
reference spectra of the same species or strain present in preset

databases. This is due to the fact that preset databases were
made on a different instrument.
6. The extraction method with formic acid and acetonitrile
results in higher quality and higher similarity indexes compared to the direct transfer method and might exceptionally
be necessary for proper identification of certain species, such
as Histophilus somni.
7. Results of identifications are given by a similarity index starting
with the species giving the best match. Good similarity indexes
generally are above 2.0. As the MALDI-TOF MS identification is based on the comparative analysis of MS spectra based
on ribosomal proteins, the method in general is unable to differentiate subspecies, biotypes, or serotypes, which all were
shown to cluster tightly. This is illustrated in Fig. 2 with the
reference strains of A. pleuropneumoniae serotype 1, S4074T;
serotype 2, S1536; serotype 3, 1421; serotype 7, WF83; and
serotype 10, 13039, which all form a tight cluster.
8. Actinobacillus pleuropneumoniae and A. lignieresii are genotypically very closely related. However A. pleuropneumoniae is
hemolytic and can be readily differentiated from A. lignieresii
by hemolysis, e.g., on blood-agar medium plates. The species
A. pleuropneumoniae can be confirmed further by the presence of the apxIVA gene using PCR or real-time PCR [11].
9. Some species, e.g., [Pasteurella] testudinis, [Actinobacillus]
rossii, or [Haemophilus] parasuis, do not cluster with their corresponding genus (Fig. 2). This is due to their misclassification
within this genus, which is therefore given in brackets [5, 12].
However, this does not influence at all the reliable identification of these three species.
10. Subspecies of Pasteurella multocida cannot be differentiated as
they are phylogenetically very closely related and often only
differ by specific virulence attributes.
11. Actinobacillus suis, Actinobacillus equuli subsp. haemolyticus,
and Actinobacillus equuli subsp. equuli represent phylogenetically a tight entity and cannot be separated by MALDI-TOF
based on ribosomal protein spectra. A. equuli subsp. equuli is
nonhemolytic, while A. suis and A. equuli subsp. haemolyticus
are hemolytic. They differ from each other mainly by the different, hemolytic, RTX toxins of which A. suis secretes the
porcine-specific toxins ApxI and ApxII and A. equuli subsp.
haemolyticus secretes the equine-specific Aqx toxin. The latter
can be differentiated by PCR [13].
12. MALDI-TOF analysis is able to detect and characterize yet
unknown or unassigned taxa during research and routine
diagnosis. They are evidenced by the fact that their spectra are
243
clustered and differentiated from those of the known species.

The use of reference spectra from new, yet unassigned taxa will
help to recognize them for further characterization and finally
for the description of new taxa. This is demonstrated by
Bisgaard Taxon 16 in Fig. 2.
References
1. Boyce JD, Harper M, Wilkie IW et al (2010)
Pasteurella. In: Gyles CL, Prescott JF, Songer
JG, Thoen CO (eds) Pathogenesis of bacterial
infections in animals. Wiley-Blackwell,
Weinheim, pp 325346
2. Christensen H, Korczak BM, Bojesen AM et al
(2011) Classification of organisms previously
reported as the SP and Stewart-Letscher
groups, with descriptions of Necropsobacter
gen. nov. and of Necropsobacter rosorum sp.
nov. for organisms of the SP group. Int J Syst
Evol Microbiol 61:18291836
3. Foster G, Higgins R, Leclair D et al (2011)
Proposal of Bisgaardia hudsonensis gen. nov.,
sp. nov. and an additional genomospecies, isolated from seals, as new members of the family
Pasteurellaceae. Int J Syst Evol Microbiol 61:
30163022
4. Dousse F, Thomann A, Brodard I et al (2008)
Routine phenotypic identification of bacterial
species of the family Pasteurellaceae isolated
from animals. J Vet Diagn Invest 20:716724
5. Korczak BM, Kuhnert P (2008) Phylogeny of
Pasteurellaceae. In: Kuhnert P, Christensen H
(eds) Pasteurellaceae: biology, genomics and
molecular aspects. Caister Academic Press,
Norfolk, UK, pp 2752
6. Kuhnert P, Korczak BM (2006) Prediction of
whole-genome DNA-DNA similarity, determination of G + C content and phylogenetic analysis within the family Pasteurellaceae by
Multilocus Sequence Analysis (MLSA).
Microbiology 152:25372548
7. Fenselau
C,
Demirev
PA
(2001)
Characterization of intact microorganisms by
MALDI mass spectrometry. Mass Spectrom
Rev 20:157171
8. Tamura H, Hotta Y, Sato H (2013) Novel
accurate bacterial discrimination by MALDITime-of-Flight MS based on ribosomal proteins coding in S10-Spc-Alpha operon at strain
level S10-GERMS. J Am Soc Mass Spectrom
24:11851193
9. Clark AE, Kaleta EJ, Arora A et al (2013)
Matrix-assisted laser desorption ionization-time
of flight mass spectrometry: a fundamental shift
in the routine practice of clinical microbiology.
Clin Microbiol Rev 26:547603
10. Kuhnert P, Bisgaard M, Korczak BM et al
(2012) Identification of animal Pasteurellaceae
by MALDI-TOF mass spectrometry. J
11. Schaller A, Djordjevic SP, Eamens GJ et al
(2001) Identification and detection of
Actinobacillus pleuropneumoniae by PCR based
on the gene ApxIVA. Vet Microbiol 79:4762
12. Christensen H, Bisgaard M (2008) Taxonomy
and biodiversity of members of Pasteurellaceae.
In: Kuhnert P, Christensen H (eds)
Pasteurellaceae: biology, genomics and molecular aspects. Caister Academic Press, Norfolk,
UK, pp 126
13. Kuhnert P, Berthoud H, Straub R et al (2003)
Host cell specific activity of RTX toxins from
haemolytic
Actinobacillus
equuli
and
Actinobacillus suis. Vet Microbiol 92:161167
Chapter 19
Gold Nanoparticles as a Potential Tool
for Diagnosis of Fish Diseases
Mona Saleh, Hatem Soliman, and Mansour El-Matbouli
Abstract
Infectious diseases are a serious problem and a major contributor to severe economic losses in intensive fish
culture. Therefore, rapid and sensitive detection of fish pathogens is extremely important. Although various assays for determination of fish pathogens have been developed, most of these diagnostic methods are
time-consuming and laborious. To overcome these limitations, functional nanomaterials have been actively
investigated to improve detection ability and rapidity of diagnostic assays. Gold nanoparticles (AuNPs)
have been widely studied for their unique optical properties arising from their surface plasmon resonance,
which is responsible for their large absorption and scattering properties. These unique properties are four
to five orders of magnitude larger than those of conventional dyes and can be controlled by varying their
sizes, shapes, and compositions. Moreover, AuNPs can be easily synthesized and functionalized with different biomolecules, including pathogen-specific oligonucleotides or antibodies. Recently, nanoparticlebased assays have been introduced as a tool for laboratory diagnosis. They have been used for the direct
detection of unamplified nucleic acids in hybridization assays. Single- and double-stranded oligonucleotides can be adsorbed on AuNPs in colloidal solution under certain conditions. The result of the hybridization process can be visually detected within 1 min after addition of AuNPs, when the color of the
reaction mixture changes from red to blue (positive reaction) or remains red (negative). The development
of such nanoparticle-based strategies holds the potential to become powerful approaches for diagnosis of
fish pathogens.
Key words Diagnosis, Fish pathogens, Gold nanoparticles, Label-free, Colorimetric detection,
Unamplified nucleic acids, Nucleic acid probes, Hybridization assay
Introduction
Methods conventionally used for the diagnosis of fish diseases
mostly require expensive laboratory facilities, preventing their
wide-scale use. Additionally, these methods need extensive sample
preparation steps and have long readout times, which delay a timely
response and hamper effective disease control [1]. Recently, a
powerful emerging technology based on the unique properties of
nanoscale materials was introduced, which presents a great
245
246
Mona Saleh et al.
opportunity to develop fast, accurate, and cost-effective diagnostics

for the detection of infectious agents [13]. The optical transduction by noble metal nanoparticles is based upon the phenomenon of
nanoparticle surface plasmon resonance [46]. Surface plasmon
resonance is the collective oscillations of surface electrons induced
by visible light and is responsible for the intense colors exhibited by
colloidal solutions of noble metals such as gold and silver [711].
Gold nanoparticles (AuNPs) are suitable for a wide range of biological applications due to their unique size-, shape-, and compositiondependent optical, physical, and chemical properties [12].
When in solution, AuNPs are typically stabilized by negatively
charged citrate ions adsorbed on their surfaces whose repulsion
prevents aggregation due to the strong van der Waals attraction
between gold particles [13, 14]. However, on addition of ionic
substances such as NaCl, the attraction force becomes stronger
than the counteraction, which leads to an aggregation of AuNPs
and to the consequent color change of the solution from red to
blue [15]. This property, along with the corresponding shift of
surface plasmon absorption, has been utilized for the colorimetric
detection of DNA and RNA [1623]. AuNPs-based DNA detection can be generally classified as either being labeled or label-free
[22]. In the labeled technique, AuNPs are modified mainly with
thiolated single-stranded DNA (ssDNA) and then allowed to
hybridize with a complementary target sequence [23]. However,
the need for premodification of the AuNPs makes this strategy
laborious, complicated, and time-consuming [24].
The label-free method takes advantage of the different electrostatic properties of ssDNA and double-stranded DNA (dsDNA).
Since ssDNA is flexible and can partially uncoil, it can be easily
adsorbed on AuNPs and enhance the electrostatic repulsion
between the nanoparticles. This stabilizes the AuNPs even in the
presence of salt. In contrast, because dsDNA cannot easily uncoil
and has an exposed negatively charged phosphate backbone, its
adsorption to the AuNPs is prevented, and the salt-induced aggregation of the nanoparticles is not blocked [22]. When AuNPs are
added to a saline solution containing the target nucleic acid and its
complementary unlabeled ssDNA probe, the nanoparticles aggregate, and the solution color changes to blue since the probes are
not free to stabilize the AuNPs. On the other hand, in the absence
of the target nucleic acid, the probes are free to stabilize the AuNPs,
thus preventing its aggregation, and the solution color remains red
[22, 23, 25, 26] (Fig. 1). This AuNPs-based label-free strategy has
been utilized to develop several colorimetric hybridization assays
[25, 2730]. Gold nanoparticles-based assays have also been used
successfully for the detection of fish pathogens [29, 31]. Herein,
we describe how these assays can be performed properly to assist
rapid, accurate, and affordable diagnosis of fish diseases.
Gold Nanoparticles for Diagnosis of Fish Diseases

Non Complementary RNA
247
Complementary RNA
Probe
RNA
Denaturation
Annealing
Addition
of
AuNPs
Stabilization of the AuNPs due to

adsorption of the probe on ist surface
and the color of the AuNPs remains red
Aggregation from AuNPs and

color shift from red to blue because
the probe is not free to stabilize the AuNPs
Fig. 1 Schematic diagram of a colorimetric assay based on unmodified AuNPs for detection of unamplified
nucleic acids (SVCV RNA). First, the target RNA is denatured and the complementary probe hybridizes to the
target forming double strands. Adding AuNPs causes its aggregation since the probe is not free to stabilize the
AuNPs, and the solution color changes from red to blue. In the presence of a noncomplementary target RNA,
the probe will be free to adsorb onto and stabilize the AuNPs consequently preventing their aggregation and
the solution color remains red
248
Mona Saleh et al.
Materials
2.1 Gold
Nanoparticles
1. 38.8 mM sodium citrate solution (Sigma-Aldrich, GmbH,

Schnelldorf, Germany).
2. 1 mM aqueous solution of gold (III) chloride trihydrate
(HAuCl4) (Sigma-Aldrich, GmbH, Schnelldorf, Germany).
2.2 Oligonucleotide
Probes
1. Oligonucleotide probes targeting specific sequences of a particular gene of interest of the pathogen. For example, we have
recently described the development of a 26 bp specific probe
(5-GTC TAT CAT CAG CTA CAT CGC ATT CC-3)
designed to target the spring viremia of carp virus (SVCV) glycoprotein gene [29]. Assess the specificity of the probe against
other common aquatic pathogens sequences deposited in
GenBank.
2. Stock solutions of the probes: order the designed probes commercially and prepare them according to the supplied specification sheet that usually gives instructions needed to rehydrate
the probes. For each probe, add the recommended amount of
purified, double-distilled, deionized, and autoclaved water
(PCR grade water), and mix well to get a stock solution of
100 pmol/l. Prepare several aliquots from these stock solutions to avoid degradation by repeated freezing and thawing,
and keep at 20 C until required.
2.3 Colorimetric
Detection of Nucleic
Acids
1. Extracted nucleic acids of the pathogens (DNA or RNA): in this

illustrative protocol we use RNA extracted from SVCV grown
in epithelioma papulosum cyprinid culture (EPC) [29] (see
Note 1).
2. Hybridization buffer: 10 mM phosphate buffer saline (PBS),
pH 7.0, containing 0.4 M of NaCl and 1.8 M of oligonucleotide probe (see Note 2).
Methods
3.1 Preparation
of Gold Nanoparticles
Prepare gold nanoparticles of 13 nm diameter by the citrate reduction method according to Grabar et al. [32] or purchase commercially (e.g., from Strem Chemicals. Newburyport, MA, USA).
1. Add 10 ml of 38.8 mM sodium citrate solution rapidly to
100 ml of vigorously stirred boiling 1 mM HAuCl4 aqueous
solution (see Note 3).
2. The mixture should be boiled for 10 min and stirred for an
additional 15 min.
249
3. Allow the solution to cool to room temperature.

4. Filter and store at 4 C before use.
3.2 Colorimetric
Detection of Nucleic
Acids Using
Unmodified Gold
Nanoparticles
Optimum concentrations of NaCl and oligonucleotide probe

(see Note 1), as well as optimal pH, annealing temperature, and
incubation times, need to be determined for each assay. We give an
example based on the detection of unamplified SVCV RNA that
we recently described [29].
The assay is performed as follows:
1. In a sterile PCR tube place 5 l of extracted RNA.
2. Add 3 l of the hybridization buffer.
3. Complete the reaction mixture to 10 l with sterile distilled
water and mix well.
4. Denature the mixture at 95 C for 30 s, anneal at 58 C for
30 s, and then cool at room temperature for 10 min.
5. Finally, add 10 l of colloidal AuNPs to the reaction mixture,
and observe the change in the solution color within 1 min
(Fig. 2) (see Notes 46).
Fig. 2 Colorimetric assay using unmodified AuNPs. Each tube contains 5 L of

sample (SVCV RNA), 1.8 M of oligonucleotide probe, and 0.1 M of NaCl. The
samples were denatured at 95 C for 30 s and annealed at 58 C for 30 s and
then cooled at room temperature for 10 min. 10 L of AuNPs solution was added
and results were observed within 1 min. Tube 1 contains a positive sample and
tube 2 contains a negative sample. In the positive sample, the color changes
from red to blue
250
Mona Saleh et al.
Notes
1. Inoculate SVCV onto EPC cell line maintained in Eagles minimal essential medium (EMEM) buffered to pH 7.6 with
sodium bicarbonate, supplemented with 2 % of fetal bovine
serum (FBS) and standard concentrations of antibiotic.
Incubate the inoculated cultures at 15 C.
2. Optimum concentrations of NaCl and of oligonucleotide
probe need to be determined for each assay, allowing the visual
detection of the color change of the solutions and, at the same
time, an effective annealing of the probe to its complementary
target. For the detection of SVCV, the concentration of NaCl
sufficient for both aggregation of AuNPs and proper annealing
of the probe to its complementary target was 0.4 M. Use different concentrations of the probe to determine the optimum
probe concentration sufficient to stabilize the AuNPs in the
presence of salt. We found that a final probe concentration of
more than 3 M was too high for any aggregation to occur in
the presence of the target, leading to false negative results. In
contrast, a probe concentration of less than 0.2 M did not
prevent aggregation of AuNPs in the absence of the target and
led to false-positive results.
3. A change in the color of the solution from pale yellow to deep
red will be observed.
4. The specificity of the assays should be previously assessed using
nucleic acids extracted from closely related organisms as template. Our SVCV-targeted assay showed no false-positive
results when tested with nucleic acids extracted from epizootic
hematopoietic necrosis virus (EHNV), infectious hematopoietic necrosis virus (IHNV), infectious salmon anemia virus
(ISAV), koi herpes virus (KHV), viral hemorrhagic septicemia
virus (VHSV), pike fry rhabdovirus (PFRV), zander rhabdovirus (ZRV), and, also, the EPC cells.
5. The lower detection limit of the AuNPs-based assay was determined using a tenfold serial dilution of RNA extracted from
SVCV grown in EPC culture with a known titer estimated
according to the method described by Reed and Muench [33]
(Fig. 3). The detection limit is the lowest RNA concentration
able to change the solution color from red to blue upon aggregation of AuNPs.
6. The ability of the AuNPs-based assay to detect SVCV RNA
directly from fish specimens can be evaluated by testing RNA
samples extracted from SVCV-infected and noninfected fish
tissue homogenates. Test outcomes can be compared with
those of virus isolation or PCR amplification [34].
251
Fig. 3 Lower detection limit of the gold nanoparticle (SVCV-AuNP) assay was
estimated in cell culture system using a tenfold dilution series of the nucleic acid
tested (SVCV RNA). Tubes 110 contain 105, 104, 103, 102, 10, 101, 102, 103,
104, and 105 TCID 50 ml1, respectively. SVC-AuNPs assay detection limit was
assessed as about 103 TCID 50 ml1 (Tube 8; blue color)
References
1. Kaittanis C, Santra S, Perez JM (2010)
2. Jain KK (2005) Nanotechnology in clinical
laboratory diagnostics. Clin Chim Acta
358:3754
3. Rosi NL, Mirkin CA (2005) Nanostructures in
biodiagnostics. Chem Rev 105:15471562
4. Kreibig U, Genzel L (1985) Optical absorption spectra of pairs of small metal particles.
Surf Sci 156:678700
5. Quinten M, Kreibig U (1986) Optical properties of small metal particles. Surf Sci
172:557577
6. Link S, El-Sayed MA (2000) Shape and size
dependence of radiative, nonradiative, and
photothermal properties of gold nanocrystals.
Int Rev Phys Chem 19:409453
7. Nath N, Chilkoti A (2002) A colorimetric gold
nanoparticle sensor to interrogate biomolecular interactions in real time on a surface. Anal
Chem 74:504509
8. Nath N, Chilkoti A (2004) Label free
colorimetric biosensing using nanoparticles. J
Fluoresc 14:4
9. Jain PK, Lee KS, El-Sayed IH, El-Sayed MA
(2006) Calculated absorption and scattering
properties of gold nanoparticles of different
size, shape, and composition: applications in
10.
11.
12.
13.
14.
15.
16.
biological imaging and biomedicine. J Phys

Chem 110:72387248
Yguerabide J, Yguerabide EE (1998) Lightscattering submicroscopic particles as highly
fluorescent analogs and their use as tracer labels
in clinical and biological applicationsI. Theory.
Anal Biochem 262:137156
Yguerabide J, Yguerabide EE (1998) Lightscattering submicroscopic particles as highly
fluorescent analogs and their use as tracer labels
in clinical and biological applicationsII.
Experimental characterization. Anal Biochem
262:157176
Pissuwan D, Cortie CH, Valenzuela SM,
Cortie MB (2009) Functionalised gold
nanoparticles for controlling pathogenic bacteria. Trends Biotechnol 28:207213
Shaw DJ (1992) Introduction to colloid and
surface chemistry, 4th edn. Butterworth
Heinemann, Oxford
Hunter RJ (2001) Foundations of colloid science. Oxford University Press, New York
Baudhuin P, Van der Smissen P, Beauvios S,
Courtoy PJ (1989) Molecular Interactions
between Colloidal Gold, Proteins, and Living
Cells. In: Hayat MA (ed) Colloidal gold.
Academic, San Diego, pp 117
Peak SH, Seung HL, Joung HC, Young SK
(2000) Development of rapid one-step immunochromatographic assay. Methods 22:5360
252
Mona Saleh et al.
17. Huang JT, Hou SY, Fang SB et al (2008)

Development of a biochip using antibodycoated gold nanoparticles to detect specific
bioparticles. J Ind Microbiol Biotechnol 35:
13771385
18. Zhao Y, Zhang G, Lio Q et al (2008)
Development of a lateral flow colloidal gold
immunoassay strip for the rapid detection of
enrofloxacin residues. J Agric Food Chem
56:1213812142
19. Soo PC, Horng YT, Chang KC et al (2009) A
simple gold nanoparticle probes assay for identification of Mycobacterium tuberculosis and
Mycobacterium tuberculosis complex from clinical specimens. Mol Cell Probes 23:240246
20. Chirathaworn
C,
Chantaramalai
T,
Sereemaspun A, Kongthong N, Suwancharoen
D (2011) Detection of Leptospira in urine
using anti-Leptospira-coated gold nanoparticles. Comp Immunol Microbiol Infect Dis
34:3134
21. Saleh M, Soliman H, Haenen O, El-Matbouli
M (2011) Antibody-coated gold nanoparticles
immunoassay for direct detection of Aeromonas
salmonicida in fish tissues. J Fish Dis
34:845852
22. Li H, Rothberg L (2004) Colorimetric detection of DNA sequences based on electrostatic
interactions with unmodified gold nanoparticles. Proc Natl Acad Sci U S A 101:
1403614039
23. Mirkin CA, Letsinger RL, Mucic RC, Storhoff
JJ (1996) A DNA-based method for rationally
assembling nanoparticles into macroscopic
materials. Nature 382:607609
24. Jung YL, Jung C, Parab H, Li T, Park HG
(2010) Direct colorimetric diagnosis of pathogen infections by utilizing thiol-labeled PCR
primers and unmodified gold nanoparticles.
25. Elghanian R, Storhoff JJ, Mucic RC, Letsinger
RL, Mirkin CA (1997) Selective colorimetric
detection of polynucleotides based on the
26.
27.
28.
29.
30.
31.
32.
33.
34.
distance-dependent optical properties of gold

nanoparticles. Science 277:10781081
Storhoff JJ, Lucas AD, Garimella V, Bao YP,
Mller UR (2004) Homogeneous detection of
unamplified genomic DNA sequences based on
colorimetric scatter of gold nanoparticle
probes. Nat Biotechnol 22:7
Li H, Rothberg L (2005) Detection of specific
sequences in RNA using differential adsorption
of single-stranded oligonucleotides on gold
nanoparticles. Anal Chem 77:62296233
Shawky SM, Bald D, Azzazy HME (2010)
Direct detection of unamplified hepatitis C
virus RNA using unmodified gold nanoparticles. Clin Biochem 43:11631168
Saleh M, Soliman H, Schachner O, El-Matbouli
M (2012) Direct detection of unamplified
spring viraemia of carp virus RNA using
unmodified gold nanoparticles. Dis Aquat
Organ 100:310
Saleh M, Soliman H, Srum H, Fauske AK,
El-Matbouli M (2012) A novel gold
nanoparticles-based assay for rapid detection of
Melissococcus plutonius, the causative agent of
European foulbrood. Vet Rec 171:400
Saleh M, Gotesman M, El-Matbouli M (2013)
Going for gold in the detection of Cyprinid
herpesvirus-3. In: Diagnostics, Abstract Book,
277 (423) 416427, 16th international conference on diseases of fish and shellfish,
European Association of Fish Pathologists, Sep
26, Tampere, Finland
Grabar KC, Griffith-Freeman R, Hommer MB,
Natan MJ (1995) Preparation and characterization of Au colloid monolayers. Anal Chem
67:735743
Reed LJ, Muench H (1938) A simple method
of estimating fifty per cent endpoints. Am J
Hyg 27:493497
Koutn M, Vesely T, Psikal I, Hulov J (2003)
Identification of spring viraemia of carp virus
(SVCV) by combined RT-PCR and nested
PCR. Dis Aquat Organ 55:229235
Chapter 20
Nucleic-Acid Testing, New Platforms and Nanotechnology
for Point-of-Decision Diagnosis of Animal Pathogens
Abstract
Accurate disease diagnosis in animals is crucial for animal well-being but also for preventing zoonosis
transmission to humans. In particular, livestock diseases may constitute severe threats to humans due to
the particularly high physical contact and exposure and, also, be the cause of important economic losses,
even in non-endemic countries, where they often arise in the form of rapid and devastating epidemics.
Rapid diagnostic tests have been used for a long time in field situations, particularly during outbreaks.
However, they mostly rely on serological approaches, which may confirm the exposure to a particular
pathogen but may be inappropriate for point-of-decision (point-of-care) settings when emergency
responses supported on early and accurate diagnosis are required. Moreover, they often exhibit modest
sensitivity and hence significantly depend on later result confirmation in central or reference laboratories.
The impressive advances observed in recent years in materials sciences and in nanotechnology, as well as in
nucleic-acid synthesis and engineering, have led to an outburst of new in-the-bench and prototype tests for
nucleic-acid testing towards point-of-care diagnosis of genetic and infectious diseases. Manufacturing,
commercial, regulatory, and technical nature issues for field applicability more likely have hindered their
wider entrance into veterinary medicine and practice than have fundamental science gaps. This chapter
begins by outlining the current situation, requirements, difficulties, and perspectives of point-of-care tests
for diagnosing diseases of veterinary interest. Nucleic-acid testing, particularly for the point of care, is
addressed subsequently. A range of valuable signal transduction mechanisms commonly employed in
proof-of-concept schemes and techniques born on the analytical chemistry laboratories are also described.
As the essential core of this chapter, sections dedicated to the principles and applications of microfluidics,
lab-on-a-chip, and nanotechnology for the development of point-of-care tests are presented. Microdevices
already applied or under development for application in field diagnosis of animal diseases are reviewed.
Key words Lab-on-a-chip, Microfluidics, Nanotechnology, Nucleic-acid testing, Point of care,
Veterinary diagnosis
Abbreviations
AIDS
BTRP
CNT
DNA
Acquired immunodeficiency syndrome

Biological Threat Reduction Program
Carbon nanotube
Deoxyribonucleic acid
253
254
EIDSS
FIA
FMD
FMDV
FRET
GNP
HIV
HPAI
LAMP
LATE-PCR
MB
MNP
MWCNT
NASBA
NP
PCR
PDMS
PMMA
PNA
POC
QCM
QD
RNA
rPCR
RT-PCR
SARS
S/N
S/V
SELEX
SPR
SWCNT
TADR
Electronic Infectious Disease Surveillance System

Flow-injection analysis
Foot-and-mouth disease
Foot-and-mouth diseases virus
Fluorescence resonance energy transfer
Gold nanoparticle
Human immunodeficiency virus
Highly pathogenic avian influenza
Loop-mediated isothermal amplification
Liner-after-the-exponential PCR
Molecular beacon
Magnetic NP
Multi-walled CNT
Nucleic-acid sequence-based amplification
Nanoparticle
Polymerase-chain reaction
Polydimethylsiloxane
Poly(methyl methacrylate)
Peptide nucleic acid
Point of care
Quartz-crystal microbalance
Quantum dot
Ribonucleic acid
Real-time PCR
Reverse-transcription PCR
Severe acute respiratory syndrome
Signal-to-noise ratio
Surface-to-volume ratio
Systematic evolution of ligands by exponential enrichment
Surface plasmon resonance
Single-walled CNT
Threat Agent Detection and Response
1 The Context of Disease Diagnosis in Veterinary Science,

Medicine, and Practice
1.1
Current Situation
As in human medicine, disease diagnosis in veterinary medicine

and practice is important for several reasons, including the issues of
animal health and welfare, public health (especially in the case of
zoonotic agents affecting pets or animals for human consumption), and economy (mainly related to the rules and barriers for the
international trade of animals and animal products). In the veterinary field, it is important to consider fauna species other than cattle
and farming animals (mainly large terrestrial livestock animals and
fishes for aquaculture as well), like pets, captive (e.g., zoo, circus,
and aquariums), and wild animals. All of these constitute underestimated sources of many human infectious diseases, especially of
Point-of-Decision Diagnosis of Animal Pathogens
255
viral origin. Animal or human contamination with a veterinaryrelevant pathogen may occur through infected animals (live or
dead) and infected animal products (e.g., bush meat, unpasteurized milk) or, to a lesser extent, through direct contact with the
pathogen itself. In developing countries and regions, the impact of
livestock diseases and outbreaks goes far beyond animal welfare
and food safety. Too often, farm animals are also the only way of
human and cargo transportation and also of income, as feedstock,
as a source of manure and draft power, and as raw material for
other industries (e.g., leather, shoes, and clothing) [1].
The advent of human immunodeficiency virus (HIV)/acquired
immunodeficiency syndrome (AIDS) and other human immune
depressing conditions has been a relatively neglected factor of
enhanced susceptibility of humans to animal diseases, especially
with respect to pets. Immune-depressed individuals or other vulnerable groups, such as children or the elderly, may even become
susceptible to subtypes of zoonotic microorganisms that are usually harmless for healthy humans [2]. Interaction between domestic and wild animals may also provide an important via for indirect
human contamination [3]. A particularly important group of zoonotic agents is that of enteric pathogens that are transmitted to and
between humans and animals through the oral-fecal route, with
subsequent dissemination to wastewater effluents. Outbreaks may
occur upon contamination of surface waters and groundwater used
for recreational and irrigation purposes and insufficient microbial
removal of drinking water and/or of treated wastewaters, since
many of these enteric pathogens are resilient to classical treatment
and disinfection procedures [4]. They often contaminate water
supplies in very small concentrations, hence hindering final disinfection and complicating detection as well [5]. Screening of enteric
zoonotic agents has been proposed for pets cohabiting with
immune-susceptible humans [6]. Very often, the presence of
enteric viruses is detected indirectly, through bacterial indicators of
fecal contamination, namely, coliforms and enterococci [5]. On
the other hand, emerging wild-type zoonosis have been transmitted from animals to humans (e.g., SARS and West Nile virus)
or after specific mutations that facilitate the species jump (e.g.,
HIV and H5N1 or H1N1 influenza) [7]. Concerning bioterrorism issues and depending on the nature of the infectious pathogen,
the detection of potential zoonotic agents in animals should alert
for an intentional release act [8]. A successful anti-bioterrorism
strategy must not only account for the detection of the known
pathogen but also of genetically modified forms. However, only a
few potential veterinary pathogens fulfill the criteria for being considered effective bioterrorist agents. The group is composed by the
viral agents of rinderpest, classical swine fever, African swine fever,
avian influenza, Newcastle disease, Rift Valley fever, and foot-andmouth disease (FMD) [1]. Among them, FMD and avian
256
influenza are especially important for their high prevalence in the

world, zoonotic potential, and ramping spread. FMD is generally
considered the most contagious viral disease in animals. Occasional
occurrences in non-endemic regions are usually difficult and expensive to control [9]. Avian influenza is a viral disease with pandemic
potential; pigs can act as intermediate hosts of influenza viruses
between birds and humans. Bidirectional transmission of these
viruses between humans and pigs is documented [7].
The diagnosis of air-borne diseases is challenging, with implications in disease control, especially in the case of outbreaks, and in
individual case management. For these diseases, timely adoption of
quarantine measures and massive antimicrobial therapy administration may be sufficient to contain an emerging outbreak, as long as
the first cases are spotted in a short time. However, this may be
impracticable in developing countries and regions, where effective
routine surveillance flaws. Thus, a successful containment strategy
must include rapid diagnosis through inexpensive and easy-to-use
portable devices for in-the-field use [10]. As an example, it has
been proposed that, within 6 h of the reporting of a suspicious
FMD case, definitive detection should be made upon sample transportation to a national or regional laboratory, or else on the farm
itself, and that, within 24 h of reporting, definitive identification of
the infecting strain/subtype should be accomplished, immediately
followed by vaccine production (from stored antigens) and distribution [1].
1.2 The Need
for Point-of-Care
Testing
Following the trend of human medicine, the diagnosis of animal

diseases has also undergone progressive decentralization, from
central (reference) laboratories to in-the-field bioanalytical instrumentation, very often in resource-depleted regions and settings,
even outside laboratory infrastructures. Essentially, this has been
done through adaptation of conventional analytical methods and
instrumentation to portable and automated devices, able to be
handled by laboratory unskilled personnel (viz., veterinarian practitioners and farmers). Several nomenclatures have been given to
these tests. They include the names field tests, rapid tests,
biosensors, and point-of-care (POC) tests; this last term will
be predominantly used throughout this chapter. Improved diagnostic tests are necessary for asymptomatic diseases, for diseases
with misleading symptoms, for diseases requiring different treatments, or for diseases that, by their complex or costly treatment,
require previous case confirmation. By contrast, these tests will
likely have little or no impact for diseases which are easily recognized by their clinical symptoms and for which a syndromic treatment/approach is recommended. There is thus no clinical need to
identify the causal agent. However, surveillance and control measures must be maintained for these diseases in order to deal with
the risk of major epidemics [11]. It is among livestock animals that
257
disease epidemic outbreaks are more likely to occur, and with

higher magnitude, given the physical proximity of many animals
under intensive husbandry, the probability of pathogens to contaminate neighboring farms, and the relatively poor biosecurity
conditions of most farms, but also in the case of subclinical
diseases. As time is crucial when managing the early stages of
infectious disease, an immediate preliminary positive result
obtained by a POC test strongly argues in favor of precautionary
and preventive measures in affected farms and surroundings in
order to avoid further transmission, until a definite and more accurate result can be obtained in a reference laboratory [12]. Ideally,
POC tests should go towards increased sensitivity, not only for
early case identification but also for disease surveillance and epidemiological purposes, as infected animals may suffer and constitute
infected reservoirs for disease spreading [11]. During the 2001
FMD outbreak in the United Kingdom, most of the livestock in
infected and neighboring farms was targeted for culling during the
first 2448 h, based solely on clinical signs, which may be considerably doubtful, especially in sheep, the main species affected [13].
The time span between animal infection and the onset of clinical
symptoms, and hence infection awareness, can take months, usually through rapid and silent spreading within and between herds,
which might need to be destroyed [14]. However, indoor controlled studies with experimental infection of cattle with FMD
virus (FMDV) showed a smaller-than-expected transmission fraction during the overlapping period between the incubation and the
infectious period, suggesting that the importance of common preventive measures taken at endangered farms (viz., preemptive culling of cattle, often with severe economic downturn) has been
overestimated [15]. For most viral diseases, since the onset of
detectable viremia usually occurs at least 1 day before the onset of
infection and/or presentation of clinical signs, efforts should be
devoted to the development of new diagnosis methodologies and
tools at preclinical stages. Historically, public funds have been used
to compensate farmers for massive slaughtering of suspected diseased animals, but it has been argued that this may have generated
permissive behaviors and disinterest from livestock industries and
owners about transboundary control of cattle diseases [1]. In theory,
POC tests are advantageous over laboratory-based tests if they can
be used to detect infected animals before they become infectious,
especially if this time window is short, as in the case of FMD. This
advantage would apply if the time between collection of samples
and receipt of results in the laboratory is, at least, 24 h. In the
medium term, POC tests for cattle diseases will likely play an
increasing role in the screening and triage of biological samples
collected on the farm, as a primary support for decision-making
during disease outbreaks [16], under a challenging context of
permissive biological containment.
258
In veterinary medicine, POC tests have been largely used, for

some decades, for the screening of physiological metabolites in
blood and urine. Pathogen detection is a newer application, mainly
driven by the increasing number of emerging outbreaks, including
those with public health importance. Among these is, for instance,
the potentially pandemic H5N1 avian influenza, as well as influenza viruses of putative porcine origin, as the human pandemic
strain of 2009 [12]. POC tests have also been developed for important diseases of aquatic animals, using similar technologies to those
used for terrestrial animals [17]. The most common layouts of
commercially available devices rely on antigen detection in biological samples through affinity binding reactions with immobilized
specific antibody probes. Nevertheless, despite the requirement for
essentially the same performance features, regulatory approval and
introduction of these devices into the market are understandably
easier in the veterinary than in the clinical practice [18].
1.3 Difficulties Faced
by Point-of-Care
Testing
Disease sub-notification remains a major problem for veterinarian

health authorities; despite notifiable diseases are of obligatory
reporting, too often farmers (and even veterinarians and diagnostic
laboratories) ignore or delay the notification process owing to
unawareness, minimization, or perceived lack of consequences,
which may be aggravated when economic losses are anticipated. It
is expected this scenario to worsen as POC tests become more
readily available for utilization by farmers, especially in cases of
delayed or misleading diagnosis based upon the clinical signs, as a
result of disease underestimation or confusion with the signs of
non-notifiable endemic diseases [12]. Of course, the interpretation
of clinical signs itself and subsequent decision-making processes
are compromised by the fact of farmers being unskilled personnel
in health and veterinary medicine issues. Reducing the risk of nonreporting depends on tight cooperation and trust between veterinary authorities and livestock farmers and dealers [19]. In the
livestock business, especially for important livestock diseases (e.g.,
classical swine fever), the risk of announcing a false-positive result
is particularly worrisome, as it carries detrimental consequences in
trade and export. Sanitary requisites on imported livestock for
human feeding are very demanding and restrictive in most countries, leading to severe economic losses in cases of insufficient or
inaccurate pathogen testing. Therefore, individual animal testing
may be one of the main drivers for commercial development of
POC tests, because a preliminary positive result with a POC test
may prevent further and more expensive testing, while holding the
herd being ineligible for export as well [12]. Some animal diseases
are particularly contagious and able to spread rapidly. Many of
them are considered transboundary diseases, meaning that their
detection turns into the prohibition of livestock export and thus in
economic losses. The combination of permanent surveillance
259
programs with improved techniques for rapid detection of emerging

pathogen subtypes for efficient control of transboundary diseases
has been claimed [20]. Unambiguous identification of circulating
pathogen subtypes (viz., genotypes and/or serotypes) is frequently
a relevant epidemiological feature for the success of disease control
programs. For low-prevalence diseases, the proportion of falsepositive results is usually higher than for more prevalent ones. In
addition, many of the current POC tests are less sensitive and specific than laboratory-based methods. Altogether, this means that,
in order to achieve a desired level of performance and confidence
in the results, sampling a large number of animals is usually required
for POC-based testing of low-prevalent diseases [12]. In pets, the
prevalence of many pathogens, particularly of zoonotic parasites,
has been probably underestimated as a consequence, among other
reasons, of using inadequate and inaccurate diagnostic tests and
procedures, including limitations in sample collection and processing, which may directly result in false-negative results [21, 22] and,
as such, putting the animals themselves and their owners at greater
risk than currently assumed [3].
Intellectual property constraints frequently hamper the passage of these new devices from the proof of principle to the prototype and even commercialization levels. Another bottleneck is the
high cost for final development of such devices, the reason why
partnerships between research laboratories and biotechnological
companies are usually established with such purpose. In this case,
of course, the economic leitmotiv is much higher for high-impact
diseases, especially those for which control of outbreaks is difficult
and expensive. However, even for such diseases (e.g., FMD), the
only sporadic and unpredictable character of outbreaks might disincentive investments in individual testing; high demand usually
only occurs by the occasion of an outbreak or suspected outbreak.
Only a few tests for economically important livestock diseases have
been developed and commercialized in developed countries, due
to the limited market resulting from only infrequent diseases [12].
It seems that the most promising commercial segment for POC
devices for veterinary pathogens concerns multiplexed platforms
for a wide range of endemic and non-endemic pathogens [16],
taking advantage of the relative simplicity and low cost of incorporating several additional targets in a multiplexed test. Indeed, veterinary health services eagerly lack rapid and simple diagnostic
devices designed for in-the-field simultaneous detection, in a single
sample, of a broader range of common pathogens [8], thus
enabling the rapid gathering of field information on individual animals or whole herds disease status. Currently, simultaneous identification and eventual subtyping of many pathogens in a single test
run is a province of central or reference laboratories and only available if the demanding entity (e.g., person, laboratory, or agency) is
able to afford to pay for such expensive testing. POC tests have
260
been also used for field differentiation between vaccine and field
strains, especially in endemic regions where vaccination is permitted [12]. Suitable application of such differential testing at slaughtering settings to confirm prior livestock vaccination has been
argued [1].
1.4 Challenges
for Point-of-Care
Testing
The ultimate goal of the use of POC portable devices by unskilled

and unsupervised practitioners will likely pose enormous challenges for the overall bioanalytical process, from sample acquisition
to post-analytical data storage, interpretation, and management.
Bearing in mind that most of these devices are to be commonly
used in remote and low-resource regions, uncontrolled and irregular reporting of results, in addition to test biosafety, especially when
dealing with zoonotic agents, are major issues [23]. For these reasons, a balanced merging between in-the-field testing with remote
data analysis and interpretation by competent clinical staff may be
desirable. In this regard, telemedicine is an attractive system for
healthcare improvement in developing countries, for allowing
unskilled persons to provide useful healthcare in remote settings.
This can be carried out by using miniaturized analytical devices
with integrated hardware for image acquisition and software for
storage of results. These results can be downloaded to hard copies
or directly transferred online for a remote healthcare central unit
for processing and interpretation by expert personal. Processed
results can afterwards be returned to the tester, almost in real time
[24]. Remote data from POC systems can still be incorporated in
national disease surveillance and diagnostic systems, as the Threat
Agent Detection and Response (TADR), developed under the
Biological Threat Reduction Program (BTRP) of the US Defense
Departments Defense Threat Reduction Agency. This system uses
real-time polymerase-chain reaction (rPCR) for detection of pathogens. Another surveillance system, the Electronic Infectious
Disease Surveillance System (EIDSS), contains a subsystem to
report suspicious disease outbreaks in real time. The EIDSS is able
to locate disease outbreaks through a geographic positioning
device. This system aims to encompassing all available public and
animal disease surveillance information. The EIDSS is able to
report laboratory results from rPCR up to a few hours, depending
on the distance. These systems will eventually enable a shift of paradigm in remote analysis, allowing world reference laboratories to
simply handle and manage diagnostic information from pathogens
and hosts based on biological samples remotely collected and analyzed, with subsequent reporting of results to the countries and
regions of origin [1].
A full evaluation program of POC tests must include
performance evaluation (validation), quality assessment (control
and assurance), and standardization [25]. The performance of
POC tests is highly dependent on the local conditions for their use,
261
on the epidemiology of the pathogen, and on the biology of the

host [26]. Thus, the evaluation of such tests sets the particular
ranges of in-the-field conditions in which they can be used [27],
ideally under multicenter evaluation. Quality control assures
correct functioning of the devices with prolonged use; usually, randomly selected units from a given production batch are compared
to infer reproducibility. The quality assurance step demonstrates
the readiness of the tests to be introduced into the routine diagnostic practice. Standardization is needed in POC diagnostics for
veterinary applications, as well as new rules to compare results
obtained from the two different methodologiesthe POC and the
laboratory-based method, respectivelywhich implicates in the
final (accepted) diagnostic result [23, 28]. Proper validation and
standardization of many POC tests frequently lack, in part because
these often correspond to in-house rather than to well-standardized
assays and techniques. It is thus important that national or reference healthcare entities establish quality assurance programs that
guarantee the production of reference materials and protocols for
effective quality control of rapid diagnostic tests [29]. For the clinics, a set of guidelines for standardization of POC blood-based
tests has already been established [30]. Hopefully, in the future,
this will also be useful to inspire standardization procedures in new
diagnostics for veterinary medicine and practice.
POC tests hold great promise to shift the paradigm of veterinary diagnostics, particularly for field situations, and in cases in
which the biological sample is easy to collect and process. However,
its advantageous use presumes the availability of sufficient manpower to survey enough animals on high-risk premises, which
remains a burdensome challenge. The decision of whether using
them or not to manage animal infectious diseases depends on biological and epidemiological factors, on the specific circumstances
in which clinical signs arise, on cost-benefit issues (taking into
account the costs for deployment, including equipment and
reagent storage), and on the relative performance compared to
diagnostic tests in reference laboratories. The possibility of sending
suspect samples to a central laboratory within 2448 h has probably discouraged the use of POC tests in some past situations in
Western countries, e.g., under medical suspicion of highly pathogenic avian influenza (HPAI); from another point of view, this
strengthens the idea of a promising use of these tests in remote
regions, far away from laboratory settings. Once POC tests have
equivalent analytical sensitivity and specificity to laboratory-based
tests, it may be foreseen, on the basis of a POC test alone, to take
actions beyond simple restriction/quarantine on suspect premises
[12]. Transboundary livestock diseases are probably among the
major concerns in veterinary medicine. It has been proposed that
an efficient governmental control strategy of these diseases should
include legislation enforcing, namely, (a) disease screening in
262
people, conveyances, and goods arriving from other countries, in a

reasonable extent, according to previously defined performance
benchmarks, including possible use of robotic automated devices;
(b) higher extent of screening for people, conveyances, and goods
arriving from endemic countries, even reaching exhaustive screening when such countries are recognized as not making acceptable
progresses in disease control; and (c) the need to develop tests to
certificate animal products region or country of origin, at the
point of importation [1]. These points certainly constitute an
immense and valuable fountainhead of opportunities for commercial attraction-driven development of new POC devices in the veterinary field.
Nucleic-Acid Testing
2.1 Advantages
for Disease Diagnosis
Early disease diagnosis not only prevents or minimizes potential

animal suffering but also the risk for infection transmission among
susceptible hosts [31]. In contrast, delayed diagnosis carries an
increased risk for severe symptoms and complications, ultimately
leading to longer suffering, increased toxicity due to accumulated
pathogen load and/or virulence effects, and a higher risk for acquisition of drug resistance [12]. Antibody-based detection requires a
sufficient level of antibodies to be produced for successful detection, which usually happens only some days after exposure to the
pathogen. In this regard, specific detection of pathogen nucleic
acids in biological samples by PCR-based methods may be more
suitable, since the pathogen genomic material is present in the host
from the very beginning of infection and even very little amounts
are detectable before the onset of immune response markers or
clinical or veterinary signs. Moreover, methods based in nucleicacid detection are able to detect both live and dead pathogens, an
advantage for disease diagnosis [1], especially when time is crucial
for disease containment and control. In conventional methods
(e.g., cell culturing and serology), pathogen detection strongly
depends on the sample quality [13], leading more easily to falsenegative or irreproducible results.
Deoxyribonucleic acid (DNA) is a particularly suitable material
for biosensing owing to unique characteristics, including the ability
for highly specific and mutual recognition between a short
immobilized oligonucleotide (probe) and a longer-sized genome
and high physicochemical stability. Unlike enzymes and antibodies, DNA forms biological recognition layers easily synthesizable and readily reusable after thermal heating [ 24 ]. DNA is
also prone to very specific manipulation and processing precision
by ligases, nucleases, and other enzymes [32] and is the most
easily copyable biomolecule, through PCR and similar techniques
263
of amplification, which is also an enormous advantage for the

development of portable and miniaturized diagnostic devices.
In addition, DNA micro- and nanoarrays are more suitable than
protein counterparts for direct synthesis onto a chip surface,
without the need to produce and purify the ligands [33]. Most of
these features of DNA are also extensive to ribonucleic acid (RNA).
Indeed, nucleic-acid (molecular biology) testing comprises genetic
analysis (DNA level) and functional genomics (including mRNA,
non-coding RNA, and microRNA). In particular, functional
genomics dedicates to the identification and analysis of specific
RNA expression patterns (profiles) associated with particular
experimental or clinical conditions. DNA (and RNA) microarrays
and quantitative PCR have been the most common techniques
used with this purpose [34]. DNA microarrays (DNA chips) are
usually produced in the form of highly dense arrays printed on a
silicon or glass chip, coated with different probes for simultaneous
detection of multiple DNA-target sequences [35]. Current microarrays can detect in the order of 104 nucleic-acid sequences on a
single chip [1]. The Virochip is particularly well succeeded in this
regard; it is a panviral DNA microarray platform, able to detect
known viruses and new viruses related to known viral families, in a
single assay. Its high robustness has been confirmed with viruses of
high genetic variability, as the swine virus. This platform is especially useful for detecting viruses for which there are no available
reverse transcription-PCR (RT-PCR) assays [7]. Nevertheless,
microarrays do not seem promising for the POC use, being too
expensive, complex, and bulky [24]. Another peculiarity of DNAbased detection is the superior ability to differentiate strains from
the same organism, especially when isolated from different geographical locations. This is useful not only for pathogen identification but also for epidemiological studies. As an example, the
significant differences among the nucleic-acid sequences of the different serotypes of FMDV (as in other viruses) and the likelihood
for the occurrence of typing errors during viral RNA replication
demonstrate how the virus can rapidly evolve in nature [36], which
constitutes an enormous challenge for successful viral identification. In influenza viruses, genetic reassortment is able to generate
novel subtypes whose cell surface antigens might no longer be
recognized by preexisting antibodies (antigenic drift) [37]. The
potential for pandemics caused by novel highly pathogenic subtypes strongly stresses the need for specific subtype identification
through nucleic-acid testing. Of course, the drifting in influenza
viruses, responsible for the sudden onset of dominant subtypes
during a yearly season, requires not only rapid development and
validation of suitable molecular probes for nucleic-acid tests but
also the unobstructed use of such tests. Unraveling the pathogen
subtypes circulating in a given region may assist in designing
264
tailored vaccines and disease containment strategies, as well as

tracking outbreaks sources [38].
2.2 Nucleic-Acid
Testing in the Point
of Care
Most of the current POC tests for human and animal medicine still
rely on antigen/antibody bioaffinity reactions, but they are usually
handicapped by relatively small sensitivity. Thus, there is a trend for
shifting towards more sensitive nucleic-acid detection, usually
based on DNA/DNA hybridization schemes. A major challenge
for detection of pathogen nucleic acids in host body fluids, apart
their scarcity compared to antigenic proteins, is the confinement
inside pathogen cells, surrounded by hard biomembranes and cell
walls. Consequently, the nucleic-acid levels present in host fluids
may be too low for successful diagnosis without prior target amplification by PCR-based techniques. For blood infections in humans,
the amount of human genomic DNA can be 1014 times higher than
that of pathogen DNA [39], an important challenge in terms of
sensitivity and selectivity. For POC testing, this constitutes a challenge for the miniaturization of the blood sample preparation step,
especially in the case of gram-positive bacteria, whose cell walls are
thicker and more rigid than those of gram-negative bacteria. The
majority of available POC systems for clinical and veterinary applications require off-device sample preparation (including microorganism concentration and nucleic-acid extraction). This is a
traditionally cumbersome and time-consuming step, especially for
in-the-field testing, but newer processes, including filter paper capture of nucleic acids and automated extraction procedures and kits,
have been developed to simplify such task [40]. In parallel with
POC device development, considerable efforts have been spent in
the simplification and robustness of sample preparation, in order to
minimize manual handling, thus reducing cross-contamination
and the effects from potentially interfering substances present during the nucleic-acid amplification assay. Of note are the technical
difficulties inherent to the analysis of matrices such as feces, semen,
and decomposing tissue or the detection of Mycobacterium tuberculosis from saliva [12]. For these cases, it is necessary to incorporate, in POC devices, systems that are able to suppress such
interfering substances and that reduce handling prior to the
nucleic-acid amplification step.
PCR has been, by far, the most widely employed technique for
nucleic-acid amplification in laboratory analysis but also in POC
tests. Many similar techniques have been originated from the basic
PCR principles, including nucleic-acid sequence-based amplification (NASBA), targeted for direct RNA amplification, thus precluding the need for a previous reverse-transcription step. The
development of this panoply of techniques for pathogen detection
has been possible due to the increasing availability of whole
genomic sequences; a remarkable case in veterinary science is the
current possibility of rapidly distinguishing severe acute respiratory
265
syndrome (SARS) from other circulating coronaviruses [41].

Nevertheless, PCR is prone to false-positive results, as a result of
unwanted amplification of contaminant nucleic acids. Proper quality management of these issues requires using adequate controls
for each stage of the testing process [12]. For RNA analysis through
RT-PCR, storing biological samples at very low temperatures is
crucial, owing to the high liability of RNA genomes. Innovative
lyophilized reagents with enhanced sensitivities have significantly
improved the operational conditions for POC disease diagnosis
[42]. Moreover, the need for improved stability of RNA used as an
internal positive control, especially for real-time RT-PCR assays,
has led to the search for new RNA sources. Another approach for
improving RNA assays is the use of minor groove-binding probes
which, by being short sized, are suitable for multiplexing and for
targeting sequences of highly variable genomes [20]. Nevertheless,
PCR-based techniques remain challenging for POC pathogen
diagnosis in many endemic regions of the world. Even in human
medicine, however, RT-PCR, for instance, is only used for clinically important specimens, due to the complexity and time demanding of this technique [43]. Linear-after-the-exponential PCR
(LATE-PCR) is another PCR-based technique for detection of
RNA. Probably its most known application is in FMDV subtyping,
to tackle the difficulty of targeting all field strains with novel
sequence mutations, even those in target sequences for which
degenerate primers are being used [44]. The amplification process
can begin with as few as a single DNA molecule and abundantly
generates amplified product over a broad temperature range. The
technique employs primers that hybridize to conserved genomic
regions and a mismatch-tolerant probe able to target different variable sequences, depending on the temperature. Thus, the technique is especially convenient for detection of RNA viruses [36].
Among the vast diversity of available nucleic-acid amplification
schemes and devices, both at the proof-of-concept and commercial
levels, the technique of loop-mediated isothermal amplification
(LAMP), already widely used in laboratory analysis, seems quite
promising for application in POC systems for pathogen detection
and identification. In remote PCR-based nucleic-acid testing,
power supply is a keystone for device operation, although the use
of rechargeable batteries is expected to circumvent this problem,
by avoiding the need for an external power source [42].
Advantageously, LAMP does not require thermal cycling for the
amplification, rather making use of a simpler power source compared to a PCR thermocycler. Such operation at constant and low
temperatures permits LAMP to be incorporated in polymer-based
microdevices instead of more traditional and expensive materials,
like glass and silicon that, for being temperature-resistant, are
required for PCR-based devices. Unlike PCR, LAMP does not
require a denatured template for amplification, and given the usual
266
abundance of generated DNA, the amplified product can often be

visualized directly [13]. For viral detection, in particular, the technique has shown sensitivity at least equivalent to PCR [45] and
even to rPCR [46]. Coupled to easier sample preparation procedures, these features make LAMP inherently simple and hence
especially suitable for POC applications [47].
POC tests based on nucleic-acid amplification potentially allow
early detection of latently infected animals on targeted high-risk
premises, with some examples already being applied in field situations [48]. However, this would require sample collection and
testing from many suspect herds, which will require too demanding manpower in the course of an outbreak. This is probably why
existing tests have not been adopted in contingency plans in many
countries, although the issue remains controversial [12]. During
the FMD outbreak in 2007, up to 269 samples were analyzed each
day [38], but larger outbreaks would require higher-throughput
testing. Of course, from a certain point above, it is admissible that
central laboratories would become overloaded and that true POC
devices, able to be manipulated by farmers themselves, would be
probably the best (or even unique) solution. This, however, by the
reasons pointed above, is still far from reality, although the unstoppable technological advances in this field, coupled to new paradigms for decentralized detection, will more and more shorten the
present distance to that goal.
Methods for Signal Transduction in Biosensors and Point-of-Care Devices

For bioanalysis with prototype biosensors and POC devices, three
main types of signal transduction mechanisms have been used:
electrochemical, optical, and microgravimetric (mass sensitive).
They are well known and have been extensively used in research
laboratories for analytical chemistry, holding great promise for new
prototype and fully developed bioanalytical and diagnostic microdevices. Among microgravimetric methods, quartz-crystal microbalance (QCM) is the most common; it usually relies on the use of
a piezoelectric crystal whose fundamental resonance frequency
changes upon successive immobilization of a biorecognition probe
and its target. However, the difficulty of miniaturization, the high
cost, and the complex influence of multiple interfacial parameters
on the sensor response (especially in liquid phase) have hampered
wider development of POC devices based on this technique. The
applicability of electrochemical methods for nucleic-acid analysis
has greatly benefited from the emergence of solid electrodes [24].
Electrochemical-based analytical devices can be relatively simple,
rapid, less costly, low-power demanding, and amenable for
miniaturization and mass production through standardized microfabrication techniques [49].
267
Optical detection has been the most widely employed transducing principle in biosensing, partially driven by the unending
advances of optic applications in telecommunications and information systems. Furthermore, the very high frequency of optical signals is appropriated for the enormous amount of information that
can be carried by optical systems and devices [24]. Conventional
optical microscopy has been reliably used for detection and imaging of infectious pathogens (at both cellular and molecular levels),
integrated with research and development of new POC diagnostic
devices [50]. Within optical detection methods, chemiluminescence and fluorescence have been the most widely used for their
versatility of designs and applications. Imaging methods usually
require bulky and expensive microscopes and camera-equipped
microscopy systems, i.e., in off-device formats. Such equipment is
obviously unsuitable for POC diagnostics. The innovative technique of optofluidic seems thus promising in this regard, as this
high-throughput and high-resolution on-device technique does
not make use of such components [51]. In optofluidic devices, the
sample flows through a metal film-etched array with submicron
apertures for imaging, onto a plastic platform.
An intrinsic limitation of conventional optical detection is the
interference between closely spaced light waves. Understandably,
this is especially limiting for the design and performance of miniaturized devices for multi-analyte detection and identification.
However, optical transmission through minuscule structures
gained a new impulse with the technique of surface plasmon resonance (SPR), in which light waves are directed to the interface
between a metal and a dielectric. The technique is label-free and
the immobilized probe can be easily reused, although sensitivity
must still be improved [24]. Moreover, it faces the challenges of
other optical techniques for POC diagnosis, namely, the high cost,
instrumental complexity, expensiveness of optical components,
and difficulty for miniaturization/portability and mass production.
The advent of integrated photodiode detectors is promising for the
development of cheap, sensitive, easy-to-use, and easy-to-fabricate
fluorescence-based diagnostic microdevices [52]. A remarkable
milestone might be the shift from current fluorescent-based detection methods to naked-eye (visual) recognition, which would considerably reduce complexity and costs. These readouts can be
recorded as digital images and then transmitted to remote clinicians through trivial and inexpensive telecommunication devices
(e.g., digital cameras and scanners); some current examples include
the detection of glucose, pH, and proteins [53]. It is expected that
future POC diagnostic devices will become connected to wireless
communication and information systems through camera-equipped
mobile phone networks coupled to web databases, for diagnostic
imaging and telemedicine, especially in remote and resourcelimited regions and settings [54]. Remote monitoring will not
268
constitute a valuable or even indispensable way for analysis when

in-the-field conditions do not allow doing that, but also an
approach to improve quality management for tests conducted in
the field.
4
4.1
New Platforms for Point-of-Care Disease Diagnosis

Microfluidics
Multiplex PCR and DNA microarrays have been among the most
commonly used techniques for the detection and identification of
infectious pathogens. Multiplex PCR is frequently limited to the
analysis of only a few target genes, owing to interferences between
different primer sets in the same reaction vessel. DNA microarrays
are usually too expensive, labor intensive, and complex for POC
applications; moreover, the microarray assays are usually lengthy
due to the slow diffusion-limited hybridization kinetics. On the
other hand, lateral-flow devices employed for POC diagnosis usually have relatively low sensitivity; moreover, in the most common
format (immunochromatographic format, corresponding to the
well-known test strips), they do not provide genetic information,
thus hindering the assessment of eventual pathogen subtypes and/
or drug resistance markers. In general, the number of targets that
can be simultaneously probed in lateral-flow assays is low, thus
increasing the cost per assay and limiting the throughput. Also,
their degree of multiplexing usually does not reach that of microarrays [55].
The last decade has witnessed tremendous advances in microfluidic sciences and applications for bioanalysis. Microfluidic
devices basically consist in a set of microchambers interconnected
through microchannels, imprinted onto a suitable solid platform.
After injection into the system, the liquid biological sample flows
throughout the hydrophilic inner walls of the chambers and channels for final analysis. The flow is usually controlled automatically
by mechanical valves. A primary advantage of microfluidics for the
development of miniaturized diagnostic devices, especially for
POC usage, is the requirement for only very small sample volumes,
which permits to save reagents (viz., probes and labels), but also
gaining time and sensitivity, as a consequence of the enhanced
binding kinetics (unlike in bulky reaction media). It also provides
lower power consumption and lower operating costs. Moreover,
since the overall analytical process is automated, sample losses and
contamination due to human handling can be minimized, in parallel with improved multiplexing capabilities. The confinement and
automation of the process also reduces errors due to human
manipulation and increases biosafety. In microfluidic devices, the
occurrence of nucleic-acid hybridization in solution and the
enhanced aqueous mixing allow surpassing the kinetic barriers that
slow affinity reactions due to limited diffusion in traditional
269
microarrays [53]. Recent developments in microfluidic technology

have pointed towards integrating traditionally off-chip processes
into the microdevices. Indeed, significant reduction of bulky, complex, and expensive equipment is mandatory for POC and in-thefield diagnostic applications.
Traditional microfluidic devices usually rely on pressure-driven
flow (through a syringe pump or pressure injector) or electroosmotic flow, but these techniques require external bulky and complex equipment, like a power supply. For POC applications, more
suitable methods for fluid delivery have been developed, namely,
mechanical pumping, capillarity, and light-driven motion [53].
Compared to conventional injection systems, as flow-injection
analysis (FIA), microfluidics enables achieving lower detection limits, as a result of enhanced probe/target binding kinetics [56] and
of time-dependent target pre-concentration in microchambers.
Droplet-based schemes offer a significant improvement in microfluidics, due to the ability to independently control each free droplet containing the target under analysis. In this way, each single
droplet functions as a pump, valve, mixer, solid-phase extractor,
and thermocycler, thus greatly simplifying the assay design [10].
The first microfluidic devices were manufactured as glass or
silicon platforms, but the high cost of these materials led to the
widespread use of polydimethylsiloxane (PDMS) for such purpose.
However, some properties of PDMS limit its use for biosensing in
microfluidic devices, e.g., hydrophobicity and swelling/disintegration in organic solvents. In order to prevent some of the limitations
of PDMS, other materials have been used, like paper and thermoplastics. These materials, as well as their fabrication process, are
cheaper than PDMS, glass, and silicon, making large-scale fabrication more feasible. This low cost also encourages disposability, an
important biosafety asset when dealing with infectious agents, and
a way to avoid cross-contamination of biological samples.
Moreover, these materials are lightweight and hence easy to transport in the form of portable devices. Finally, their fabrication does
not require clean-room settings. Thermoplastics are attractive
materials for simple, low-cost, and reproducible fabrication of
POC devices by well-known replication molding techniques (e.g.,
injection molding or hot embossing). An example is poly(methyl
methacrylate) (PMMA), which is mechanically stable, is optically
transparent, and has an easily modifiable surface. Another example
is polycarbonate, whose lower thermic conductivity in comparison
with glass or silicon turns it amenable for high-temperature
PCR applications [53]. Patterned paper-based microfluidic devices
are valuable alternatives to test strips. Advantages of paper include
its abundance, easiness to use (e.g., clean rooms or other complex
and expensive infrastructures for its manipulation are unnecessary), low cost, disposability, and easily patterned with polymers
and other molecules by conventional printing techniques
270
(e.g., photolithography, wax and inkjet printing). Its common

white color is particularly suitable for the use of colored substrates
in quantitative colorimetric tests. Moreover, unlike in test strips
and conventional microfluidics, its porous nature allows capillaritydriven fluid wicking and flow through its structure, without the
need for external pumps and pressure source. New three-dimensional structures will enable a vertical flow to be added to the sole
lateral flow of two-dimensional devices, in higher complex structures than those presented by plastic frames. In this way, they may
exhibit improved abilities for initial purification and concentration
as the liquid wicks throughout the inner layers of the device, until
final detection [57].
Many current microfluidic devices still rely on complex and
bulky laboratorial (off-chip) equipment for fluid delivery and control, making their use impractical in field situations, e.g., by emergency response teams [53]. Other drawbacks faced by microfluidic
systems include biomolecule adsorption to microchannel walls,
inaccurate control of temperature, liquid evaporation due to heatgenerating components, and bubble formation [5]. In addition,
future developments in microfluidic platforms may eventually benefit from materials with improved analytical performance [58], as
well as simplicity and cost-effectiveness.
4.2
Lab-on-a-Chip
The processes of sample purification and pre-concentration are

usually the most complex and cumbersome in biological analysis.
In molecular diagnostics, this is particularly true for nucleic-acid
isolation procedures, which still remain too complex for in-thefield use. One of commonest requirements is a centrifuge, which
obviously hinders the integration of such detection schemes within
miniaturized analytical devices. In many diagnostic microdevices,
such procedures are carried out off-chip, prior to the detection
step itself. Moreover, they strongly depend on the characteristics of
the specific biological sample and require relatively high volumes
of raw sample for downstream nucleic-acid amplification. In the
last years, lab-on-a-chip devices have emerged as second-generation
chips, essentially based on the concept of microfluidics. By suitable
integration of modules for sample processing and analysis in a single device, they offer enhanced flexibility and discriminatory ability
over conventional diagnostic methods and devices. Yet, minimizing and miniaturizing the whole sample preparation procedure
towards easiness to use and true POC remains challenging and a
relatively underestimated task in the development of POC tests
[5]. Compared to conventional detection techniques, lab-on-achip devices allow the integration and automation of all (or nearly
all) steps for sample processing and analysis; the confinement of
the bioelement under measurement in a predefined region of interest facilitates its detection and eventual quantification from very
small sample volumes. This, in turn, reduces background noise and
271
hence increases sensitivity [53]. In lab-on-a-chip devices, minimization of the chemical interferences that result from tight spatial
confinement is usually envisaged, enabling miniaturization and
highly sensitive detection. The high mass transfer rate thus achieved
is due to the low diffusional distance and high surface-to-volume
ratio (S/V) [59]. Traditional cell analysis and processing, including cell sorting, cell/serum separation (for immunoassays), and
cell lysis (for immunoassays or nucleic-acid amplification), can be
adapted to POC schemes [53]. Some principles commonly used to
separate and concentrate cells within POC devices are cell size,
labeling (fluorescent or magnetic), electrophoretic mobility, and
cell adhesion [60]. For analysis of real, biological samples, the
detection of highly virulent pathogens presumes the ability of
detecting very few cells from large sample volumes and, concurrently, washing out sample contaminants (e.g., other cells), in
order to prevent, for instance, downstream PCR inhibition and
microchannel clogging [61]. In particular, environmental water
samples may contain certain substances, like humic acids, that
inhibit PCR reactions, able to drastically decrease the resulting signals. The presence of contaminants in biological samples may be
particularly troublesome in microfluidic assays for veterinary
applications.
A particular advantage of bioanalysis with lab-on-a-chip devices
concerns the processing of pathogen RNA. Owing to the confined
environment of the purification steps and to the requirement for
minimal user handling, the probability for RNA contamination
and degradation by ubiquitous RNases is highly decreased [62].
Schemes employing nucleic-acid extraction through detergents
rather than high temperature-operating lytic enzymes coupled
with isothermal (e.g., LAMP) instead of PCR and RT-PCR amplification processes are also preferred in this regard. In this way, the
concept of microfluidics might be able to address a recurrent gap
in veterinary literaturethe lack of information about RNA quality and integrity, which further complicates the standardization of
RT-PCR procedures [34]. Several commercial multiplexed POC
tests for diagnosis of influenza and other respiratory viruses are
already available, as the FilmArray RP (BioFire Diagnostics, Salt
Lake City/UT, United States), the xTAG RVP (Luminex, Toronto,
Canada), and the Xpert Flu A Panel (Cepheid, Sunnyvale/CA,
United States), consisting in closed systems that include sample
preparation and detection by integrated RT-PCR [63, 64].
However, these systems may not be able to detect low viral load
specimens, as is the case of the Xpert Flu A Panel with some important avian influenza viruses. In addition, economic constraints still
restrict full applicability of some of these tests in POC testing. For
the Xpert Flu A panel, it was estimated a cost of 45 euros per test,
compared to 15 euros for the antigenic tests [63]. Current lab-ona-chip devices, despite being simpler than conventional laboratory
272
Table 1
Illustrative works described in the literature employing nucleic-acid amplification methods
for the detection of animal pathogens. POC tests are those claiming, at least, one of the following
characteristics: lab-on-a-chip; microfluidics; portability
POC
Target pathogen(s)
Yes
African swine fever virus
Amplification
No method
LOD or sensitivity
References
LAMP
330 copies
[67]
Avian influenza virus (H5N1)
RT-PCR
[10]
Avian influenza virus (H5N1)
rRT-PCR
98 %
[42]
Influenza virus
LAMP
90.9 %
[43]
Influenza A viruses
RT-PCR
4005,000 viral
particles/ml
[63]
Influenza A virus (H1N1)
RT-PCR
[62]
FMDV
rPCR
109 dilution
[9]
FMDV
RT-LAMP
10 copies
[13]
FMDV
RT-LATE-PCR
10 copies (100 %)
[38]
Respiratory viruses
RT-PCR
82.2100 %
[64]
RT-LAMP
0.01 PFU (100 %)
[41]
Swine viruses (H1N1 and H2N3);
influenza A (flu A; seasonal H1N1;

pandemic H1N1)
LAMP
<10 copies/l
[65]
E. coli (O157 and K 12)
PCR
0.2 CFU/l
[61]
S. aureus (MRSA) and FMDV
RT-LAMP
17 copies
[40]
SARS-CoV
E. coli; B. subtilis; E. faecalis
RT-PCR
10 to 10 CFU/ml [66]
B. anthracis; Brucella spp.; F.

tularensis; Y. pestis
rPCR
10100 fg
[8]
LAMP
20 copies
[68]
Aquaculture pathogens (S. agalactiae;

koi herpes virus; Iridovirus;
A. hydrophila)
a
Pilot test adaptable to POC (under development)
analytical apparatus, still require complex and somewhat expensive

fabrication procedures onto plastic or glass substrates, thus severely
limiting their affordability and availability by poor countries.
Table 1 displays some literature references about proof-of-principle
schemes and POC devices for detection and identification of some
pathogens of veterinary importance.
273
Nanotechnology
An emergent topic in the development of new bioanalytical procedures, structures, and systems is nanotechnology, particularly for
the generation of useful nanostructures for diagnostic applications;
this is the so-called field of nanobiotechnology. Novel and
improved electronic devices and biosensor platforms have emerged
as a consequence of the inherent small size, enlarged surface area,
and unusual optical, magnetic, catalytic, and mechanical properties
of nanomaterials, unlike those of bulk materials [24]. Depending
on their specific nature, for biosensing, nanomaterials may act as
labels (including signal amplification), as biomolecule immobilization supports, or even as probes for specific biotarget anchoring.
Certain nanomaterials can also be used for pre-concentration of
biological targets. Among these applications, labeling has been the
most commonly employed. Label-based detection methods are
usually more time-consuming and labor intensive than label-free
methods due to the labeling steps. Labels have also limited shelf
lives and are subjected to leakage from sensing surfaces. However,
label-based methods usually provide superior performance, especially in terms of sensitivity, than label-free ones. Moreover, standardized protocols with labeling procedures are already available.
Fluorescence labeling has been, by far, the most common approach
in this regard, although suffering from pH sensitivity and photobleaching over time [53]. Such handicaps and the advent of nanoengineering have propelled the search and development of new
and improved labels.
Nanoparticles (NPs) have been the most widely employed type
of nanomaterials for biosensing, especially metallic NPs. Metallic
NPs are inorganic NPs that exhibit improved physicochemical
characteristics compared to fluorescent labels, including higher
sensitivity. In general, they are suitable for construction of highdensity bioanalytical devices, taking advantage of their high signalto-noise ratio (S/N). They are easily synthesizable and
functionalized (by simple mixing at room temperature) and have a
controlled, self-assembled surface structure [24]. Gold nanoparticles (GNPs), in particular, are already used frequently in molecular
diagnosis; some of their advantages include low toxicity and versatility for many specific biorecognition applications and schemes.
One common way to enhance the GNP signal even further, and
thus the sensitivity of detection, is the inclusion of a final step of
silver staining (silver enhancement), yielding detection schemes
able to preclude the use of a prior PCR amplification step. The
high sensitivity exhibited by many NP-based detection layouts,
especially in the form of microarrays, has enabled to avoid a prior
step of nucleic-acid amplification [69].
Quantum dots (QDs) constitute another class of metallic NPs,
able for fluorescence tagging. They are much brighter and more
274
photostable than conventional organic fluorophores. Plus, their

color can be directly correlated with size, while exhibiting very
broad excitation wavelength windows, very narrow emission wavelength windows, and large Stokes shifts, allowing excitation at
wavelengths far removed from their emission peaks [70]. Since
QDs of different emission peaks (according to their different sizes)
can be excited using a single wavelength excitation source, detection of multiple targets in complex biological systems is a hallmark
of these NPs [71]. Another alternative to the overlapping of closely
spaced fluorescence emission peaks and consequent limitation of
the maximum number of fluorescent dyes that can be discriminated when simultaneously testing multiple pathogens in a single
PCR tube is the use of masscode tagging, with a panel of distinct
labels with different molecular weights. After an initial step of multiplexed (RT-)PCR using primers labeled with the masscode tags,
unincorporated primers are removed, and the photo-cleavable tags
of amplifying primers are then released by UV irradiation.
Subsequent mass spectrometry analysis assigns each identified tag
to its specific pathogen [1]. In principle, the multiplexing ability
will only be limited by the highest primer concentration contained
by a PCR mix. The method was applied to the identification of
respiratory pathogens [72] and hemorrhagic viruses [73]. It offers
a rapid, specific, sensitive, and cost-competitive alternative to conventional PCR and RT-PCR for disease diagnosis through POC
devices. Nevertheless, some difficulties persist in miniaturizing
mass spectrometer devices.
Among metallic NPs are also magnetic NPs (MNPs).
Equivalent designations frequently found in the literature include
magnetic nanobeads, nanomagnets, nanomagnetic beads,
nanomagnetic spheres, and nanospheres. They have been
vastly employed in many biosensor layouts for diagnosis. Despite
not matching the nanosize of molecular recognition probes and
targets, their microscaled counterparts, magnetic microparticles,
are frequently preferred as magnetic labels for biosensing in view of
the easiness for detecting the lesser abundant microbeads by routine optical microscopy or by magnetic detection and by the easiness of the purification process, thus allowing more efficient
removal of nonspecifically bound labels, with enhancement of the
assay performance [74]. However, the higher S/V of nanobeads
provides much more binding sites for bioprobe and biotarget
anchoring and hence a higher S/N [5]. Very often, magnetic particles are used for target pre-concentration from large initial sample
volumes and purification, in parallel with the detection step itself
being carried out through another particle that works as the label
(e.g., fluorophore or GNP). In this case, there is an initial capture
of the target by the probe-functionalized magnetic particle,
followed by releasing of the target (debinding) for final detection. Through magnetically controlled removal of nonspecifically
bound beads (magnetic washing), improved sensitivity can be
275
achieved upon elimination of the time-consuming washing step of

nonspecifically bound molecules [75]. This process can, for example, improve significantly the detection specificity of genomic
RNA, since RNA enrichment due to magnetic confinement also
precludes the effect of common interfering substances and common
RNA inhibitors [76]. In addition, the use of magnetic beads
permits testing optically opaque samples [29], which is the case of
many crude biological samples. Magnetic particles can be manipulated off-chip by a permanent magnet, making easier the design of
disposable and inexpensive tests. Moreover, magnetic interactions
are not affected by surface charges, pH, ionic strength, or temperature, being thus compatible with most biochemical processes [10].
Unlike inorganic NPs, organic NPs have enhanced structural
flexibility and biocompatibility, while being biodegradable.
Liposomes constitute an attractive type of organic NPs for efficient
DNA-probe labeling and for signal amplification. This is commonly achieved by filling liposome particles with dye and fluorophore molecules, which amplify the response signal and are able
to yield quantitative results. Another way of using liposomes in
biosensing is in conjunction with resistive techniques. As such,
negatively charged liposomes, upon binding to immobilized DNA
chains (which are also negative), form giant negatively charged
surfaces that repel the target DNA chain, leading to shifts in the
electrochemical response [24].
In the last years, chemistry research has rendered a range of
new structures based on carbon allotropes. The most promising
for biosensing purposes seem to be carbon nanotubes (CNTs),
both in the form of single- (SWCNT) or multi-walled CNTs
(MWCNTs), depending on the number of cylindrical layers, with
unique electronic properties and enlarged surface area for DNA
immobilization. They also possess high electrical conductivity
(similar to copper and much higher than in polymers), physical
robustness, and chemical inertness. Each nanotube may act as an
individual nanoelectrode, with sufficient free space between neighboring nanotubes preventing the overlap of their diffusion layers,
therefore yielding high S/N values and hence improved detection
limits [77]. By providing high sensitivity, they are amenable to
PCR-free detection. Their production is sometimes unacceptably
irreproducible for ultrasensitive detection, but this has been circumvented by using cheap CNT arrays for multiple biological targets as a way of averaging out between different batches [78].
The recent advances in nucleic-acid synthesis and modification
processes and the discovery of nucleic acids with catalytic and regulatory activities have prompted the development of nanoengineered nucleic-acid analogues with new and improved abilities for
biorecognition and diagnostic purposes. Among them are aptamers; they are synthetic nucleic acids able to interact with molecular
or cellular targets with high specificity and sensitivity for their ability
to fold into many tertiary conformations. Aptamers can be
276
generated by Systematic Evolution of Ligands by Exponential

Enrichment (SELEX), a combinatorial procedure that starts with
a pool of candidate nucleic-acid molecules to generate a nucleicacid library [79]. Compared to antibodies, nucleic-acids can be
synthesized in a more reproducible way, have longer shelf lives, and
can be reversibly denatured without loss of activity. A remarkable
characteristic of these probes for biosensing is that they do not
require prior knowledge about the molecular differences between
the specific target and nonspecific ones. As shown in cancer diagnosis, the DNA sequences from the DNA library that bind the
cell-surface markers of a cancer cell can be determined by comparison with those that bind a healthy (control) cell. In addition,
detection occurs before the corresponding antibody against that
cancer has been produced [80]. This process is obviously attractive
for application to the diagnosis of infectious diseases as well. The
high selectivity and sensitivity achieved with aptamers permits
eliminating sample pretreatment and is thus promising for POC
applications [53]. The inability to distinguish the fluorescent signal
from labeled and unlabeled probes is a common problem in microfluidic devices, since labeled probes that did not bind targets cannot be washed out from the microchannels. Different fluorescent
labels can be used to tag the probe and the target, with the detection proceeding via fluorescence resonance energy transfer (FRET)
upon the occurrence of the bioaffinity reaction. However, this procedure is unpractical in bioanalysis owing to the cumbersome dual
labeling procedure [81]. In the case of DNA detection, this can be
circumvented with the use of molecular beacons (MBs), which can
be considered a particular type of aptamers. MBs are singlestranded oligonucleotides with a hairpin (stem-and-loop) structure, labeled with a fluorophore in one extremity of the chain and
a fluorescence quencher in the other extremity. The close proximity between the extremities prevents fluorescence emission, but
when a hybridization event occurs with a complimentary chain, the
structure becomes linearized and hence fluorescence arises. In this
way, target labeling is unnecessary. Another type of synthetic
nucleic-acid analogues is constituted by peptide nucleic acids
(PNAs), which are in which the sugar-phosphate backbone is
replaced by a peptidic structure. When used as probes in nucleicacid recognition systems, they allow very selective and sensitive
hybridization in low ionic-strength media, while having high thermal stability [82]. For being electrically uncharged, PNAs are
suitable to promote the occurrence of biochemical events triggered
by the formation of the negatively charged PNA/single-stranded
DNA hybrid, i.e., a kind of on/off processes.
Biosensing schemes reported in the literature employing at
least one of the nanotechnology-based structures described above
are depicted in Table 2, together with the transduction mechanism
employed and performance quantification.
277
Table 2
Illustrative works described in the literature employing nanostructures for the detection of animal
pathogens
Target
pathogen(s)
Nanostructuresa
Transduction
mechanism
LOD or
sensitivity
Canine
parvovirus
PNA
Fluorescence
40
[105]
2,000 copies/
l (89.8 %)
Influenza virus
(H5)
MB
Fluorescence
0.6 nM
[37]
Influenza virus
(H5N1)
GNPs and Ag enhancer
Light scattering
103 TCID50
units
[69]
Influenza virus
(H5N1)
DNA aptamer
SPR
1.28 HAU
[87]
Influenza virus
(H1N1)
GNPs
Fluorescence and
surface-enhanced
Raman scattering
[93]
Influenza virus
(H5N1)
Complementary oxide
semiconductor (CMOS)
Impedance
spectroscopy
5 nM (1011 F)
[98]
Influenza virus
(H5N1)
DNA aptamer/hydrogel
QCM
0.0128 HAU
[102]
16 avian
influenza
viruses
Magnetic beads
Colorimetry (HA test 161,024 HAU [106]

and LAT test) and
RT-PCR
Feline
calicivirus
Liposomes
Fluorescence
1.6 105 PFU/

ml
[5]
Magnetic beads
Pestiviruses
(Classical
swine fever
virus; Border
disease virus;
Bovine viral
diarrhea virus
1 and 2)
Optic (visual;
microscopy; chip
reader)
[55]
Alexandrium
sp. complex
PNA and cyanine-derived

fluorophore (DiSC2(5))
Colorimetry
[89]
B. anthracis
SWCNT
Raman spectroscopy
[97]
B. anthracis
Electrically active magnetic

NPs
Cyclic voltammetry
0.01 ng/l
[94]
B. anthracis
GNPs
QCM
3.5 102 CFU/ [95]

ml
B. anthracis; S.
enteritidis
GNPs, magnetic NPs and NP Square wave anodic

tracers (PbS and CdS)
stripping
voltammetry
50 pg/ml
References
[90]
(continued)
278
Table 2
(continued)
Target
pathogen(s)
Nanostructuresa
Transduction
mechanism
LOD or
sensitivity
References
E. coli
DNA aptamer
Impedance
spectroscopy
107 M
[79]
E. coli
Alginic acid-coated Co
magnetic beads
Transmission electron 10 cells/ml

microscopy
[86]
E. coli
Fe2O3/Au magnetic NP and

magnetic NPs
Amperometry
5 CFU/ml
[99]
E. coli
O157:H7
Aluminum anodized oxide

(AAO) nanopore
membrane
Cyclic voltammetry
and impedance
spectroscopy
0.5 nM
[91]
E. coli
O157:H7
Magnetic beads and QDs
Fluorescence
250 zM
[104]
F. tularensis
MB
Fluorescence
[84]
M. avium
GNPs
Colorimetry
1.875 ng/l
[100]
(87.5100 %)
M. tuberculosis;
M. bovis
GNPs
Colorimetry
5 108 M
[85]
S. aureus
GNPs/poly-3,4ethylenedioxythiophene
(PEDOT) film
Chronoamperometry
150 pM
[96]
S. aureus
GNPs/PANI nanofibers
Cyclic voltammetry
pM range
[101]
S. aureus
(MRSA)
PNA
Impedance
spectroscopy
10 pM
[103]
Y. enterocolitica Carbon ionic liquid electrode Differential pulse

and V2O5 nanobelt/
voltammetry
MWCNT/chitosan
1.76 1012 M
[92]
C. perfringens; GNPs
C. tetani; S.
pneumoniae;
P. aeruginosa;
E. coli
QCM
1.5 102 CFU/ [83]

ml (94.12 %)
Salmonellae
Colorimetry
104 cells
GNPs and Ag enhancer
[88]
Micro-scaled magnetic particle labels are also considered in this table
Conclusions
The advances observed on the past decades in proteomics and
genomics have led to the discovery of novel diagnostic biomarkers
for pathogens relevant in human medicine. In parallel, cuttingedge developments in materials science and in nanotechnology
279
have also been registered. Veterinary science and practice took the
train and, as such, have been greatly favored from such advances.
Microfluidic technologies and nanoengineered structures, especially when coupled together, have led to an unprecedented degree
of high-throughput, large-scale genetic analysis, even at wholegenome levels. Ultimately, the high-throughput and multiplexing
abilities of in vivo (implanted or swallowed) nanosensor arrays
should be able to monitor animals physiology and health status
during their entire lifetime, and even beyond, intended to track
and assess the quality of animal products for human feeding. In this
way, the current shortcomings related with the limited number of
sanitary surveillance resources that can be allocated to guarantee
proper product origin, stocking, and shipping could be circumvented. So far, only few POC schemes and devices have reached the
exquisite sensitivity thresholds required for detection of nucleicacid traces in unamplified biological samples, which is the ultimate
goal of nucleic-acid testing. As for human diagnostics, the veterinary medicine and practice still lack the commercial availability of
more POC devices, more probably as a result of manufacturing and
commercial cost-effectiveness constraints than to a shortage of fundamental knowledge. While remaining too expensive for single
testing, many tests targeted for POC diagnosis will ultimately prove
to be cost-effective when savings with unnecessary laboratory manpower are taken into account. Other major challenges are the need
for initial investments that are often prohibitive for small companies and the usual difficulties for obtaining regulatory approvals for
testing and commercialization. For effective improvement of
human health, more adequate and coordinated actions to face animal diseases are needed, especially concerning livestock. This
includes a more effective technology transfer from developed countries to those where diseases are prevalent and where disease preventive measures may be crucial to avoid or contain epidemics.
Probably still without meritorious examples in the world, more
effective communication and coordination among public health,
animal health, and wildlife disease surveillance authorities will be
necessary to tackle the problems posed by common and hazardous
veterinary diseases, especially in situations of outbreaks endangering animal and human health as well.
References
1. Breeze RG (2006) Technology, public policy
and control of transboundary livestock diseases in our lifetimes. Rev Sci Technol
25:271292
2. Pieniazek NJ, Bornay-Llinares FJ, Slemenda
SB et al (1999) New Cryptosporidium genotypes in HIV-infected persons. Emerg Infect
Dis 5:444449
3. Robertson ID, Irwin PJ, Lymbery AJ et al
(2000) The role of companion animals in the
emergence of parasitic zoonoses. Int J Parasitol

30:13691377
4. Teles FRR, Prazeres DMF, Lima-Filho JL
(2005) Trends in dengue diagnosis. Rev Med
Virol 15:287302
5. Connelly JT, Kondapally S, Skoupi M et al
(2012) Micro-total analysis system for virus
detection: microfluidic pre-concentration
coupled to liposome-based detection. Anal
Bioanal Chem 402:315323
280
6. Hill SL, Cheney JM, Taton-Allen GF et al

(2000) Prevalence of enteric zoonotic organisms in cats. J Am Vet Med Assoc 216:
687692
7. Nicholson TL, Kukielka D, Vincent AL et al
(2011) Utility of a panviral microarray for
detection of swine respiratory viruses in clinical samples. J Clin Microbiol 49:15421548
8. Matero P, Hemmil H, Tomaso H et al
(2011) Rapid field detection assays for
Bacillus anthracis, Brucella spp., Francisella
tularensis and Yersinia pestis. Clin Microbiol
Infect 17:3443
9. Madi M, Hamilton A, Squirrell D et al (2012)
Rapid detection of foot-and-mouth disease
virus using a field-portable nucleic acid extraction and real-time PCR amplification platform. Vet J 193:6772
10. Pipper J, Inoue M, Ng LF-P et al (2007)
Catching bird flu in a droplet. Nat Med
13:12591263
11. Teles FSRR, Tavira LAPT, Fonseca LJP
(2010) Biosensors as rapid diagnostic tests for
tropical diseases. Crit Rev Clin Lab Sci
47:139169
12. Sims L (2012) The use of new technologies
for rapid, field-based (point-of-care) testing
in the detection of emergency animal diseases.
Australian Centre of Excellence for Risk
Analysis (ACERA), ACERA Project No.
1004B 2b (final report). http://www.acera.
unimelb.edu.au/materials/
endorsed/1004B_OID1_Repor t.pdf.
Accessed 28 Aug 2013
13. Dukes JP, King DP, Alexandersen S (2006)
Novel reverse transcription loop-mediated
isothermal amplification for rapid detection of
foot-and-mouth disease virus. Arch Virol
151:10931106
14. Scott NR (2007) Nanoscience in veterinary
medicine. Vet Res Commun 31(suppl
1):139144
15. Charleston B, Bankowski BM, Gubbins S
et al (2011) Relationship between clinical
signs and transmission of an infectious disease
and the implications for control. Science
332:726729
16. King DP (2013) Progress towards the development of simple and rapid diagnostic tests
away from centralised laboratories. World
Association of Veterinary Laboratory
Diagnosticians16th international symposium, Berlin, Germany, 58 June
17. Soliman H, El-Matbouli M (2010) Loop
mediated isothermal amplification combined
with nucleic acid lateral flow strip for diagnosis of cyprinid herpes virus-3. Mol Cell Probes
24:3843
18. Niemz A, Ferguson TM, Boyle DS (2011)
Point-of-care nucleic acid testing for infec-
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
tious diseases. Trends Biotechnol 29:

240250
Palmer S, Sully M, Fozdar F (2009) Farmers,
animal disease reporting and the effect of
trust: a study of West Australian sheep and
cattle farmers. Rural Soc 19:3248
Rodriguez-Sanchez B, Sanchez-Vizcaino
JM, Uttenthal A et al (2008) Improved
diagnosis for nine viral diseases considered
as notifiable by the World Organization for
Animal Health. Transbound Emerg Dis
55:2152225
Chomel BB (1998) New emerging zoonoses:
a challenge and an opportunity for the veterinary profession. Comp Immunol Microbiol
Infect Dis 21:114
Dubey JP (1994) Toxoplasmosis. J Am Vet
Med Assoc 205:15931598
Luppa PB, Mller C, Schlichtiger A et al
(2011) Point-of-care testing (POCT): current techniques and future perspectives.
Trends Anal Chem 30:887898
Teles FRR, Fonseca LP (2008) Trends in
DNA biosensors. Talanta 77:606623
Aguilera-Herrador E, Cruz-Vera M, Valcrcel
M (2010) Analytical connotations of pointof-care testing. Analyst 135:22202232
Banoo S, Bell D, Bossuyt P et al (2006)
Evaluation of diagnostic tests for infectious
diseases: general principles. Nat Rev
Microbiol:S20S32
Special Programme for Research and Training
in Tropical Diseases (TDR), Pediatric Dengue
Vaccine Initiative (PDVI) (2009) Evaluation
of commercially available anti-dengue virus
immunoglobulin M tests. Diagnostics
Evaluation Series 3, World Health
Organization, Geneva, Switzerland
Gialamas A, Laurence CO, Yelland LN et al
(2010) Assessing agreement between point of
care and laboratory results for lipid testing
from a clinical perspective. Clin Biochem
43:515518
Special Programme for Research and Training
in Tropical Diseases (TDR) (2009) Dengue:
guidelines for diagnosis, treatment, prevention and control. World Health Organization,
Geneva, Switzerland
Briggs C, Carter J, Lee S-H et al (2008)
ICSH Guideline for worldwide point-of-care
testing in haematology with special reference
to the complete blood count. Int J Lab
Hematol 30:105116
Bollo E (2007) Nanotechnologies applied to
veterinary diagnostics. Vet Res Commun
31(suppl 1):145147
Niemeyer CM (2001) Semi-synthetic nucleic
acid-protein conjugates: applications in life
sciences and nanobiotechnology. Rev Mol
Biotechnol 82:4766

33. Campbell NF, Evans JA, Fawcett NC et al
(1993) Detection of poly (U) hybridization
using azido modified poly (A) coated piezoelectric crystals. Biochem Biophys Res
Commun 196:858863
34. Bustin S, Penning LC (2012) Improving the
analysis of quantitative PCR data in veterinary
research. Vet J 191:279281
35. Pividori MI, Merkoi A, Alegret S (2000)
Electrochemical genosensor design: immobilisation of oligonucleotides onto transducer
surfaces and detection methods. Biosens
Bioelectron 14:291303
36. Pierce KE, Mistry R, Reid SM et al (2010)
Design and optimization of a novel reverse
transcription
linear-after-the-exponential
PCR for the detection of foot-and-mouth disease virus. J Appl Microbiol 109:180189
37. Kerby MB, Freeman S, Prachanronarong K
et al (2008) Direct sequence detection of
structured H5 influenza viral RNA. J Mol
Diagn 10:225235
38. Reid SM, Pierce KE, Mistry R et al (2010)
Pan-serotypic detection of foot-and-mouth
disease virus by RT linear-after-theexponential PCR. Mol Cell Probes
24:250255
39. Peters RHP, van Agtmael MA, Danner SA
et al (2004) New developments in the diagnosis of bloodstream infections. Lancet Infect
Dis 4:751760
40. Bearinger JP, Dugan LC, Baker BR et al
(2011) Development and initial results of a
low cost, disposable, point-of-care testing
device for pathogen detection. IEEE Trans
Biomed Eng 58:805808
41. Thai HTC, Le MQ, Vuong CD et al (2004)
Development and evaluation of a novel loopmediated isothermal amplification method for
rapid detection of severe acute respiratory
syndrome coronavirus. J Clin Microbiol
42:19561961
42. Takekawa JY, Iverson SA, Scultz AK et al
(2010) Field detection of avian influenza
virus in wild birds: evaluation of a portable
rRT-PCR system and freeze-dried reagents. J
Virol Methods 166:9297
43. Abe T, Segawa Y, Watanabe H et al (2011)
Point-of-care testing system enabling 30 min
detection of influenza genes. Lab Chip
11:11661167
review of RT-PCR technologies used in veterinary virology and disease control: sensitive
and specific diagnosis of five livestock diseases
notifiable to the World Organisation for
Animal Health. Vet Microbiol 139:123
45. Parida M, Posadas G, Inoue S et al (2004)
Real-time reverse transcription loop-mediated
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
281
isothermal amplification for rapid detection of

West Nile virus. J Clin Microbiol 42:
257263
Foord A, Boyd V, Heine H (2011) A loop
mediated isothermal amplification assay for
detection of Hendra virus in the field [Poster].
One health conference, Melbourne, Australia,
1416 February
Mori Y, Notomi T (2009) Loop-mediated
isothermal amplification (LAMP): a rapid,
accurate, and cost-effective diagnostic method
for infectious diseases. J Infect Chemoter
15:6269
Ryan E, Gloster J, Reid SM et al (2008)
Clinical and laboratory investigations of the
outbreaks of foot-and-mouth disease in
southern England in 2007. Vet Rec
163:139147
Kerman K, Kobayashi M, Tamiya E et al
(2004) Recent trends in electrochemical
DNA biosensor technology. Meas Sci Technol
15:R1R11
Lee WG, Bang H, Yun H et al (2007) On-chip
erythrocyte deformability test under optical
pressure. Lab Chip 7:516519
Heng X, Erickson D, Baugh LR et al (2006)
Optofluidic microscopya method for implementing a high resolution optical microscope
on a chip. Lab Chip 6:12741276
Novak L, Neuzil P, Pipper J et al (2007) An
integrated fluorescence detection system for
lab-on-a-chip
applications.
Lab
Chip
7:2729
Rivet C, Lee H, Hirsch A et al (2011)
Microfluidics for medical diagnostics and biosensors. Chem Eng Sci 66:14901507
Breslauer DN, Maamari RN, Switz NA et al
(2009) Mobile phone based clinical microscopy for global health applications. PLoS One
4:e6320(1-7)
LeBlanc N, Gantelius J, Schwenk JM et al
(2009) Development of a magnetic bead
microarray for simultaneous and simple detection of four pestiviruses. J Virol Methods
155:19
Tai D-F, Lin C-Y, Wu T-Z et al (2006)
Artificial receptors in serologic tests for the
early diagnosis of dengue virus infection. Clin
Chem 5:14861491
Zimmermann M, Schmid H, Hunziker P et al
(2007) Capillary pumps for autonomous capillary systems. Lab Chip 7:119125
Ellerbee AK, Phillips ST, Siegel AC et al
(2009) Quantifying colorimetric assays in
paper-based microfluidic devices by measuring the transmission of light through paper.
Anal Chem 81:84478452
Ruf HH, Knoll T, Misiakos K et al (2006)
Biochip-compatible packaging and micro-
282
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.

fluidics for a silicon opto-electronic biosensor.
Microelectron Eng 83:16771680
Radisic M, Iyer RK, Murthy SK et al (2006)
Micro- and nanotechnology in cell separation. Int J Nanomedicine 1:314
Beyor N, Yi L, Seo TS et al (2009) Integrated
capture, concentration, polymerase chain
reaction, and capillary electrophoretic analysis
of pathogens on a chip. Anal Chem
81:35233528
Bhattacharyya A, Klapperich CM et al (2008)
Microfluidics-based extraction of viral RNA
from infected mammalian cells for disposable
molecular diagnostics. Sensor Actuator B
129:693698
Jenny SL, Hu Y, Overduin P et al (2010)
Evaluation of the Xpert Flu A Panel nucleic
acid amplification-based point-of-care test for
influenza A virus detection and pandemic H1
subtyping. J Clin Virol 49:8589
Rand KH, Rampersaud H, Houck HJ (2011)
Comparison of two multiplex methods for
detection of respiratory viruses: FilmArray RP
and xTAG RVP. J Clin Microbiol
49:24492453
Fang X, Chen H, Yu S et al (2011) Predicting
viruses accurately by a multiplex microfluidic
loop-mediated isothermal amplification chip.
Anal Chem 83:690695
Mahalanabis M, Al-Muayad H, Kulinski MD
et al (2009) Cell lysis and DNA extraction of
gram-positive and gram-negative bacteria
from whole blood in a disposable microfluidic
chip. Lab Chip 9:28112817
James HE, Ebert K, McGonigle R et al
(2010) Detection of African swine fever virus
by loop-mediated isothermal amplification. J
Chang W-H, Yang S-Y, Wang C-H et al (2013)
Rapid isolation and detection of aquaculture
pathogens in an integrated microfluidic system
using loop-mediated isothermal amplification.
Sensor Actuator B 180:96106
Zhao J, Tang S, Storhoff J et al (2010)
Multiplexed, rapid detection of H5N1 using a
PCR-free nanoparticle-based genomic microarray assay. BMC Biotechnol 10:74
Hohng S, Ha T (2005) Single-molecule
quantum-dot fluorescence resonance energy
transfer. Chem Phys Chem 6:956960
Alivisatos AP (2007) Less is more in medicine. Sci Am 23:7379
Briese T, Palacios G, Kokoris M et al (2005)
Diagnostic system for rapid and sensitive differential detection of pathogens. Emerg
Infect Dis 11:310313
Palacios G, Briese T, Kapoor V et al (2006)
MassTag polymerase chain reaction for differ-
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
ential diagnosis of viral hemorrhagic fevers.

Rife JC, Whitman LJ (2004) Fluidic force
discrimination. US Patent application publication 2004-0253744
Baselt D, Lee GU, Natesan M et al (1998) A
biosensor based on magnetoresistance technology. Biosens Bioelectron 13:731739
Lee W-C, Lien K-Y, Lee G-B et al (2008) An
integrated microfluidic system using magnetic
beads for virus detection. Diagn Microbiol
Infect Dis 60:5158
Vaddiraju S, Tomazos I, Burgess DJ et al
(2010) Emerging synergy between nanotechnology and implantable biosensors: a review.
Gruner G (2007) Carbon nanonetsspark
new electronics. Sci Am 17:4855
Queirs RB, de-los-Santos-lvarez N,
Noronha JP et al (2013) A label-free DNA
aptamer-based impedance biosensor for the
detection of E. coli outer membrane proteins.
Sensor Actuator B 181:766772
Xu Y, Phillips JA, Yan J et al (2009) Aptamerbased microfluidic device for enrichment,
sorting, and detection of multiple cancer
cells. Anal Chem 81:74367442
Jung J, Chen L, Lee S et al (2007) Fast and
sensitive DNA analysis using changes in the
FRET signals of molecular beacons in a
PDMS microfluidic channel. Anal Bioanal
Chem 387:26092615
Wang J, Paleek E, Nielsen PE et al (1996)
Peptide nucleic acid probes for sequencespecific DNA biosensors. J Am Chem Soc
118:76677670
Cai J, Yao C, Xia J et al (2011) Rapid parallelized and quantitative analysis of five pathogenic bacteria by ITS hybridization using
QCM biosensor. Sensor Actuator B
155:500504
Ramachandran A, Flinchbaugh J, Ayoubi P
et al (2004) Target discrimination by surfaceimmobilized molecular beacons designed to
detect
Francisella tularensis.
Biosens
Silva LB, Veigas B, Doria G et al (2011)
Portable optoelectronic biosensing platform
for identification of mycobacteria from the
Mycobacterium tuberculosis complex. Biosens
Geng P, Zhang X, Teng Y et al (2011) A
DNA sequence-specific electrochemical biosensor based on alginic acid-coated cobalt
magnetic beads for the detection of E. coli.
Wang R, Zhao J, Jiang T et al (2013) Selection
and characterization of DNA aptamers for use
88.
89.
90.
91.
92.
93.
94.
95.
96.
in detection of avian influenza virus H5N1. J

Liu C-C, Yeung C-Y, Chen P-H et al (2013)
Salmonella detection using 16S ribosomal
DNA/RNA probe-gold nanoparticles and
lateral flow immunoassay. Food Chem
141:25262532
Duy J, Smith RL, Collins SD et al (2014) A
field-deployable colorimetric bioassay for the
rapid and specific detection of ribosomal
RNA. Biosens Bioelectron 52:433437
Zhang D, Huarng MC, Alocilja EC (2010) A
multiplex nanoparticle-based bio-barcoded
DNA sensor for the simultaneous detection of
multiple pathogens. Biosens Bioelectron
26:17361742
Wang L, Liu Q, Hu Z et al (2009) A novel electrochemical biosensor based on dynamic polymerase-extending hybridization for E. coli
O157:H7 DNA detection. Talanta 78:647652
Sun W, Qin P, Gao H et al (2010)
Electrochemical DNA biosensor based on
chitosan/nano-V2O5/MWCNTs composite
film modified carbon ionic liquid electrode
and its application to the LAMP product of
Yersinia enterocolitica gene sequence. Biosens
Ganbold E-O, Kang T, Lee K et al (2012)
Aggregation effects of gold nanoparticles for
single-base mismatch detection in influenza A
(H1N1) DNA sequences using fluorescence
and Raman measurements. Colloids Surf B
Biointerfaces 93:148153
Pal S, Alocilja EC (2010) Electrically active
magnetic nanoparticles as novel concentrator
and electrochemical redox transducer in
Bacillus anthracis DNA detection. Biosens
Hao R-Z, Song H-B, Zuo G-M et al (2011)
DNA probe functionalized QCM biosensor
based on gold nanoparticle amplification for
Bacillus anthracis
detection.
Biosens
Spain E, Keyes TE, Forster RJ (2013) DNA
sensor based on vapour polymerised pedot
films functionalised with gold nanoparticles.
283
97. Bansal J, Singh I, Bhatnagar PK et al (2013)

DNA sequence detection based on Raman
spectroscopy using single walled carbon
nanotube. J Biosci Bioeng 115:438441
98. Lee K-H, Choi S-H, Lee J-O et al (2011)
An autonomous CMOS hysteretic sensor
for the detection of desorption-free DNA
hybridization. Biosens Bioelectron 26:
45914595
99. Li K, Lai Y, Zhang W et al (2011) Fe2O3@Au
core/shell nanoparticle-based electrochemical DNA biosensor for Escherichia coli detection. Talanta 84:607613
100. Liandris E, Gazouli M, Andreadou M et al
(2009) Direct detection of unamplified DNA
from pathogenic mycobacteria using DNAderivatized gold nanoparticles. J Microbiol
Methods 78:260264
101. Spain E, Kojima R, Kaner RB et al (2011)
High sensitivity DNA detection using gold
nanoparticle functionalized polyaniline
nanofibres. Biosens Bioelectron 26:
26132618
102. Wang R, Li Y (2013) Hydrogel based QCM
aptasensor for detection of avian influenza
virus. Biosens Bioelectron 42:148155
103. Corrigan DK, Schulze H, Henihan G et al
(2012) Impedimetric detection of singlestranded PCR products derived from methicillin resistant Staphylococcus aureus
(MRSA) isolates. Biosens Bioelectron
34:178184
104. Liu Y-J, Yao D-J, Chang H-Y et al (2008)
Magnetic bead-based DNA detection with
multi-layers quantum-dots labeling for rapid
detection of Escherichia coli O157:H7.
105. An D-J, Jeong W, Jeoung H-Y et al (2012)
Peptide nucleic acid-based (PNA) array for
the antigenic discrimination of canine parvovirus. Res Vet Sci 93:515519
106. Dhumpa R, Handberg KJ, Jrgensen PH
et al (2011) Rapid detection of avian influenza virus in chicken fecal samples by immunomagnetic
capture
reverse
transcriptase-polymerase chain reaction assay.
Diagn Microbiol Infect Dis 69:258265
Part III
Molecular Profiling of Veterinary Relevant Microbial
Pathogens
Chapter 21
Molecular Typing Tools: From Pattern Recognition
to Genome-Based Algorithms
Abstract
In the present chapter, we discuss DNA-based typing methods for microbial pathogens that were frequently
used in the past two decades and their essential features, as well as virtues and downsides. We conclude
with an outlook on the fundamental changes that can be expected in the era of high-throughput
genomics.
Key words Review, RAPD, RFLP, AFLP-PCR, PFGE, VNTR/MLVA, MIRU-VNTR, Spoligotyping,
Single-locus sequence typing, MLST, Genomotyping
Introduction
Ever since diagnosticians have been trying to identify the origin of
disease outbreaks, there was a demand for characterizing and classifying the microbial strain involved. Strain typing can help to
reveal important information about the infection, i.e., (1) transmission pathways and patterns, (2) possible association of the strain
with clinical manifestations and pathogenicity, (3) specific tissue or
organ affinity, and (4) the status of the infection, e.g., new infection, reinfection, or persistent infection.
Historically, the first typing schemes were based on phenotypes,
e.g., surface morphology (e.g., gram stain), serotype, biotype, or
intrinsic phenotypic properties, such as fermentation of substrates,
auxotrophy, or expression of specific antigens. The broad use of
DNA amplification and sequencing technology in the past two
decades prompted the gradual phasing out of most of these methods and a shift toward genetic typing schemes.
Most of the currently recognized approaches are based on
variations in specific genomic loci that are exploited in a direct (i.e.,
through sequence analysis) or indirect (e.g., through cleavage patterns) fashion. Since the target region for typing is usually selected
287
288
individually for each microbial agent, the vast majority of the

established molecular typing methods were designed for a particular species, group of species, genus, or family. Usually, a single
locus or a limited number of loci are targeted. These circumstances
imply limitations to the discriminatory capacity of each typing
assay. For instance, when restriction fragment length polymorphism analysis (RFLP) and mycobacterial interspersed repetitive
unit-variable number tandem repeat (MIRU-VNTR) were used in
a comparative study on tuberculosis cases, they produced different
clustering of a substantial part of the strains examined [1].
Therefore, a combination of two or more genotyping methods will
often be required to improve resolution and ensure accuracy of the
findings [2, 3]. Now that high-throughput genome sequencing
technology has become more affordable and is within reach for
more and more laboratories, it seems certain that typing algorithms
for broader use with multiple species will be tomorrows
standards.
An overview of papers on molecular typing methods used for
selected microbial agents of veterinary relevance is given in Table 1.
In the present chapter, we discuss DNA-based typing methods
that were frequently used in the past two decades, their essential
features, as well as virtues and downsides. We conclude with an
outlook on the fundamental changes that can be expected in the
era of high-throughput genomics.
Some of the typing methods described in the following sections were also used for phylogenetic studies. To justify the latter,
more stringent criteria for the choice of target structures have to be
applied, namely, stability to evolutionary pressure, which implies a
preference for ribosomal RNA and housekeeping genes. In fact,
only a minor proportion of the methods are suitable for both
epidemiological and phylogenetic purposes.
2
2.1
Fingerprint Typing Methods

RAPD
Random amplified polymorphic DNA (RAPD) analysis represents

a special variation of PCR that can be regarded as gross wholegenome characterization. It consists in parallel amplification of an
arbitrary set of genomic segments using short oligonucleotide
primers of 812 nucleotides [4]. The amplification reaction involves
one or more primers and is conducted at low-stringency conditions. The low annealing temperature allows primer binding to
multiple sites that do not need to be completely complementary,
so that the numbers and positions of binding sites are unique for
each bacterial strain. Numerous amplicons in the range of 0.13 kbp
can be produced and subsequently visualized using agarose gel
electrophoresis.
Molecular Typing Tools
289
Table 1
Selection of published genotyping studies on bacterial pathogens
Agent
Genotyping method
References
Bacillus anthracis
VNTR/MLVA
SNP analysis
[9193]
[94, 95]
Borrelia spp.
PCR-RFLP subtyping (ospA)

MLST
[54, 96]
[97]
Brucella spp.
SNP analysis
[98]
B. abortus, B. suis, B. melitensis,

and B. canis
VNTR/MLVA
[99101]
MLST
[102, 103]
Burkholderia mallei
MLST
VNTR/MLVA
PFGE
[104106]
[107, 108]
[109]
Campylobacter spp.
PFGE
MLST
PCR-RFLP genotyping (flaA)
Microarray DNA hybridization
assay
[110]
[111, 112]
[11, 113]
[114, 115]
C. fetus subsp. venerealis and

C. fetus subsp. fetus
PFGE
[25, 116]
AFLP
MLST
[21, 117]
[118, 119]
Chlamydia spp.
MLST
[61, 120]
Chlamydia psittaci
ompA genotyping (DNA

microarray, RFLP)
VNTR/MLVA
MLST
[51, 53, 121]
Chlamydia abortus
VNTR/MLVA
[123]
Clostridium botulinum
PFGE
VNTR/MLVA
[26, 27]
[124]
Clostridium perfringens
PFGE
VNTR/MLVA
[125128]
[129, 130]
Clostridium difficile
VNTR/MLVA
[131]
Clostridium septicum
MLST
[132]
Coxiella burnetii
VNTR/MLVA
10-locus multi-spacer sequence
typing (MST)
[133135]
[68, 69]
Escherichia coli
Multiplex PCRs for differentiation

of E. coli pathovars
PCR (stx1/stx2 gene)
PCR (eae gene)
PCR-RFLP (eae gene)
PCRs and PCR-RFLP assay (fedA,
K88 gene)
[136139]
[122]
[62]
[140]
[48, 49, 141, 142]
[143]
[144146]
(continued)
290
Table 1
(continued)
Agent
Genotyping method
References
Microarray genotyping
MLST
[147149]
[150]
PFGE
AFLP
VNTR/MLVA
SNP genotyping (RT-PCR,
microarray)
VNTR + INDELs + SNP
[151]
[151]
[152, 153]
[154]
Mycobacterium avium subsp.

paratuberculosis
Reviews
PFGE
IS900-RFLP
MIRU-VNTR
MLSSR
[157, 158]
[159161]
[16, 17]
[33]
[3, 162164]
M. avium subsp. avium
IS901-RFLP
MIRU-VNTR
[165]
[33]
M. avium subsp. hominissuis
IS1245-RFLP, IS1311-RFLP
MIRU-VNTR
[166168]
[33]
Mycobacterium tuberculosis
complex
IS6110-RFLP
[13]
MIRU-VNTR
[3538]
M. bovis
M. caprae
MIRU-VNTR
Spoligotyping, microarray
spoligotyping
[169]
[41, 44]
Mycoplasma mycoides subsp.

mycoides
VNTR/MLVA
MLST
[170]
[171173]
Mycoplasma bovis
RAPD
AFLP
PFGE
VNTR/MLVA
MLST
[5]
[5]
[5]
[174, 175]
[176]
Salmonella enterica
Reviews
PFGE
VNTR/MLVA
S. Typhimurium
VNTR/MLVA
S. Enteritidis
VNTR/MLVA
S. Newport
MLST
[177179]
[28, 179, 180]
[181]
Francisella tularensis
Taylorella equigenitalis
[155, 156]
[182184]
[185]
MLST (prophage loci)

MLST-seq
DNA microarray typing
[59, 186]
(http://mlst.
ucc.ie/mlst/
dbs/Senterica)
[187]
[188]
[77, 189, 190]
PFGE
[191194]
291
RAPD has been used for discriminatory analysis of isolates of

many microbial pathogens. For instance, investigating Mycoplasma
bovis infections in cattle, the number of distinct strains present in a
geographical region or a herd was determined based on the
obtained banding patterns [5, 6]. This included identification of the
strain at the source of the outbreak [7]. Likewise, strains of
Mycobacterium (M.) avium were distinguished by their fingerprints
using a panel of four or six primers [8, 9]. Differentiation among
M. avium subsp. paratuberculosis strains using RAPD was also
attempted [10], but proved more difficult.
The basic asset of the method is its versatility, which allows the
use of a theoretically unlimited number of primers and thus offers
unlimited capacity for revealing strain-to-strain differences [9]. It
also means that the methodology can be adapted individually to
any organism. While the method is easy to use, inexpensive, and
rapid, its major drawback consists in limited reproducibility.
Banding patterns tend to vary considerably from run to run and
from laboratory to laboratory. Therefore, it was recommended to
conduct RAPD analyses in triplicate [8].
2.2
RFLP
Restriction fragment length polymorphism (RFLP) analysis is based

on enzymatic cleavage of genomic DNA of an isolate. The fragments generated by specific restriction endonucleases are separated
according to their size using gel electrophoresis. Mutations in the
genome can lead to changes in the number of cleavage sites, whereas
insertions and deletions can shift their positions and give rise to
fragment length polymorphisms.
A well-known example of RFLP typing refers to Campylobacter
jejuni, where the tandem flagellin genes flaA and flaB served as
target for subtyping in molecular epidemiological studies [11].
The classical serovars of Chlamydia psittaci could be distinguished
using PCR-RFLP of the ompA gene locus [12].
If an organisms genome carries specific insertion sequences,
Southern hybridization with a fluorescent-labeled complementary
gene probe can be used to reveal banding patterns that are specific
for individual strains. Thus, IS6110-RFLP was widely used for
genotyping strains of the Mycobacterium tuberculosis complex
(MTC), e.g., M. tuberculosis [13], M. bovis, and M. caprae [14].
The discriminatory capacity is particularly high for strains with six
or more IS6110 copies [15]. In the case of M. avium subsp. paratuberculosis, RFLP based on IS900 and using at least two restriction
enzymes can provide high resolution in typing [16, 17]. Ribotyping
[18], which was used for years as a versatile typing method for
bacterial families, genera, and species, also includes the use of
rDNA probes, so that only those bands containing a portion of the
ribosomal operon are visualized. The number of reactive bands on
Southern blot reflects the multiplicity of rRNA operons in a microbial species. Numerous applications to taxonomic classification,
epidemiological tracking, geographical distribution, population
292
biology, and phylogeny were reported [19]. The general use of

RFLP-based typing has been in decline for the last few years, not
so much for being labor-intensive, time-consuming, and technically demanding, but mainly because more efficient assays have
become available (see below).
2.3
AFLP-PCR
Amplified fragment length polymorphism (AFLP) analysis is based

on selective PCR amplification of restriction endonuclease-digested
genomic DNA [20]. The cleavage reaction involving one,
(typically) two, or more enzymes is followed by ligation of oligonucleotide adaptors on both termini of the fragments. Subsequent
PCR often includes two amplification steps and uses primers complementary to the adaptor sequences to amplify a subset of the
restriction fragments. Individual assays can be tailored by using
selective bases in the adaptor sequences to keep the number and
size of finally generated amplicons in a manageable range, e.g.,
50100 fragments of 50500 bp. Visualization of the patterns is
accomplished through acrylamide gel or capillary electrophoresis.
In a comparative study on Mycoplasma bovis isolates from cases
of respiratory disease in calves from different regions of the United
Kingdom, McAuliffe et al. [5] identified two genetically distinct
clusters, whereupon the AFLP-PCR findings largely coincided
with those of RAPD. Wagenaar et al. [21] used AFLP-PCR for
genotyping of Campylobacter fetus strains and were able to differentiate the subspecies Campylobacter fetus subsp. venerealis. Hu
et al. [22] identified phage type-specific markers by using this technique for Salmonella Typhimurium strains.
The advantages of AFLP-PCR include its high sensitivity and
resolution for genome-wide detection of polymorphisms, as well as
relatively good reproducibility. On the other hand, the number of
amplified fragments has to be limited in order to keep the performance at high level. All in all, the procedure is relatively elaborate
and requires purified and intact double-stranded DNA, as well as
specialized equipment and software.
2.4
PFGE
The acronym stands for macro-restriction fragment length polymorphism analysis using pulsed-field gel electrophoresis. The
method utilizes specific restriction sites throughout the microbial
genome for differentiation below the species level. Bacterial cultures are embedded in agarose blocks, lysed in situ, and digested
with rare-cutter restriction endonucleases. The resulting macrorestriction fragments sized up to 10 Mb can only be separated
using agarose gel electrophoresis with an alternating electric field
[23]. The final fingerprint patterns typically consist of 1020 fragments. For an update on recent developments in PFGE technology, the reader is referred to an exhaustive review [24].
Due to its high discriminatory power, PFGE analysis evolved
as a gold standard for typing of many bacteria, such as Campylobacter
293
spp. [25], Clostridium spp. [26, 27], and Salmonella [28]. There
are publicly accessible databases having thousands of individual
strain patterns of food-borne pathogens, such as Salmonella
serovars, Listeria monocytogenes, and others (e.g., http://www.
pulsenetinternational.org/).
The main reason why the use of the procedure has been confined to a limited circle of specialized laboratories lies in its sophisticated and technically demanding work flow. For instance, the in
situ digestion of genomic DNA in the agarose block may prove
difficult for certain pathogens. Therefore, it remains a challenge to
attain satisfactory interlaboratory reproducibility.
3
3.1
Typing Based on Repetitive Elements

VNTR/MLVA
Variable number tandem repeat (VNTR) analysis is targeting short

nucleotide sequences (up to 100 bp) organized as tandem repeats in
selected genomic regions [29]. Individual strains may vary in the
number of repeat units associated with a certain locus. In the case of
mycobacteria and other pathogens, multiple-locus VNTR analysis
(MLVA) is an approach characterizing the polymorphism of tandemly repeated sequences in a number of genomic loci. The extensive use of MLVA typing for the characterization of food-borne
pathogens, such as Salmonella enterica, Listeria monocytogenes,
Escherichia coli, Brucella spp., and other bacteria, was reviewed
recently by Lindstedt et al. [30]. The reader is also referred to the
PulseNet database at http://www.pulsenetinternational.org/.
The practical assay comprises PCR amplification of the respective genomic locus or loci and subsequent electrophoretic separation of the products. The resolution parameters of agarose gel
and capillary electrophoresis are comparable [31]. The number of
repeats in the loci can be calculated from electrophoresis and combined into the MLVA profile. For instance, in the case of Coxiella
burnetii, the code 7-6-6-3-5-3-7-3-13 denotes the number of
repeats present in loci MS 03, 21, 22, 28, 30, 31, 34, 27, and 36,
respectively, which corresponds to the unique profile designated
CbNL01 [32]. For M. avium subsp. paratuberculosis, the panel of
tandem repeats denoted 3-2-3-3-2-2-2-8 in the MIRU-VNTR
loci 292, X3, 25, 47, 3, 7, 10, and 32, respectively, represents profile INMV2 [33].
VNTR/MLVA can be conducted directly on bacterial cell
lysates and is generally well reproducible from laboratory to laboratory. The simple digitized output data format facilitates storage
in databases and exchange among collaborators. As the technology
allows differentiation below species level and identification of
mixed infections, it lends itself for large-scale multilateral epidemiological surveys, as well as phylogenetic studies. However, its
use will be confined to those pathogens possessing a sufficient
number of highly variable repeat regions.
294
Table 2
VNTR loci recommended for MLVA typing of Mycobacterium bovis, Mycobacterium caprae, and other
MTC isolatesa
Locusb
Synonym
VNTR 424
Specificity
MTC, M. bovis + M. caprae, M. caprae
VNTR 580
ETR D
No diversity in certain geographical regions
VNTR960
MIRU 10
MTC, M. bovis + M. caprae
VNTR 1644
MIRU 16
M. bovis + M. caprae
VNTR 1955
MTC, M. bovis + M. caprae, M. bovis
VNTR 2163a
QUB 11a
MTC, M. bovis + M. caprae, M. bovis, M. caprae
VNTR 2163b
QUB 11b
VNTR 2165
ETR A
VNTR 2461
ETR B
M. bovis
VNTR 3232
QUB 3232
VNTR 3690
VNTR 4052
QUB 26
MTC, M. bovis + M. caprae, M. bovis
VNTR 4156
QUB 4156
MTC, M. bovis + M. caprae, M. caprae
Bold print means that the respective loci are particularly suitable for differentiating among M. bovis and
M. caprae strains, respectively
a
Compiled by the National Reference Laboratory for Bovine Tuberculosis at Friedrich-Loeffler-Institut Jena, Germany
(Head: Dr. Irmgard Moser)
b
All loci have a discriminatory index larger than 0.6 according to Hunter and Gaston [195]
3.2
MIRU-VNTR
MIRU (mycobacterial interspersed repetitive units)-VNTR is a

mycobacteria-specific term for an MLVA typing scheme. It is based
on 40100-bp DNA elements arranged as tandem repeats and dispersed in intergenic regions of MTC genomes [34]. MIRU-VNTR
typing allows high-throughput discriminatory analysis of clinical
MTC isolates. The resolution of a typing assay can be fine-tuned
depending on the number of examined loci. Different workers
suggested using 24 [35], 12 [36, 37], or 15 [38, 39] loci.
The MTC members of veterinary relevance include M. bovis,
M. caprae, M. microti, and M. pinnipedii. Their strains can be
analyzed based on a variety of VNTR loci as compiled in Table 2.
Thus, six loci are recommended for differentiation among M. bovis
and five for M. caprae strains.
3.3
SSR Typing
Short sequence repeat (SSR)-based typing exploits variations in

length and distribution of homopolymeric tracts of a singlenucleotide (mononucleotide repeats) or multimeric tracts (di- or
trinucleotide repeats) in homogeneous or heterogeneous arrangements. The approach is actually a special case of VNTR analysis.
295
Genomic regions harboring this kind of repeats are often the most
variable targets in a bacterial genome, whereas longer repeats are
generally less diverse. SSR typing was suggested for differentiation
and subtyping of Mycoplasma spp., Mycobacterium spp., and other
bacteria [29].
The method can be efficient in discriminating between similar
strains. However, mononucleotide repeats of more than ten units
can give rise to slipped-strand mispairing or replication slippage
events affecting the DNA polymerase during the amplification
reaction. This leads to inaccurate results as shown in a study on M.
avium subsp. paratuberculosis [40].
3.4
Spoligotyping
As a specialized typing scheme based on repetitive elements, spacer

oligonucleotide typing or spoligotyping detects the presence or
absence of 43 specific DNA spacer sequences in the direct repeat
(DR) genomic region of all currently classified MTC organisms,
i.e., M. tuberculosis, M. bovis, M. caprae, M. africanum, M. canettii,
M. microti, and M. pinnipedii. It was the first PCR-based genotyping method for tuberculosis agents [41] and has become widely
accepted for epidemiological tracking [42] and evolutionary studies [43]. To facilitate high-throughput spoligotyping, the conventional membrane-based hybridization protocol may be replaced by
a recently developed DNA microarray assay [44]. The resulting
hybridization pattern is converted into the generally established
binary and octal codes [45], so that the output of this assay can be
directly submitted to the international spoligotyping databases
SpolDB4.0 [46] and Mbovis.org [47]. The methodology is widely
used and well standardized, and the use of databases allows easy
interlaboratory comparison of MTC strains. A recent comparative
study revealed that spoligotyping is generally less discriminatory
for MTC strains than IS6110 RFLP analysis and MIRU-VNTR
using 12 or 15 loci [42].
Single-Locus Sequence Typing

Highly variable genomic loci have been used to distinguish among
strains of a species. Initially, the relevant genetic polymorphisms
were detected using PCR with subsequent restriction enzyme analysis (PCR-RFLP) or Southern hybridization, before direct sequencing became commonly available. In recent years, the tendency
toward direct use of nucleotide sequences instead of restriction
enzyme digestion has increased. Sequence data have the advantage
of being unambiguous, universally applicable and portable.
Therefore, they are easily comparable, transferable, and compatible
with many different typing approaches.
The first genomic locus used for typing purposes was the ribosomal RNA operon [18]. In the last three decades, ribotyping was
296
used extensively with microorganisms of more than 200 genera for

taxonomic classification, epidemiological tracking, and phylogenetic analysis. While comparatively easy to perform and well reproducible, the techniques discriminatory capacity is considered to be
limited and less satisfactory in the age of genomics. In a critical
review, Bouchet et al. [19] suggested an in silico ribotyping scheme
to reflect the complete molecular genetic basis of ribotype
polymorphisms. They found out that genetic variation in the
housekeeping genes flanking the ribosomal operon was primarily
responsible for these polymorphisms and, therefore, had to be
taken into account when interpreting ribotyping data.
Strains of enterohemorrhagic Escherichia coli produce the outer
membrane protein intimin encoded by the eae gene. The proteins
high variability in the C-terminal region, where the host cell-binding
specificity is localized, provided the basis for the eae typing scheme
[48, 49]. In the area of Chlamydia spp., the demonstration of
equivalence between traditional serotypes and ompA genotypes
[50] represented a crucial finding that allowed the replacement of
serotyping. To date, at least 15 ompA genotypes of Chlamydia psittaci have been described, and the original PCR-RFLP procedure
has been supplanted by DNA microarray genotyping [51, 52] and
real-time PCR [53]. The locus encoding the outer surface protein
OspA was shown to differentiate among the species of Borrelia
burgdorferi sensu lato and within the heterogeneous species of
Borrelia garinii [54, 55]. Single-locus typing based on nucleotide
sequence data can further improve accuracy and repeatability
compared to PCR-RFLP. For instance, the modification of Campylobacter spp. flaA typing to a sequence-based protocol easily allowed
inclusion of the flaB gene and led to an increase in resolution [56].
While single-locus typing schemes are still widely used, their
major caveat is the limited discriminatory potential due to the fact
that one locus alone often cannot provide high epidemiological
resolution.
Multi-locus Sequence Typing (MLST)

Analyzing six to eight genomic loci encoding conserved housekeeping genes has become a widely used approach in epidemiology
of microbial infections. Variable segments from each target gene of
an average size between 400 and 600 bp are PCR amplified using
specific primers and sequenced. The sequence type (ST) or allelic
profile of a strain represents a defined set of sequences, each representing a distinct allele within the microbial species. An arbitrary
number is assigned to each allele (unique sequence), so that the
allelic profile is presented as a combination of numbers.
Since its introduction in 1998 [57], MLST has evolved as the
most widely used tool in molecular typing of microbial strains. In
a recent review, Prez-Losada et al. [58] outlined the amazing
297
achievements reached through the use of this typing approach over

the past decade. Several publicly accessible MLST databases are
available for about 80 microorganisms, mainly bacteria, e.g.,
http://pubmlst.org and http://www.pasteur.fr. Users can run
their sequence data and conduct inquiries for allele sequence identification, allelic profile identification, and matching of isolates.
Moreover, there is a number of specialized software programs to
process experimental data (for details, see ref. 58).
The main areas of application include molecular epidemiology,
phylogeny, and taxonomy, as well as population structure and
dynamics. An MLST scheme for Salmonella enterica comprised
seven housekeeping genes, i.e., aroC, dnaN, hemD, hisD, purE,
sucA, and thrA [59]. The scheme revealed a characteristic clustering of serovar Derby isolates from humans and pigs that correlated
well with other typing methods, but failed to unambiguously reveal
animal-to-human transmission [60].
Korczak et al. [56] introduced an optimized MLST strategy
for Campylobacter jejuni and C. coli that included the aspA, atpA,
glmM, glnA, gltA, glyA, and tkt loci. This system identified 118
different STs, 34 of which were described for the first time.
In the case of chlamydiae, three different typing schemes have
been suggested. Dean et al. [61] selected seven genes on the basis
of (1) diverse chromosomal regions where a single recombinational exchange would be unlikely to co-introduce >1 selected
gene, (2) regions where several contiguous genes were involved in
metabolic or key functions, (3) essential metabolic enzymes (e.g.,
tRNA synthases), (4) genes without similarity to human genes, and
(5) no genes under diversifying selection. The panel includes glyA,
mdhC, pdhA, yhbG, pykF, lysS, and leuS loci and is suitable for epidemiological and phenotypic studies.
Pannekoek et al. [62] included seven housekeeping genes
(enoA, fumC, gatA, gidA, hemN, hlfX, oppA), which allowed the
detection of links between individual STs of Chlamydia psittaci
and Chlamydia abortus and their host species. Another approach
based on five highly variable but stable genomic loci (hctB, CT058,
CT144, CT172, and pbpB) was intended for short-term clinical
epidemiology and outbreak investigations and provided superior
resolution [63]. The system was later modified into a DNA microarray assay by Christerson et al. [64] to allow rapid and economical
typing at high throughput.
The fact that MLST is strictly sequence based renders it not
only unambiguous and highly discriminatory but also portable and
repeatable from one laboratory to another. One of the few drawbacks is associated with the selection of the housekeeping loci. The
selection criteria applied to the different microorganisms are not
always comparable as they depend on current knowledge and
certainly also the preferences of individual workers. While the original idea consisted in using only housekeeping genes that were
evenly distributed along the chromosome, flanked by genes of
298
known function, and not under diversifying selection [59], later

attempts were undertaken to develop alternative typing schemes
based on virulence genes, as has been reported for salmonellae
[65] and staphylococci [66].
As genetically monomorphic bacterial pathogens, such as mycobacteria, brucellae, and Bacillus anthracis, tend to exhibit less DNA
sequence diversity in their housekeeping genes, MLST cannot provide the high resolution required for epidemiological studies on these
agents [2, 67].
Instead of using functional genes, the genetic variation seen in
intergenic spacer regions can also be exploited for typing. Multispacer sequence typing (MST) is a special variant of MLST that
was used for Coxiella burnetii [68]. The numerical coding is similar to VNTR/MLVA, and the resulting MST genotypes can be
identified by visiting a public database at http://ifr48.timone.
univ-mrs.fr/MST_Coxiella/mst. MST data are easily comparable
between laboratories, but the method is more laborious and less
discriminatory than MLVA [69].
Even though there is now a clear tendency toward typing
schemes using the entire genome, the MLST approach will certainly
retain its importance in the near future, and the extensive data
gathered so far will remain important references for comparison.
Genome-Wide Typing Approaches

As the demands on epidemiological resolution of typing schemes
became ever higher in the last decades, the use of whole-genome
sequences (WGS) for intraspecies discrimination and thus the emergence of genomotyping appeared to be only a question of time
[70]. Early attempts focused on the utilization of high-density
microarray slides covering whole bacterial genomes, similar to those
used in transcriptomics. Typically, microarrays carrying 40- to 70-mer
oligonucleotide probes to represent each genomic locus were
employed [71, 72]. However, this expensive technology was not
particularly suitable for routine diagnosis, and the experimental
approach proved to have limitations as the accuracy of typing
seemed to be satisfactory only among strains of average nucleotide
identity (ANI) values higher than 90 % [73]. Another example of
microarray-based genomotyping featured Coxiella burnetii and was
based on the presence or absence of selected genes [74]. In 52 isolates, the authors identified ten genomotypes organized into three
groups, of which four types were associated with acute Q fever.
Meanwhile, as more and more WGS have become available,
the attractiveness of high-density microarray technology for molecular typing has diminished, because the same information can now
be directly extracted from WGS, which is less expensive and strictly
299
sequence based rather than converted into a pattern-like output

format. At the same time, more versatile low-density DNA microarray platforms, such as the ArrayStrip system, will remain a
relevant economical option for specialized typing purposes in diagnostic laboratories. Prominent examples include assays for methicillin-resistant Staphylococcus aureus (MRSA) [75], DNA serotyping
of E. coli [76], as well as identification of antibiotic resistance genes
in Salmonella [77] and E. coli [78].
In an attempt to bridge the gap between PFGE fingerprint
typing and genome sequencing, whole-genome mapping (WGM)
was used as a strain typing tool in epidemiological surveys.
Representing an advanced version of optical mapping introduced
in the 1990s [79], the methodology starts with genomic DNA
fragments from lysed microbes being immobilized on a glass surface in a microfluidics device. A restriction enzyme specifically
cleaves the DNA and leaves the fragments in the original genomic
order stretched on a glass slide, where they are subsequently fluorescence stained, analyzed, and assembled to yield a barcode-like
map. While the performance of WGM is not yet fully validated to
compete with PFGE [80], it has a potential of enhancing differentiation among strains in outbreak situations.
Using a complete genome sequence as the basis of a typing
scheme offers a number of advantages: (1) all the genetic information of an organism can be used, (2) standardization of the methodological approach is easier than with most other typing methods, and
(3) the universal character of the nucleotide sequence information
ensures worldwide comparability and repeatability now and in the
future.
The great challenge in designing efficient genome-based typing schemes consists in the necessity to condense the huge amount
of sequence data into a handy piece of essential information that
will represent a particular genomotype. Currently there are no
generally agreed operating procedures, nor criteria or parameters
defining such procedures. In a recent review, Sabat et al. [81]
singled out three possible strategies that are explained in the
following paragraphs.
First, an extended MLST (eMLST) approach could be based on
all genes of the so-called core genome, i.e., a panel of genes present
in all strains of a species. The resulting allelic profile would be composed of hundreds or thousands of different alleles. Larsen et al. [82]
used preassembled genome sequences and even short sequence
reads to conduct MLST according to the established schemes for
about 700 isolates of different bacterial species. This appears to be a
realistic option because the costs of high-throughput sequencing
have declined, so that the procedure can be cheaper than MLST
based on traditional Sanger sequencing.
300
The use of WGS also allows more sophisticated MLST schemes

to be implemented. Strain analysis of a recent outbreak of a
multidrug-resistant enterohemorrhagic E. coli O104:H4 infection
in Germany [83] showed that traditional MLST was unable to
reveal distinctions between the outbreak strain and earlier isolates,
because it failed to identify the diversity outside the genes covered
by MLST. Cody et al. [84] conducted whole-genome MLST on
379 patient isolates of Campylobacter jejuni and Campylobacter
coli. Using the Genome Comparator module of the Bacterial
Isolate Genome Sequence Database (BIGSdb) [85] and including
a total of 1,595 defined loci, they were able to further discriminate
within clonal groups (sequence types) that had been defined by
conventional 52-locus MLST.
Second, the pan-genomic approach would include the complete
sequence information of a given genome, i.e., the core genome,
dispensable genes found in a limited number of strains, and unique
genes specific to individual strains of a species. Inter-strain relatedness would be defined through the presence or absence of genes.
However, the scientific community has yet to agree on a procedure
to condense the data into a user-friendly output format.
Third, comparison of WGS at single-nucleotide resolution can
characterize the distribution of SNPs throughout the genomes,
thus enabling high-resolution analysis of sequence variation among
related strains and/or along the timeline in epidemiological chains.
This was shown in the paper by Roetzer et al. [86], where the
number of SNPs emerging in a human-to-human transmission
chain was used to calculate the natural mutation rate of Mycobacterium tuberculosis. Similarly, Sherry et al. [87] used Ion Torrent
sequencing data to conduct SNP analysis, which demonstrated the
identity of four outbreak strains of multidrug-resistant E. coli in a
neonatal intensive care unit.
All in all, WGS-based genotyping is still an emerging field, the
number of studies published so far is limited, and its full potential
has yet to be explored. The absence of standardization concerning the selection of target loci, the software tools to be used for
sequence analysis, and other essential operations is currently the
main deficit, and it will certainly take some more time for the
research community to agree on these fundamentals. Nevertheless,
this area can be expected to develop dynamically in the next few
years. One of the most intriguing options opening up refers to the
possibility of addressing specific features of a microbial strain,
such as virulence, resistance, presence of toxins, or host preference. This means that thematic sequence information can be
extracted routinely from WGS to form artificial partial genomes,
such as the antibiotic resistome [88, 89], toxome [90], and
virulome.
301
Conclusion
The development of microbial typing over the last two decades has
significantly contributed to enhanced surveillance and outbreak
management [7, 63, 83, 87], as well as to ever more detailed characterization of field strains in terms of virulence properties, antimicrobial resistance, phylogenetic position, etc. As outlined in the
previous sections, the evolution of tools shows a clear tendency
toward sequence-based methods, with the nascent WGS-based
algorithms holding great promise.
Given the diversity in the various methodological approaches
and the multitude of typing protocols, it is obvious that there is no
single method that would be universally applicable. The choice of
the methodology rather depends on the objective of the study, the
concrete epidemiological situation, and the budget available.
For instance, in an outbreak scenario, rapid methods are preferable, such as VNTR, partial sequencing, and RAPD. As shortterm delivery of relevant strain characteristics is crucial to inform
decision makers, it can be more important to use a fast and robust
tool rather than aspiring to the highest resolution. In monitoring
and surveillance schemes, the overall cost, practical feasibility, and
availability of a standardized protocol are likely to be the essential
parameters. Therefore, MLST and VNTR schemes are frequently
used for this purpose.
Finally, retrospective studies and epidemiological research
projects will be demanding ever higher information contents to be
obtained on the strains involved, as well as maximum resolution,
all of which can be delivered using genome-wide typing methods.
References
1. de Beer JL, van Ingen J, de Vries G et al
(2013) Comparative study of IS6110 restriction fragment length polymorphism and
variable-number tandem-repeat typing of
Mycobacterium tuberculosis isolates in the
Netherlands, based on a 5-year nationwide
survey. J Clin Microbiol 51:11931198
2. Pitondo-Silva A, Santos AC, Jolley KA, Leite
CQ, Darini AL (2013) Comparison of three
molecular typing methods to assess genetic
diversity for Mycobacterium tuberculosis. J
3. Fritsch I, Luyven G, Kohler H, Lutz W,
Mobius P (2012) Suspicion of Mycobacterium
avium subsp. paratuberculosis transmission
between cattle and wild-living red deer
(Cervus elaphus) by multitarget genotyping.
Appl Environ Microbiol 78:11321139
4. Welsh J, McClelland M (1990) Fingerprinting
genomes using PCR with arbitrary primers.
5. McAuliffe L, Kokotovic B, Ayling RD,

Nicholas RA (2004) Molecular epidemiological analysis of Mycoplasma bovis isolates from
the United Kingdom shows two genetically
distinct clusters. J Clin Microbiol 42:
45564565
6. Hotzel H, Schneider B, Sachse K (1998)
Investigation of Mycoplasma bovis field isolates
using PCR fingerprinting. In: Leori G, Santini
F, Scanziani E, Frey J (eds) Mycoplasmas of
ruminants: pathogenicity, diagnostics, epidemiology and molecular genetics, vol 2.
European Commission, Brussels, Belgium,
pp 1719
7. Butler JA, Pinnow CC, Thomson JU,
Levisohn S, Rosenbusch RF (2001) Use of
arbitrarily primed polymerase chain reaction
to investigate Mycoplasma bovis outbreaks. Vet
Microbiol 78:175181
8. Schrenzel M, Nicolas M, Witte C et al (2008)
Molecular epidemiology of Mycobacterium
302
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.

avium subsp. avium and Mycobacterium
intracellulare in captive birds. Vet Microbiol
126:122131
Kauppinen J, Hintikka E, Iivanainen E, Katila
M (2001) PCR-based typing of Mycobacterium
avium isolates in an epidemic among farmed
lesser white-fronted geese (Anser erythropus).
Scheibl P, Gerlach GF (1997) Differentiation
of Mycobacterium paratuberculosis isolates by
rDNA-spacer analysis and random amplified
polymorphic DNA patterns. Vet Microbiol
57:151158
Petersen L, Newell DG (2001) The ability of
Fla-typing schemes to discriminate between
strains of Campylobacter jejuni. J Appl Microbiol 91:217224
Sayada C, Andersen AA, Storey C et al (1995)
Usefulness of omp1 restriction mapping for
avian Chlamydia psittaci isolate differentiation. Res Microbiol 146:155165
van Embden JD, Cave MD, Crawford JT et al
(1993) Strain identification of Mycobacterium
tuberculosis by DNA fingerprinting: recommendations for a standardized methodology.
J Clin Microbiol 31:406409
Erler W, Martin G, Sachse K et al (2004)
Molecular fingerprinting of Mycobacterium
bovis subsp. caprae isolates from central
Europe. J Clin Microbiol 42:22342238
Michel AL, Hlokwe TM, Coetzee ML et al
(2008) High Mycobacterium bovis genetic
diversity in a low prevalence setting. Vet
Pavlik I, Horvathova A, Dvorska L et al (1999)
Standardisation of restriction fragment length
polymorphism analysis for Mycobacterium
avium subspecies paratuberculosis. J Microbiol
Methods 38:155167
Mobius P, Luyven G, Hotzel H, Kohler H
(2008) High genetic diversity among Mycobacterium avium subsp. paratuberculosis strains
from German cattle herds shown by combination of IS900 restriction fragment length
polymorphism analysis and mycobacterial
interspersed repetitive unit-variable-number
tandem-repeat typing. J Clin Microbiol 46:
972981
Grimont F, Grimont PA (1986) Ribosomal
ribonucleic acid gene restriction patterns as
potential taxonomic tools. Ann Inst Pasteur
Microbiol 137B:165175
Bouchet V, Huot H, Goldstein R (2008)
Molecular genetic basis of ribotyping. Clin
Microbiol Rev 21:262273
Vos P, Hogers R, Bleeker M et al (1995)
AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res 23:44074414
21. Wagenaar JA, van Bergen MA, Newell DG,

Grogono-Thomas R, Duim B (2001) Comparative study using amplified fragment length
polymorphism fingerprinting, PCR genotyping, and phenotyping to differentiate
Campylobacter fetus strains isolated from animals. J Clin Microbiol 39:22832286
22. Hu H, Lan R, Reeves PR (2002) Fluorescent
amplified fragment length polymorphism analysis of Salmonella enterica serovar typhimurium
reveals phage-type-specific markers and potential for microarray typing. J Clin Microbiol
40:34063415
23. Schwartz DC, Cantor CR (1984) Separation
of yeast chromosome-sized DNAs by pulsed
field gradient gel electrophoresis. Cell 37:
6775
24. Herschleb J, Ananiev G, Schwartz DC (2007)
Pulsed-field gel electrophoresis. Nat Protoc
2:677684
25. On SL, Harrington CS (2001) Evaluation of
numerical analysis of PFGE-DNA profiles for
differentiating Campylobacter fetus subspecies
by comparison with phenotypic, PCR and 16S
rDNA sequencing methods. J Appl Microbiol
90:285293
26. Nevas M, Lindstrom M, Hielm S et al (2005)
Diversity of proteolytic Clostridium botulinum
strains, determined by a pulsed-field gel electrophoresis approach. Appl Environ Microbiol
71:13111317
27. Leclair D, Pagotto F, Farber JM, Cadieux B,
Austin JW (2006) Comparison of DNA fingerprinting methods for use in investigation
of type E botulism outbreaks in the Canadian
Arctic. J Clin Microbiol 44:16351644
28. Ribot EM, Fair MA, Gautom R et al (2006)
Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for
PulseNet. Foodborne Pathog Dis 3:5967
29. van Belkum A, Scherer S, van Alphen L,
Verbrugh H (1998) Short-sequence DNA
repeats in prokaryotic genomes. Microbiol
Mol Biol Rev 62:275293
30. Lindstedt BA, Torpdahl M, Vergnaud G et al
(2013) Use of multilocus variable-number
tandem repeat analysis (MLVA) in eight
European countries, 2012. Euro Surveill 18:
20385
31. Jenkins AO, Venter EH, Hutamo K, Godfroid
J (2010) Comparison of the capillary and agarose electrophoresis based multiple locus
VNTR (variable number of tandem repeats)
analysis (MLVA) on Mycobacterium bovis isolates. Vet Microbiol 145:172176
32. Roest HI, Ruuls RC, Tilburg JJ et al (2011)
Molecular epidemiology of Coxiella burnetii
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
from ruminants in Q fever outbreak, the

Netherlands. Emerg Infect Dis 17:668675
Thibault VC, Grayon M, Boschiroli ML et al
(2007) New variable-number tandem-repeat
markers for typing Mycobacterium avium
subsp. paratuberculosis and M. avium strains:
comparison with IS900 and IS1245 restriction fragment length polymorphism typing. J
Supply P, Mazars E, Lesjean S et al (2000)
Variable human minisatellite-like regions in
the Mycobacterium tuberculosis genome. Mol
Microbiol 36:762771
Supply P, Allix C, Lesjean S et al (2006)
Proposal for standardization of optimized
mycobacterial interspersed repetitive unitvariable-number tandem repeat typing of
Mycobacterium tuberculosis. J Clin Microbiol
44:44984510
Oelemann MC, Diel R, Vatin V et al (2007)
Assessment of an optimized mycobacterial
interspersed repetitive-unit-variable-number
tandem-repeat typing system combined with
spoligotyping for population-based molecular
epidemiology studies of tuberculosis. J Clin
Microbiol 45:691697
Mazars E, Lesjean S, Banuls AL et al (2001)
High-resolution minisatellite-based typing as
a portable approach to global analysis of
Mycobacterium tuberculosis molecular epidemiology. Proc Natl Acad Sci U S A 98:
19011906
Mandal S, Bradshaw L, Anderson LF et al
(2011) Investigating transmission of Mycobacterium bovis in the United Kingdom in 2005
to 2008. J Clin Microbiol 49:19431950
Alonso-Rodriguez N, Martinez-Lirola M,
Herranz M et al (2008) Evaluation of the new
advanced 15-loci MIRU-VNTR genotyping
tool in Mycobacterium tuberculosis molecular
epidemiology studies. BMC Microbiol 8:34
Kasnitz N, Kohler H, Weigoldt M, Gerlach
GF, Mobius P (2013) Stability of genotyping
target sequences of Mycobacterium avium
subsp. paratuberculosis upon cultivation on
different media, in vitro- and in vivo passage,
and natural infection. Vet Microbiol 167:
573583
Kamerbeek J, Schouls L, Kolk A et al (1997)
Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. J Clin Microbiol 35:
907914
Stone MJ, Brown TJ, Drobniewski FA (2012)
Human Mycobacterium bovis infections in
London and Southeast England. J Clin
Microbiol 50:164165
Smith NH, Gordon SV, de la Rua-Domenech
R, Clifton-Hadley RS, Hewinson RG (2006)
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
303
Bottlenecks and broomsticks: the molecular

evolution of Mycobacterium bovis. Nat Rev
Microbiol 4:670681
Ruettger A, Nieter J, Skrypnyk A et al (2012)
Rapid spoligotyping of Mycobacterium tuberculosis complex bacteria by use of a microarray
system with automatic data processing and
assignment. J Clin Microbiol 50:24922495
Dale JW, Brittain D, Cataldi AA et al (2001)
Spacer oligonucleotide typing of bacteria of
the Mycobacterium tuberculosis complex: recommendations for standardised nomenclature. Int J Tuberc Lung Dis 5:216219
Brudey K, Driscoll JR, Rigouts L et al (2006)
Mycobacterium tuberculosis complex genetic
diversity: mining the fourth international
spoligotyping database (SpolDB4) for classification, population genetics and epidemiology.
BMC Microbiol 6:23
Smith NH, Upton P (2012) Naming spoligotype patterns for the RD9-deleted lineage of
the Mycobacterium tuberculosis complex;
www.Mbovis.org. Infect Genet Evol 12:
873876
Oswald E, Schmidt H, Morabito S et al
(2000) Typing of intimin genes in human and
animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a
new intimin variant. Infect Immun 68:6471
Blanco M, Schumacher S, Tasara T et al
(2005) Serotypes, intimin variants and other
virulence factors of eae positive Escherichia
coli strains isolated from healthy cattle in
Switzerland. Identification of a new intimin
variant gene (eae-eta2). BMC Microbiol 5:23
Vanrompay D, Butaye P, Sayada C, Ducatelle
R, Haesebrouck F (1997) Characterization of
avian Chlamydia psittaci strains using omp1
restriction mapping and serovar-specific
monoclonal antibodies. Res Microbiol 148:
327333
Sachse K, Laroucau K, Hotzel H et al (2008)
Genotyping of Chlamydophila psittaci using a
new DNA microarray assay based on sequence
analysis of ompA genes. BMC Microbiol 8:63
Ruettger A, Feige J, Slickers P et al (2011)
Genotyping of Chlamydia trachomatis strains
from culture and clinical samples using an
ompA-based DNA microarray assay. Mol Cell
Probes 25:1927
Geens T, Dewitte A, Boon N, Vanrompay D
(2005) Development of a Chlamydophila psittaci species-specific and genotype-specific
real-time PCR. Vet Res 36:787797
Michel H, Wilske B, Hettche G et al (2004) An
ospA-polymerase chain reaction/restriction
fragment length polymorphism-based method
for sensitive detection and reliable differentiation of all European Borrelia burgdorferi sensu
304
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.

lato species and OspA types. Med Microbiol
Immunol 193:219226
Will G, Jauris-Heipke S, Schwab E et al
(1995) Sequence analysis of ospA genes
shows homogeneity within Borrelia burgdorferi sensu stricto and Borrelia afzelii strains
but reveals major subgroups within the
Borrelia garinii species. Med Microbiol
Immunol 184:7380
Korczak BM, Zurfluh M, Emler S, Kuhn-Oertli
J, Kuhnert P (2009) Multiplex strategy for multilocus sequence typing, fla typing, and genetic
determination of antimicrobial resistance of
Campylobacter jejuni and Campylobacter coli
isolates collected in Switzerland. J Clin Microbiol 47:19962007
Maiden MC, Bygraves JA, Feil E et al (1998)
Multilocus sequence typing: a portable
approach to the identification of clones within
populations of pathogenic microorganisms.
Perez-Losada M, Cabezas P, Castro-Nallar E,
Crandall KA (2013) Pathogen typing in the
genomics era: MLST and the future of molecular epidemiology. Infect Genet Evol 16:
3853
Kidgell C, Reichard U, Wain J et al (2002)
Salmonella typhi, the causative agent of
typhoid fever, is approximately 50,000 years
old. Infect Genet Evol 2:3945
Hauser E, Hebner F, Tietze E et al (2011)
Diversity of Salmonella enterica serovar Derby
isolated from pig, pork and humans in
Germany. Int J Food Microbiol 151:141149
Dean D, Bruno WJ, Wan R et al (2009)
Predicting phenotype and emerging strains
among Chlamydia trachomatis infections.
Pannekoek Y, Dickx V, Beeckman DS et al
(2010) Multi locus sequence typing of
Chlamydia reveals an association between
Chlamydia psittaci genotypes and host species. PLoS One 5:e14179
Klint M, Fuxelius HH, Goldkuhl RR et al
(2007) High-resolution genotyping of Chlamydia trachomatis strains by multilocus sequence analysis. J Clin Microbiol 45:14101414
Christerson L, Ruettger A, Gravningen K
et al (2011) High-resolution genotyping of
Chlamydia trachomatis by use of a novel
multilocus typing DNA microarray. J Clin
Tankouo-Sandjong B, Sessitsch A, Liebana E
et al (2007) MLST-v, multilocus sequence
typing based on virulence genes, for molecular
typing of Salmonella enterica subsp. enterica
serovars. J Microbiol Methods 69:2336
66. Verghese B, Schwalm ND 3rd, Dudley EG,

Knabel SJ (2012) A combined multivirulence-locus sequence typing and Staphylococcal Cassette Chromosome mec typing
scheme possesses enhanced discriminatory
power for genotyping MRSA. Infect Genet
Evol 12:18161821
67. Scholz HC, Vergnaud G (2013) Molecular
characterisation of Brucella species. Rev Sci
Tech 32:149162
68. Glazunova O, Roux V, Freylikman O et al
(2005) Coxiella burnetii genotyping. Emerg
69. Santos AS, Tilburg JJ, Botelho A et al (2012)
Genotypic diversity of clinical Coxiella burnetii isolates from Portugal based on MST
and MLVA typing. Int J Med Microbiol
302:253256
70. Lucchini S, Thompson A, Hinton JC (2001)
Microarrays for microbiologists. Microbiology
147:14031414
71. Ballerstedt H, Volkers RJ, Mars AE et al
(2007) Genomotyping of Pseudomonas
putida strains using P. putida KT2440-based
high-density DNA microarrays: implications
for transcriptomics studies. Appl Microbiol
72. Snyder LA, Davies JK, Saunders NJ (2004)
Microarray genomotyping of key experimental strains of Neisseria gonorrhoeae reveals
gene complement diversity and five new neisserial genes associated with Minimal Mobile
Elements. BMC Genomics 5:23
73. Oh S, Yoder-Himes DR, Tiedje J, Park J,
Konstantinidis KT (2010) Evaluating the performance of oligonucleotide microarrays for
bacterial strains with increasing genetic divergence from the reference strain. Appl Environ
74. Leroy Q, Armougom F, Barbry P, Raoult D
(2011) Genomotyping of Coxiella burnetii
using microarrays reveals a conserved genomotype for hard tick isolates. PLoS One
6:e25781
75. Monecke S, Coombs G, Shore AC et al
(2011) A field guide to pandemic, epidemic
and sporadic clones of methicillin-resistant
Staphylococcus aureus. PLoS One 6:e17936
76. Ballmer K, Korczak BM, Kuhnert P et al
(2007) Fast DNA serotyping of Escherichia
coli by use of an oligonucleotide microarray. J
77. Braun SD, Ziegler A, Methner U et al (2012)
Fast DNA serotyping and antimicrobial resistance gene determination of salmonella
enterica with an oligonucleotide microarraybased assay. PLoS One 7:e46489

78. Perreten V, Vorlet-Fawer L, Slickers P, Ehricht
R, Kuhnert P, Frey J (2005) Microarray-based
detection of 90 antibiotic resistance genes of
gram-positive bacteria. J Clin Microbiol 43:
22912302
79. Schwartz DC, Li X, Hernandez LI et al
(1993) Ordered restriction maps of Saccharomyces cerevisiae chromosomes constructed by
optical mapping. Science 262:110114
80. Miller JM (2013) Whole-genome mapping: a
new paradigm in strain-typing technology. J
81. Sabat AJ, Budimir A, Nashev D et al (2013)
Overview of molecular typing methods for
outbreak detection and epidemiological surveillance. Euro Surveill 18:20380
82. Larsen MV, Cosentino S, Rasmussen S et al
(2012) Multilocus sequence typing of totalgenome-sequenced bacteria. J Clin Microbiol
50:13551361
83. Mellmann A, Harmsen D, Cummings CA
et al (2011) Prospective genomic characterization of the German enterohemorrhagic
Escherichia coli O104:H4 outbreak by rapid
next generation sequencing technology. PLoS
One 6:e22751
84. Cody AJ, McCarthy ND, Jansen van Rensburg
M, Isinkaye T et al (2013) Real-time genomic
epidemiology of human Campylobacter isolates using whole genome multilocus sequence
typing. J Clin Microbiol 51:25262534
85. Jolley KA, Maiden MC (2010) BIGSdb: scalable analysis of bacterial genome variation at
the population level. BMC Bioinformatics
11:595
86. Roetzer A, Diel R, Kohl TA et al (2013)
Whole genome sequencing versus traditional
genotyping for investigation of a Mycobacterium tuberculosis outbreak: a longitudinal
molecular epidemiological study. PLoS Med
10:e1001387
87. Sherry NL, Porter JL, Seemann T et al (2013)
Outbreak investigation using high-throughput
genome sequencing within a diagnostic microbiology laboratory. J Clin Microbiol 51:
13961401
88. Poirel L, Bonnin RA, Nordmann P (2011)
Analysis of the resistome of a multidrugresistant NDM-1-producing Escherichia coli
strain by high-throughput genome sequencing. Antimicrob Agents Chemother 55:
42244229
89. Forsberg KJ, Reyes A, Wang B et al (2012) The
shared antibiotic resistome of soil bacteria and
human pathogens. Science 337:11071111
90. Koser CU, Holden MT, Ellington MJ et al
(2012) Rapid whole-genome sequencing for
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
305
investigation of a neonatal MRSA outbreak.

N Engl J Med 366:22672275
Keim P, Price LB, Klevytska AM et al (2000)
Multiple-locus variable-number tandem repeat
analysis reveals genetic relationships within
Bacillus anthracis. J Bacteriol 182:29282936
Lista F, Faggioni G, Valjevac S et al (2006)
Genotyping of Bacillus anthracis strains based
on automated capillary 25-loci multiple locus
variable-number tandem repeats analysis.
BMC Microbiol 6:33
Van Ert MN, Easterday WR, Huynh LY et al
(2007) Global genetic population structure of
Bacillus anthracis. PLoS One 2:e461
Keim P, Van Ert MN, Pearson T et al (2004)
Anthrax molecular epidemiology and forensics: using the appropriate marker for different evolutionary scales. Infect Genet Evol
4:205213
Van Ert MN, Easterday WR, Simonson TS
et al (2007) Strain-specific single-nucleotide
polymorphism assays for the Bacillus anthracis Ames strain. J Clin Microbiol 45:4753
Fingerle V, Michel H, Hettche G, Hizo-Teufel
C, Wilske B (2004) Borrelia burgdorferi s.l.
OspA-types are widespread in Bavaria but
show distinct local patterns. Int J Med
Microbiol 293(suppl 37):165166
Margos G, Gatewood AG, Aanensen DM
et al (2008) MLST of housekeeping genes
captures geographic population structure and
suggests a European origin of Borrelia burgdorferi. Proc Natl Acad Sci U S A 105:
87308735
Foster JT, Price LB, Beckstrom-Sternberg SM
et al (2012) Genotyping of Brucella species
using clade specific SNPs. BMC Microbiol
12:110
Bricker BJ, Ewalt DR, Halling SM (2003)
Brucella HOOF-Prints: strain typing by
multi-locus analysis of variable number tandem
repeats (VNTRs). BMC Microbiol 3:15
Le Fleche P, Jacques I, Grayon M et al (2006)
Evaluation and selection of tandem repeat loci
for a Brucella MLVA typing assay. BMC
Microbiol 6:9
Whatmore AM, Shankster SJ, Perrett LL et al
(2006) Identification and characterization of
variable-number tandem-repeat markers for
typing of Brucella spp. J Clin Microbiol 44:
19821993
Whatmore AM, Perrett LL, MacMillan AP
(2007) Characterisation of the genetic diversity of Brucella by multilocus sequencing.
BMC Microbiol 7:34
Wattiau P, Whatmore AM, Van Hessche M,
Godfroid J, Fretin D (2011) Nucleotide
306
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.

polymorphism-based single-tube test for
robust molecular identification of all currently
described Brucella species. Appl Environ
Godoy D, Randle G, Simpson AJ et al (2003)
Multilocus sequence typing and evolutionary
relationships among the causative agents of
melioidosis and glanders, Burkholderia pseudomallei and Burkholderia mallei. J Clin Microbiol 41:20682079
Currie B, Thomas AD, Godoy D, Dance D
et al (2007) Australian and Thai isolates of
Burkholderia pseudomallei are distinct by multilocus sequence typing: revision of a case of
mistaken identity. J Clin Microbiol 45:
38283829
Vesaratchavest M, Tumapa S, Day NP et al
(2006) Nonrandom distribution of Burkholderia pseudomallei clones in relation to
geographical location and virulence. J Clin
Currie BJ, Haslem A, Pearson T et al (2009)
Identification of melioidosis outbreak by multilocus variable number tandem repeat analysis. Emerg Infect Dis 15:169174
U'Ren JM, Schupp JM, Pearson T et al
(2007) Tandem repeat regions within the
Burkholderia pseudomallei genome and their
application for high resolution genotyping.
BMC Microbiol 7:23
Chantratita N, Vesaratchavest M, Wuthiekanun
V et al (2006) Pulsed-field gel electrophoresis
as a discriminatory typing technique for the
biothreat agent Burkholderia mallei. Am J
Trop Med Hyg 74:345347
Ribot EM, Fitzgerald C, Kubota K,
Swaminathan B, Barrett TJ (2001) Rapid
pulsed-field gel electrophoresis protocol for
subtyping of Campylobacter jejuni. J Clin
Dingle KE, Colles FM, Wareing DR et al
(2001) Multilocus sequence typing system for
Campylobacter jejuni. J Clin Microbiol 39:
1423
Parsons BN, Cody AJ, Porter CJ et al (2009)
Typing of Campylobacter jejuni isolates from
dogs by use of multilocus sequence typing
and pulsed-field gel electrophoresis. J Clin
Nachamkin I, Bohachick K, Patton CM
(1993) Flagellin gene typing of Campylobacter
jejuni by restriction fragment length polymorphism analysis. J Clin Microbiol 31:
15311536
Buchanan CJ, Yoshida C, Kruczkiewicz P et al
(2011) High-resolution comparative genomic
fingerprinting of Campylobacter jejuni using
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
ArrayTube miniaturized diagnostic microarrays. In: Proceedings of 16th international

workshop on Campylobacter, Helicobacter and
Related
Organisms
(CHRO
2011).
Vancouver, Canada, p 164
El-Adawy H, Hotzel H, Tomaso H et al
(2013) Detection of genetic diversity in
Campylobacter jejuni isolated from a commercial Turkey flock using flaA typing, MLST
analysis and microarray assay. PLoS One
8:e51582
van Bergen MA, van der Graaf-van BL, Visser
IJ, van Putten JP, Wagenaar JA (2006)
Molecular epidemiology of Campylobacter
fetus subsp. fetus on bovine artificial insemination stations using pulsed field gel electrophoresis. Vet Microbiol 112:6571
van Bergen MA, Simons G, van der Graaf-van
BL et al (2005) Amplified fragment length
polymorphism based identification of genetic
markers and novel PCR assay for differentiation of Campylobacter fetus subspecies. J Med
van Bergen MA, Dingle KE, Maiden MC et al
(2005) Clonal nature of Campylobacter fetus
as defined by multilocus sequence typing. J
Miller WG, Chapman MH, Yee E et al (2012)
Multilocus sequence typing methods for the
emerging Campylobacter species C. hyointestinalis, C. lanienae, C. sputorum, C. concisus, and
C. curvus. Front Cell Infect Microbiol 2:45
Pannekoek Y, Morelli G, Kusecek B et al
(2008) Multi locus sequence typing of
Chlamydiales: clonal groupings within the
obligate intracellular bacteria Chlamydia trachomatis. BMC Microbiol 8:42
Geens T, Desplanques A, Van Loock M,
Bnner B et al (2005) Sequencing of the
Chlamydophila psittaci ompA gene reveals a
new genotype, E/B, and the need for a rapid
discriminatory genotyping method. J Clin
Laroucau K, Thierry S, Vorimore F et al
(2008) High resolution typing of Chlamydophila psittaci by multilocus VNTR analysis
(MLVA). Infect Genet Evol 8:171181
Laroucau K, Vorimore F, Bertin C et al
(2009) Genotyping of Chlamydophila abortus
strains by multilocus VNTR analysis. Vet
Umeda K, Wada T, Kohda T, Kozaki S (2013)
Multi-locus variable number tandem repeat
analysis for Clostridium botulinum type B isolates in Japan: comparison with other isolates
and genotyping methods. Infect Genet Evol
16:298304

125. Maslanka SE, Kerr JG, Williams G et al (1999)
Molecular subtyping of Clostridium perfringens
by pulsed-field gel electrophoresis to facilitate
food-borne-disease outbreak investigations. J
126. Lukinmaa S, Takkunen E, Siitonen A (2002)
Molecular epidemiology of Clostridium perfringens related to food-borne outbreaks of
disease in Finland from 1984 to 1999. Appl
127. Johansson A, Aspan A, Bagge E et al (2006)
Genetic diversity of Clostridium perfringens
type A isolates from animals, food poisoning
outbreaks and sludge. BMC Microbiol 6:47
128. Ferreira TSP, Moreno AM, de Almeida RR
et al (2012) Molecular typing of Clostridium
perfringens isolated from swine in slaughterhouses from Sao Paulo State, Brazil. Cienc
Rural 42:14501456
129. Sawires YS, Songer JG (2005) Multiple-locus
variable-number tandem repeat analysis for
strain typing of Clostridium perfringens.
Anaerobe 11:262272
130. Chalmers G, Martin SW, Prescott JF, Boerlin
P (2008) Typing of Clostridium perfringens
by multiple-locus variable number of tandem
repeats analysis. Vet Microbiol 128:126135
131. Knetsch CW, Lawley TD, Hensgens MP et al
(2013) Current application and future perspectives of molecular typing methods to
study Clostridium difficile infections. Euro
Surveill 18:20381
132. Neumann AP, Rehberger TG (2009) MLST
analysis reveals a highly conserved core
genome among poultry isolates of Clostridium
septicum. Anaerobe 15:99106
133. Arricau-Bouvery N, Hauck Y, Bejaoui A et al
(2006) Molecular characterization of Coxiella
burnetii isolates by infrequent restriction sitePCR and MLVA typing. BMC Microbiol
6:39
134. Svraka S, Toman R, Skultety L, Slaba K,
Homan WL (2006) Establishment of a genotyping scheme for Coxiella burnetii. FEMS
Microbiol Lett 254:268274
135. Tilburg JJ, Rossen JW, van Hannen EJ et al
(2012) Genotypic diversity of Coxiella burnetii in the 2007-2010 Q fever outbreak
episodes in The Netherlands. J Clin Microbiol
50:10761078
136. Franck SM, Bosworth BT, Moon HW (1998)
Multiplex PCR for enterotoxigenic, attaching
and effacing, and Shiga toxin-producing
Escherichia coli strains from calves. J Clin
137. Nguyen TV, Le Van P, Le Huy C, Gia KN,
Weintraub A (2005) Detection and characterization of diarrheagenic Escherichia coli from
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
307
young children in Hanoi, Vietnam. J Clin

Microbiol 43:755760
Muller D, Hagedorn P, Brast S, Heusipp G
et al (2006) Rapid identification and differentiation of clinical isolates of enteropathogenic
Escherichia coli (EPEC), atypical EPEC, and
Shiga toxin-producing Escherichia coli by a
one-step multiplex PCR method. J Clin
Casey TA, Bosworth BT (2009) Design and
evaluation of a multiplex polymerase chain
reaction assay for the simultaneous identification of genes for nine different virulence
factors associated with Escherichia coli that
cause diarrhea and edema disease in swine. J
Vet Diagn Invest 21:2530
Scheutz F, Teel LD, Beutin L et al (2012)
Multicenter evaluation of a sequence-based
protocol for subtyping Shiga toxins and standardizing Stx nomenclature. J Clin Microbiol
50:29512963
Adu-Bobie J, Frankel G, Bain C et al (1998)
Detection of intimins alpha, beta, gamma,
and delta, four intimin derivatives expressed
by attaching and effacing microbial pathogens. J Clin Microbiol 36:662668
Jores J, Zehmke K, Eichberg J, Rumer L,
Wieler LH (2003) Description of a novel intimin variant (type zeta) in the bovine O84:NM
verotoxin-producing Escherichia coli strain
537/89 and the diagnostic value of intimin
typing. Exp Biol Med (Maywood) 228:
370376
Ramachandran V, Brett K, Hornitzky MA
et al (2003) Distribution of intimin subtypes
among Escherichia coli isolates from ruminant
and human sources. J Clin Microbiol 41:
50225032
Barth S, Schwanitz A, Bauerfeind R (2011)
Polymerase chain reaction-based method for
the typing of F18 fimbriae and distribution of
F18 fimbrial subtypes among porcine Shiga
toxin-encoding Escherichia coli in Germany. J
Vet Diagn Invest 23:454464
Franklin MA, Francis DH, Baker D, Mathew
AG (1996) A PCR-based method of detection
and differentiation of K88+ adhesive Escherichia coli. J Vet Diagn Invest 8:460463
Imberechts H, Van Pelt N, De Greve H,
Lintermans P (1994) Sequences related to the
major subunit gene fedA of F107 fimbriae in
porcine Escherichia coli strains that express
adhesive fimbriae. FEMS Microbiol Lett
119:309314
Schilling AK, Hotzel H, Methner U et al
(2012) Zoonotic agents in small ruminants
kept on city farms in southern Germany. Appl
308
148. Monecke S, Mariani-Kurkdjian P, Bingen E

et al (2011) Presence of enterohemorrhagic
Escherichia coli ST678/O104:H4 in France
prior to 2011. Appl Environ Microbiol
77:87848786
149. Geue L, Schares S, Mintel B et al (2010)
Rapid microarray-based genotyping of
enterohemorrhagic Escherichia coli serotype
O156:H25/H-/Hnt isolates from cattle and
clonal relationship analysis. Appl Environ
150. Wirth T, Falush D, Lan R et al (2006) Sex and
virulence in Escherichia coli: an evolutionary
perspective. Mol Microbiol 60:11361151
151. Garcia Del Blanco N, Dobson ME, Vela AI
et al (2002) Genotyping of Francisella tularensis strains by pulsed-field gel electrophoresis, amplified fragment length polymorphism
fingerprinting, and 16S rRNA gene sequencing. J Clin Microbiol 40:29642972
152. Johansson A, Farlow J, Larsson P et al (2004)
Worldwide genetic relationships among
Francisella tularensis isolates determined by
multiple-locus
variable-number
tandem
repeat analysis. J Bacteriol 186:58085818
153. Vogler AJ, Birdsell D, Wagner DM, Keim P
(2009) An optimized, multiplexed multilocus variable-number tandem repeat analysis
system for genotyping Francisella tularensis.
Lett Appl Microbiol 48:140144
154. Vogler AJ, Birdsell D, Price LB et al (2009)
Phylogeography of Francisella tularensis: global
expansion of a highly fit clone. J Bacteriol
191:24742484
155. Larsson P, Svensson K, Karlsson L et al (2007)
Canonical insertion-deletion markers for rapid
DNA typing of Francisella tularensis. Emerg
156. Svensson K, Back E, Eliasson H et al (2009)
Landscape epidemiology of tularemia outbreaks in Sweden. Emerg Infect Dis 15:
19371947
157. Castellanos E, de Juan L, Dominguez L,
Aranaz A (2012) Progress in molecular typing
of Mycobacterium avium subspecies paratuberculosis. Res Vet Sci 92:169179
158. Bannantine JP, Li LL, Sreevatsan S, Kapur V
(2013) How does a Mycobacterium change its
spots? Applying molecular tools to track
diverse strains of Mycobacterium avium subspecies paratuberculosis. Lett Appl Microbiol
57:165173
159. Stevenson K, Hughes VM, de Juan L et al
(2002) Molecular characterization of pigmented
and nonpigmented isolates of Mycobacterium
avium subsp. paratuberculosis. J Clin Microbiol
40:17981804
160. de Juan L, Mateos A, Dominguez L, Sharp

JM, Stevenson K (2005) Genetic diversity of
Mycobacterium avium subspecies paratuberculosis isolates from goats detected by pulsedfield gel electrophoresis. Vet Microbiol 106:
249257
161. Sevilla I, Li LL, Amonsin A et al (2008)
Comparative analysis of Mycobacterium avium
subsp paratuberculosis isolates from cattle,
sheep and goats by short sequence repeat and
pulsed-field gel electrophoresis typing. BMC
Microbiol 8:204
162. Amonsin A, Li LL, Zhang Q et al (2004)
Multilocus short sequence repeat sequencing
approach for differentiating among Mycobacterium avium subsp. paratuberculosis strains.
163. Thibault VC, Grayon M, Boschiroli ML et al
(2008) Combined multilocus short-sequencerepeat and mycobacterial interspersed repetitive
unit-variable-number tandem-repeat typing of
Mycobacterium avium subsp paratuberculosis
isolates. J Clin Microbiol 46:40914094
164. Kasnitz N, Kohler H, Weigoldt M, Gerlach
GF, Mobius P (2013) Stability of genotyping
target sequences of Mycobacterium avium
subsp. paratuberculosis upon cultivation on
different media, in vitro- and in vivo passage,
and natural infection. Vet Microbiol 167:
573583
165. Dvorska L, Bull TJ, Bartos M et al (2003) A
standardised restriction fragment length polymorphism (RFLP) method for typing
Mycobacterium avium isolates links IS901
with virulence for birds. J Microbiol Methods
55:1127
166. van Soolingen D, Bauer J, Ritacco V et al
(1998) IS1245 restriction fragment length
polymorphism typing of Mycobacterium
avium isolates: proposal for standardization. J
167. Johansen TB, Olsen I, Jensen MR et al (2007)
New probes used for IS1245 and IS1311
restriction fragment length polymorphism of
Mycobacterium avium subsp. avium and
Mycobacterium avium subsp. hominissuis isolates of human and animal origin in Norway.
BMC Microbiol 7:14
168. Johansen TB, Djonne B, Jensen MR, Olsen I
(2005) Distribution of IS1311 and IS1245 in
Mycobacterium avium subspecies revisited. J
169. McLernon J, Costello E, Flynn O, Madigan
G, Ryan F (2010) Evaluation of mycobacterial
interspersed repetitive-unit-variable-number
tandem-repeat analysis and spoligotyping for
genotyping of Mycobacterium bovis isolates
170.
171.
172.
173.
174.
175.
176.
177.
178.
179.
180.
and a comparison with restriction fragment

length polymorphism typing. J Clin Microbiol
48:45414545
McAuliffe L, Ayling RD, Nicholas RA (2007)
Identification and characterization of variablenumber tandem-repeat markers for the molecular epidemiological analysis of Mycoplasma
mycoides subspecies mycoides SC. FEMS
Microbiol Lett 276:181188
Yaya A, Manso-Silvan L, Blanchard A,
Thiaucourt F (2008) Genotyping of Mycoplasma mycoides subsp. mycoides SC by multilocus sequence analysis allows molecular
epidemiology of contagious bovine pleuropneumonia. Vet Res 39:14
Lorenzon S, Arzul I, Peyraud A, Hendrikx P,
Thiaucourt F (2003) Molecular epidemiology
of contagious bovine pleuropneumonia by
multilocus sequence analysis of Mycoplasma
mycoides subspecies mycoides biotype SC
strains. Vet Microbiol 93:319333
Churchward CP, Hlusek M, Nicholas RA,
Ayling RD, McAuliffe L (2012) A simplified
PCR method for genotyping Mycoplasma
mycoides subspecies mycoides small colony: the
aetiologic agent of contagious bovine pleuropneumonia. Vet Microbiol 159:257259
Pinho L, Thompson G, Rosenbusch R,
Carvalheira J (2012) Genotyping of Mycoplasma bovis isolates using multiple-locus variable-number tandem-repeat analysis. J
Amram E, Freed M, Khateb N et al (2013)
Multiple locus variable number tandem repeat
analysis of Mycoplasma bovis isolated from
local and imported cattle. Vet J 197:286290
Manso-Silvan L, Dupuy V, Lysnyansky I,
Ozdemir U, Thiaucourt F (2012) Phylogeny
and molecular typing of Mycoplasma agalactiae and Mycoplasma bovis by multilocus
sequencing. Vet Microbiol 161:104112
Malorny B, Hauser E, Diekerman R (2011)
New approaches in subspecies-level Salmonella classification. In: Porwollik S (ed)
Salmonella, from genome to function. Caister
Academic Press, Norfolk, UK, pp 124
Wain J, Olsen JE (2013) Current and new
approaches to typing of Salmonella. In: Barrow
PA, Methner U (eds) Salmonella in domestic
animals. CAB International, Oxfordshire, UK,
pp 498517
Wattiau P, Boland C, Bertrand S (2011)
Methodologies for Salmonella enterica subsp.
enterica subtyping: gold standards and alternatives. Appl Environ Microbiol 77:78777885
Peters TM, Maguire C, Threlfall EJ et al
(2003) The Salm-gene projecta European
181.
182.
183.
184.
185.
186.
187.
188.
189.
190.
191.
309
collaboration for DNA fingerprinting for

food-related salmonellosis. Euro Surveill
8:4650
Torpdahl M, Sorensen G, Lindstedt BA,
Nielsen EM (2007) Tandem repeat analysis
for surveillance of human Salmonella Typhimurium infections. Emerg Infect Dis 13:
388395
Boxrud D, Pederson-Gulrud K, Wotton J
et al (2007) Comparison of multiple-locus
variable-number tandem repeat analysis,
pulsed-field gel electrophoresis, and phage
typing for subtype analysis of Salmonella
enterica serotype Enteritidis. J Clin Microbiol
45:536543
Malorny B, Junker E, Helmuth R (2008)
Multi-locus variable-number tandem repeat
analysis for outbreak studies of Salmonella
enterica serotype Enteritidis. BMC Microbiol
8:84
Campioni F, Davis M, Medeiros MI, Falcao JP,
Shah DH (2013) MLVA typing reveals higher
genetic homogeneity among S. Enteritidis
strains isolated from food, humans and chickens in Brazil in comparison to the North
American strains. Int J Food Microbiol 162:
174181
Davis MA, Baker KN, Call DR et al (2009)
Multilocus variable-number tandem-repeat
method for typing Salmonella enterica serovar
Newport. J Clin Microbiol 47:19341938
Foley SL, White DG, McDermott PF et al
(2006) Comparison of subtyping methods for
differentiating Salmonella enterica serovar
Typhimurium isolates obtained from food animal sources. J Clin Microbiol 44:35693577
Ross IL, Heuzenroeder MW (2005) Discrimination within phenotypically closely related
definitive types of Salmonella enterica serovar
typhimurium by the multiple amplification of
phage locus typing technique. J Clin
Singh P, Foley SL, Nayak R, Kwon YM
(2013) Massively parallel sequencing of
enriched target amplicons for high-resolution
genotyping of Salmonella serovars. Mol Cell
Probes 27:8085
Scaria J, Palaniappan RU, Chiu D et al (2008)
Microarray for molecular typing of Salmonella
enterica serovars. Mol Cell Probes 22:
238243
Huehn S, Malorny B (2009) DNA microarray
for molecular epidemiology of Salmonella.
Methods Mol Biol 551:249285
Matsuda M, Miyazawa T, Moore JE, Buckley
TC, Thomas LA (1998) Molecular genotyping by pulsed-field gel electrophoresis of
310
restricted genomic DNA of strains of Taylorella equigenitalis isolated in Ireland and in the
United States. Vet Res Commun 22:217224
192. Kagawa S, Moore JE, Murayama O, Matsuda
M (2001) Comparison of the value of pulsedfield gel electrophoresis, random amplified
polymorphic DNA and amplified rDNA
restriction analysis for subtyping Taylorella
equigenitalis. Vet Res Commun 25:261269
193. Kagawa S, Klein F, Corboz L et al (2001)
Demonstration of heterogeneous genotypes
of Taylorella equigenitalis isolated from horses
in six European countries by pulsed-field gel

electrophoresis. Vet Res Commun 25:
565575
194. Aalsburg AM, Erdman MM (2011) Pulsedfield gel electrophoresis genotyping of
Taylorella equigenitalis isolates collected in
the United States from 1978 to 2010. J Clin
Microbiol 49:829833
195. Hunter PR, Gaston MA (1988) Numerical
index of the discriminatory ability of typing
systems: an application of Simpsons index of
diversity. J Clin Microbiol 26:24652466
Chapter 22
Characterization of Campylobacter jejuni
and Campylobacter coli Genotypes in Poultry Flocks by
Restriction Fragment Length Polymorphism (RFLP) Analysis
Abstract
We describe a simple, rapid, and discriminatory methodology that allows the routine molecular characterization of Campylobacter jejuni and Campylobacter coli isolates. The proposed approach is built on one of
the earliest and simplest molecular typing methods ever, consisting on the analysis of the fragments of
different lengths generated by digestion of homologous DNA sequences with specific restriction endonucleases, a process known as restriction fragment length polymorphism (RFLP) analysis. The strategy
underneath the workflow reported here is meant to explore the polymorphisms of Campylobacter spp. flaA
gene (flaA-RFLP) that allows the local investigation of the genetic diversity and distribution of C. coli and
C. jejuni isolates from different sources, namely, chickens caeca. Although not appropriate for global and
long-term epidemiological studies as a single approach, flaA-RFLP analysis can be very useful in surveys
limited in space and time and, for specific epidemiological settings, an alternative to more modern and
resource-demanding techniques.
Key words Genotyping, Restriction fragment length polymorphism, flaA-RFLP, Campylobacter
jejuni, Campylobacter coli, Molecular epidemiology
Introduction
Campylobacteriosis caused by Campylobacter spp. is considered
one of the most prevalent zoonotic enteric infections occurring
worldwide [1], Campylobacter jejuni being associated to the vast
majority of human campylobacteriosis cases (about 90 %), followed
by C. coli (510 %) [2, 3]. The main reservoirs of these species are
the gastrointestinal tracts of poultry (e.g., chickens, turkeys, ducks,
and geese). Handling and consumption of chicken concur as
important risk factors in pathogen transmission to humans [47].
Isolation, identification, and phenotypic and genetic characterization of pathogens are fundamental to understand the
epidemiology of infectious diseases. Using suitable genotyping
311
312
methodologies, essential information on the sources and routes of

pathogen infection may be gathered, which may help to prevent
and control infectious diseases and to minimize the occurrence
and/or effects of potential outbreaks.
Several methodologies have been developed to genotype
Campylobacter spp. [8, 9]. However, the procedures applied in different laboratories, both at the national and international levels,
lack in standardization. Monitoring prevalence and distribution of
different strains at a local, national, and global level is, therefore,
hampered [10]. Efforts have been made in this matter, particularly
in the United States, through the implementation in 1996 of the
PulseNet network (http://www.cdc.gov/pulsenet/). This network is responsible for the standardization of methodologies
applied in the subtyping of food-borne pathogens. In the European
Union, the Campynet (http://campynet.vetinst.dk/CONTENTS.
HTM) network was established in 1998 aiming the uniformization
of the methods used in C. coli and C. jejuni subtyping. Despite
these efforts, the progress made in the standardization of
Campylobacter spp. subtyping has been occurring slowly [10].
In this report, we describe a simple procedure based on the
restriction fragment length polymorphism analysis (RFLP) of the
flaA gene (flaA-RFLP). In Campylobacter spp., the genetic locus
encoding the flagellin is formed by the flaA and flaB genes arranged
in tandem. This locus has both variable and highly conserved
regions, which make it suitable for molecular typing [8, 11]. The
RFLP methodology exploring the polymorphisms within the flagellin locus is fairly inexpensive, is relatively simple to perform, and
is well suited for relatively high-throughput analysis. Still, some
limitations have been reported over the years, especially the possibility for genetic recombination in the flagellin locus [12], which
hamper molecular tracking in epidemiologically related strains.
This method is also not appropriate for global and long-term duration epidemiological studies as a single approach. Over the years, it
has been progressively replaced, or complemented, by other methodologies with higher discriminatory power and reproducibility,
such as multilocus sequence typing (MLST), based on the nucleotide sequence analysis of housekeeping genes, and the longstanding gold-standard technique, pulsed-field gel electrophoresis
(PFGE). On the other hand, flaA-RFLP analysis can be very useful
in epidemiological studies limited in space and time (e.g., to genotype the isolates from poultry flocks) and, for specific epidemiological scenarios, an alternative to the more resource-demanding
techniques mentioned above. Its low cost associated with the quick
procedures of the workflow also stands out as major advantage.
This method was recently applied with success to the comparative
genotypic analysis of C. jejuni and C. coli isolated from broilers in
a nationwide survey in Portugal [13].
Campylobacter Genotyping by flaA-RFLP
313
Several experimental protocols have been developed for

Campylobacter spp. typing based on the amplification and restriction of the flaA gene, which differ considerably in DNA preparation, the set of primers, the annealing temperature used in PCR,
and the restriction enzymes [8]. Various restriction enzymes have
been used individually or in combination, in particular, AluI, DdeI,
HinfI, EcoRI, and PstI [14]. The methodology reported in this
work is based on the procedure proposed by the Campynet network, which in turn is based on the method originally described by
Nachamkin and coworkers [15, 16]. Here, we complement the
former protocols with a few adaptations that have been developed
to improve the reproducibility and accuracy of the flaA-RFLP patterns. From the experimental viewpoint, flaA-RFLP analysis can be
subdivided into five major procedures: DNA extraction, amplification of a fragment of the flaA gene by PCR, amplicon restriction
with different endonucleases, electrophoretic separation of generated fragments, and RFLP analysis using suitable software.
Materials
2.1 Growth of
Campylobacter spp.
and Maintenance
1. Growth media: Prepare Columbia blood agar base according

to manufacturers instructions. Sterilize by autoclaving at
121 C for 15 min. Cool to 50 C and aseptically add 5 %
(v/v) of defibrinated lysed horse or sheep blood.
2. Cryopreservation media: Prepare a mixture of 40 % (v/v) glycerol and 6 % (w/v) Tryptone Soya Broth.
3. Incubation jars of 2.5 L or special incubation bags for the incubation of Petri dishes in an oxygen-depleted and CO2-enriched
atmosphere (see Note 1).
4. Microaerophilic gas generator systems suitable for incubation
bars or for incubation bags.
5. Incubator at 42 C.
2.2 Isolation
of Genomic DNA
Prepare all solutions using ultrapure water. Purify deionized water

to reach a resistivity of 18.2 M cm at 25 C. Keep the reagents/
buffers at room temperature, unless otherwise indicated.
1. SET buffer: 150 mM NaCl, 15 mM EDTA, 10 mM TrisHCl,
and pH 8.0.
2. Sodium dodecyl sulfate (SDS) in distilled, deionized water:
Prepare a 10 % (w/v) stock solution (see Note 2).
3. Proteinase K: Prepare a stock solution of 20 mg/mL in distilled water. Keep it at 20 C.
4. Phenol/chloroform/isoamyl alcohol (25:24:1) solution,
saturated with 10 mM Tris (pH 8.0) and 1 mM EDTA. Keep
it at 4 C.
314
5. 3 M sodium acetate; pH 5.3.

6. Absolute and 75 % (v/v) ethanol.
7. Sterile 1 mL syringes.
8. 1.5 mL sterile tubes.
9. Benchtop centrifuge.
10. DNA vacuum dryer equipment.
2.3 Amplification
of flaA Gene by
Polymerase Chain
Reaction (PCR)
1. Sterile PCR microtubes.

2. Reagents for conventional PCR reactions: Taq DNA polymerase and the respective 10 reaction buffer, 25 mM MgCl2,
10 mM deoxynucleoside triphosphate mix (dNTPs), and
0.1 mM of each oligonucleotide primer (primer A1: 5-GGA
TTT CGT ATT AAC ACA AAT GGT GC-3 and primer A2:
5-CTG TAG TAA TCT TAA AAC ATT TTG-3) [15].
Commercially synthetized primers are lyophilized and need to
be diluted with nuclease-free water. Stock solutions can be prepared at a standard concentration of 100 pmol/l and stored
at 20 C. To avoid freeze and thaw, aliquots of 10 pmol/l
working solutions of each primer may be prepared from stock
solutions in water and stored also at 20 C.
3. Sterile PCR-grade nuclease-free water.
4. Reference strains as controls: C. jejuni subsp. jejuni ATCC
33560 and C. coli CCUG 11283.
5. Standard PCR equipment (thermocycler).
2.4 Agarose Gel

Preparation and
Electrophoresis
1. 5 TBE buffer: 0.89 M Tris Base, 0.89 M boric acid, and

0.5 M EDTA; adjust pH to 8.0. Dilute 200 mL of 5 TBE
buffer in 800 mL of purified deionized water to obtain 1 L of
1 TBE buffer. Store at room temperature.
2. Agarose gel: In a glass bottle (see Note 3), add the appropriate
amount of agarose (electrophoresis grade) to 100 mL of 1
TBE buffer [e.g., 1 % (w/v) agarose gel contains 1 g of agarose]. Put the bottle with the cap unscrewed in a microwave
(used only for this purpose). Heat until completely liquefied
(about 3 min). Let it cool down to 50 C. Add ethidium bromide at 0.3 g/mL to the gel (see Note 4). Ethidium bromide
is a known mutagen and should be handled as a hazardous
substance. Put the gel into a suitable mold (midi gel dimensions: about 12 cm wide by 10 cm long; pour 100 mL of molten volume). Put one comb inside the mold before the gel
polymerizes. After 30/40 min, the gel should be ready to use
(see Note 5). Remove the combs and put the mold with the gel
in an electrophoresis tank. Use 1 TBE as running buffer. The
gel must be completely covered by the buffer.
315
3. Molecular weight markers: Select up to three ladders producing regularly spaced 100 bp, 50 bp, and 25 pb fragments.
4. Commercial DNA loading and staining dye or homemade
solution (see Note 6).
5. Standard equipment for performing agarose gel electrophoresis and for detecting nucleic acids under UV light.
2.5 Digestion of
Amplified DNA with
Restriction Enzymes
and Analysis of
flaA-RFLP Profiles
1. Restriction enzymes DdeI and HinfI.

2. Appropriate 10 restriction buffer for each enzyme.
3. Bovine serum albumin (BSA): 0.1 mg/mL.
4. PCR-grade water.
5. Analysis software: GelCompar II v. 3.50 (Applied Maths).
Methods
3.1 Growth of
Thermotolerant
Campylobacter Strains
1. After detection and identification of Campylobacter species,

according to ISO 10272-1:2006 standard (E) [17] (see Note 7),
inoculate nonselective Columbia blood agar base plates, supplemented with 5 % (v/v) sheep blood (see Note 8), with a colony
from an agar plate or from a slope, or use a loopful of bacteria
from cryotubes.
2. Incubate the plates at 42 C for 48 h under microaerophilic
conditions (5 % O2, 10 % CO2), using the appropriate incubation jars/bags (see Note 9).
3.2 Phenol/
Chloroform Extraction
of Genomic DNA
1. Collect single colonies (13 colonies depending on the size)

grown on solid medium using a sterile disposable loop. In a
microcentrifuge tube, wash the cells with 1 mL of SET buffer.
Then, centrifuge the cell suspension at 7,000 g at room temperature for 5 min. Discard the supernatant.
2. To lyse the cells, resuspend the pellet in 570 L SET buffer
and add 29 L of a solution of 10 % (w/v) SDS and 3 L of
proteinase K. Vortex cell suspension briefly and then incubate
in a water bath at 50 C for 1 h without shaking.
3. For the removal of proteins, add 550 L of phenol/chloroform/isoamyl alcohol solution. Vortex briefly (510 min) and
centrifuge at 12,000 g for 8 min to allow organic and aqueous phase separation.
4. Transfer the supernatant (approximately 500 L) to a new
microtube. Add 550 L of phenol/chloroform/isoamyl alcohol solution. Shake the resulting mixture before proceeding to
a new centrifugation under the above conditions. Recover the
supernatant into a new tube.
316
5. In order to precipitate and collect the DNA extracted from the

cells, add to the supernatant 40 L of 3 M sodium acetate and
800 L of absolute ethanol. Incubate overnight at 20 C.
6. Perform centrifugation at 12,000 g for 10 min to pellet the
DNA in the bottom of the tube. Remove the supernatant carefully with a syringe and wash the pellet with 500 L of 75 %
ethanol (v/v). Repeat the centrifugation under the same
conditions.
7. Evaporate ethanol by exposing the open tubes at room temperature for about 1 h and then carry out vacuum drying for
10 min.
8. After drying, resuspend the DNA in 50 L of autoclaved
nuclease-free water. Store at 20 C until further use (see
Note 10).
9. Other suitable methods may be used to extract Campylobacter
spp. DNA (see Note 11).
3.3 Quantitation,
Purity, and Integrity
of DNA
1. Use disposable plastic cuvettes. Read the optical density of the

diluted DNA solutions at 260 and 280 nm. Before reading
absorbance of DNA samples, zero the UV spectrophotometer
against the control cuvette, containing 1,000 L of the solvent
used for dissolving the DNA samples (e.g., water). Mix 5 L of
the DNA stock solution with 995 L of the DNA solvent. Rinse
the cuvette with deionized water between samples. Alternatively,
to spare the DNA solutions, use a nanospectrophotometer.
2. Estimate the purity of DNA solution based on the ratio A260nm/
A280nm. Consider that DNA solutions with acceptable purity
present reasons comprised between 1.8 and 2.0.
3. To estimate the DNA concentration, consider that each unit of
absorbance at 260 nm corresponds to 50 g/mL for doublestranded DNA. DNA concentration (g/mL) is given by
A260 50 dilution factor.
4. Add 1 L of 6 gel loading dye to 5 L of each DNA solution.
Store at 4 C until electrophoresis is performed.
5. Prepare 1 % (w/v) agarose gel with 1 TBE buffer to verify the
integrity of the extracted DNA.
6. Put the DNA samples with the loading dye into the wells using
a micropipette. Introduce a molecular weight marker in one of
the wells just to check that the gel is appropriately stained.
Perform the electrophoresis using the following conditions:
95 V, 60 min (see Note 12).
7. Examine the gel under UV light (see Note 13).
3.4 Amplification
of flaA Gene by PCR
317
1. Each PCR reaction should be prepared to a final volume of

50 L using sterile PCR microtubes. Prepare the master mix
containing 1.5 mM MgCl2, 0.2 mM of each dNTP (deoxynucleoside triphosphate mix), 1 Taq DNA polymerase reaction
buffer, 1 M of each oligonucleotide primer (primers A1 and
A2), and, finally, 0.05 U/L of reaction mix of Taq DNA polymerase (see Note 14). Add the necessary volume of sterile
nuclease-free water to complete the reaction volume. For
N number of samples, make up sufficient volume for N + 1
reactions (see Note 15). Do not forget to prepare reactions for
positive (DNA from reference strains) and negative (nucleasefree water) controls.
2. Distribute the reaction mixture by individual 0.2 mL
microtubes.
3. Label each tube and, in a different room (if available), add the
template DNA (see Note 16). Each reaction should contain
approximately 30 ng/mL of template DNA (see Note 17).
4. Place the tubes in the thermocycler and start the appropriate
program. Use the following amplification conditions: initial
denaturation step at 94 C for 1 min, 35 cycles of denaturation
at 94 C for 15 s, annealing at 50 C for 45 s, and extension at
72 C for 105 s; a final step at 72 C for 5 min is required for
extension.
5. Store PCR reactions at 4 C or 20 C until ready for analysis
by electrophoresis.
3.5 Detection of
Amplification Products
by Agarose Gel
Electrophoresis
1. Prepare 1.5 % (w/v) agarose gel using 1 TBE buffer as

previously described.
2. Add 2 L of 6 gel loading dye to 10 L of each PCR
product.
3. Load the mixture into the wells of the gel. Considering that
the amplified flaA gene fragment has approximately 1,700 bp,
use an appropriate molecular weight marker. It should be
placed in the first and last wells and at regular intervals across
the gel, ideally after every fifth sample. Use the manufacturers
recommended loading concentration.
4. Electrophoresis conditions: 90 V; 1 h 30 min. Visualize the
gel under UV light. An amplicon of ~1,700 bp is expected
(see Note 18).
3.6 Endonuclease
Restriction
of Amplification
Products (flaA-RFLP)
1. Separately, carry out DdeI or HinfI restriction reactions of each

PCR product corresponding to the amplified flaA gene (see
Note 19). Prepare each 30 L reaction in sterile microtubes by
adding the appropriate restriction buffer (1), BSA in a final
concentration of 0.1 mg/mL, 510 L of the PCR product
(depending on the concentration, estimated according to the
318
intensity of the band on agarose gel), and sterile nuclease-free

water up to the final reaction volume. Finally, add the restriction enzyme, DdeI or HinfI using 0.1 U/L of reaction mix.
Keep the enzymes on ice or in the freezer, until needed.
2. Incubate all the reactions at 37 C (water bath or oven) during
3 h or overnight (see Note 20).
3. Visualize the restriction products on 2 % (w/v) agarose gels
prepared with 1 TBE buffer (midi gel or a gel with higher
dimensions). Perform electrophoresis with the following
conditions: 90 V for about 3 h (see Note 21).
4. Use as standard molecular weight markers 100 bp, 50 bp, and
25 bp fragment DNA ladders in the first and last wells and in
regular intervals as previously referred using the final concentration recommended by the manufacturers. Alternate each
marker in the gel (see Note 22).
5. Visualize the gel under UV light under the transilluminator
and capture the image of the gel using a digital system for
further analysis.
6. Carry out visual analysis of the flaA gene restriction profiles
(see Note 23) and complement this analysis with the aid of the
GelCompar II software version 3.50, enclosed in the
BioNumerics package (Applied Maths, Ghent, Belgium), or
with analogous software. Normalize all profiles to the same
reference system (e.g., selected DNA ladder) and proceed
according to software instructions.
7. To calculate the discriminatory power of the technique, the
formula proposed by Hunter [18] can be used. There are
also bioinformatic tools available online used to calculate
this parameter (e.g., http://insilico.ehu.es/mini_tools/
discriminatory_power/).
Notes
1. To save on gas generation systems, select an incubation jar or
an incubation bag taking into consideration the number of
Petri dishes. According to size, incubation bags are normally
appropriate for two dishes only.
2. SDS precipitates at 4 C. Should this occur, warm the solution
in a water bath up to 20 C.
3. The glass bottle should have twice the capacity of the volume
of the prepared gel. This prevents spillage of gel upon
heating.
4. Staining the gel about 30 min in 1 TBE or in water containing 0.3 g/mL of ethidium bromide before UV visualization
319
could be an alternative to the addition of ethidium bromide

directly to the gel.
5. The complete polymerization of the agarose gel is essential
before loading samples into wells.
6. Alternatively, you can use homemade loading dye: Prepare a
solution containing 50 % glycerol (v/v), 0.25 % (w/v) bromophenol blue, and 0.25 % (w/v) cyanol xylene in distilled water.
Store at 4 C.
7. Molecular identification to the species level could also be performed, in addition to the biochemical identification tests
(hydrolysis of hippurate and the indoxyl acetate and catalase).
For this purpose, use a multiplex PCR assay according to previously established methodologies [19, 20].
8. Campylobacter species are unable to metabolize carbohydrates,
and their metabolism is dependent on amino acid availability.
Supplementation of the culture medium with blood is therefore essential.
9. The strains are generally microaerophilic, which means that, in
order to grow, a particular atmospheric environment, comprising approximately 10 % CO2 and 5 % O2, is required. The optimum growth temperature ranges from 37 C to 42 C. For
incubations at 37 C, extend the incubation period. After
growth, the colonies should have typical morphological characteristicsgray and small colonies, with 13 mm in diameter.
10. DNA can also be stored in TE buffer.
11. If the phenol/chloroform extraction yield is not satisfactory,
try to extract the DNA from cells by the boiling procedure:
Depending on size, collect with a sterile 10 L loop 2 to 4
colonies from the solid media and suspend in 100 L of TE
buffer (prepared with 10 mM Tris base and 1 mM EDTA;
pH 8.0) using sterile microtubes. Place the tubes with cell suspensions in a water bath at 100 C for about 15 min. Centrifuge
at 14,000 g for 5 min and transfer the supernatant (with a
sterile syringe or 1 mL disposable pipette) to a new sterile tube.
Store at 20 C. This procedure is suitable for the rapid screening of large numbers of isolates, but the long-term storage and
reuse of cell lysates could be problematic as the DNA tends to
deteriorate.
For Campylobacter spp. DNA extraction using commercial
systems, we found that the High Pure PCR Template
Preparation Kit from Roche is a very effective option.
12. The electrophoresis conditions will vary upon the dimensions
and concentration of the agarose gel.
13. Should you verify by gel electrophoresis that the DNA solutions are contaminated with RNA, use RNase for RNA removal.
320
For this purpose, add 1 L of RNase (500 g/mL) to DNA

solutions and incubate at 37 C for 1 h. Let the solutions reach
room temperature and then store at 20 C until further use.
14. Before the DNA, Taq DNA polymerase is the last component
to be added to the master mix; therefore, keep it on ice or in
the freezer until required.
15. Check whether the pipettes are properly calibrated to avoid
errors in master mix preparation.
16. The master mix preparation and the DNA addition should be
performed in separate rooms in order to avoid DNA
carryover.
17. The 1 in 10 dilutions of DNA stock solutions (with sterile
deionized water) are frequently of an appropriate concentration to use in PCR reactions. Store the dilutions at 20 C
until needed.
18. If nonspecific products resulting from the PCR reaction are
present, the amplified flaA gene fragment (with approximately
1.7 kb) needs to be purified. For this purpose, visualize the
band of interest in the transilluminator and proceed to its
removal from the gel. With protective gloves, use a sterile scalpel and put the excised piece of gel in a microtube. There are
many commercial systems available for gel band purification;
we found that illustra GFX PCR DNA and Gel Band
Purification Kit from GE Healthcare is a good option.
19. It is advisable to use more than one restriction enzyme to
increase the discriminatory power of the technique.
20. We found that the 3 h duration of the electrophoretic separation of restriction fragments in the referred conditions is an
important issue to enable the discrimination of each band and
the interpretability and reproducibility among gels.
21. In some restriction profiles, the emergence of very weak bands
into a secondary plane could appear. Normally, this situation
occurs when the incubation time of the restriction reactions is
exceeded. Probably these bands are a result of partial digestion
and/or loss of fidelity in relation to enzyme activity (also called
star activity). Better results may be achieved with less extensive incubation periods (up to 3 h).
22. Bands of high and low molecular weight may be generated in
the restriction profiles. It is therefore advisable to switch the
two molecular weight markers in the gel in order to facilitate
the profile analysis.
23. The restriction profiles should be set based on the bands of
greater intensity (foreground) and having in consideration the
size of the gene in question.
321
References
1. FAO/WHO
[Food
and
Agriculture
Organization of the United Nations/World
Health Organization] (2009) Risk assessment
of Campylobacter spp. in broiler chickens:
Technical Report. Microbiological Risk
Assessment Series No 12. Geneva. pp 132
2. Miller WG, Mandrell RE (2005) Prevalence of
Campylobacter in the food and water supply:
incidence, outbreaks, isolation and detection.
In: Ketley JM, Konkel M (eds) Campylobacter:
molecular and cellular biology. Horizon
Bioscience, Norfolk, UK, pp 101108
3. Wilson DJ, Gabriel E, Leatherbarrow AJH
et al (2008) Tracing the source of campylobacteriosis. PLoS Genet. doi:10.1371/journal.
pgen.1000203
4. Wingstrand A, Neimann J, Engberg J et al
(2006) Fresh chicken as main risk factor for
campylobacteriosis, Denmark. Emerg Infect
Dis 12:280285
5. Humphrey T, OBrien SJ, Madsen M (2007)
Campylobacters as zoonotic pathogens: a food
production perspective. Int J Food Microbiol
117:237257
6. Dasti JI, Tareen AM, Raimond L et al (2010)
Campylobacter jejuni: a brief overview on
pathogenicity associated factors and diseasemediating mechanisms. Int J Med Microbiol
300:205211
7. Silva J, Leite D, Fernandes M et al (2011)
Campylobacter spp. as a foodborne pathogen: a
review. Front Microbiol 2:112
8. Wassenaar T, Newell D (2000) Genotyping of
Campylobacter spp. Appl Environ Microbiol
66:19
9. Klena JD, Konkel E (2005) Methods for epidemiological analysis of Campylobacter jejuni. In:
Ketley JM, Konkel M (eds) Campylobacter:
10. Fitzgerald C, Sails AD, Fields PI (2005)
Campylobacter jejuni strain variation. In: Ketley
JM, Konkel M (eds) Campylobacter: molecular
and cellular biology. Horizon Bioscience,
Norfolk, UK, pp 5972
11. Jagannathan A, Penn C (2005) Motility. In:
Ketley JM, Konkel M (eds) Campylobacter:
12.
13.
14.
15.
16.
17.
18.
19.
20.

Harrington CS, Thomson-Carter FM, Carter
PE (1997) Evidence for recombination in the
flagellin locus of Campylobacter jejuni; implications for the flagellin gene typing scheme.
Carreira AC, Clemente L, Rocha T et al
(2012) Comparative genotypic and antimicrobial susceptibility analysis of zoonotic
Campylobacter species isolated from broilers
on a nationwide survey, Portugal. J Food Prot
75:21002109
Ertas HB, Cetinkaya B, Muz A et al (2004)
Genotyping of broiler-originated Campylobacter jejuni and Campylobacter coli isolates
using fla typing and random amplified polymorphic DNA methods. Int J Food Microbiol
94:203209
Nachamkin I, Bohachick K, Patton CM
(1993) Flagellin gene typing of Campylobacter
jejuni by restriction fragment length polymorphism analysis. J Clin Microbiol 31:
15311536
Nachamkin I, Ung H, Patton CM (1996)
Analysis of HL and O serotypes of
Campylobacter strains by the flagellin gene typing system. J Clin Microbiol 34:277281
Anonymous (2006) Microbiology of food and
animal feeding stuffshorizontal method for
detection and enumeration of Campylobacter
spp. Part 1. Detection method. ISO102721:2006. International Organization for
Standardization, Geneva
Hunter PR (1990) Reproducibility and indices
of discriminatory power of microbial typing
methods. J Clin Microbiol 28:19031905
Denis M, Soumet C, Rival K et al (1999)
Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and
Campylobacter coli. Lett Appl Microbiol 29:
406410
Wang G, Clark C, Taylor T et al (2002) Colony
multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C.
upsaliensis, and C. fetus subsp fetus. J Clin
Chapter 23
Pulsed-Field Gel Electrophoresis (PFGE): Application
inPopulation Structure Studies ofBovine
Mastitis-Causing Streptococci
IldaSantos-Sanches, LliaChambel, andRogrioTenreiro
Abstract
Pulsed-field gel electrophoresis (PFGE) separates large DNA molecules by the use of an alternating electrical field, such that greater size resolution can be obtained when compared to normal agarose gel electrophoresis. PFGE is often employed to track pathogens and is a valuable typing scheme to detect and
differentiate strains. Particularly, the contour-clamped homogeneous electric field (CHEF) PFGE system
is considered to be the gold standard for use in epidemiological studies of many bacterial pathogens. Here
we describe a PFGE protocol that was applicable to the study of bovine streptococci, namely, Streptococcus
agalactiae (group B Streptococcus, GBS), Streptococcus dysgalactiae subsp. dysgalactiae (group C
Streptococcus, GCS), and Streptococcus uberiswhich are relevant pathogens causing mastitis, a highly prevalent and costly disease in dairy industry due to antibiotherapy and loss in milk production.
Key words Bovine mastitis, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. dysgalactiae,
Streptococcus uberis, Molecular typing, Molecular epidemiology, Pulsed-field gel electrophoresis,
PFGE, Alternating electrical field, CHEF
1 Introduction
Pulsed-field gel electrophoresis (PFGE) is generally considered the
most discriminatory method to infer relationships between strains
[1, 2]. Briefly, PFGE is based on enzymatic DNA restriction of
bacterial genome (by using rare-cutting restriction endonucleases)
to generate DNA fragments, which are subsequently separated on
a gel, due to molecular reorientation produced by periodic changes
in the electric field, in order to separate the large DNA fragments.
The banding pattern obtained from each isolate is then compared
with the remaining patterns in order to infer epidemiological relation between the isolates. When two isolates show indistinguishable DNA patterns, it is assumed that they are of the same strain,
323
324
IldaSantos-Sanches et al.
and if the patterns differ, then its epidemiological relation must be

evaluated [1, 2]. Different interpretations for analyzing relationships between isolates patterns have been described [2].
1.1 Streptococci
Associated
withBovine Mastitis
Bovine mastitis remains the most important disease in the dairy

industry because of economic loss due to treatment costs (antibiotherapy) and loss in milk production and quality. Streptococcus
uberis is traditionally considered an environmental pathogen
because it may be found and acquired in the bovine surroundings,
such as straw or peat used in bedding materials, in farm soil, and in
the nose, vagina, and rumen of the bovines [3]. On the other hand,
S. agalactiae is considered a contagious pathogen because it is
spread from infected to healthy udders, between quarters of the
same animal and between animals (e.g., through the milking
machine), and is not found in the environment of the bovine [4].
Streptococcus dysgalactiae subsp. dysgalactiae is considered either
an environmental or contagious pathogen [3].
Molecular epidemiology tools offer unique opportunities to
advance the study of diseases through the investigation of infectious agents at the molecular level in a veterinary context [5]. We
used PFGE as a molecular tool to study the molecular characterization of field S. agalactiae, S. dysgalactiae subsp. dysgalactiae, and
S. uberis associated with bovine mastitis, which is of utmost importance in order to implement efficient management practices in
herds [610]. The frequent occurrence of both indistinguishable
PFGE profiles and major clonal PFGE groups among S. agalactiae
isolates collected from the same farm (all farm specific) suggested
widespread strain transmission between animals from the same
farm and confirmed S. agalactiae as a contagious mastitis pathogen. In contrast, the occurrence of identical PFGE patterns
(sharing>82.8% and 100% similarity) among S. dysgalactiae
subsp. dysgalactiae isolates collected at different farms suggested

an environmental source for this pathogen. Heterogeneity in
S. uberis PFGE patterns was observed between isolates collected
from different farms, while almost half of the isolates were clonal,
all farm associated, suggesting direct transmission of S. uberis
among animals within the same farm. This is indicative that possibly inadequate implementation of management programs for the
control of contagious pathogens at farm level may promote the
contagious route for S. uberis infection within herds, despite it is
considered an environmental pathogen.
2 Materials
Prepare all solutions using distilled (or purified) water and analytical
grade reagents. Prepare and store all reagents at room temperature
(unless indicated otherwise). Sterilize the buffers and solutions by
autoclaving at 121C for 20min (or by filtration through a
0.22m filter unit, when indicated).
PFGE Typing of Streptococci
2.1 Solutions
forStreptococcal
Chromosomal DNA
Agarose Discs
(for PFGE)
325
The composition of all the buffers and solutions was previously

described by Rato etal. [9] and was based on the original report by
Chung etal. [11].
1. 1M TrisHCl, pH8.0: weigh out 121.1g of Tris base and add
800ml of distilled water. Adjust to pH8.0 by adding approximately 42ml of concentrated HCl and complete volume to
1L with distilled water.
2. 0.5M EDTA, pH8.0: weigh out 186.1g of EDTA (disodium
salt, m.w.=372.2) and add 800ml of distilled water. Stir and
adjust to pH8.0 with NaOH (approx. 20g of NaOH pellets).
Add distilled water up to 1L.
3. TE buffer (1): 10mM TrisHCl, pH8.0, and 1mM
EDTA.Prepare this solution using a stock solution of TE buffer 10. Solution is sterilized by filtration (0.22m filter unit)
and dispensed into vials.
4. PIV: 10mM TrisHCl, pH8.0, and 1M NaCl. To prepare
500ml of PIV, add 5ml of 1M TrisHCl, pH8.0, and 29.2g
of sodium chloride to distilled water up to 500ml.
5. EC solution: 6mM TrisHCl, pH8.0, 1M NaCl, 100mM
EDTA, pH8.0, 0.2% (w/v) sodium deoxycholate, 0.5%
sodium N-lauroylsarcosinate, and 0.5% Brij 58. To prepare
500ml of EC solution, add 3ml of 1M TrisHCl, pH8.0,
29.2g of sodium chloride, 100ml of 0.5M EDTA, pH8.0, 1g
of sodiumdeoxycholate, 2.5g of sodium N-lauroylsarcosinate,
and 2.5g of Brij 58 to distilled water up to 500ml.
6. EC lysis solution: 1mg/ml lysozyme, 5U/ml mutanolysin,
and 50g/ml RNase in EC solution.
The enzymes are diluted in EC solution from stock solutions: 10mg/ml lysozyme in TE buffer; 5U/l of mutanolysin in potassium phosphate (0.1M) buffer; and 10mg/ml
RNase in double-distilled water (see Note 1).
7. ES buffer: 0.5M EDTA, pH9.0, and 1% sodium
N-lauroylsarcosinate. To prepare 500ml of ES buffer, weigh
out 93.1g of EDTA (disodium salt) and dissolve in 400ml of
distilled water. Adjust the pH to 9.0 by adding NaOH pellets
(approximately 10g). Add 5g of sodium N-lauroylsarcosinate
and complete the volume to 500ml with distilled water.
8. ESP solution: to prepare 15ml of ESP solution, add 15mg of
proteinase K (final concentration of 1mg/ml) to 15ml of ES
buffer (see Note 2).
9. Pre-SmaI restriction buffer: 6mM TrisHCl, pH8.0, 20mM
KCl, and 6mM MgCl2.
To prepare 500ml, add 3ml of 1M TrisHCl, pH8.0,
0.75g of KCl, and 0.61g of MgCl2.6H2O to distilled water up
to 500ml (see Note 3).
326
10. SmaI restriction buffer: mix 15ml of pre-SmaI restriction buffer and 6.3l of mercaptoethanol (prepare on the day of use).
11. 10 TBE running buffer: 1M TrisHCl, 0.9M boric acid, and
0.01M EDTA.Dilute to 0.5 TBE with double-distilled (or
ultrapure) water (see Note 4).
12. Solution of ethidium bromide (1g/ml): add 25l of a
10mg/ml stock solution in 300ml of autoclaved distilled
water. The stock solution should be stored away from light
at 4C.
13. Loading buffer with bromophenol blue (6): 0.25% bromophenol blue and 40% (w/v) sucrose in double-distilled (or
ultrapure) water to a final volume of 10ml. Store at 4C.
14. Low melting temperature agarose solution for the DNA discs:
weigh out 0.15g of low melting temperature agarose (we use
SeaPlaque agarose), add 10ml of PIV, and heat at the microwave to dissolve completely. Transfer dissolved agarose to a
42C water bath where it should stay for at least 10min before
use (prepare just before use).
15. Low melting temperature agarose solution to seal the DNA
discs in the gel: to prepare sealing agarose, weigh out 0.075g
of low melting temperature agarose (we use SeaPlaque
agarose), add 10ml of 0.5 TBE, and boil on the microwave.
Keep at 42C until use.
16. SeaKem LE Agarose solution for the gel: 150ml of 1% SeaKem
LE Agarose. Weigh out 1.5g of agarose, and add 7.5ml of
10 TBE and 130ml of distilled water. Boil in microwave for
12min and mix in between. Adjust the final volume to 150ml
with distilled water. Put a magnetic stirrer bar into agarose; stir
slowly at room temperature, until not too hot for hands (about
50C); and pour immediately.
17. Running buffer: add 100ml of 10 TBE in a measuring cylinder and adjust the volume to 2L with distilled water.
2.2 Other
Materials, Equipments,
and Software
1. Liquid culture medium ToddHewitt (commercially purchased

and prepared according to the manufacturers instructions).
2. Restriction enzyme SmaI (recognizes the nucleotide sequence
CCC^GGG and the optimum temperature for the restriction
of DNA is 25C).
3. Lambda ladder PFG marker (New England Biolabs): successively larger concatemers of lambda DNA embedded in 1%
low melting point (LMP) agarose and supplied in a dispenser
(gel syringe type). Size range: 501,000kb. Should be stored
at 20C.
4. Pulsed-field electrophoresis system for pulsed-field gel electrophoresis (PFGE) (e.g., CHEF-DRIII, BioRad).
327
5. Digital gel documentation system to capture and image scanning after the pulsed-field gel electrophoresis (PFGE) (e.g.,
Gel Doc XR system and Quantity One 1-D analysis software,
BioRad) or conventional camera photography and a
UV-sensitive film.
6. Software for the analysis of DNA banding profiles and construction of dendrograms (e.g., BioNumerics, version 6.6,
Applied Maths, Belgium).
3 Methods
Carry out all procedures at room temperature unless otherwise
specified. Wear gloves during the protocol to avoid nuclease contamination of the DNA samples from the operators skin. Use sterile materials throughout (e.g., tubes, tips, etc.).
3.1 Growth
ofBacterial Cultures
1. Inoculate 12 colonies into a glass tube containing 6ml of

ToddHewitt broth.
2. Incubate at 37C overnight with aeration without shaking.
3.2 Harvest
andWash ofCells
From this point on, all tubes must be kept on ice.

1. Transfer overnight cultures to 15ml centrifuge tubes.
2. Centrifuge at 1,800g (RCF) at 4C for 15min.
3. Discard the supernatants and resuspend cell pellets by adding
1ml of PIV to each 15ml centrifuge tube (see Note 5).
4. Transfer PIV cell suspensions into 1.5ml centrifuge tubes
(which were prechilled on ice).
5. Centrifuge at 11,200g (RCF) at 4C for 5min.
6. Remove the supernatant with a micropipette (do not touch
the pellets; remove carefully the last amounts of supernatant
using, e.g., 200l volume tips and the correspondent automatic pipette).
7. Resuspend bacterial pellets by adding 200l of PIV to each
1.5ml centrifuge tube (the estimated total volume in each
tube is now approx. 210l, with the contribution of the pellet
volume; resuspend pellets by up and down pipetting with
200l volume tips).
3.3 Adjustment
ofCell Concentration
1. Label disposable 1ml plastic spectrophotometer cuvettes.

2. Pipette 1ml of PIV into each cuvette.
3. Gently vortex cell suspensions (all tubes are on ice) and pipette
5l of suspension into the 1ml PIV containing cuvettes.
4. Cover cuvette with parafilm and mix content by inverting
(leave no air bubbles).
328
5. Discard the parafilm and measure the OD620 (which should be

between 0.025 and 0.15).
6. Discard cuvettes.
7. To each tube of cell suspension, add PIV to make the
OD620=5.0 according to the following formula: Vadd(l)=(OD
62040210)210 (see Note 6).
3.4 Preparation
ofDNA AgaroseDiscs
1. Prepare glass microscope slides by washing them with 70%

ethanol.
2. Dry the slides by blotting with tissue paper.
3. Take a large piece of glass plate and cover its surface with
parafilm completely.
4. Rinse the parafilm surface with 70% ethanol and dry by gently
blotting with tissue paperit will be onto this large glass plate
that the agarose/cell suspensions will be deposited during the
preparation of DNA agarose discs (Fig.1).
5. Pipette 150l of the OD620=5.0 cell suspensions into a new
set of 1.5ml centrifuge tubes.
6. Transfer the centrifuge tubes to a 42C water bath and incubate for 10min.
7. Take the first tube and add 150l of the low melting agarose
(which has been at 42C) and vortex briefly.
8. Deposit 20l droplets onto the parafilm-coated large glass
plate (Fig.1; use 200l pipette tips).
9. Deposit six 20l droplets in one row, and in a parallel line
deposit a second set of six 20l droplets (i.e., a total of 12
droplets for each strain).
10. Cover the two times six droplets with a microscope slide
(Fig.1).
11. When all agarose droplets are lined up on the glass tray covered with the microscope slides, transfer the entire glass tray to
the freezer compartment of a refrigerator (20C) for 5min
(do not keep longer than 5min at 20C).
12. Take out the glass tray from the refrigerator and keep it at
room temperature for 10min.
13. Carefully lift off the microscope slides (the agarose d
roplets are
now ready to be used as agarose DNA discs for the rest of
the PFGE protocol).
3.5 Lysis
andTreatment
withProteinaseK
1. Remove the agarose discs one by one (from the previous step)
into 15ml plastic tubes containing 1ml of EC lysis solution in
each (use disposable sterile loops to transfer the agarose discs
into the tubes; all 12 or more agarose discs containing the
same DNA go into the same tube) (see Note 7).
329
Side view
Deposit 20 l
agarose droplets
Microscope
slides
Glass plate coated

(wrapped) with parafilm
Side view of
the droplets:
Put microscope slide on top of droplets

(while droplet are still liquid)
Glass plate coated

Final presentation:
Microscope
slides
Glass plate coated
Fig. 1 Schematic drawing of DNA agarose discs preparation (adapted from Chung etal. [11]). Source: H. de
Lencastre, ITQB. Portugal)
2. Incubate the agarose discs in EC lysis solution at 37C for 3h

(make sure all discs are submerged in the EC lysis solution).
3. Decant carefully the EC lysis solution (use sterilized hydrophilic gauze or muslin cloth) leaving the agarose discs in the
15ml tube.
4. Remove the last amount of liquid using a 200l tip and a
pipette.
5. Add 1ml of ESP solution to each of the 15ml tubes containing the agarose discs.
330
6. Incubate at 50C overnight (17h) (no agitation/stirring

necessary).
7. Decant the ESP solutions.
8. Add to each tube 13ml of TE buffer and wash the discs with
gentle agitation for at least 30min at room temperature (during agitation, the 15ml tubes are in horizontal position, fixed
on a shaker).
9. Repeat the washing step for 8 times (at least 30min each) to
remove the proteinase K.
10. After discs have been washed, they can be stored in TE buffer
at 4C for at least 34 months.
3.6 Restriction
withSmaI
1. Transfer 1 DNA agarose disc into a 1.5ml microtube containing 150l of pre-SmaI restriction buffer.
2. Incubate at room temperature for 3040min and remove the
buffer with a pipette.
3. Add 45l of SmaI restriction buffer plus 20 units of SmaI
enzyme stock per DNA disc (check the equivalent volume in
l) (see Note 3).
4. Incubate at 25C overnight.
5. Add 5 l of loading buffer (the preparation stays at room
t
emperature while the gel is prepared; if the discs are not
immediately used, add 10l of ES to the preparation and store
the discs at 4C for up to 2 days).
3.7 Preparation
oftheGel andPFGE
Apparatus
1. Prepare agarose, running buffer, and sealing agarose (see

Subheading2.1).
2. Clean with distilled water all parts of the casting tray.
3. Assemble apparatus, be sure that it is perfectly horizontal, and
add comb.
4. When agarose is ready, pour it in the apparatus slowly to avoid
trapping air bubbles (which have to be removed with a pipette
tip).
5. Leave the gel to solidify for at least 30min at room temperature (if the gel is not going to be used within the first hour,
wrap it in Saran wrap and keep at 4C).
6. Rinse the machine three times with 2L of autoclaved distilled water. Put the frame into the chamber; add 2L of
running buffer, and turn on the machine, the cooling system, and the variable pump, which should be set at 70.
Temperature of cooling system is 11.3C.Run parameters:
initial time of 5s, final time of 35s, running time of 23h,
and voltage of 200V (6V/cm).
7. Insert the discs in the gel: take out the agarose disc from the
1.5ml microtube with a sterile disposable plastic loop, deposit
331
it on the glass slip, and blot off excess liquid with a soft hand
paper towel; with the help of the loop, slide the agarose disc
into the first well. Make sure the disc is positioned at the bottom and front part of the well (see Note 8).
8. Repeat the process for other agarose DNA discs.
9. The PFGE lambda marker is used as a molecular weight
standard.
10. At the end, when all the wells are filled, seal them with the sealing agarose (be careful not to leave bubbles inside wells).
11. Put the assembled gel into the PFGE chamber and cover the
chamber with the lid.
12. Start running the program.
3.8 Staining
andPhotography
oftheGel
1. Stain the gel by immersing it into 300ml of 1g/ml ethidium

bromide solution for 30min at room temperature.
2. Destain after decanting the ethidium bromide solution and
replacing it with 300ml of distilled water.
3. Place the gel on a shaker for 3060min.
4. Images are captured by using the Gel Doc XR system and
Quantity One 1-D analysis software or equivalent equipment
and software. In alternative, use a conventional camera and a
UV-sensitive positive/negative film (keep the negative).
5. Images are usually saved in tagged image file format (TIFF).
An example of the typical results produced is shown in Fig.2.
There should be a complete DNA restriction in all lanes (partially restricted DNA produces faint smeared bands between
better-defined bands of the profiles).
3.9 Computer-
Fingerprinting
Analysis
Analysis and interpretation of PFGE profiles is best done using a

software program such as BioNumerics software (Applied Maths,
Belgium) for computer-assisted cluster analysis. An example is
shown in Fig.3. The PFGE profiles in TIFF images are normalized
between all images by using standards (molecular weight standard
and duplicated DNAs) included in every gel. Good-quality gel
images are essential for the interpretation of PFGE patterns, such as
to allow matching PFGE patterns to known PFGE fingerprinting
data within a PFGE database. Levels of similarity between fingerprints are calculated by the Dice association coefficient and
unweighted pair group method using arithmetic averages (UPGMA)
for clustering and produce band-based dendrograms (e.g., with a
band position tolerance of 1.5% and no optimization or 1% optimization). Groups of patterns with no observed band differences
(corresponding to a level of similarity of 100%) are considered
indistinguishable and should be assigned to the same subtype of a
PFGE type. Patterns with variation up to six bands are considered
related according to previous suggested criteria [1] and are clustered
332
Fig. 2 Representative image of SmaI and Cfr9I PFGE patterns of bovine streptococci (S. dysgalactiae subsp.
dysgalactiae). Capital letters B, C, D, E, F, G, I, and J on top of PFGE images are farm codes where isolates were
collected. Capital letters and numeral suffix under farm code represent the PFGE typesubtype patterns.
LADDER corresponds to lambda ladder PFG marker. (a) All PFGE profiles obtained among the 18 bovine
isolates using the endonuclease SmaI (one isolate from farm E was resistant to cleavage by endonuclease
SmaI). (b) PFGE profile of Cfr9I-digested genomic DNA of one isolate (of PFGE F-1) which was resistant to
cleavage by SmaI
Fig. 3 Representative image of a dendrogram of PFGE patterns of bovine streptococci (S. dysgalactiae subsp.
dysgalactiae) (adapted from Rato et al. (http://wwwnc.cdc.gov/eid/article/16/1/09-0632-f1)) [7]. The dendrogram was produced by using Dice coefficients and an unweighted pair group method using arithmetic averages
(UPGMA). Default clustering settings of 0% optimization (i.e., the relative distance an entire lane is allowed to
shift in matching attempts) and 1.5% band position tolerance were used
333
in most cases above 80% similarity. These are assigned to different

subtypes of a PFGE type. Patterns with variation of six or more
bands (corresponding to levels of similarity of less than 80%) are
considered unrelated and are assigned to distinct PFGE types.
PFGE types may be designated with uppercase letters of alphanumeric codes, and each of their subtypes (subclonal variants) may be
identified by an additional numeral-or letter-code suffix.
4 Notes
1. Solutions prepared from powdered pancreatic RNase (ribonuclease A from bovine pancreas, Sigma-Aldrich) products can be
made free of DNase by boiling. Prepare a 10mg/ml stock
solution in 10mM sodium acetate buffer, pH5.2. Heat to
100C for 15min, allow to cool to room temperature, and
then adjust to pH7.4 using 0.1 volumes of 1M TrisHCl,
pH7.4. Aliquot and store at 20C.
2. The deproteinization solution should be freshly prepared
before use.
3. The Cfr9I (XmaI) restriction enzyme (C^CCGGG) can be
used instead of SmaI (CCC^GGG) when DNAs are uncut by
SmaI.If Cfr9I is used, do the equilibration step of the protocol
as referred but with pre-Cfr9I restriction buffer (10mM Tris
HCl, pH7.2, 5mM MgCl2, 200mM sodium glutamate,
100 g/ml BSA) at 37C.For the restriction, add 45l of
Cfr9I restriction buffer plus 20 units of Cfr9I enzyme stock
per DNA disc and incubate at 37C overnight.
4. TBE buffer is prone to precipitation over time.
5. Remove supernatants carefully using a 5ml pipette with an
automatic pipette aid.
Caution: Pellets are easy to lose! Be careful when taking tubes
out of centrifuge. Remove the last amounts of supernatant
fluid using 1ml tips and corresponding pipette.
6. The formula is derived as follows:
OD620 200 Vadd + 210
=
5.0
210

where:
OD620: optical density measured in the cuvette

200: dilution factor (of 5l of cell suspension to 1ml of PIV
in the cuvette)
OD620200: the true OD620 of the suspension of bacteria
(in 210l PIV) in the 1.5ml tubes
5.0: desired final OD620 of the bacterial suspension in the
1.5ml tubes
334
Vadd: volume (l) to add to the 1.5ml tubes in order to obtain

a final OD620=5.0
210: original volume (l) of the cell suspension in PIV
Vadd+210: total volume (l) in the 1.5ml tubes, after the addition of the extra volume of PIV
7. Important: the DNA agarose discs are fragile; manipulate them
gently.
8. Do not touch agarose disc with hand paper towel.
Acknowledgments
The PFGE data mentioned in this chapter were obtained by Mrcia
Rato as part of her research leading to Ph.D. thesis. Fundao para
a Cincia e a Tecnologia (FCT) is acknowledge for the financial
support for the accomplishment of Mrcia Rato Doctoral Project
(SFRH/BD/32513/2006). The work was supported by the
grants Pest-OE/BIA/UI0457/2011-CREM (Centro de Recursos
Microbiolgicos) and PROC 60839, funded by Fundao para a
Cincia e Tecnologia, Portugal and Fundao Calouste Gulbenkian,
Portugal (respectively).
References
1. Tenover FC, Arbeit RD, Goering RV etal
(1995) Interpreting chromosomal DNA
restriction patterns produced by pulsed-field
gel electrophoresis: criteria for bacterial strain
typing. J Clin Microbiol 33:22332239
2. Van Belkum A, Tassios PT, Dijkshoorn L etal
(2007) Guidelines for the validation and application of typing methods for the use in bacterial epidemiology. Clin Microbiol Infect
13(suppl 3):146
3. Ericsson U, Lindberg A, Persson W etal
(2009) Microbial aetiology of acute clinical
mastitis and agent-specific risk factors. Vet
Microbiol 137:9097
4. Barkema HW, Green MJ, Bradley AJ, Zadoks
RN (2009) Invited review: the role of contagious disease in udder health. J Dairy Sci 92:
47174729
5. Muellner P, Zadoks RN, Perez AM etal
(2011) The integration of molecular tools into
veterinary and spatial epidemiology. Spat
Spattemporal Epidemiol 2:159171
6. Rato MG, Bexiga R, Nunes SF etal (2008)
Molecular epidemiology and population structure of bovine Streptococcus uberis. J Dairy Sci
91:45424551
7. Rato MG, Bexiga R, Nunes SF, Vilela CL,

Santos-Sanches I (2010) Human group A
streptococci virulence genes in bovine group C
streptococci. Emerg Infect Dis 16:116119
8. Rato MG, Nerlich A, Bergmann R etal (2011)
Virulence gene pool detected in bovine group
C Streptococcus dysgalactiae subsp. dysgalactiae
using a group A Streptococcus pyogenes virulence
microarray. J Clin Microbiol 49:24702479
9. Rato MG, Bexiga R, Florindo C etal (2013)
Antimicrobial resistance and molecular epidemiology of streptococci from bovine mastitis.
10. Rato M (2011) Epidemiological characterization, antimicrobial resistance and virulence
mechanisms in animal and human streptococci. Ph.D. thesis, Faculdade de Cincias e
Tecnologia. Universidade Nova de Lisboa.
Portugal. ISBN: 978-989-20-2618-3
11. Chung M, de Lencastre H, Matthews P etal
(2000) Molecular typing of methicillin-
resistant Staphylococcus aureus by pulsed-field
gel electrophoresis: comparison of results
obtained in a multilaboratory effort using
identical protocols and MRSA strains. Microb
Drug Resist 6:189198
Chapter 24
Multiple-Locus Variable-Number Tandem Repeat (VNTR)
Analysis (MLVA) Using Multiplex PCR and Multicolor
Capillary Electrophoresis: Application to the Genotyping
of Brucella Species
Giuliano Garofolo
Abstract
The multiple-locus variable-number tandem repeat (VNTR) analysis (MLVA) is a genetic typing method
based on the evaluation of the number of repeated sequences in multiple selected loci of microbial
DNA. Although several MLVA typing panels have been proposed for brucellae, the 16-loci panel is recognized as the standard genotyping method, also used for the Brucella international online database. This
chapter describes a high-throughput MLVA-16 protocol using multiplex PCRs and multicolor capillary
electrophoresis.
Key words MLVA, Capillary electrophoresis, Multiplex PCR, Brucella spp, Genotyping
Introduction
Brucellosis is a widespread animal infectious disease and probably
the worlds most common zoonosis. The Brucella genus currently
comprises six classical species (B. abortus, B. melitensis, B. suis, B. ovis,
B. canis, and B. neotomae) and four novel species (B. ceti, B. pinnipedialis, B. inopinata, and B. microti) [1]. New species have
been proposed in recent years. The highly monomorphic nature of
this genus, presenting few polymorphisms not only within species
but between species as well, makes strains particularly difficult to
differentiate using most genetic typing techniques. This makes
crucial public health tasks, such as diagnosis and strain typing, a
challenge for veterinary laboratories testing livestock and wildlife.
To date, multiple-locus variable-number tandem repeat (VNTR)
analysis (MLVA) [2] is recognized as one of the best genotyping
approaches for Brucella. Mutation rate variability between loci in
Brucella allows this method to discriminate closely related strains
335
336
Giuliano Garofolo
(through highly mutable loci) as well as yield useful information at

the phylogenetic/taxonomic level (through relatively conserved
loci). VNTRs are found in both chromosomes and may exhibit
several allelic states within a brucellae population. Slipped strand
mispairing during DNA replication is the biological reason for
such variation. Thus far, MLVA panels of either 21, 16, or 15 loci
(MLVA-21, MLVA-16, and MLVA-15, respectively) have been
developed [35], each with its strengths and weaknesses. A cooperative online public database based on the MLVA-16 panel was
established with the aim of promoting the creation of a global epidemiological map of Brucella (http://mlva.u-psud.fr/brucella/).
The MLVA-16 protocol normally employs singleplex PCRs and
agarose gel electrophoresis. We describe an alternative methodology for MLVA-16 Brucella genotyping, using multiplex PCRs and
capillary electrophoresis performed on an ABI PRISM genetic analyzer. Methods for MLVA data management and analysis, including the submission of queries to international databases, will also
be illustrated.
Materials
2.1 Laboratory
Plasticware
1. 0.5 ml amber-colored tubes (to protect fluorescent dyes from

light; in the absence of amber-colored tubes, transparent tubes
covered with aluminum foil may be used).
2. 1.5 ml microcentrifuge tubes.
3. 96-well v-bottom PCR plates or blocks for 0.2 ml PCR tubes
with caps.
4. Presterile DNase- and RNase-free filter pipette tips (20 l,
100 l, 1,000 l).
5. 1.4 ml noncoded U-bottom bulk tubes (Micronic, Lelystad,
The Netherlands).
6. Storage rack for 96 individual tubes (8 12)Comorack-96
(Micronic, Lelystad, The Netherlands).
7. Rubber septa for the 96-well reaction plate.
2.2 Laboratory
Reagents
1. Water, Mol Bio grade (i.e., DNase-, RNase-, and protease-free

molecular biology grade water).
2. Either TE buffer (i.e., 1 TE: 1 mM TrisHCl, 0.1 mM EDTA,
pH 8.0) or water, Mol Bio grade.
3. Multiplex PCR master mix (we use 2 Type-it microsatellite
PCR Master Mix, Qiagen).
4. Q solution, an innovative PCR additive that facilitates amplification of difficult templates (Qiagen).
Genotyping Brucella Species with MLVA-16
337
5. 50 M primer stock solutions for the following loci: Bruce04,

Bruce06, Bruce07, Bruce08, Bruce09, Bruce11, Bruce12,
Bruce43, Bruce45, and Bruce55. MLVA primers sequences for
the 16 loci and fluorescent dyes used in the capillary electrophoresis are given in Table 1 [6, 7].
6. 10 forward primer mixes (M1fw, M2fw, M3fw, and M4fw
mixes) (see Note 1):
(a) M1fw: Mix and dilute 4.4 l of each 50 M primer stock
solutions [Bruce08 Fw (PET labelled), Bruce11 Fw
(6FAM labelled), Bruce45 Fw (6FAM labelled),
Bruce30 Fw (PET labelled), and Bruce19 Fw (NED
labelled)] in a final volume of 110 l of TE buffer or Mol
Bio grade water to obtain a 2 M (10) primer mix working solution (see Note 2).
(b) M2fw: Mix and dilute 50 M primer stock solutions [8.8 l
of Bruce06 Fw (NED labelled), 1.1 l of Bruce42 Fw
(VIC labelled), and 1.1 l of Bruce42 Fw (unlabelled)]
in a final volume of 110 l of TE buffer or Mol Bio grade
water to obtain a 4.0, 0.5, and 0.5 M (10) primer mix
working solution, respectively (see Note 2).
(c) M3fw: Mix and dilute 50 M primer stock solutions
[3.3 l of Bruce12 Fw (NED labelled), 1.1 l of
Bruce55 Fw (PET labelled), 1.1 l of Bruce55 Fw
(unlabelled), 1.1 l of Bruce18 Fw (PET labelled),
1.1 l of Bruce18 Fw (unlabelled), 4.4 l of Bruce21
Fw (6FAM labelled), and 4.4 l of Bruce04 Fw (VIC
labelled)] in a final volume of 110 l of TE buffer or Mol
Bio grade water to obtain a 1.5, 0.5, 0.5, 0.5, 0.5, 2.0, and
2.0 M (10) primer mix working solution, respectively
(see Note 2).
(d) M4fw: Mix and dilute 50 M primer stock solutions [3.3 l
of Bruce07 Fw (NED labelled), 4.4 l of Bruce09 Fw
(VIC labelled), 4.4 l of Bruce16 Fw (6FAM labelled),
and 3.3 l of Bruce43 Fw (6FAM labelled)] in a final
volume of 110 l of TE buffer or Mol Bio grade water to
obtain a 1.5, 2.0, 2.0, and 1.5 M (10) primer mix working solution, respectively (see Note 2).
7. 10 reverse primer mixes (M1rw, M2rw, M3rw, and M4rw
mixes) (see Note 1).
(a) M1rw: Mix and dilute 4.4 l of each 50 M primer stock
solutions [Bruce08 Rw (unlabelled), Bruce11 Rw
(unlabelled), Bruce45 Rw (unlabelled), Bruce30 Rw
(unlabelled), and Bruce19 Rw (unlabelled)] in a final volume of 110 l of TE buffer or Mol Bio grade water to obtain
a 2 M (10) primer mix working solution (see Note 2).
338
Giuliano Garofolo
Table 1
MLVA primers sequences
Multiplex
PCR mixa
Locus
Primer sequences (5-3)b
M1
Bruce30
Fw: PET - TGACCGCAAAACCATATCCTTC

Rw: TATGTGCAGAGCTTCATGTTCG
119199
Bruce08
Fw: PET - ATTATTCGCAGGCTCGTGATTC

Rw: ACAGAAGGTTTTCCAGCTCGTC
312384
Bruce11
Fw: 6FAM - CTGTTGATCTGACCTTGCAACC

Rw: CCAGACAACAACCTACGTCCTG
2571076
Bruce45
Fw: 6FAM - ATCCTTGCCTCTCCCTACCAG

Rw: CGGGTAAATATCAATGGCTTGG
133187
Bruce19
Fw: NED - GACGACCCGGACCATGTCT

Rw: ACTTCACCGTAACGTCGTGGAT
79205
Bruce06
Fw: NED - GATTGCGGAACGTCTGAACT

Rw: TAACCGCCTTCCACATAATCG
312714
Bruce42
Fw: VIC - CATCGCCTCAACTATACCGTCA

Rw: ACCGCAAAATTTACGCATCG
164914
Bruce12
Fw: NED - CGGTAAATCAATTGTCCCATGA

Rw: GCCCAAGTTCAACAGGAGTTTC
302452
Bruce18
Fw: PET - TATGTTAGGGCAATAGGGCAGT

Rw: GATGGTTGAGAGCATTGTGAAG
130186
Bruce55
Fw: PET - TCAGGCTGTTTCGTCATGTCTT

Rw: AATCTGGCGTTCGAGTTGTTCT
193553
Bruce21
Fw: 6FAM - CTCATGCGCAACCAAAACA

Rw: GTGGATACGCTCATTCTCGTTG
431463
Bruce04
Fw: VIC - CTGACGAAGGGAAGGCAATAAG

Rw: TGGTTTTCGCCAATATCAACAA
313473
Bruce07
Fw: NED - GCTGACGGGGAAGAACATCTAT

Rw: ACCCTTTTTCAGTCAAGGCAAA
134246
Bruce09
Fw: VIC - GCGGATTCGTTCTTCAGTTATC

Rw: GGGAGTATGTTTTGGTTGTACATAG
124292
Bruce43
Fw: 6FAM - TCTCAAGCCCGATATGGAGAAT

Rw: TATTTTCCGCCTGCCCATAAAC
170194
Bruce16
Fw: 6FAM - ACGGGAGTTTTTGTTGCTCAAT

Rw: GGCCATATCCTTCCGCAATA
227353
M2
M3
M4
Allele size
range (bp)c
a
For primer mixes including the forward primers targeting the Bruce18, Bruce42, and Bruce55 loci, equal concentrations of both labelled and unlabelled primers targeting these loci were added to the mix in order to avoid the posterior
production of excessive fluorescence during the capillary electrophoresis [6]
b
Fw, forward primer; Rw, reverse primer
c
Expected allele size ranges are given in base pairs. The test has been designed so that fragments would differ from one
another by either size, fluorescence, or both, to exclude the possibility of overlap in capillary electrophoresis results
339
(b) M2rw: Mix and dilute 50 M primer stock solutions

[8.8 l of Bruce06 Rw (unlabelled) and 2.2 l of
Bruce42 Rw (unlabelled)] in a final volume of 110 l
of TE buffer or Mol Bio grade water to obtain a 4.0 and
1.0 M (10) primer mix working solution, respectively
(see Note 2).
(c) M3rw: Mix and dilute 50 M primer stock solutions
[3.3 l of Bruce12 Rw (unlabelled), 2.2 l of Bruce55
Rw (unlabelled), 2.2 l of Bruce18 Rw (unlabelled),
4.4 l of Bruce21 Rw (unlabelled), and 4.4 l of
Bruce04 Rw (unlabelled)] in a final volume of 110 l
of TE buffer or Mol Bio grade water to obtain a 1.5, 1.0,
1.0, 2.0, and 2.0 M (10) primer mix working solution,
respectively (see Note 2).
(d) M4rw: Mix and dilute 50 M primer stock solutions
[3.3 l of Bruce07 Rw (unlabelled), 4.4 l of Bruce09
Rw (unlabelled), 4.4 l of Bruce16 Rw (unlabelled),
and 3.3 l of Bruce43 Rw (unlabelled)] in a final volume of 110 l of TE buffer or Mol Bio grade water to
obtain a 1.5, 2.0, 2.0, and 1.5 M (10) primer mix working solution, respectively (see Note 2).
8. Hi-Di formamide.
9. POP-7 polymer, a separation matrix for performing DNA
sequencing and fragment analysis on the Applied Biosystems
genetic analyzer instruments (Life Technologies, USA).
10. Anode and cathode buffers, reagents to support electrophoresis on Applied Biosystems genetic analyzer instruments (Life
Technologies, USA).
11. GeneScan 1200 LIZ size standard (Life Technologies, USA).
12. DNA samples from one or more reference strains having
known MLVA profiles, for comparison (e.g., B. melitensis
biovar 1 strain 16 M). Be sure to use purified DNAs (A260/
A280 ratio 1.8).
13. DNA samples to be tested. Be sure to use purified DNAs
(A260/A280 ratio 1.8).
2.3 Equipment
and Instruments
1. PCR plate cooling block or ice.

2. Complete clean set (1,000 l, 200 l, 100 l, 20 l, and
10 l) of single-channel pipettes for PCR master mix setup.
3. 10 l single-channel pipettes for DNA solutions.
4. 8-channel pipettes (200 l and 10 l) for DNA solutions.
5. Thermocycler with heated lid.
6. Heat block (or thermocycler), capable of operating at 95 C.
340
Giuliano Garofolo
7. Centrifuge and rotors adapted to 0.2 ml PCR tubes, 1.5 ml

microcentrifuge tubes, and 96-well v-bottom PCR plates.
8. Mixer.
9. Capillary electrophoresis genetic analyzer (e.g., we use ABI
PRISM genetic analyzer, either 3130 or 3500 series) (Life
Technologies, USA) (see Note 3).
10. Capillary arrays, 50 cm.
2.4
Software
1. Data collection software, the operative software to drive the

Applied Biosystems genetic analyzer instruments.
2. GeneMapper 4.1 (Life Technologies, USA).
3
3.1
Methods
PCR Setup
1. Defrost all PCR components and keep them on ice during

preparation.
2. Briefly vortex and spin down the primer mixes in their amber
tubes.
3. Place a 96-well v-bottom PCR plate or the required number of
0.2 ml PCR tubes in a PCR block or on ice.
4. Mark four 1.5 ml microcentrifuge tubes as M1, M2, M3, and
M4, respectively, for each of the four multiplex master mixes to
be prepared.
5. Prepare each master mix in the correspondent 1.5 ml microcentrifuge tube using the appropriate volumes (see Table 2),
preferably introducing them in the following order: Mol Bio
water, Q solution, 2 Type-it microsatellite PCR Master Mix,
and primers.
6. Vortex the master mixes for 12 s.
7. Leave the DNA clean room.
8. To optimize the workflow and facilitate the dispensation of
DNA samples, it is useful to include 32 samples in each PCR
run: 28 DNA samples to be tested, two positive reference
DNA samples for positive controls, and two no-template negative controls.
9. Due to differences in the PCR cycling conditions, the M2 PCR
should be run separately from M1, M3, and M4 PCRs.
10. In a single 96-well plate or tube rack, dispense M1, M3, and
M4 master mixes: 9 l of each master mix in each well/tube,
for each sample to be tested, dedicating distinct columns to
each kind of master mix. Using a multichannel pipette, add
1 l of each DNA sample (150 ng) to each master mix, keeping row positions constant across columns.
341
Table 2
PCR master mixes composition
Volume per reaction (l)a
Component
Final concentration
2 Type-it microsatellite
PCR Master Mix
Q solution
0.5
Mol Bio grade water
DNA template solution
1050 ng
10 forward primer mixb

10 reverse primer mix
Final volume (l)
10
The volume of each component to add to the master mix corresponds to the volume per reaction of that component
multiplied by the total number of samples (including any positive and negative controls) plus 10 % of the original volume to compensate for eventual pipetting losses (DNA template solutions are not added to master mixes)
b
Primer mix for the specific multiplex PCR being prepared, primer solutions should be paired as follows: M1fw and
M1rw (for multiplex master mix 1M1), M2fw and M2rw (for multiplex master mix 2M2), M3fw and M3rw (for
multiplex master mix 3M3), and M4fw and M4rw (for multiplex master mix 4M4)
11. In a separate 96-well plate or tube rack, dispense 9 l of M2

master mix in each well/tube for each sample to be tested.
Using a multichannel pipette, add 1 l of each DNA sample
(150 ng) to the master mix, keeping row positions constant
across columns.
12. Keep the plates/racks on ice.
13. Run the PCRs under the following thermocycling conditions:
initial activation step at 95 C for 5 min followed by 30 cycles
(for M1, M3, and M4 PCRs) or 26 cycles (for M2 PCR) of
denaturation (at 95 C for 30 s), annealing (at 60 C for 90 s)
and extension (at 72 C for 30 s) steps, and a final extension
step at 60 C for 45 min and 20 C for 120 min. Keep the
products at 4 C after the amplification reactions.
3.2 Dilution
of PCR Products
1. Prepare as many U-bottom bulk tubes as the wells used in

PCR reactions.
2. Insert the tubes in their storage racks.
3. Dispense 450 l of Mol Bio grade water in each tube (see Note 4).
4. For each sample, add 2 l of the PCR product from each reaction (M1, M2, M3, and M4).
3.3 Preparation
of the Samples
for Capillary
Electrophoresis
1. Calculate the volumes of the reagents needed for the

formamide/size standard mix by multiplying the volumes
required for the injection of a single DNA sample for capillary
electrophoresis (i.e., 10.25 l formamide and 0.3 l Liz 1200
size standard) by the total number of samples (including any
342
Giuliano Garofolo
positive and negative controls). Then, multiply by three, since

three capillary electrophoresis injections will be needed to analyze each sample, plus 10 % of the original volumes obtained
for each reagent (see Note 5).
2. Dispense 10.55 l of the mix into each tube/well of a 96-well
PCR plate.
3. Using a multichannel pipette, for each sample, add 2 l of
diluted PCR product; M1 and M2 diluted products should
be mixed together in a single well; M3 and M4 should be dispensed separately. Only three capillary electrophoresis injections will therefore be needed to analyze the products of the
four multiplex PCRs.
4. Cover the plate with the rubber septa.
5. Denature the sample plate at 95 C for 3 min, and cool it on
ice or ice block for 1 min.
6. Spin down the sample plate to remove any air bubbles.
7. Place the sample plate on a plate base. Snap the plate retainer
(cover) onto the plate and plate base. Place the prepared
96-well plate on the autosampler tray of the capillary electrophoresis equipment.
3.4 Capillary
Electrophoresis
The following steps are adapted for ABI PRISM genetic analyzer
instruments.
1. Power the ABI PRISM genetic analyzer.
2. Run the data collection software.
3. Ensure that consumables (e.g., polymers, buffers) are not
expired and that buffer levels are at the fill lines.
4. Set the oven temperature to 60 C by clicking preheat.
5. Check for and remove any bubbles from the pump assembly.
6. Create a plate record and assign plate contents by entering the
following information:
(a) Sample names: be sure to name the samples in a way that
reflects their order in the 96-well plate.
(b) Assay, set run module parameters as follows: oven temperature (C) 60, run voltage (kV) 8.5, pre-run voltage (kV)
15, injection voltage (kV) 1.6, run time (sec.) 4900, prerun time (sec.) 180, injection time (sec.), and data delay
(sec.) 480.
(c) Assign file name convention to each sample: sample name,
wells, and capillary number.
(d) Results group: create a MLVA_Brucella folder.
7. Save the plate record.
8. Load the plate onto the instrument, access the plate record
created, and link the plate to its plate record.
343
9. Start run (see Note 6).

10. After the capillary electrophoresis, an .fsa file containing the
results will be generated for each sample.
3.5 GeneMapper
Setup
Before starting the first analysis on your .fsa capillary electrophoresis

results, prepare GeneMapper by running it on one or more sample
files of known Brucella reference strains:
1. Create a kit, giving the kit name MLVA Brucella.
2. Create a new bin set with the name Brucella.
3. Create three panels with the names M1M2, M3, and M4.
4. Add the following new markers for the three panels:
(a) M1M2 with Bruce06, Bruce08, Bruce11, Bruce19,
Bruce30, Bruce42, and Bruce45.
(b) M3 with Bruce04, Bruce12, Bruce18, Bruce21, and
Bruce55.
(c) M4 with Bruce07, Bruce09, Bruce16, and Bruce43.
(d) For each marker, enter the following information (displayed
in Table 1): marker name, dye color (6FAM, blue; VIC,
green; NED, yellow; and PET, red), and allele size range
(minimum and maximum sizes).
5. Create a new project and add all the reference sample files
(e.g., Brucella melitensis biovar 1 str. 16 M).
6. Set a new analysis method named Brucella from the
GeneMapper manager. Associate the previously created bin
set. Select advanced from the peak detection algorithm dropdown menu. Select partial range for the analysis range. The
latter step serves to exclude the primer peak from the analysis
range. Under peak quality, set the expected allele number to 1
(for haploid organisms).
7. Set a custom Liz 1200 size standard based on the Liz 1200,
but which includes only the values of the partial range.
8. Analyze the samples.
9. Examine the results.
10. Open panel manager and import the reference file.
11. For each of the three panels (corresponding to M1 + M2, M3,
and M4), select each marker (locus), add bin, and, on the basis
of the observed peak, manually assign it an allelic value
(expected VNTR) using Table 3.
3.6 Data Analysis

Using GeneMapper
1. After the initial creation of kits, setting of analysis methods and

of custom size standard, new samples can be easily analyzed.
2. Open the GeneMapper software.
133 151 169 187
10
553
91
431 439 447 455 463
85
130 138 146 154 162 170 178 186
79
11
887
12
13
15
220
331
134 142 150 158 166 174 182 190 198 206 214 222 230
124 132 140 148 156 164 172 180 188 196 204 212
227 235 243 251 259 267 275 283 291 299 307 315 323
119 127 135 143 151 159 167 175 183 191 199
Bruce07
Bruce09
Bruce16
Bruce30
425
422
1013 1076
14
Bruce04 313 321 329 337 345 353 361 369 377 385 393 401 409 417
Panel 2B
Bruce21
Bruce19
Bruce18
Panel 2A
Bruce55 193 233 273 313 353 393 433
Bruce45
Bruce43 170 182 194
635 698
302 317 332 347 362 377 392 407
Bruce42 164 289 414 539 664 789 914
Bruce12
257 320 383
Bruce11
509
312 330 348 366 384
Bruce08
17
19
20
21
22
23
163 169 175 181 187 193
18
24
337
353
228 236 244 252 260 268 276 284 292
246
433 441 449 457 465 473 481 489
437 452
16
205
25
529
26 27 28
Data pertaining to B. melitensis biovar 1 str. 16 M is underlined and given in bold; the 16 markers can be split into two groups: one comprises 8 minisatellite loci (panel 1), and the second group
contains 8 microsatellite loci (panel 2A and panel 2B). In this approach, the loci are divided into different panels containing increasing levels of genetic resolution: the MLVA-8 (panel 1), MLVA-11
(panels 1 and 2A), and MLVA-16 (panels 1, 2A, and 2B) (for the original source of the table, go to http://mlva.u psud.fr/brucella/IMG/pdf/bru_table_allele_assignement_version3.6.pdf)
Bruce06 312 446 580 714
Panel 1
Allelic
value
Table 3
Expected VNTR sizes per locus of Brucella sequences currently known and correspondent allelic valuea
345
Table 4
VNTR size by locus
Locus
VNTR size (bp)
Bruce06
134
Bruce08
18
Bruce11
63
Bruce12
15
Bruce42
125
Bruce43
12
Bruce45
18
Bruce55
40
Bruce18
Bruce19
Bruce21
Bruce04
Bruce07
Bruce09
Bruce16
Bruce30
3. Import the electrophoresis .fsa files into a new project. Select

the previously created analysis method Brucella and the
panels corresponding to the M1 + M2, M3, and M4 reactions
(see Subheading 3.5).
4. Analyze the project.
5. Review the sizing quality (SQ).
6. Examine the size standard.
7. View sample information (including raw data).
8. View sample plots.
9. For each marker, check all allele calls against those of the reference strain or strains. Wherever the allele call of the analyzed
strain differs from those of your known reference strains, add
the new allele to the bin. Putative new alleles will be identified
where, in any given locus, the DNA fragment is found to be
shorter or longer than expected in light of the VNTR size for
that locus and the number of repetitions known to occur in the
reference strain or strains (see Table 4).
346
Giuliano Garofolo
10. Confirm new alleles, whenever possible, through Sanger

sequencing.
11. GeneMapper will store all observed and confirmed bins present in the population studied. This information will be used as
reference for future analyses.
12. In the GeneMapper, genotype page results are grouped by
panel. Export the genotype table of each panel in a .csv file and
then merge them together in a single .csv file.
13. Import the data, e.g., into Microsoft Access or Microsoft
Excel, and arrange it by loci in the following order: Bruce06,
Bruce09, Bruce16, and Bruce30.
3.7
Cluster Analysis
1. Go to the Brucella cooperative database (http://mlva.u-psud.

fr/mlvav4/genotyping/) using either a Mozilla Firefox or
Microsoft Internet Explorer browser (see Note 7).
2. For each one of tested isolates, submit a query that will compare
it to the strains present in the database. From the menu, select
the Brucella cooperative database, then select the MLVA-16
panel, enter the numeric code for each MLVA marker, and
submit the data (for further information, consult the tutorial:
http://mlva.u-psud.fr/MLVAnet/IMG/pdf/MlvaBank_
tutorial.pdf). The Brucella MLVA data efficiently cluster the
strains by species. The minimum distance between the isolate
submitted and strains previously deposited in the database will
determine its species (see Notes 8 and 9).
Notes
1. The preparation of primer mix solutions should be performed
in a DNA-free room. Thaw primer stock solutions and place
on ice until use. Avoid the exposure of primers to light. In the
absence of amber-colored tubes, use aluminum foil to cover
the vials.
2. To minimize repetitive freeze-thaw cycles of primer stock solutions, prepare 10 batches of 10 primer mixes (volume 110 l)
every couple of months or if a drop in fluorescence is observed
in your old batch. This amount should be sufficient for 1000
PCRs, allowing MLVA on 200250 strains.
3. Other capillary electrophoresis machines may be used, but it is
recommended that fragment analysis be set to 1401,100 bp
and the proper reagents be used, as suggested by the
manufacturer.
347
4. In the first few runs, verify the dilution factor by running one
column at a time (M1M2, M3, and M4 fragments, respectively). If peak fluorescence intensity does not fall between 400
and 6,000 nm, correct the dilution to optimize your electrophoresis. Further PCRs will generate a similar pattern of fluorescence for all samples, provided that equal amounts of
purified DNAs are used.
5. For example, for a total of 32 DNA samples: 1082.4 l of
formamide [10.25 l 3 injections 32 (=984 l) + 10 % of this
volume (=98.4 l)] and 31.6 l of Liz 1,200 size standard
[0.3 l 3 injections 32 (=28.8 l) + 10 % of this volume
(=2.8 l)].
6. Each injection takes about 1.5 h. The analysis of a single plate
involves 12 injections and will thus take about 17 h.
7. A cooperative public online database, based on the MLVA-16
panel, was established with the aim of promoting the creation
of a global epidemiological map of Brucella and is freely accessible at http://mlva.u-psud.fr/brucella/.
8. MLVA genotypes are considered to be closely related if they
share 70 % or more of their VNTR alleles. For MLVA-16,
strains having between 11 and 16 alleles in common are said to
belong to the same species.
9. Further analysis may be recommended. Both free (e.g., Phyloviz
1.0) and paid (e.g., PAUP 4.0, Bionumerics) software are available for this purpose. UPGMA, neighbor-joining analyses, and
minimum spanning trees can be generated to assess fine and
broad relationships between the strains analyzed.
References
1. Pappas G (2010) The changing Brucella ecology: novel reservoirs, new threats. Int J
Antimicrob Agents 36:S8S11
2. Whatmore AM (2009) Current understanding
of the genetic diversity of Brucella, an expanding
genus of zoonotic pathogens. Infect Genet Evol
9:11681184
3. Al Dahouk S, Flche PL, Nckler K et al (2007)
Evaluation of Brucella MLVA typing for human
brucellosis. J Microbiol Methods 69:137145
4. Whatmore AM, Shankster SJ, Perrett LL et al
(2006) Identification and characterization of variable-number tandem-repeat markers for typing of
Brucella spp. J Clin Microbiol 44:19821993
5. Bricker BJ, Ewalt DR, Halling SM (2003)

Brucella HOOF-Prints: strain typing by multilocus analysis of variable number tandem repeats
(VNTRs). BMC Microbiol 3:15
6. Garofolo G, Ancora M, Di Giannatale E (2013)
MLVA-16 loci panel on Brucella spp. using multiplex
PCR
and
multicolor
capillary
electrophoresis. J Microbiol Methods 92:
103107
7. Garofolo G, Di Giannatale E, De Massis F
et al (2013) Investigating genetic diversity of
Brucella abortus and Brucella melitensis in
Italy with MLVA-16. Infect Genet Evol 19:
5970
Chapter 25
Multilocus Sequence Typing (MLST): Markers
for the Traceability of Pathogenic Leptospira Strains
Ahmed Ahmed, Ana S. Ferreira, and Rudy A. Hartskeerl
Abstract
Leptospirosis is a major zoonosis with worldwide distribution. Conventional serological typing is arduous
and time consuming. Genotyping is increasingly applied for the typing and identification of leptospires and
contributes to genetic and virulence divergence and molecular epidemiological characteristics such as host
versus leptospires population interactions and dynamics. Presently, multilocus sequence typing (MLST) is
the most robust approach. In this chapter, we describe the practical steps of two major multilocus sequence
typing methods for leptospires. The first method (denoted as the 6 L scheme) is based on genotyping by
phylogeny using concatenated sequences derived from six loci, including genes that encode outer membrane proteins and rrs and can be used for typing pathogenic species and strains of intermediate species.
The second method (referred to as the 7 L scheme) uses seven loci on housekeeping genes and allows the
analysis of seven major Leptospira pathogenic species. The 7 L scheme is web based and includes the option
to analyze sequence types (STs).
Key words Leptospira, Leptospirosis, Genotyping, MLST, Multilocus typing
Introduction
Leptospirosis is a hemorrhagic zoonotic disease with a worldwide
distribution presenting a major burden for the veterinary and public health. Leptospires, the causative agents, are long (620 m)
and thin (0.10.2 m) helically coiled gram-negative bacteria with
typically hooked ends from which each of the two endoflagella is
extruding. These bacteria belong to the family Leptospiraceae and
to the genus Leptospira. There are free-living saprophytic and
pathogenic leptospires, the latter requiring a host for survival.
Traditionally, saprophytic and pathogenic leptospires have been
denoted as Leptospira biflexa and Leptospira interrogans, respectively. There is a wide variety of sero- and genotypes of leptospires,
which are generally associated with a certain host. Hence, the availability of effective tools to identify infecting leptospires is of utmost
importance in both animal and human health fields, not only for
349
350
Ahmed Ahmed et al.
the diagnosis of the disease but also for assessing its epidemiology
and defining intervention strategies.
Traditionally, the serovar is the basic taxon of leptospires.
The serovar is a serological entity determined by the cross agglutinin absorption test (CAAT). To date more than 300 serovars, both
saprophytic and pathogenic, have been identified, separated into 26
serogroups on the basis of similarity in serological features. Since
the 1990s, speciation of leptospires based on genomic DNA homology has been introduced. This technique, involving heterologous
DNA hybridization, allows the speciation of members of Leptospira
based on the established criterion that >70 % homology under
defined stringency conditions corresponds to conspecificity. The
method is laborious and tedious, and presently it is only executed
at the Centers for Disease Control and Prevention (CDC), Atlanta,
USA. Currently, molecular approaches have identified 21 Leptospira
species, consisting of three clades comprising nine pathogenic, five
intermediate, and seven saprophytic species. The molecular and
serological classification of leptospires show little correlation.
In the past years, numerous restriction enzyme-generated or
PCR-based DNA fingerprinting methods have been described.
Among others, pulsed-field gel electrophoresis (PFGE), bacterial
endonuclease DNA analysis (BRENDA), and arbitrarily primed
PCR (AP-PCR) have been explored to genotype leptospires and,
eventually, to achieve molecular speciation, but these methods usually yield complex patterns and lack the ability to directly generate
digital data, show low reproducibility, and/or require cultures of
viable leptospires. Considering the increasing complexity and associated costs for the international shipment of pathogens, there is a
need for typing methods that generate electronically portable data
and online databases that can be easily accessed for data insertion
and comparison.
Phylogeny-based genotyping has been described for leptospires using sequences of several genes such as rrs (16S ribosomal
RNA), secY (translocase preprotein secY), gyrB (DNA gyrase subunit B), flaB (flagellar protein B), and rpoB (RNA polymerase
beta-subunit), some of these presenting a high discriminative
power. However, horizontal DNA transfer has been described for
Leptospira, and thus limitation to one locus holds the risk of misclassification. Therefore, the use of multiple loci for the genotyping of Leptospira is imperative. Multilocus sequence genotyping is
one of such methods and currently the most robust one. The first
Leptospira multilocus sequence genotyping system has been developed in the early 2000s [1] and was hampered at that time by a
scarcity of available working sequences from public databases. This
scheme uses six loci (6 L), including the rrs gene and two genes,
lipL32 and lipL41, coding for outer membrane proteins. This 6 L
scheme for leptospires was followed by additional MLST
approaches using seven loci (7 L) [24], while a theoretical
Multilocus Sequence Typing of Leptospires
351
genotyping scheme based on a super locus comprising four genes

was described without information on its practical applicability.
The 6 L scheme has the advantage that it can be applied on all
pathogenic species of Leptospira and seems to enable inclusion of
strains of intermediate species. The method uses phylogeny-based
approaches on concatenated gene sequences but does not include
analysis via sequence types (STs). The other 7 L MLST schemes
were originally described for application with L. interrogans and,
to some extent, the closely related species L. kirschneri [2, 3]. One
of these schemes was further expanded for the genotyping of additional pathogenic species, namely, L. borgpetersenii, L. noguchii, L.
santarosai, L. weilii, and L. alexanderi [4], and has the advantage
that it is web based and includes analysis of STs [2, 4]. Since the
availability of gene sequence data from intermediate and saprophytic Leptospira species in public databases is limited, both the
7 L and 6 L MLST schemes currently present constraints when
analyzing such species. However, a variety of Leptospira genomes
are being presently sequenced, which will allow the design of novel
and more universal primers and the setting of an improved MLST
scheme comprising all Leptospira clades. A comparison of the 7 L
and 6 L MLST schemes showed that both approaches mostly
yielded comparable results [5]. It was also demonstrated that the
outer membrane encoding genes included in the 6 L scheme did
not suffer from unequal evolutionary pressure [5].
This chapter describes the practical application of both the 6 L
[1, 5] and the expanded 7 L [4] MLST approaches for the genotyping of pathogenic leptospires.
Materials
2.1 DNA Extraction

from Cultures
1. 1.01.5 ml of fresh fully grown (i.e., approximate optical

density at 420 nm is 0.35) purified cultures of the Leptospira
isolates to genotype, usually in Ellinghausen-McCulloughJohnson-Harris (EMJH) liquid media.
2. Commercial kit for genomic DNA extraction from microbial
cultures.
3. Negative (specimen without leptospires) and positive (specimen
spiked with 104 leptospires/ml) extraction control.
4. Support equipment: centrifuge; thermostatized water bath or
heating block (usually adjusted to 56 C for DNA extraction).
2.2 Multilocus
Sequence Typing
(6 L and 7 L Schemes)
1. Primer sets for the 6 L (Table 1) [1, 5] and 7 L (Table 2) [4]

MLST schemes (see Notes 1 and 2).
2. Reagents for conventional PCR reactions: DNA polymerase
enzyme and respective 10 buffer, MgCl2 (25 mM), dNTPs
(25 mM), and distilled PCR grade water.
ATCTCCGTTGCACTCTTTGC
ACCATCATCATCATCGTCCA
LipL32R
CCGTCCCTTAATTTTAGACTTCTTC
(alternative: CCTTCCTTTAATTTTAGACTTTTTC)f
secYR
LipL32F
ATGCCGATCATTTTTGCTTC
AGTTGAGCCCGCAGTTTTC
rrsR
secYF
CATGCAAGTCAAGCGGAGTA
GCATCGAGAGGAATTAACATCA
LipL41R
rrsF
TAGGAAATTGCGCAGCTACA
LipL41F
TTTTTTGAGATCCGCAGCTTT
(alternative: CTTTTTTGAGATCTCCGGCTTT)f
icdAR
1.5
1.5
1.5
1.5
1.5
1.5
MgCl2
(mM)c
474
548
549
541
520
674
674
531
557
Size of PCR
product (bp)
1667072166641
34594023458902
18625351862984
36036443604120
39809263980372
34587893458361
Location of the
sequence used to
define MLST locusd, e
432
501
450
477
555
429
Size of MLST
locus (bp)d
When using these alternative primers, the annealing temperature should be adjusted to 54 C in the PCR cycling conditions
adk (adenylate kinase), icdA (isocitrate dehydrogenase), lipL41 (outer membrane lipoprotein LipL41), rrs (16S rRNA), secY (preprotein translocase SecY protein), and lipL32
(outer membrane lipoprotein LipL32)
b
Original primers according to Ahmed et al. [1] and additional alternative primers for some loci according to Ahmed et al. [5]
c
Concentration of MgCl2 in the PCR mixture as adjusted for each primer pair
d
The location of the sequence used to define MLST locus and the size of MLST locus (bp) as modified in Ahmed et al. [5]
e
Nucleotide positions based in the published genome sequence of L. interrogans serovar Copenhageni strain Fiocruz L1-130 chromosome I (GenBank Accession Number
AE016823)
lipL32
secY
rrs
lipL41
GGGACGAGATGACCAGGAT
icdAF
ACGCAAGCTCCTTTTGAATC
(alternative: TTACACAAGCTCCCTTTGAAT)f
adkR
icdA
GGGCTGGAAAAGGTACACAA
(alternative: ACATTATCTTCATGGGACCTCC)f
adkF
adk
Sequence (5 to 3)b
Primer
Locus/
genea
Table 1
Loci and respective flanking oligonucleotide primers for the Leptospira 6 L MLST scheme
352
Ahmed Ahmed et al.
CAACTTGCGGAYATAGGAGGAG
ATTATGTTCCCCGTGAYTCG
caiB-R
TCCRTAACTCATAAAMGACAAAGG
mreA-RM
caiB-F
GGCTCGCTCTYGACGGAAA
AGAACACCCGCCGCAAAACAAT
pfkB-RM
mreA-FM
CGGAGAGTTTTATAARAAGGACAT
GTTTTACRGAACCHCCGTAGAGAAT
tpiA-RM
pfkB-FM
TTGCAGGAAACTGGAAAATGAAT
TCTTTTTTGAATTTTTGACG
sucA-RM
tpiA-FM
TCATTCCACTTYTAGATACGAT
sucA-FM
AAGAAGCAAGATCCACAAYTAC
pntA-RM
1.5
2.0
1.5
3.5
2.5
1.5
1.5
MgCl2
(mM)c
650
719
588
639
640
621
650
Size of PCR
product (bp)
15628451563246
27345502734116
13865531386984
16946731694248
12274741227920
5634756871
37849553784512
Location
of MLST locusd
402
435
432
426
447
525
444
Size of MLST
locus (bp)
Nucleotide positions based in the published genome sequence of L. interrogans serovar Lai strain 56601 chromosome I (GenBank Accession Number NC004342)
glmU (UDP-N-acetylglucosamine pyrophosphorylase), pntA (NADP transhydrogenase subunit alpha), sucA (2-oxoglutarate dehydrogenase decarboxylase component), tpiA
(triosephosphate isomerase), pfkB (ribokinase), mreA (rod-shape-determining protein rodA), and caiB (carnitine dehydratase)
b
Primers according to Boonsilp et al. [4]
c
Concentration of MgCl2 in the PCR mixture as adjusted for each primer pair
caiB
mreA
pfkB
tpiA
sucA
TAGGAAARATGAAACCRGGAAC
pntA-FM
AGTTTTTTTCCGGAGTTTCT
glmU-RM
pntA
AGGATAAGGTCGCTGTGGTA
glmU-FM
glmU
Sequence (5 to 3)b
Primer
Locus/
genea
Table 2
Loci and respective flanking oligonucleotide primers for the Leptospira 7 L MLST scheme

353
354
Ahmed Ahmed et al.
3. Negative (sample without added DNA from leptospires) and

positive (sample spiked with leptospiral DNA approximating
20 ng genomic DNA per reaction) PCR reaction controls.
4. PCR thermocycler.
5. Tris-borate EDTA (TBE) buffer (pH 8.0): 50 mM Tris,
50 mM boric acid, 0.5 mM EDTA.
6. 1.5 % (w/v) agarose gel stained with ethidium bromide: prepare a 1.5 % agarose gel by adding 1.5 g of agarose to 100 mL
of TBE buffer. Heat in a microwave and boil for 12 min to
melt the agarose. Leave it to cool for 35 min, add 0.5 L of
a 10 mg/mL stock solution of ethidium bromide, gently mix,
and pour the melted gel in the electrophoresis tray with the
respective combs.
7. 6 DNA loading dye (blue) containing 0.25 % (W/V) of bromophenol blue, 0.25 % (W/V) of xylene cyanol FF, 40 %
(W/V) of sucrose, and 60 mM of EDTA (or orange dye consisting of 0.4 % of orange G, 40 % (W/V) of sucrose) and
deionized/milli-Q water.
8. Electrophoresis apparatus and respective power source.
9. Ultraviolet light transilluminator.
10. Sequencing facilities or commercial sequencing services.
11. Informatics programs for nucleic acid sequence processing,
alignment, and phylogenetic analysis. We are using SeqMan
software (DNASTAR Inc., USA), Chromas Lite (Technelysium
Pty Ltd, Australia), Clustal X multiple sequence alignment
program [6], Molecular Evolutionary Genetics Analysis
(MEGA) [7], and PhyML version 3.0.1 [8].
Methods
3.1 6 L MLST
Scheme
1. Leptospiral genomic DNA is extracted from cultures as per the

manufacturers commercial kit.
2. Six conventional PCR reactions are performed for each leptospiral isolate, each one containing a pair of forward and
reverse primers targeting different loci (according to Table 1)
(see Note 1). The total volume of each reaction is 25 l and
contains 1.5 mM MgCl2 (see Table 1), 200 M dNTPs, 1.25 U
of DNA polymerase and the respective 1 buffer, 5 pmol of
each forward and reverse primers (see Table 1), and approximately 2550 ng of Leptospira DNA (see Note 3).
3. Run the PCR mixtures with the following program in the
thermocycler: one cycle of 95 C for 5 min; 35 cycles of 94 C
for 30 s, 58 C (or 54 C for alternative primers, see Table 1)
for 30 s, and 72 C for 1 min; and a final extension step of
72 C for 7 min (see Note 4).
355
4. Run the PCR products in a 1.5 % agarose gel stained with

ethidium bromide using standard gel electrophoresis technique (see Notes 5 and 6).
5. Sequence the PCR products, corresponding to each amplified target locus, for both forward and reverse directions
using sequencing in-house facilities or commercial services
(see Note 7).
6. After obtaining the nucleotide sequences of all the six loci to
be analyzed per Leptospira isolate, edit the sequences and trim
the same to the correct length spanning each locus, according to the reference lengths and nucleotide positions displayed
in Table 1, using appropriate software (e.g., Chromas Lite)
7. Use appropriate software for the nucleotide sequence analysis
(e.g., MEGA), namely, for performing sequence alignments,
identifying the polymorphic sites, and the construction of
neighbor-joining phylogenetic trees using the concatenated
sequences of the six MLST loci (mean pairwise distances are
calculated using the Kimura two-parameter nucleotide substitution model) according to the order adk-icdA-lipL32-lipL41rrs2-secY (see Notes 10 and 11).
8. Construct the likelihood tree from concatenated sequences of
MLST loci using an algorithm implemented in PhyML version
3.0.1 (see Notes 10 and 11).
3.2 7 L MLST
Scheme
1. Leptospiral genomic DNA is extracted from cultures as per the

manufacturers commercial kit.
2. Seven conventional PCR reactions are performed for each leptospiral isolate, each one containing a pair of forward and
reverse primers targeting different loci (according to Table 2)
(see Note 2). The total volume of each reaction is 25 l and
contains 1.53.5 mM MgCl2 (adjusted for each primer pair
according to Table 2), 200 M dNTPs, 1.25 U of DNA polymerase and the respective 1 buffer, 5 pmol of each forward
and reverse primers (see Table 2), and approximately 2550 ng
of Leptospira DNA (see Note 3).
3. Run the PCR mixtures with the following program in the
thermocycler: one cycle of 95 C for 2 min, 30 cycles of 95 C
for 10 s, 46 C for 15 s, and 72 C for 1 min and final extension step of 72 C for 7 min (see Note 4).
4. Run the PCR products in a 1.5 % agarose gel stained with
ethidium bromide using standard gel electrophoresis technique (see Notes 5 and 6).
5. Sequence the PCR products, corresponding to each amplified target locus, for both forward and reverse directions
using sequencing in-house facilities or commercial services
(see Note 7).
356
Ahmed Ahmed et al.
6. After obtaining the nucleotide sequences of all the seven loci

to be analyzed per Leptospira isolate, edit the sequences and
trim the same to the correct length spanning each locus,
according to the reference lengths and nucleotide positions
displayed in Table 2, using appropriate software (e.g., SeqMan
or Chromas Lite) (see Notes 8 and 9).
7. To assign allele numbers and sequence types (STs), access the
Leptospira MLST database webpage at http://leptospira.mlst.
net [2, 4] and use the online software provided for the analysis. Select the Multiple Locus and allelic profile query option,
copy the seven trimmed sequences from each isolate into the
corresponding query boxes, and submit the search analysis.
The allelic profiles of the submitted sequence data will be
obtained as well as details of any Leptospira isolates presenting identical profiles to the one that has been submitted
(see Notes 1215).
Notes
1. The 6 L MLST scheme was originally developed by Ahmed
et al. [1], for genotyping a broad range of pathogenic leptospires. This scheme does not conform to the original concept
of MLST as it includes a non-housekeeping gene (rrs) and
genes that encode cell surface proteins (LipL32 and LipL41).
Later, in 2011, Ahmed et al. [5] designed four additional
alternative primers for use with the 6 L scheme (see Table 1).
These primers should be used in a repeat PCR reaction in the
event that the original primers fail to generate an amplicon.
2. The 7 L MLST scheme was originally described by
Thaipadungpanit et al. [2], in 2007, primarily for genotyping
isolates of L. interrogans. The scheme followed a conventional
strategy for MLST by selecting seven housekeeping genes that
were distributed around the genome and were not under positive selection. However, the primers used for this scheme
worked variably for other leptospiral species. This scheme was
recently further expanded by Boonsilp et al. [4], by updating
primers sequences and replacing one of the analyzed locus.
Therefore, as presented in this chapter, the modified 7 L
MLST scheme can be used to genotype the seven pathogenic
species of Leptospira linked to the overwhelming majority of
disease: L. interrogans, L. kirschneri, L. borgpetersenii, L. noguchii, L. santarosai, L. weilii, and L. alexanderi.
3. Defrost the components needed for preparing the PCR mixtures at room temperature but maintain the DNA polymerase
at 20 C (or in ice) and add it to the mixtures in the last.
Prepare the required master PCR mixtures (one for each
357
primer pair targeting distinct loci) containing all components,

with the exception of the template DNA, taking into account
the total number of reactions to perform and including both
positive and negative controls. Distribute the required amount
of reaction mixtures by individual microtubes, add the respective DNA template, and proceed for the cycling temperature
steps in the thermocycler (can also keep the PCR mixtures at
4 C if not using immediately). To monitor eventual crosscontaminations, the negative control should be also added in
the DNA addition room.
4. Ideally, PCR conditions should be the same for all loci in a
MLST scheme. To accomplish this, primers should be designed
in order to have comparable melting temperatures and yield
amplified DNA fragments of similar lengths.
5. Standard agarose gel electrophoresis can be employed to check
that the amplification reactions have been successful and that
amplicons of the expected size have been produced. However,
when the MLST scheme is fully developed and routinely applied
on a large scale, only occasional verification will be necessary.
6. The same primers are used for both the PCR amplification and
sequencing reactions. Therefore, it is important that only a
single DNA fragment be amplified. The PCR conditions may
need to be optimized if more than one fragment is observed in
an electrophoresis control gel.
7. Sequence information from both forward and reverse DNA
strands of an amplified PCR product should be obtained and
used to compile the final accurate consensus sequence.
Discrepancies between the forward- and reverse-strand
sequences should be resolved by referring to the original electrophoretograms. Only sequencing chromatograms of good
quality are acceptable for MLST. The sequencing reactions are
easily performed with commercial kits that contain all of the
necessary components. A variety of commercial instruments is
available for the sequencing of the PCR products. In most
cases, they are capillary based and generally operated by inhouse central sequencing facilities. Commercial companies
also offer sequencing services.
8. Although the exact start and stop positions are defined for
each locus (Tables 1 and 2), it may be useful to import a known
allele for each locus to make trimming easier by comparison
9. Eventually, although it seems to be a rare event, some leptospires may present nonstandard length alleles for some loci.
For example, Boonsilp et al. detected two L. borgpetersenii isolates with a 78 bp deletion in caiB locus [4]. Also, Ahmed
et al. detected two L. interrogans isolates with a deletion of
three nucleotides in the lipL32 sequence [5].
358
Ahmed Ahmed et al.
10. The 6 L MLST scheme is not associated with a public database

and website, and therefore the comparative phylogenetic analysis of novel sequences using this scheme requires the download and storage of related sequences from public databases
(e.g., NCBI-GenBank) and its offline analysis using dedicated
software. Nevertheless, an increasing number of sequences are
available for analysis, while an ongoing genome sequencing
project will provide additional loci from virtually all serovars.
For example, Nalam et al. [9] made available the 6 L loci
sequences for a global collection of 271 isolates obtained from
a diverse array of hosts and geographic regions.
11. In addition to genotyping of leptospiral isolates, both the 6 L
and 7 L MLST scheme can be used to assign genetic species to
the same isolates. Isolates of a same pathogenic Leptospira species clustered together in the phylogenetic analysis of concatenated loci sequences.
12. A website supporting the sequence analysis of the 7 L MSLT
scheme was launched at the time of publication, http://leptospira.mlst.net, which is regularly maintained and updated [2,
4]. Representative isolates of each ST are recorded in a downloadable spreadsheet. This is an easy-to-use online resource,
providing tools for comparison of a given strain with all of the
other strains in the database. On completion of the 7 L MLST
scheme for an isolate, and after submission of the data to the
supporting website (http://leptospira.mlst.net), the result is
the assignment of an ST to that isolate (e.g., ST50) that is
underlain by the allelic profile for the seven loci (i.e., 6, 8, 2,
2, 9, 7, 5 for ST50) (the order of the loci is glmU-pntA-sucAtpiA-pfkB-mreA-caiB). If the allele sequence is novel, all
sequences should be checked against the closest alleles in the
database, and, if necessary, the original data should be
rechecked. If the new allele is confirmed, the novel information should be submitted to the curator for updating the
database.
13. The utility of the 7 L MLST scheme, based in ST analysis, was
recently demonstrated by providing confirmatory evidence for
the role of rodents as major maintenance hosts for L. interrogans and bovines as major maintenance hosts for L.
borgpetersenii and L. weilii and was able to identify relatedness
between STs in specific geographic regions [4].
14. Leptospires belonging to the same serovar may present unrelated STs, meaning that serovar is a very limited indicator of
genetic relatedness. Serovars can vary within a given clone or
lineage, which may be most likely due to horizontal gene
transfer of genes encoding the surface determinants that confer serovar designation [4].
359
15. Although the ST assignment to isolates is useful for genotyping,

relationships between different STs are not immediately apparent from these notations. One option for showing relationships
between STs is to construct phylogenetic trees that show the
relationships between isolates. For this, the allele sequences for
all seven loci of each strain are compiled in a series, and the
resulting concatamers are then compared pairwise and analyzed
with appropriate sequence analysis software and algorithms.
References
1. Ahmed N, Devi SM, Valverde Mde L et al
(2006) Multilocus sequence typing method for
identification and genotypic classification of
pathogenic Leptospira species. Ann Clin
Microbiol Antimicrob 5:28
2. Thaipadungpanit J, Wuthiekanun V, Chierakul
W et al (2007) A dominant clone of Leptospira
interrogans associated with an outbreak of
human leptospirosis in Thailand. PLoS Negl
Trop Dis 1:e56
3. Leon A, Pronost S, Fortier G et al (2010)
Multilocus sequence analysis for typing
Leptospira interrogans and Leptospira kirschneri.
4. Boonsilp S, Thaipadungpanit J, Amornchai P
et al (2013) A single multilocus sequence typing
(MLST) scheme for seven pathogenic Leptospira
species. PLoS Negl Trop Dis 7:e1954
5. Ahmed A, Thaipadungpanit J, Boonsilp S
et al (2011) Comparison of two multilocus
6.
7.
8.
9.
sequence based genotyping schemes for

Leptospira species. PLoS Negl Trop Dis
5:e1374
Jeanmougin F, Thompson JD, Gouy M et al
(1998) Multiple sequence alignment with
Clustal X. Trends Biochem Sci 23:403405
Tamura K, Peterson D, Peterson N et al (2011)
MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary
distance, and maximum parsimony methods.
Mol Biol Evol 28:27312739
Guindon S, Gascuel O (2003) A simple, fast,
and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol
52:696704
Nalam K, Ahmed A, Devi SM et al (2010)
Genetic affinities within a large global collection of pathogenic Leptospira: Implications for
strain identification and molecular epidemiology. PLoS One 5:e12637
Chapter 26
Single-Nucleotide Polymorphism Discrimination
Using High-Resolution Melting Analysis
for the Genotyping of Bacillus anthracis
Sylviane Derzelle
Abstract
High-resolution melting (HRM) is a post-PCR technique that determines with high precision the melt
profile of PCR products using a new generation of double-stranded DNA-binding dyes and accurate fluorescence data acquisition over small temperature increments. The method can be used to interrogate small
sets of single-nucleotide polymorphisms (SNPs). Here, we describe a simple and cost-effective HRMbased method for the screening of 14 phylogenetically informative SNPs within the genome of Bacillus
anthracis that subtype the species into 13 major sublineages or subgroups. Fourteen monoplex and seven
duplex SNP-discrimination assays have been designed. We detail the parameters most important for the
successful application of HRM for B. anthracis genotyping.
Key words High-resolution melting (HRM), Single-nucleotide polymorphism (SNP), Genotyping,
Phylogeny, Discrimination, Diversity, Bacillus anthracis
Introduction
Bacillus anthracis, the etiological agent of anthrax, is a sporeforming, Gram-positive bacterium belonging to the B. cereus
group. Although all mammals are known to be susceptible to
anthrax, the bacterium primarily affects wild and domesticated herbivores, causing acute, often fatal disease. Transmission to animals
typically occurs through the gastrointestinal tract. Ruminants
become infected by ingestion of soil-borne spores while browsing
or grazing [1]. Anthrax has been one of the infectious diseases with
major mortality among livestock for centuries. It is nowadays considered as a sporadic disease in much of Western Europe, Northern
America, and Australia, but anthrax remains endemic in many
countries and particularly in Africa [24].
B. anthracis is a monomorphic pathogen with extremely low
genetic variability [5, 6]. Due to this lack of diversity, only modern
molecular characterization techniques with high discrimination
361
362
Sylviane Derzelle
power such as multiple-locus variable-number tandem repeat

analysis (MLVA) and genome-wide single-nucleotide polymorphism (SNP) analyses are effective to differentiate strains. SNPs
are evolutionarily stable markers that make them valuable for
broadly defining major phylogenetic divisions [7]. The analysis of
a set of 14 diagnostic SNPs (termed canonical SNPs or canSNPs)
is currently used to classify B. anthracis into three lineages (A, B,
and C) and 13 distinct sublineages or groups (e.g., C.Br.A1055,
B.Br.001/002, B.Br.KrugerB, B.Br.CNEVA, A.Br.001/002,
A.Br.Ames, A.Br.Australia94, A.Br.003/004, A.Br.Vollum, A.Br.
005/006, A.Br.Western North America, and A.Br.008/009 that
can be further subdivided into A.Br.008/011 and A.Br.011/009
subgroups) (Fig. 1) [8, 9].
Cost is an important issue for all diagnostic assays. In this
respect, high-resolution DNA melting analysis (HRM) has become
an attractive real-time technology. HRM techniques can determine
with high precision the melt profile of PCR products using a new
generation of double-stranded DNA-binding dyes and accurate
fluorescence data acquisition over small temperature increments
(commonly in 0.2 C increments) [10]. HRM is an ideal format for
scoring a small number of SNPs, with minimal cost and time
requirements for new assay development. Two standard primers
are used to amplify short segments flanking each SNP. The melt
profile of the resulting amplicon is characteristic of its GC content
in which a substitution of a G or C to an A or T reduces the melting
temperature (Tm), while a substitution of an A or T to a G or C
increases the Tm. The turnaround time for a run and the follow-on
data analysis requires less than 2 h. Based on its simplicity, low cost,
nondestructive nature, high sensitivity, and specificity, the popularity
of HRM analysis has grown considerably in the last few years.
B - lineage
B.Br CNEVA
B.Br 001/002
A - lineage
B.BrKruger
A.Br 005/006
A.Br 003/004
A.Br Vollum
A.Br Aust94
A.Br 001/002
A.Br Ames
A.Br 008/011
A.Br 011/009
A.Br 008/009
A.Br WNA
C - lineage
C.Br A1055
Fig. 1 Phylogeny of the major groups (in bold) and sublineages (marked by stars)
of B. anthracis (modified from [8] and [9])
HRM-Based SNP-Interrogation Method
363
HRM is superior in terms of cost-effectiveness, ease of use, and

speed of development compared to alternative SNP-interrogation
approaches on real-time technologies, i.e., dual-probe TaqMan
PCR assays [1113] and mismatch amplification mutation assays
(MAMA) [14, 15]. TaqMan-minor groove-binding allelic discrimination assays can be cost-prohibitive in studies interested only in
small-scale SNP screening, requiring two sequence-specific fluorescently labeled probes. Based on allele-specific (AS) primers,
MAMA is another cheap technique. The labeling of AS-forward
primers with distinct GC-clamp enables facile differentiation of
AS-PCR products through melt curve analysis (Melt-MAMA)
[14], agarose gel electrophoresis [15], or capillary electrophoresis
[16]. However, MAMA traditionally suffers from high rates of
assay design failures and knowledge gaps on assay robustness [15].
Here, we describe 14 monoplex and seven duplex canonical
SNP-based discrimination assays that coupled with HRM analysis
have the potential to differentiate Bacillus anthracis strains into 13
major sublineages or subgroups.
2
2.1
Materials
DNA Preparation
1. Template DNA(s): 510 ng genomic DNA. Use template

DNA suitable for PCR in terms of purity, concentration, and
absence of PCR inhibitors (see Note 1). Use the same amount
of template in each reaction (see Note 2).
2. Control DNA(s): at least one reference strain of known
canSNP genotype has to be used as melt curve standard to
ensure that the correct allele is called (see Note 3).
3. Sterile 0.22 m filter units (optional). DNA suspensions can
be microfiltered on 0.22 m micro-column for 2 min at 6,000
to 10,000 g for removal of any live forms of B. anthracis.
2.2
PCRHRM Mix
1. HRM Master Mix: ready-to-use reaction mixes for PCR

HRM are available from various suppliers (see Note 4). Store
at 15 to 25 C. Keep away from light. Once the kit is
opened, avoid repeated freezing and thawing: the Master Mix
may be stored up to 4 weeks at +2 to +8 C. Commercial kits
usually include 25 mM MgCl2 stock solution and a Master
Mix containing Taq DNA polymerase (see Note 5), reaction
buffer, dNTP (see Note 6), and HRM-compatible saturating
fluorescent dye.
2. PCR-grade H2O: ultrapure water prepared by purifying
deionized water, nuclease-free.
BA2
BA3
BA4
BA5
BA6
BA7
BA8
BA9
BA10
BA11
BA12
BA13
BA14
A.Br.002
A.Br.003
A.Br.004
A.Br.006
A.Br.007
A.Br.008
A.Br.009
B.Br.001
B.Br.002
B.Br.003
B.Br.004
A/B.Br.001
A.Br.011
2552486
3697886
69952
1494269
1056740
1455279
2589823
3947248
266439
162509
3600659
1493157
947760
182106
G to A
A to G
T to C
G to A
G to T
T to C
A to G
T to G
T to C
C to A
T to C
A to G
G to A
T to C
Base
change
CGAATTCCCGCTGAAAATAA
AAAATCGGAATTGAAGCAGGA
ATTCCAATCGCTGCACTCTT
CCCCGATAATTTTCACAAAGC
TGCTTGGGTAACCTTCTTTACTT
AGAATAAAATGAAGATAATGACAAACG
ATTCGCATAGAAGCAGATGAGC
TCAAGTTCATAACGAACCATAACG
GCACCTTCTGTGTTCGTTGTT
TTCACCGAATGGAGGAGAAG
GCACGGTCATAAAAGAAATCG
TGTTCAAAAGGTTCGGATATGA
AATCGGCCACTGTTTTTGAAC
AGGTATATTAACTGCGGATGAT
CCAAACGGTGAAAAAGTTACAAA
GCAACTACGCTATACGTTTTAGATGG
TTACAAGGTGGTAGTATTCGAGCTG
TTGGTAACGAGACGATAAACTGAA
GCGTTTTTAAGTTCATCATACCC
ATGTTGTTGATCATTCCATCG
ATCGCCGTCATACTTTGGAA
GGAATTGGTGGAGCTATGGA
AAAGGAATTTAGATTTTCGTGTCG
ATAAAAACCTCCTTTTTCTACCTCA
GCAGAAGGAGCAAGTAATGTTATAGGT
CCTAAAATCGATAAAGCGACTGC
GTGGTAAGGCAAGCGGAAC
ACGGTTTCCCTTTATCATCG
Forward and reverse primers (5-3)
Localization on the Bacillus anthracis str. Ames Ancestor chromosome (accession no. NC_003997.3)
BA1
A.Br.001
canSNP name
canSNPa
location
Table 1
Set of 14 canonical SNPs and primer sequences
50
59
62
59
68
75
55
80
67
54
53
58
62
76
Size
(bp)
Pair n
1
2
3
3
4
4
5
5
2
1
6
6
7
7
Duplex
concentration
0.2 M
0.15 M
0.2 M
0.15 M
0.2 M
0.2 M
0.2 M
0.25 M
0.2 M
0.15 M
0.2 M
0.3 M
0.2 M
0.2 M
364
Sylviane Derzelle
365
3. Oligonucleotide primers set (see Note 7): 100 M stock

solutions diluted in ultrapure water (see primer sequences
in Table 1). Store at 15 to 25 C. Primer purification by
HPLC is not necessary.
2.3
Equipment
1. A real-time PCR detection system with excellent thermal

control and uniformity is important.
2. HRM-dedicated software capable of performing melt profile
normalization to discriminate the fine melt profile differences
generated from small sequence variations such as SNPs.
3. Standard swing-bucket centrifuge containing a rotor for multiwell plates.
Methods
3.1 Preparation
of DNA Samples
and Biosafety
Procedures
Bacillus anthracis is a class 3 pathogen and should be manipulated

in a BSL3 laboratory. All security rules and hygiene precautions
should be applied during DNA preparation steps (including the
elimination of infectious waste).
Viability testing should be systematically performed to assess
the complete removal of live forms of B. anthracis from DNA samples so that subsequent PCRHRM analysis could be carried out
safely at lower levels of biocontainment (see Note 8).
3.2
HRM primers have been designed to amplify very small amplicons

(5080 bp) around each SNP to maximize the differences in melting temperature the SNP confers (see Note 9).
Assay Design
3.3 Real-Time PCR

Amplification
1. Using monoplex assays:

(a) Prepare 14 distinct PCR reaction mixtures for all samples
(including template and control DNAs). The total PCR
volume is 10 l per reaction (see Note 10).
(b) Mix 0.2 l of both forward and reverse primers (10 M
work solution) (see Note 11), 5 l of Master Mix (2),
1.2 l of MgCl2 (3 mM) (see Note 12), and 2.4 l of ultrapure water.
2. Using duplex assays:
(a) Prepare 7 distinct PCR reaction mixtures for all samples.
(b) Adjust concentration of the two pairs of primers used in
each reaction mix as specified in Table 1 (from 0.15 M to
0.3 M final) in order to amplify the two coupled canSNP
loci with similar efficiency (see Note 13).
3. Aliquot 9 l of each monoplex or duplex reaction mix to wells
and add 1 l of template (or control) DNA.
4. Centrifuge the samples prior to the run to remove air bubbles.
366
Sylviane Derzelle
5. Run the amplification and HRM steps using the following

thermocycling parameters: 95 C for 10 min, followed by 35
cycles consisting of 10 s at 95 C, 10 s at 58 C, and 10 s
at 72 C (see Note 14). After an additional denaturation
(at 95 C for 1 min) and cooling (to 50 C for 1 min) steps,
melt curves are generated by heating from 65 C to 90 C
with fluorescence data acquisition at 0.025 C/s increments
(see Note 15).
The standard workflow to analyze melt curve data and identify
changes in the shape of the curve has four basic steps:
3.4 Melt Curve

Analysis
1. Check for aberrant amplification plots and eliminate negative

samples, i.e., samples with low fluorescence signals or late
amplification that lack a prominent melt curve. Results that do
not satisfy amplification cutoffs are assigned as no data results
(see Note 16).
A.Br.001/002
B.Br.CNEVA
A.Br.005/006
B.Br.CNEVA
A.Br.005/006
Temperature (C)
A.Br.001/002
BA12
B.Br.CNEVA
A.Br.005/006
A.Br.001/002
Difference
post-melt Area
pre-melt Area
p
Fluorescence
Temperature (C)
A.Br.001/002
Temperature (C)
Normalized Fluorescence (%)
Temperature (C)
Difference Plot
Difference
post-melt Area
Fluorescence
pre-melt Area
p
Normalized Melt Curves

Normalized Fluorescence (%)
Raw Melt Curves
B.Br.CNEVA
A.Br.005/006
BA11
Temperature (C)
Temperature (C)
Fig. 2 Representative melt curves and HRM difference plots obtained for three canSNP genotypes (B.Br.CNEVA,
A.Br.005/006, and A.Br.001/002) by HRM using the canSNP B.Br.004 (BA12) singleplex assay (a) or B.Br.003
and B.Br.004 (pair BA11 and BA12) duplex assays (b). Data and plots were produced by the ViiA7 instrument
using the ViiA7 v1.2. HRM software (Life Technologies)
367
2. Normalize the raw melt curve data by setting the pre-melt

(initial fluorescence) and post-melt (final fluorescence) signals
of all samples to uniform values (see Fig. 2). Select manually
areas before and after the melt phase on the dissociation
curves. Pre-melt fluorescence intensities are then automatically set to a relative value of 100 % by the software, while
post-melt signals are set to a relative value of 0 %.
3. Do not perform any temperature (x-axis) shifting to avoid
superimposition of both alleles. A default temp shift threshold
of 5 % to all data is automatically applied by some software.
This threshold can be set manually to a different value (zero)
(see Note 17).
4. A difference plot is automatically generated by the software
to help clustering samples into groups that have similar melt
profiles (see Fig. 2). For each temperature point, the average
value of a reference curve is calculated and subsequently
subtracted from each samples normalized relative fluorescence unit (RFU) value. The curve used as reference can be
modified.
3.5 canSNP
Genotype Assignment
1. The cluster detection settings of HRM software include melt

curve shape sensitivity (see Note 18) and Tm difference
threshold. Adjust empirically the cluster detection settings
so that all samples sharing the same allele are called same
and the remaining ones are denoted as different by the
software.
2. On average, differences in Tm ranging from 0.7 to about 1 C
are observed between the two allelic states (see Table 2). Melt
curves are therefore usually considered the same as the defined
control if the melting temperature is different by less than
0.5 C.
3. Alleles can also be determined as same or different by a difference cutoff in the difference graph relative to the sample of
interest (see Fig. 2). The relative fluorescence unit (RFU) cutoffs in the difference plot have been empirically estimated to
1015 RFU. But variations among runs may be observed.
These variations or errors are sometimes higher than the chosen cutoff for the differential analysis.
4. Use the 14 canSNP profiles (see Table 2) to ultimately classify
samples into their corresponding canSNP sublineage or
subgroup.
5. Any sample with aberrant Tm requires further analysis by
sequencing. Discrepancies between observed and expected
results may suggest unexpected sequence variability at the
canSNP locus.
368
Sylviane Derzelle
Table 2
canSNP signatures defining B. anthracis sublineages and subgroups and representative melting
temperatures (Tm) for each SNP allele obtained by HRM
Mean
Tm (C)
C.Br.A1055
B.Br.KrugerB
B.Br.001/002
B.Br.CNEVA
A.Br.Ames
A.Br.001/002
A.Br.Aust94
A.Br.003/004
A.Br.Vollum
A.Br.005/006
A.Br.008/009
A.Br.008/011
A.Br.011/009
A.Br.WNA
A.Br.001 BA1
75.6 76.4
A.Br.002 BA2
77.5 78.3
A.Br.003 BA3
72.0 72.9
A.Br.004 BA4
76.6 77.6
A.Br.006 BA5
76.4 77.3
A.Br.007 BA6
73.9 74.9
A.Br.008 BA7
75.0 75.9
A.Br.009 BA8
78.3 nd
B.Br.001 BA9
74.6 nd
B.Br.002 BA10 77.1 78.3
B.Br.003 BA11 75.5 76.2
canSNP sublineage
C/G allele
A/T allele
canSNP name
B.Br.004 BA12 72.5 73.4
tT
A/B.
BA13 74.5 nd
Br.001
A.Br.011 BA14 76.0 77.0
canSNPs that define a particular sublineage or subgroup are underlined and the corresponding allele is indicated in
bold. nd: not determined
a
Tm value of 71.5 C (tT) instead of 72.5 C (cT) due to a second SNP (C to T) located 5 to the B.Br.004 canSNP in
strains affiliated to the A.Br.005/006 subgroup
Notes
1. The following points should be considered when preparing
DNA for HRM:
(a) Use ideally the same extraction procedure to prepare all
DNA samples to be analyzed via HRM. This eliminates
any subtle differences that might be introduced by the
reagent components in the final elution buffers.
(b) Quantify all DNA samples and adjust to the same
concentration.
369
(c) Target sample purity with A260/280 and A260/230

ratios in the range of 1.82.2 and 1.62.4, respectively, is
recommended. Poor-quality samples may result in high Ct
values and noisy HRM results.
(d) The EDTA concentration should be minimized in DNA
solution to avoid interference with the activity of some
enzymes used in downstream reactions, particularly when
at high concentration (>0.5 mM). Optimally, DNA should
be in sterile deionized water or 10 mM TrisHCl (pH 8.0)
solution.
2. Standardizing the amount of template DNAs is one means of
minimizing reaction-to-reaction variability. The recommended
amount is 530 nanograms of input template per reaction,
which should produce amplification plots with a threshold or
quantification cycle value of no more than 30 cycles. Products
that amplify late due to limited starting template amount,
template degradation, or PCR inhibition may typically produce variable HRM results due to amplification artifacts.
3. HRM assays involve comparing melt profiles from independent PCR reactions. Although the relative temperature
calibration is extremely accurate, absolute temperature calibration can vary between runs and instruments (by up to 0.5 C).
A reference sample of known genotype is therefore needed for
allele calling in each run.
4. Excellent results have been reported using the LightCycler
480 High-Resolution Melting Master Mix (Roche Diagnostics).
5. Hot-start Taq DNA polymerases are strongly recommended
for HRM applications to improve the specificity and sensitivity
of PCR. It minimizes the formation of nonspecific amplification products at the beginning of the reaction.
6. dNTP mix with dUTP instead of dTTP can be used for prevention of carry-over contamination in PCR in diagnostic laboratories under quality assurance (optional). Pretreatment of
successive PCR mixtures with uracil-DNA glycosylase (UNG)
is suitable to avoid preexisting amplicons in PCR mixture.
UNG cleaves uracil-glycosidic bonds in DNA, creating alkalisensitive abasic sites where a deoxyuridylate residue has been
incorporated. The resulting abasic sites are next hydrolized by
heat treatment during the initial PCR denaturation step and
cannot serve as PCR templates. Briefly, add UNG to the PCR
mix prior to amplification and incubate the reaction mixture for
2 min at 50 C (or 10 min at 40 C) to destroy any contaminating template. The heat-labile UNG is inactivated by performing
the 10 min preincubation step (initial denaturation) at 95 C.
7. Primer pairs have been designed to have annealing temperatures around 60 C and as little self or cross complementarity
as possible (particularly in the 3 end).
370
Sylviane Derzelle
8. Viability testing can be performed by spreading an aliquot of

each DNA preparation on blood agar Petri dish and incubation at 37 C for 1824 h. In case of growth, perform an
additional microfiltration and repeat viability steps.
9. Analyzing short amplicons (50 pb) is preferable since it
increases the statistical confidence in calling particular SNPs
between samples. The SNP should be in the middle of the
amplicon, close to the 3 end of primers.
10. According to the instrument used, PCR can be performed in
reaction volume of less than 10 l to reduce the cost per analysis. However, it is crucial to minimize reaction-to-reaction
variability in HRM assays.
11. Relatively low primer concentrations (less than 300 nM final)
are used in the experimental reactions to minimize primerdimer formation.
12. Salts affect the shape and Tm of melt profiles. It is therefore
important that the amount of Mg2+ in the reaction mix is as
uniform as possible for all samples. The optimal MgCl2 concentration that ensures both the specificity and robustness of the
PCR depends on the dye used. It may vary from 1.5 to
3.5 mM. As a general rule, lower MgCl2 concentration will give
more specific PCR amplification and slightly lower overall Tm.
13. In duplex HRM format, input amplicons concentration must
be normalized to get consistent SNP genotyping data. Primer
concentrations are adjusted so as to yield melting peaks of
equivalent height for both amplicons. Correct automatic
grouping of both alleles by the software is, however, often
problematic and needs empirical adjustments to compensate
for variability in PCR efficiency.
14. A number of 35 cycles are suitable for most assays.
15. The melting pre-hold step (50 C) is optional. It ensures that
all PCR products have reassociated and encourages heteroduplex formation. The melt program should start at least 10 C
before and end at least 10 C after the expected Tm values.
16. Successful HRM analysis is highly dependent on the quality of
the amplicons being compared. Ensure that only target amplicons of interest are being amplified. Examine amplification
data for abnormal amplification curve shapes. A curve with a
jagged log-linear phase or one that reaches a low signal plateau
compared to other reactions can indicate poor amplification or
a fluorescence signal that is too low for analysis. HRM from
such samples can cause low resolution and poor or inconsistent
classification of samples. Discard these samples [17]. Analyzing
real-time PCR amplification data prior to HRM analysis can be
extremely useful when troubleshooting HRM experiments.
371
17. Analyzing the data in temperature-shifted view facilitates

detection of heterozygotes. Heterozygotes are typically
characterized by a change in melt curve shape (y-axis displacement) generated from base-pairing mismatches resulting from
destabilized heteroduplex annealing between some of the
wild-type and variant strands. As bacteria are haploid, only
homozygote templates are analyzed in this method.
Homozygotic SNPs are distinguished by the temperature
(x-axis) shift of their melt curves, which is easier to see in the
normalized data. Both alleles have similar curve shapes but
different Tm.
18. The sensitivity parameter, which influences the stringency with
which melt profiles are classified into different groups, can be
adjusted in some software so that all samples sharing the same
allele are called same and the remaining ones are denoted as
different by the software. A high sensitivity value generally
produces more groups than a low value.
References
1. Turnbull PC (2002) Anthrax history, disease
and ecology. In: Koehler TM (ed) Anthrax, vol
271, Springer-Verlag. Berlin, Germany,
pp 119
2. Hugh-Jones M (1999) 1996-97 Global Anthrax
Report. J Appl Microbiol 87:189191
3. Fasanella A, Galante D, Garofolo G et al
(2010) Anthrax undervalued zoonosis. Vet
4. Derzelle S, Thierry S (2013) Genetic Diversity
of Bacillus anthracis in Europe: Genotyping
Methods in Forensic and Epidemiologic
Investigations. Biosecur Bioterror 11:S166S176
5. Keim P, Gruendike JM, Klevytska AM et al
(2009) The genome and variation of Bacillus
anthracis. Mol Aspects Med 30:397405
6. Keim P, Price LB, Klevytska AM et al (2000)
Multiple-locus variable-number tandem repeat
analysis reveals genetic relationships within
Bacillus anthracis. J Bacteriol 182:29282936
7. Pearson T, Busch JD, Ravel J et al (2004)
Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms
from whole-genome sequencing. Proc Natl
Acad Sci U S A 101:1353613541
8. Van Ert MN, Easterday WR, Huynh LY et al
9. Marston CK, Allen CA, Beaudry J et al (2011)
Molecular epidemiology of anthrax cases associated with recreational use of animal hides and
yarn in the United States. PLoS One 6:e28274
10. Erali M, Voelkerding KV, Wittwer CT (2008)
High resolution melting applications for clinical
laboratory medicine. Exp Mol Pathol 85:5058
11. Hurtle W, Bode E, Kulesh DA et al (2004)

Detection of the Bacillus anthracis gyrA gene
by using a minor groove binder probe. J Clin
Microbiol 42:179185
12. Easterday WR, Van Ert MN, Simonson TS
et al (2005) Use of single nucleotide polymorphisms in the plcR gene for specific identification of Bacillus anthracis. J Clin Microbiol
43:19951997
13. Satterfield BC, Kulesh DA, Norwood DA
et al (2007) Tentacle Probes: differentiation
of difficult single-nucleotide polymorphisms
and deletions by presence or absence of a
signal in real-time PCR. Clin Chem 53:
20422050
14. Easterday WR, Van Ert MN, Zanecki S et al
(2005) Specific detection of Bacillus anthracis
using a TaqMan mismatch amplification mutation assay. Biotechniques 38:731735
15. Birdsell DN, Pearson T, Price EP et al (2012)
Melt analysis of mismatch amplification mutation assays (Melt-MAMA): a functional study
of a cost-effective SNP genotyping assay in
bacterial models. PLoS One 7:e32866
16. Price EP, Matthews MA, Beaudry JA et al
(2010) Cost-effective interrogation of single
nucleotide polymorphisms using the mismatch
amplification mutation assay and capillary electrophoresis. Electrophoresis 31:38813888
17. Krypuy M, Newnham GM, Thomas DM et al
(2006) High resolution melting analysis for
the rapid and sensitive detection of mutations
in clinical samples: KRAS codon 12 and 13
mutations in non-small cell lung cancer. BMC
Cancer 6:295
Chapter 27
Clustered Regularly Interspaced Short Palindromic
Repeats (CRISPRs) Analysis of Members
of the Mycobacterium tuberculosis Complex
Ana Botelho, Ana Canto, Clia Leo, and Mnica V. Cunha
Abstract
Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by
short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are
polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in
the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of
a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR
chromosomal region and recognition after hybridization of the spacers that are present. The workflow
beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization
of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent
spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and
typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal
tuberculosis.
Key words Tuberculosis, Bovine tuberculosis, Molecular typing, Direct repeats, Spoligotyping,
Epidemiology
Introduction
Clustered regularly interspaced short palindromic repeat (CRISPR)
regions are present in the genome of almost all archaea and many
bacteria, in association with cas (CRISPR-associated system) genes,
which are involved in DNA recombination and repair [1]. The
origin of cas in prokaryotic genomes is related with the acquisition
of heritable immunity against mobile nucleic acid elements, limiting phage infection and horizontal gene transfer of plasmids [2, 3].
373
374
Ana Botelho et al.
Cas genes
Leader sequence
DR region or CRISPR array
DVR 5
DR
DRa
DR
DRb DRa
DR
DRb DRa
DR
DRb DRa
DR
DRb DRa
DRb
DR
DRa
DRb
c
Multi-sized PCR products
IS
Strain I
Strain III
Strain II
Strain III
Strain IV
Spacers 1 to 43
Strains
1 2 3 4 5............43
Strain I
Strain II
Strain III
Strain IV
Fig. 1 Schematic structure of a CRISPR/Cas region in MTBC strains and application of the CRISPR array, to the
development of the spoligotyping method, using 43 selected spacer sequences. (a) General structure of a
CRISPR/Cas region; (b) structure of DR region: 056 copies of 36 bp direct repeats, separated by variable
spacer sequences of 3651 bp, whose order is well conserved in the genome of MTBC. Spacers, here numbered from 4 to 8. The DRs together with the adjacent spacers form the direct variant repeats (DVRs); (c) PCR
amplification of the DR flanking spacers, using primers DRa and DRb, one of them biotin labeled, complementary to the conserved direct repeats; (d) five pretend patterns in the DR region and possible formation of strain
III pattern by insertion of IS6110 sequence in DVR 5, hampering the amplification of spacer 5 by loss of primer
DVRb hybridization site. (e) Simplified spoligotyping membrane results obtained for the five strains and example of a real spoligotyping membrane. Note that the genome spacer order/number does not correspond to the
membrane spacer order/number
A typical CRISPR locus is composed of cas genes, a leader sequence,

and a repeat-spacer array (Fig. 1). These arrays are formed by direct
repeat (DR) sequences, of 2550 base pair (bp) long, interspersed
by unique, non-repetitive spacer sequences of similar size. An explanation for the origin of new spacers could be the preferential
uptake of bacteriophage DNA, as reported in Yersinia pestis [4], or
CRISPR Analysis of Mycobacterium tuberculosis Complex
375
extrachromosomal DNA. CRISPR sequences provide an adaptive,

heritable record of past infections and are transcribed into CRISPR
RNAssmall RNAs that target invasive nucleic acids [5, 6].
Removal or integration of particular spacers, derived from phage
genomic sequences, plasmids, or other recombination event(s), to
CRISPR loci may modify the phage-resistance phenotype of the
cell [2], conferring also a high level of polymorphism to these loci,
in different strains of the same species. The characteristics of
CRISPR loci made them useful in biotechnological applications,
such as artificial immunization against phage and genomic engineering, and in molecular epidemiology by comparison of CRISPR
spacer regions in different bacterial strains, allowing for their
discrimination.
The polymorphic property of CRISPR arrays, revealed by the
presence or absence of certain spacers, has been used for identification and genotyping of clinical isolates of Mycobacterium tuberculosis [7, 8], Streptococcus pyogenes [9], and Campylobacter jejuni
[10] contributing to enlighten the epidemiology of the diseases
they cause.
A comprehensive and updated database, containing information about CRISPR systems in several bacterial genomes is available
on http://crispr.u-psud.fr/crispr/. Convincing CRISPR structures were found in 1,251 genomes out of 2,630 analyzed so far
(as of January 2014).
Within the genus Mycobacterium, the presence of CRISPRs
structures is exclusive to members of the Mycobacterium tuberculosis complex (MTBC). Their number per genome varies from one
(in some strains of Mycobacterium canettii and of M. tuberculosis)
to four (in M. tuberculosis H37Rv), with an average of two CRISPRs
arrays in all M. bovis analyzed (http://crispr.u-psud.fr/).
In MTBC strains, a CRISPR array consists of multiple 36 bp
tandem DRs, with the consensus sequence TGAGGTGCGGC
GTGAGCGCGGGT, interspersed by a total of 94 recognized
spacers with 3541 bp in length [11, 12]. The order and sequence
of the spacers is highly conserved between strains of the MTB
complex. However, the size of the DR region and, thereby, the
presence of spacers differ significantly between strains. Differences
have been shown to be due to deletions of spacer sequences in the
DR region by transposition of the insertion sequence IS6110 [11,
13], which is almost invariably present in the DR cluster of MTBC
strains, probably driven by homologous recombination between
adjacent or distant DRs [7] or by replication slippage.
Based on the nature of the DNA polymorphism in the DR cluster region, two methods of MTBC strain differentiation were developed: direct variable repeat polymerase chain reaction (DVR-PCR)
[7], enabling detection and typing of individual M. tuberculosis
strains in a single PCR, and spoligotyping (spacer oligonucleotide
typing) [8]. This last method, also based on PCR coupled with
Ana Botelho et al.
376
. Spoligotyping membrane preparation

EDAC
COOH
Membrane
Membrane
Multi-sized PCR
products biotinlabelled
Spacer -oligos with aminolink NH 3

agtctagtctgaatt
NH3
COOH
Membrane
Spacers 1 to 43
1 2 3 4 5 .......................................43
Covalent binding of spacer-oligos

Membrane
. Hybridization
2. Hybridization
PCR products-biotin
Membrane
. Detection
Streptavidin-peroxidase
Spacers 1 to 43
Strains
Membrane
O2+H2O
Detection reagents: H2O2 and luminol
Oxidized product
Light
Membrane
Fig. 2 Schematic basic steps of spoligotyping method. See text for details
reverse line blot hybridization, gained wide diffusion, due to its easy
execution and high throughput, to assess global MTBC strain
diversity. This technique consists in the amplification of the DR
region using two inversely orientated primers, one of them labeled
with biotin, complementary to the flanking conserved DR sequence
(Figs. 1 and 2). DNA spacer sequences in between adjacent DRs
and in between more distantly positioned DRs are amplified [8].
Evaluation of the presence or absence of spacers is done by reverse
hybridization of the obtained PCR products with a set of selected
43-spacer oligonucleotides covalently linked to a nylon membrane
(Table 1, Fig. 2), designed according to the sequences of M. tuberculosis H27Rv and M. bovis BCG P3 strains. The PCR products are
applied onto the membrane in reverse orientation of the rows with
the synthetic oligonucleotides. Since one of the DR primers is
labeled with biotin, the detection of hybridization is done by
chemiluminescence, through addition of streptavidin-peroxidase
conjugate and a substrate (Fig. 2).
Spoligotyping applied to bacterial isolates is simple, robust,
and highly reproducible. On the other hand, for MTBC strains
containing few copies of the IS6110 element, such as M. bovis,
spoligotyping is generally more discriminatory than IS6110 typing
methods, and the DR region is, consequently, also more stable.
377
Table 1
Sequences and concentrations of the oligonucleotide probes covalently linked to the Biodyne C
membrane [8]
Oligonucleotide
number order
Sequence (3-5 amino)
Concentration
(pmol/150 l)
ATAGAGGGTCGCCGGTTCTGGATCA
12.5
CCTCATAATTGGGCGACAGCTTTTG
30.0
CCGTGCTTCCAGTGATCGCCTTCTA
12.5
ACGTCATACGCCGACCAATCATCAG
12.5
TTTTCTGACCACTTGTGCGGGATTA
12.5
CGTCGTCATTTCCGGCTTCAATTTC
12.5
GAGGAGAGCGAGTACTCGGGGCTGC
25.0
CGTGAAACCGCCCCCAGCCTCGCCG
50.0
ACTCGGAATCCCATGTGCTGACAGC
12.5
10
TCGACACCCGCTCTAGTTGACTTCC
15.0
11
GTGAGCAACGGCGGCGGCAACCTGG
30.0
12
ATATCTGCTGCCCGCCCGGGGAGAT
60.0
13
GACCATCATTGCCATTCCCTCTCCC
12.5
14
GGTGTGATGCGGATGGTCGGCTCGG
30.0
15
CTTGAATAACGCGCAGTGAATTTCG
30.0
16
CGAGTTCCCGTCAGCGTCGTAAATC
12.5
17
GCGCCGGCCCGCGCGGATGACTCCG
100.0
18
CATGGACCCGGGCGAGCTGCAGATG
12.5
19
TAACTGGCTTGGCGCTGATCCTGGT
12.5
20
TTGACCTCGCCAGGAGAGAAGATCA
12.5
21
TCGATGTCGATGTCCCAATCGTCGA
25.0
22
ACCGCAGACGGCACGATTGAGACAA
12.5
23
AGCATCGCTGATGCGGTCCAGCTCG
50.0
24
CCGCCTGCTGGGTGAGACGTGCTCG
50.0
25
GATCAGCGACCACCGCACCCTGTCA
25.0
26
CTTCAGCACCACCATCATCCGGCGC
12.5
27
GGATTCGTGATCTCTTCCCGCGGAT
25.0
28
TGCCCCGGCGTTTAGCGATCACAAC
12.5
29
AAATACAGGCTCCACGACACGACCA
12.5
30
GGTTGCCCCGCGCCCTTTTCCAGCC
12.5
(continued)
378
Ana Botelho et al.
Table 1
(continued)
Oligonucleotide
number order
Sequence (3-5 amino)
Concentration
(pmol/150 l)
31
TCAGACAGGTTCGCGTCGATCAAGT
12.5
32
GACCAAATAGGTATCGGCGTGTTCA
25.0
33
GACATGACGGCGGTGCCGCACTTGA
34
AAGTCACCTCGCCACACCGTCGAA
25.0
35
TCCGTACGCTCGAAACGCTTCCAAC
12.5
36
CGAAATCCAGCACCACATCCGCAGC
12.5
37
CGCGAACTCGTCCACAGTCCCCCTT
12.5
38
CGTGGATGGCGGATGCGTTGTGCGC
25.0
39
GACGATGGCCAGTAAATCGGCGTGG
25.0
40
CGCCATCTGTGCCTCATACAGGTCC
12.5
41
GGAGCTTTCCGGCTTCTATCAGGTA
12.5
42
ATGGTGGGACATGGACGAGCGCGAC
25.0
43
CGCAGAATCGCACCGGGTGCGGGAG
50.0
100.0
A hybridization profile is generated for any MTBC isolate (Fig. 1)

allowing, simultaneously, its identification and genotyping, since
each species has a specific spoligotype signature [14]. Such is the
case of M. bovis, M.canettii, M. caprae, and M. tuberculosis (Table 2).
The typical signature of most M. bovis strains and all M. bovis BCG
is the absence of spacers 3, 9, 16, and 3943 [14, 15] (Table 2).
The spoligotyping profile can be expressed as a numerical profile (binary or octal code), which simplifies storing of typing data
and facilitates interlaboratory comparison. Most relevant for the
global comparison of data is the existence of international spoligotyping databases: SpolDB4 [17] and Mbovis.org [18], the latter
specific for M. bovis and other non-M. tuberculosis isolates, characterized by absence in the genome of RD9 (region of difference).
Most spoligotype attribution codes use the international databases
calls: ST (for shared types) followed by a number in M. tuberculosis
databases or SB (for spoligotype bovis) followed by four digits in
Mbovis.org database. These databases allow easy interlaboratory
comparison of spoligotype patterns and contribute for the definition
of the major lineages within M. tuberculosis and M. bovis strains.
In an attempt to enlarge the discriminatory power of spoligotyping, additional spacers have been evaluated for M. bovis [12,
19], M. africanum [16], and M. caprae [20] strains typing.
However, these extended spoligotypes have had few practical
applications, since other methods, such as mycobacterial interspersed
379
Table 2
Spoligotyping patterns and signatures of members of the MTBC [14, 21, 22]
Filled square: presence of spacer; open square: absence of spacer

1: Presence of spacer; 0: absence of spacer; underlined numbers mark how spoligotypes SB0121 and SB0119 could
have derived from spoligotype SB0120 by deletion of spacers 15 and 21. Other spoligotypes could have evolved from
SB0121 by deletion of other spacers: spacers 4 and 1 (double underlined) for, respectively, SB1093 and SB0122.
Spacers that make the core signature are indicated in bold. Even for less common spoligotypes, like SB1175, the core
spoligotype signature is maintained
c
Shared type (ST) number or spoligotype bovis (SB) number attributed by, respectively, SpolDB4 and Mbovis.org databases
d
Based on the consistent absence of certain spacers in all M. bovis and M. caprae strains analyzed so far
b
repetitive units variable number of tandem repeats (MIRU-VNTR)

in conjunction with spoligotyping, proved to be the most suitable
tools to increase the discriminatory power and to further differentiate strains of the MTBC [21, 22].
Provided that suitable quality control measures are adopted,
the spoligotyping procedure described below, using 43 spacer
analyses, should enable the identification and typing of members of
the MTBC. For a self-sufficient procedure and independent from
commercial membranes, we describe the in-house preparation of
the spoligotyping membrane.
Materials
All the solutions should be freshly prepared, with ultrapure water
(18.2 M cm at 25 C) and analytical grade reagents, and stored
at room temperature. The stock solutions should be sterilized in
autoclave at 121 C for 15 min. The nylon membrane can be
regenerated and reused up to ten times.
2.1
Solutions
2.1.1 Stock Solutions
1. 0.5 M EDTA: For 1,000 ml, weight 186.12 g of ethylenediaminetetraacetic acid (EDTA) and add half the water. Mix
until complete dissolution using a magnetic stirrer and adjust
to pH 8.0. Complete the volume to 1,000 ml (see Note 1).
2. 20 SSPE (w/v): Weight 35.6 g of Na2HPO4.2H2O, 210.24 g
of NaCl, and 7.4 g of EDTA for a final volume of 1,000 ml in
water. Mix well and adjust to pH 7.4.
380
Ana Botelho et al.
2.1.2 Working Solutions

For Membrane Preparation
1. 500 mM NaHCO3 (pH 8.4): For 250 ml, weight 10.5 g of

NaHCO3 and dissolve in water. Mix, adjust to pH 8.4, and add
water up to 250 ml.
2. 16 % (w/v) EDAC: For 10 ml, add 1.6 g of 1-ethyl-3-(3dimethylaminopropyl) carbodiimide (EDAC) and mix with
9.4 ml of water. Store at 20 C.
3. 100 mM NaOH: Weight 1.0 g of sodium hydroxide (NaOH)
and add water up to 250 ml and mix.
4. 10 % SDS (w/v): Weight 10 g of sodium dodecyl sulfate (SDS)
to a glass bottle, and add water up to a final volume of 100 ml
(see Note 2).
5. 2 SSPE/0.1 % SDS (w/v): For 250 ml solution, add 25 ml of
20 SSPE to 222.5 ml of water. After stirring, carefully add
2.5 ml of 10 % SDS (w/v) (see Note 3).
6. 1:100 China ink diluted in 2 SSPE: For 300 l, add 3 l of
China ink to 297 l of 2 SSPE.
7. 20 mM EDTA: For 100 ml, add 4 ml of 0.5 M EDTA to 96 ml
of water.
For Hybridization
1. 10 % (w/v) SDS: For 130 ml, add 13 g of SDS to 100 ml of

water. Stir until complete dissolution using a magnetic stirrer.
In a graduated cylinder, add water up to 130 ml final volume
(see Note 2).
2. 2 SSPE (v/v): For 500 ml, add 50 ml of 20 SSPE to 450 ml
of water.
3. 2 SSPE/0.1 % SDS: For 300 ml, add 30 ml of 20 SSPE to
267 ml of water. After stirring, carefully add 3 ml of 10 %
(w/v) SDS (see Note 3).
4. 2 SSPE/0.5 % SDS: For 1,000 ml, add 100 ml of 20 SSPE
to 850 ml of water. After stirring, carefully add 50 ml of 10 %
SDS (see Note 3).
5. 1 % SDS: For 750 ml, add 75 ml of 10 % SDS to 675 ml of
water.
6. 20 mM EDTA: For 1,000 ml, measure 40 ml of 0.5 M EDTA
and add water up to 1,000 ml.
2.2 Membrane
Preparation
1. Oligonucleotide probes synthesized with a 5-end amino

group (see Note 4), diluted in 150 l of 500 mM NaHCO3
pH 8.4.
2. Nylon membrane negatively charged (Biodyne C).
3. 10 ml of 16 % (w/v) EDAC.
4. 300 l of 1:100 China ink diluted in 2 SSPE.
5. 250 ml of 100 mM NaOH.
381
6. 250 ml of 2 SSPE/0.1 % SDS.

7. 120 ml of 20 mM EDTA pH 8.0.
8. Ultrapure water.
9. Horizontal platform rocker.
10. Miniblotter (MN45 system).
11. Laboratory trays (about 200 300 mm).
12. Vacuum pump.
13. Forceps.
2.3 PCR
Amplification
1. Primers DRa: 5- biotin-GGT TTT GGG TCT GAC GAC- 3and

DRb: 5- CCG AGA GGG GAC GGA AAC- 3 (see Note 5).
2. 50 l of PCR mix reaction: 1 Taq DNA polymerase reaction
buffer, 3.5 mM MgCl2, 400 M dNTPs, 0.4 M of each primer
(DRa and DRb), 1 U of Taq DNA polymerase, and 2 l of
genomic DNA.
3. Positive controls: Mycobacterium tuberculosis H37Rv (CCUG
37357); Mycobacterium bovis BCG (Danish) (CCUG 27863).
4. Negative control: ultrapure water.
5. 2 % (w/v) agarose gel.
6. 1 TrisBorateEDTA (TBE) (see Note 6).
7. 2 % (v/v) GelRed.
8. Horizontal gel electrophoresis system.
9. Power supplies.
10. UV transilluminator.
11. Thermal cycler, 96-well format compatibility.
2.4 DNA
Hybridization
1. 20 l of amplification products diluted in 150 l of 2

SSPE/0.1 % SDS.
2. Ice.
3. 250 ml of 2 SSPE/0.1 % SDS.
4. 1,000 ml 2 SSPE/0.5 % SDS.
5. 2.5 l Streptavidin-peroxidase conjugate (500 U/ml).
6. 500 ml of 2 SSPE.
7. Hybridization oven with rolling bottles.
8. Thermal cycler.
9. Forceps.
10. Miniblotter (MN45 system).
11. Nylon membrane Biodyne C.
12. Vacuum pump.
13. Laboratory trays (see Subheading 2.2).
382
Ana Botelho et al.
2.5 Detection
of Hybridizing DNA
1. 10 ml ECL solution 1 from ECL Direct Labeling and Detection

System (GE Healthcare).
2. 10 ml ECL solution 2 from ECL Direct Labeling and Detection
System (GE Healthcare).
3. Hyperfilm ECL.
4. Hybridization roller bottles.
5. Autoradiography cassette.
6. Acetate sheet.
7. Blotting paper 3MM.
8. Laboratory trays.
9. Plastic trays.
10. Developer solution.
11. Fixer solution.
12. Red safelight in a dark room.
Methods
Always use gloves and forceps to manipulate the membrane.
3.1 Preparation
of In-House Membrane
with the 43
Oligonucleotides
Covalently Linked
(See Note 7)
1. Dilute each oligonucleotide probe in the recommended optimized concentrations (see Table 1) in 150 l of 500 mM
NaHCO3 (pH 8.3).
2. Incubate the nylon membrane in a laboratory tray containing
10 ml of 16 % (v/v) EDAC solution for 10 min at room temperature to activate the membrane.
3. Discard the EDAC solution and wash the membrane with
ultrapure water for 2 min, with orbital shaking.
4. With the forceps, place the membrane on top of the foam
cushion of the Miniblotter system and hand-tight the screws.
5. Remove all the residual water of the membrane by aspiration
with the vacuum pump (see Note 8).
6. Fill the slots of the Miniblotter with 150 l of the 43 diluted
oligonucleotide probes, in the order displayed on Table 2,
leaving the first and the last slots empty (see Note 9).
7. Fill the first and the last slots of the Miniblotter with the diluted
China ink.
8. Incubate for 2 min at room temperature.
9. Remove all the solutions of the slots of the Miniblotter by aspiration with the vacuum pump, by the same order in which they
were filled.
383
10. Remove the membrane from the Miniblotter using forceps and
incubate in a laboratory tray, with 250 ml of 100 mM NaOH
for 8 min at room temperature with shaking.
11. Discard the solution and wash the membrane with ultrapure
water at room temperature.
12. Wash the membrane with 250 ml of 2 SSPE/0.1 % SDS with
gentle shaking for 5 min at 60 C.
13. The membrane is ready to use or to store.
14. Before storing the membrane, wash it in a laboratory tray, with
100 ml of 20 mM EDTA (pH 8.0), for 15 min at room temperature with gentle shaking.
15. Remove the membrane with forceps and store at 4 C, in a
sealed plastic bag to avoid dehydration, with 10 ml of 20 mM
EDTA (pH 8.0) until being used.
3.2 Sample
Preparation
(In a Biosafety
Level 3 Facility)
1. Place 150 l of ultrapure water in a 2 ml screw-cap tubes.
3.3 DR Region
Amplification by PCR
1. Prepare PCR reaction mix in a total volume of 50 l per reaction. Mycobacterium tuberculosis H37rv (CCUG 37357) and
Mycobacterium bovis BCG (CCUG 27863) are used as positive
controls and ultrapure water as negative control.
2. Using a disposable loop, collect sufficient MTBC colonies from

culture medium and suspend in the water.
3. In a thermo block, incubate for 30 min at 90 C to extract the
DNA and to kill the bacteria. From this step on, the sample can
be manipulated out of the P3 facilities (see Note 10).
2. Perform the amplification reactions in a thermocycler with an

initial step at 96 C for 3 min, followed by 35 cycles at 96 C
for 1 min, 55 C for 1 min, and 72 C for 30 s, ending with a
step at 72 C for 5 min.
3. Analyze the amplified products by electrophoresis in a 2 %
(w/v) agarose gel prepared in 1 TBE buffer and stained with
2 % GelRed (see Note 11). Run the gel at 90 V for 60 min.
Visualize the gel under UV light in a transilluminator.
3.4 DNA
Hybridization
to the Membrane
(See Subheading 3.1)
All buffers should be previously warmed to the respective work

temperatures, with the exception of 10 ml of 2 SSPE/0.1 % SDS
and 2 SSPE that should be at room temperature. Pre-warm the
hybridization oven at 60 C.
1. Dilute 20 l of the PCR products (maximum of 40 samples,
plus two positive controls and one negative control, per membrane) in 150 l of 2 SSPE/0.1 % SDS buffer.
2. Store the remaining PCR products at 4 C.
3. Denature the diluted PCR products for 10 min at 99 C in a
thermocycler or in a dry bath, and cool immediately on ice.
384
Ana Botelho et al.
4. Place the membrane, with forceps and held by its edges, in a

laboratory tray and rinse twice in 250 ml of 2 SSPE/0.1 %
SDS for 5 min at 60 C.
5. Put the foam cushion into the Miniblotter (that acts as a joint)
and place the membrane above it, so that the side with the
oligonucleotides (spacers) faces the slots and these are perpendicular to the black line of the spacers on the membrane
(use the date in the bottom right corner as a marker) (Fig. 2).
6. Tightly fasten the six plastic screws to close the press.
7. Remove the excess of 2 SSPE/0.1 % SDS from each of
the slots of the Miniblotter by aspiration with a vacuum pump
(see Note 8).
8. Fill the first slot of the Miniblotter with 150 l of 2 SSPE/0.1 %
SDS to prevent the dehydration of the membrane.
9. Fill the remaining slots, one by one, starting in the second slot,
with 150 l of the diluted PCR products (maximum 43), kept
at 4 C until loading, avoiding air bubbles (see Note 12). Mark
the loading order.
10. Fill the last slot and any empty slots of the Miniblotter with
150 l of 2 SSPE/0.1 % SDS. The samples must always be
surrounded by buffer to prevent leaking.
9. Incubate in a hybridization oven at 60 C for 1 h without
shaking.
10. Remove the samples from the slots of the Miniblotter by aspiration with a vacuum pump, in the same order as they were filled.
11. Disassemble the Miniblotter and, with the forceps, carefully
remove the membrane to a laboratory tray, and wash twice
with 250 ml of 2 SSPE/0.5 % SDS at 60 C for 10 min, on
the hybridization oven with shaking.
12. Discard the washing buffer and lower the temperature of the
hybridization oven to 42 C (see Note 13).
13. Add 2.5 l of streptavidin-peroxidase conjugate (500 U/ml)
to 10 ml of 2 SSPE/0.5 % SDS at 42 C and place the solution in a rolling bottle.
14. Place the membrane and a mesh of the same size in the rolling
bottle and incubate at 42 C during 90 min on the hybridization oven, with rolling movement (see Note 14).
15. Remove the membrane from the rolling bottle, with the forceps, and wash it twice in a tray with 250 ml of 2 SSPE/0.5 %
SDS at 42 C during 10 min, in the hybridization oven with
shaking. Add fresh solution each time.
16. Discard the solution and rinse the membrane twice with
250 ml of 2 SSPE at room temperature for 5 min with shaking. Add fresh solution each time.
3.5 Detection
of Hybridized DNA
385
1. Prepare a light-tight X-ray film holder (autoradiography

cassette) placing inside one sheet of blotting paper 3 MM and
an acetate sheet (see Note 15).
2. Immediately before required, prepare 20 ml of solution by
mixing 10 ml of each of the solutions supplied in the commercial system ECL (ECL solution 1 and ECL solution 2) in a
flask involved in a tinfoil.
3. Place the nylon membrane over one sheet of blotting paper
3 MM to remove the excess of washing buffer.
4. In a complete darkroom, incubate the membrane in 20 ml of
the ECL mixture, during 2 min, in a laboratory tray, with gentle
manual shaking so that all the membrane is in uniform contact
with the liquid (the membranes repel water) (see Note 16).
5. Remove the excess of ECL mixture from the membrane with a
sheet of blotting paper 3 MM. The membrane does not need
to be completely dried, but the sharpness of the image is much
improved if it is.
6. Place the membrane inside the cassette with the side where the
hybridization has occurred up, between the acetate sheet
(above) and the blotting paper 3 MM.
7. Place the hyperfilm ECL on top of the acetate sheet and remove
the air bubbles. Close the cassette and expose the membrane to
the autoradiography film for 10 min (see Note 17).
8. In the darkroom, remove the hyperfilm ECL as quickly as possible and develop it immediately in an X-ray developer solution
during a few seconds (see Note 18).
9. Wash the autoradiography film with water in a plastic container, for 1 min.
10. Fix the film with a rapid fixer solution in a plastic container, for
5 min.
11. Wash the film with running water for 5 min.
12. Let the film dry and visualize the results.
13. Wash the membrane twice for 15 min with 250 ml of 20 mM
EDTA at room temperature, with shaking.
EDTA (pH 8.0) until being regenerated in the dehybridization (stripping) step (see Subheading 3.7).
3.6 Interpretation
of Results
The membrane is analyzed by recording the presence or absence of

signals at the sites of DNA/DNA hybridizations, using the binary
code (0 for absence, 1 for presence of signal) annotation. The
obtained sequence, of 0 and 1, is then checked against the databases
(http://www.pasteur-guadaloupe.fr/tb or http://www.mbovis.
org) for spoligotype attribution.
386
Ana Botelho et al.
Clear sharp signals are easy to interpret, but some weak signals
may occur with some spacers, mainly 14, 26, and 33, whose presence or absence is more critical to evaluate. Comparing with
well-known control patterns and checking for the presence of the
expected spots can clarify some doubts. The negative control
should be absolutely clear and with no contamination or leaks.
Very faint dots should, in principle, not be considered, unless the
positive control gives otherwise information. Obtaining a clear
negative control and a correct positive control profile is critical for
the assessment of membrane quality and for the interpretation of
results.
3.7 Regeneration
of the Nylon
Membrane for Reuse
The membranes can be reused if the oligonucleotides can be freed

from the attached PCR products. As the oligonucleotides (spacers)
are covalently fixed to the membrane, the removal method must be
highly stringent.
1. Pre-warm the hybridization oven and the 1 % SDS at 85 C.
2. Place the membrane into a laboratory tray, with the forceps,
and wash 3 times for 30 min with 250 ml of 1 % SDS at 85 C
with shaking.
3. Discard the washing solution and wash twice for 15 min with
250 ml of 20 mM EDTA at room temperature, with shaking.
EDTA (pH 8.0) until being used.
Notes
1. To prepare 1,000 ml of 0.5 M EDTA, weight 186.12 g of
EDTA to a glass bottle and add 800 ml of water. It is convenient to dissolve the powder using a magnetic stirrer with maximum speed. Add NaOH pellets to adjust the solution at a
pH 8.0. Only a pH 8.0 solution, at 25 C, completely dissolves
the EDTA. Adjust the volume to 1,000 ml with water and mix
again. Store at room temperature.
2. To prepare 100 ml of 10 % SDS, weight 10 g of sodium lauryl
sulfate to a glass bottle and add 80 ml of water. Dissolve by
gentle shaking (to avoid the formation of foam) in a magnetic
stirrer with heating up to 68 C. Adjust the volume to 100 ml
with water and mix again. Store at room temperature.
3. Prepare the solutions of 2 SSPE/0.1 % SDS and 2
SSPE/0.5 % SDS firstly mixing the water with the 2 SSPE.
After complete homogenization, add the SDS and homogenize again. The addition of the solutions should be as indicated
to avoid the formation of a precipitate.
387
4. All the oligonucleotide probes are synthesized with a 5-end

amino group, to promote the covalent linking to the activated,
negatively charged, membrane Biodyne C.
5. The DRa primer is labeled with biotin that binds to streptavidin coupled with peroxidase, making possible to detect any
amplification product. The primers are reconstituted in ultrapure water for a stock solution of 100 M and diluted in water
for a working solution of 20 M. Store the primers in aliquots:
the DRa primer at 4 C, because the repeated freeze-thawing
of the biotinylated primer results in a weak reaction, and the
DRb primer at 20 C.
6. To prepare 1,000 ml of 1 TBE, add 200 ml of 5 TBE and
mix with 800 ml of water (1,000 ml of 5 TBE is prepared by
adding 54 g of Tris base, 27.5 g of boric acid and 800 ml of
water to a glass bottle. Mix using a magnetic stirrer. Add 20 ml
of 0.5 M EDTA and add water to complete the volume of
1,000 ml).
7. Ready-to-use customized membranes can be obtained from
some manufacturers. Also European reference laboratories for
tuberculosis can, upon request, supply these membranes.
8. To remove the residual solution from the slots of the Miniblotter, put a 1,000 l micropipette tip in the top of the tube
of the vacuum pump to aspirate the slots. Aspirate the upper
slots with the Miniblotter in the horizontal plan and the lower
slots with the Miniblotter in a slanting plan.
9. The first and the last slot must be left without oligonucleotide
probes because they are going to be used to mark the edges of
the membrane with the diluted China ink.
10. The amplification step requires very little DNA concentration.
It is therefore better to take fewer bacteria from the agar slopes
than to risk taking a large amount of medium. It is important
that the bacteria are exactly heated to 90 C for, at least, 30 min
to ensure that they are all killed at this stage. It is also possible
to use DNA extracted by phenolchloroform method or with
any commercial DNA extraction kit. Extracted DNA can be
stored at 20 C.
11. The purpose of this step is only to confirm that the amplification of the DR loci has occurred. For each sample, it should be
observed a smear of bands with different sizes.
12. Fill the slots carefully avoiding air bubbles and using absorbent
paper to prevent cross contamination of adjacent slots.
13. The temperature of incubation should be rigorously at 42 C,
since streptavidin-peroxidase conjugate is inactivated above
this temperature.
388
Ana Botelho et al.
14. Carefully wrap the membrane and the mesh, with the size of
the membrane, together and place them inside the rolling
bottle. Unroll the membrane and the mesh in the opposite
rotation direction to adhere completely at the rolling bottle
walls, avoiding bubbles and promoting the contact of the membrane with the streptavidin solution. Place the rolling bottle
in the hybridization oven, in the proper rotation direction, in
order to prevent the curl of the membrane during the incubation period.
15. To prepare the autoradiography cassette, place a sheet of blotting paper 3 MM and acetate sheet inside the cassette and hold
them individually with adhesive tape.
16. Incubate the membrane at room temperature, in the dark
room, with the ECL mixture with gentle shaking in order to
cover the entire membrane surface.
17. Exposure time can be adjusted according to the results obtained
and the intensity of signals. Shorter or longer exposures may
vary from 5 to 20 min, depending on the results from the first
film.
18. Leave the hyperfilm in the X-ray developer solution the time
enough (could be a few seconds) to visualize positive signals,
avoiding darkness of the hyperfilm. Once the hyperfilm starts
to get dark, wash immediately in water.
Acknowledgments
This work was supported by Fundaco para a Cincia e Tecnologia
(FCT) through project PTDC/CVT/117794/2010 and in the
framework of Projecto 3599Promover a Produo Cientfica e
Desenvolvimento Tecnolgico e a Constituio de Redes Temticas.
References
1. Jansen R, van Embden J, Gaastra WL, Schouls
M (2002) Identification of genes that are associated with DNA repeats in prokaryotes. Mol
2. Barrangou R, Fremaux C, Deveau H et al
(2007) CRISPR provides acquired resistance
against viruses in prokaryotes. Science 31:
17091712
3. Deveau H, Garneau JE, Moineau S (2010)
CRISPR/Cas system and its role in phagebacteria interactions. Annu Rev Microbiol
64:475493
4. Pourcel C, Salvignol G, Vergnaud G (2005)
CRISPR elements in Yersinia pestis acquire
new repeats by preferential uptake of bacte-
riophage DNA, and provide additional tools

for evolutionary studies. Microbiology 151:
653663
5. Sorek R, Kunin V, Hugenholtz P (2008)
CRISPR a widespread system that provides
acquired resistance against phages in bacteria
and archaea. Nat Rev Microbiol 6:181186
6. Marraffini L, Sontheimer EJ (2010) CRISPR
interference: RNA-directed adaptive immunity
in bacteria and archaea. Nat Rev Genet 11:
181190
7. Groenen PM, Bunschoten AE, van Soolingen
D, van Embden JD (1993) Nature of DNA
polymorphism in the direct repeat cluster of
Mycobacterium tuberculosis; application for strain
8.
9.
10.
11.
12.
13.
14.
differentiation by a novel typing method. Mol

Kamerbeek J, Schouls L et al (1997) Simultaneous detection and strain differentiation of
Mycobacterium tuberculosis for diagnosis and
epidemiology. J Clin Microbiol 35:907914
Hoe N, Nakashima K, Grigsby D et al (1999)
Rapid molecular genetic subtyping of serotype
M1 group A Streptococcus strains. Emerg Infect
Dis 5:254263
Schouls LM, Reulen S, Duim B et al (2003)
Comparative genotyping of Campylobacter
jejuni by amplified fragment length polymorphism, multilocus sequence typing, and short
repeat sequencing: strain diversity, host range,
and recombination. J Clin Microbiol 41:1526
Van Embden JDA, Van Gorkom T, Kremer K,
Jansen R et al (2000) Genetic variation and
evolutionary origin of the Direct Repeat locus
of Mycobacterium tuberculosis complex bacteria. J Bacteriol 182:23932401
Caimi K, Romano MI, Alito A et al (2001)
Sequence analysis of the direct repeat region
in Mycobacterium bovis. J Clin Microbiol 39:
10671072
Filliol I, Driscoll JR, Van Soolingen D et al
(2003) Snapshot of moving and expanding
clones of Mycobacterium tuberculosis and their
global distribution assessed by spoligotyping in
an international study. J Clin Microbiol 41:
19631970
Streicher EM, Victor TC, van der Spuy G et al
(2007) Spoligotype signatures in the Mycobacterium tuberculosis complex. J Clin Microbiol
45:237240
389
15. Van Soolingen D (2001) Molecular epidemiology

of tuberculosis and other mycobacterial infections: main methodologies and achievements.
J Intern Med 249:126
16. Brudey K, Driscoll JR, Rigouts L et al (2006)
Mycobacterium tuberculosis complex genetic
diversity: mining the fourth international spoligotyping database (SpolDB4) for classification,
population genetics and epidemiology. BMC
Microbiol 6:23
17. Intitute Pasteur de la Guadeloupe (1993)
Tuberculose et Mycobactries, Abymes Cedex.
http://www.pasteur-guadeloupe.fr/tb/
bd_myco.html. Accessed 10 Jan 2014
18. Mycobacterium bovis spoligotyping Database.
http://www.Mbovis.org. Accessed 10 Jan 2014
19. van der Zanden AGM, Kremer K, Schouls LJ
et al (2002) Improvement of differentiation
and interpretability of spoligotyping for Mycobacterium tuberculosis complex isolates by
introduction of new spacer oligonucleotides.
20. Javed MT, Aranaz A, de Juan L et al (2007)
Improvement of spoligotyping with additional
spacer sequences for characterization of
Mycobacterium bovis and M. caprae isolates
from Spain. Tuberculosis 87:437445
21. Duarte EL, Domingos M, Amado A, Botelho A
(2008) Spoligotype diversity of Mycobacterium
bovis and Mycobacterium caprae animal isolates.
22. Rodrguez S, Bezos J, Romero B, de Juan L
et al (2011) Mycobacterium caprae infection in
livestock and wildlife, Spain. Emerg Infect Dis
17:532535
Chapter 28
Rapid Microarray-Based Genotyping of Chlamydia spp.
Strains from Clinical Tissue Samples
Abstract
Pathogenic Chlamydia (C.) psittaci and C. trachomatis strains can be genotyped based on variations in the
ompA genomic locus. In the present chapter, we describe rapid genotyping assays for both chlamydial
agents using the ArrayStrip (AS) microarray platform. The test is targeting multiple discriminatory sites
in the variable domains of the ompA gene by using 35 (C. psittaci) and 61 (C. trachomatis) oligonucleotide
probes representing genotype-specific polymorphisms. In addition to discrimination among the established genotypes, this approach allows identification of atypical strains that were not accessible to typing
using previously established techniques, such as PCR-RFLP or serotyping.
The present DNA microarray assay can be conducted directly on clinical tissue samples and is suitable
for tracing epidemiological chains and exploring the dissemination of particular genotypes. The procedure
is easy to handle and economically affordable, and it allows genotyping of up to 32 clinical samples per day,
thus lending itself for routine diagnosis as well.
Key words Chlamydia psittaci, Chlamydia trachomatis, ompA genotyping, Diagnostic DNA microarray
test, Direct testing of clinical samples
1
1.1
Introduction
History of Typing
Members of the family Chlamydiaceae represent obligate intracellular bacteria that are distinguished by a characteristic biphasic
developmental cycle. There are several well-established pathogens
among them. For instance, Chlamydia (C.) psittaci, the causative
agent of psittacosis in birds and humans, is responsible for outbreaks in psittacine birds and domestic poultry [1], as well as cases
of atypical pneumonia in exposed individuals [2, 3]. The fact that
C. psittaci is a heterogeneous taxon in terms of host range and
virulence entailed the development of a serotyping scheme in the
1990s [4]. Strains of the agent were assigned to serovars A, B, C,
D, E, and F on the basis of their immune reaction with a panel of
monoclonal antibodies (MAbs) recognizing specific epitopes of
the major outer membrane protein (MOMP). Later on, Sayada
391
392
et al. [5] suggested restriction fragment length polymorphism

(RFLP), i.e., PCR amplification of the ompA gene with subsequent
restriction enzyme analysis, for differentiation among C. psittaci
isolates. The finding by Vanrompay et al. [6] that serotypes and
RFLP genotypes were generally equivalent rendered strain typing
accessible to all laboratories without access to the specific MAbs.
However, there were obvious limitations to PCR-RFLP typing. To
obtain distinctive and reproducible RFLP patterns on ethidium
bromide-stained agarose gels, substantial amounts of target DNA
and PCR amplicon were required. Some of the related genotypes
gave quite similar patterns and were difficult to distinguish, and
different enzymes could produce ambiguous or even contradictory
patterns (e.g., AluI vs. MboII). Finally, atypical strains were not
amenable to this genotyping procedure.
The use of real-time PCR [7] helped to further increase sensitivity but also failed to cover the entire spectrum of natural sequence
diversity at the target locus.
Historically, nine genotypes (former serotypes) were postulated, and a certain degree of host preference was assigned to them
[4, 810], i.e., genotype A occurring in psittacine birds, B in
pigeons, C in ducks and geese, D in turkeys, E in pigeons, ducks,
and others, E/B in ducks, F in parakeets, WC in cattle, and M56 in
rodents. In reality, the host specificity of most of these types is limited (see Table 1).
Based on the original serotyping scheme [11], an analogous
ompA-based genotyping system has also been in use for strains of
the human pathogen C. trachomatis The agent can also be found
occasionally in animals [12, 13]. There are 17 generally recognized
genotypes, i.e., A, B, Ba, C (associated with trachoma), D, Da, E,
F, G, H, I, Ia, J, K (urogenital infections), L1, L2, and L3 (lymphogranuloma venereum). Like in the case of C. psittaci, they are
equivalent to the previously defined serotypes.
1.2 Genotyping
Using DNA
Microarrays
In principle, sequencing of the ompA gene can also be used to

identify the genotype of C. psittaci, as well as C. trachomatis.
However, there are no generally agreed criteria in terms of sequence
similarity, so that the assignment remains somewhat arbitrary.
Detailed analysis of ompA sequence data deposited at the GenBank
database led Sachse et al. [14] to the conclusion that at least 15
ompA genotypes of C. psittaci are occurring in nature. A summary
of this classification in Table 1 shows that the more heterogeneous
types A, D, and E/B can be further divided into subtypes. The
host range of the proposed new genotypes 1V, 6N, Mat116, R54,
YP84, and CPX0308 is not yet fully known, but they seem to occur
predominantly in wildlife birds.
The fact that genotype-specific sites of C. psittaci are located in
ompAs variable domains (VD) 2 and 4 allows a molecular definition of individual genotypes at the nucleotide level.
DNA Microarray for Chlamydia Genotyping
393
Table 1
ompA genotypes and subtypes of Chlamydia psittaci [Adapted from reference [14]]
Genotype
Known hosts
Subtypes
Type strain (representative GenBank

strain of subtype)
acc. no.
Psittacine, pigeon, canary, turkey
A-VS1
VS1, MN Zhang
AF269281
pheasant, chicken, duck, cattle
A-6BC
6BC
X56980
swine, sheep, horse, human
A-8455
84-55
Y16561
Pigeon, canary, budgerigar,

chicken, pheasant, turkey
CP3
AF269265
Duck, goose, swan, sheep, human
GR9, avian type C
L25436
Turkey, human
D-NJ1
NJ1
AF269266
D-9 N
9N
EF375557
CPMN, EAE A22/M
X12647
EB-E30
WS/RT/E30
AY762613
EB-859
06-859/1
EU159263
Pigeon, duck, turkey, ostrich,

human
EB
Duck, human
EB-KKCP KKCP-1
AB284062
Psittacine
VS225
AF269259
M56
Muskrat, snowshoe hare
M56
AF269268
WC
Cattle
WC
AF269269
1 Va
Crow
1V
EF028916
Crow
6N
EF197820
Mat116
Psittacine, budgerigar
Mat116
AB284058
R54a
Antarctic skua
R54
AJ243525
Psittacine
Daruma-1981
AB284065
Stork
CPX0308
AB284064
6N
a
a
YP84
a
a
CPX0308
a
Additional genotypes proposed by Sachse and colleagues [14]
In this situation, the use of DNA microarray technology can

provide added value because of its potential to simultaneously
exploit minor sequence differences at multiple target sites. In the
present chapter, we describe a rapid genotyping assay using the
ArrayStrip (AS) platform that was shown to work with clinical
samples under the conditions of routine diagnosis [14, 15]. The
AS platform is open and flexible, so that iterative adaptation of
probes and extension beyond the currently covered genotypes will
always be possible, for instance, in the case of newly emerging
types. Comments on the platforms major performance parameters
394
and comparison with PCR-RFLP and ompA sequencing are given

in Note 1. While both sensitivity and specificity of the microarray
assay are high, its main assets include rapidity, ease of operation,
and the possibility of mixed genotype identification, as well as
high-throughput and moderate costs. An AS unit consists of eight
connected plastic vessels in microtiter format, each of which carrying a microarray chip on the bottom.
The present genotyping procedure is based on target DNA
being amplified using duplex PCR with 5-biotinylated primers to
generate a 418-bp product encompassing VD1 and VD2, as well as
a 570-bp fragment covering VD3 and VD4. Subsequently, the
amplification products are subjected to hybridization on the microarray. Based on the analysis of ompA sequences described above, 35
hybridization probes derived from the discriminatory sites of VD2
and VD4 were selected. They had an average size of 26 nt (2230),
average melting temperature of 60.3 C (59.761.2), and G + C
contents of 46.0 mol % (37.059.0).
Similarly, an ompA genotyping microarray assay was developed
for C. trachomatis [16]. Variable domains 1, 2, and 4 of the ompA
locus were amplified using a multiplex PCR with biotinylated primers. A total of 61 oligonucleotide probes representing genotypespecific polymorphisms in the same variable domains were included.
2
2.1
Materials
DNA Extraction
2.2 Biotinylation
PCR and Agarose Gel
Electrophoresis
Commercially available DNA extraction kit for PCR template

preparation. We use the High Pure PCR Template Preparation Kit
(Roche Diagnostics, Mannheim, Germany) for cultured strains
and nearly all kinds of tissue samples, e.g., nasal, vaginal, and conjunctival swabs, mucus, bronchoalveolar lavage, organs, feces, and
milk.
1. Water. Deionized water must be used throughout.
2. PCR reagents. We use the QIAGEN Multiplex PCR Kit
(QIAGEN, Hilden, Germany) according to the instructions of
the manufacturer (see Note 2).
3. Primers. Sequences, primer concentrations, and other parameters are given in Table 2. The oligonucleotides are stored at
20 C in 100 M stock solutions. The concentration of
primer working solutions is 10 M.
4. Agarose, molecular biology grade: 1.5 % (w/v) gels for the
PCR products mentioned in Table 2.
5. Trisborate EDTA electrophoresis buffer (TBE): 0.09 M Tris
borate, 0.002 M EDTA, pH 8.0. For 1 L of 10 TBE, mix
108 g of Tris-base, 55 g of boric acid, and 80 mL of 0.25 M
EDTA, make up with water. Dilute 1:10 before use.
395
Table 2
Primers for ompA genotyping of C. psittaci and C. trachomatis
Designation
Nucleotide sequence (5-3)a
Amount per Amplicon

reaction (L)b size (bp)
C. psittaci
VD1-fw
5-ACT ACG GAG ATT ATG TTT TCG ATC

GTG T-3
VD2-rev
5-Bio-CGT GCA CCY ACG CTC CAA GA-3
201CHOMP
5-GGI GCW GMI TTC CAA TAY GCI CAR

TC-3
ompA-rev
5-Bio-TCC TTA GAA TCT GAA TTG AGC-3
418 bp
570 bp
C. trachomatis
Trach-VD1-fw 5-Bio-ACC AAG CCT TAT GAT CGA C-3
326 bp
Trach-VD1-rev 5-Bio-AGA ATA CAT CAA AAC GAT CCC A-3 1

Trach-VD2-rev 5-Bio-TTG AGC ATA TTG GAA AGA AGC-3
572 bp (with
Trach-VD1-fw)
Trach-VD4-fw 5- Bio-CTT ACA TTG GAG TTA AAT GGT

CT-3
231 bp
Trach-VD4-rev 5-Bio-CTA CTG CAA TAC CGC AAG A-3
Bio: oligonucleotide biotinylated at 5-end

The concentration of primer working solutions is 10 pmol/L (10 M)
6. Gel loading buffer (GLB): 20 % (v/v) glycerol, 0.2 M EDTA,

0.01 % (w/v) bromophenol blue, 0.2 % (w/v) Ficoll 400.
7. Ethidium bromide stock solution: 1 % (10 mg/mL) solution
in water. CAUTION: The substance is presumed to be mutagenic. Avoid direct contact with skin. Wear gloves when preparing solutions and handling gels.
8. DNA size marker. We mostly use the ORange Ruler (100-bp
ladder) (Fermentas, St. Leon-Rot, Germany).
2.3 DNA Microarray
Hybridization
2.4 General
Equipment
and Consumables
The Identibac Hybridisation Kit (Alere Technologies, Jena,

Germany) contains all necessary reagents and is the most efficient
and convenient option (see Note 3): hybridization buffer (C1),
washing buffers (C2, C5), streptavidin-peroxidase conjugate
(C3 + C4), and TMB-substrate (D1).
1. ArrayMate transmission reader (Alere Technologies, Jena,
Germany).
2. Iconoclust software, version 2.3 or higher (Alere Technologies,
Jena, Germany).
396
3. Chlamydia ArrayStrips, version 4 or higher (layout Chlam_

gesamt_4_AS) (Alere Technologies, Jena, Germany). These
arrays are commercially available from Alere. The company
also has a service for ordering customized arrays. The sequences
of the oligonucleotide probes immobilized on these arrays
were previously published in Sachse et al. [14] (C. psittaci
assay) and Ruettger et al. [16] (C. trachomatis assay).
4. Heatable horizontal tube shaker. We recommend the Bioshake
iQ (Quantifoil Instruments, Jena, Germany; see Note 4).
5. Thermal cycler. We use the Mastercycler personal (Eppendorf,
Hamburg, Germany).
6. Vortex shaker, e.g., Vortex 1 (IKA Labortechnik, Staufen,
Germany).
7. Benchtop centrifuge with rotor for 0.2 mL or 0.5 mL plastic
tubes, e.g., Centrifuge 5415R (Eppendorf, Hamburg,
Germany).
8. Apparatus for horizontal gel electrophoresis.
9. UV transilluminator, 254 nm and/or 312 nm.
10. Video documentation or photographic equipment.
11. Set of pipettes covering the whole volume range from 0.1 to
1,000 L. We use the Eppendorf Research series (Eppendorf,
Hamburg, Germany).
12. Aerosol-resistant pipette tips (filter tips).
13. Plastic tubes 0.2 mL or 0.5 mL, sterile, thin-walled, DNaseand RNase-free for PCR.
14. Plastic tubes 1.7 mL and 2.0 mL for pre-PCR operations.
Methods
3.1
DNA Extraction
3.2
Biotinylation PCR
Follow the protocol given by the commercial supplier of the DNA

extraction kit.
1. The reaction volume is 20 L. For each amplification, pipette
10 L of Master Mix solution of the QIAGEN Multiplex PCR
Kit and the amount of primers as given in Table 2, and make
up with water to 19 L.
2. Add template to each reaction vessel: 1 L of DNA extract
from your sample. If the DNA contents of the extract is low,
up to 4 L of sample DNA can be used and the amount of
water be reduced accordingly.
3. Include external amplification controls: DNA of a chlamydial
reference strain (positive control) and water (reagent control)
instead of sample extract.
397
4. Run PCR according to the following temperature-time profile:

Initial denaturation at 95 C for 15 min, 40 cycles of denaturation (94 C for 30 s), primer annealing (50 C for 90 s) and
primer extension (72 C for 90 s), final extension at 72 C for
10 min.
5. Run agarose gel electrophoresis. Correct amplification leads to
the formation of two products in the case of C. psittaci and
three products in the case of C. trachomatis. Amplicon sizes are
given in Table 2.
3.3 DNA Microarray
Hybridization
1. Transfer 1 L of the PCR product from Subheading 3.2 into a

1.7-mL plastic tube and add 99 L of hybridization buffer
(Buffer C1).
2. Denature DNA by heating at 95 C for 5 min. Cool down
immediately by putting the tube on ice for 1 min. Spin down
the liquid by short centrifugation.
3. Condition the ArrayStrip by adding 100 L of water to each
well. Rinse by pipetting the liquid up and down four times,
and then discard it.
4. Add 100 L of buffer C1 to each well, and shake on Bioshake
iQ at 48 C and 550 RPM for 5 min. Remove liquid.
5. Hybridization. Add the hybridization mix (100 L each) from
step 2 to AS wells. Incubate on Bioshake iQ at 48 C and
550 rpm for 60 min. Remove supernatant and discard it.
6. Add 200 L of washing buffer C2 to each well, and wash at
48 C and 550 rpm for 10 min. Remove liquid and discard it.
7. Repeat step 6.
8. Combine 792 L of C4 and 8 L of C3 solutions (horseradish
peroxidase conjugated with streptavidin) in a plastic tube, vortex, and spin down. The amount is for a single AS unit, i.e., 8
wells. Add 100 L of this mix to each well. Incubate at 30 C
and 550 rpm for 10 min. Remove supernatant.
9. Wash wells by adding 200 L of washing buffer C5 and 4 times
up-and-down pipetting at room temperature. Remove all the
liquid thoroughly and completely.
10. Add 100 L of D1 solution (peroxidase substrate) to each
well, and incubate at room temperature for 5 min.
11. Remove liquid and put AS into the ArrayMate reader.
3.4
Data Processing
1. Conduct the reading process according to the instructions for

the ArrayMate equipment.
2. Transfer the image files (bmp format) to your computer and
process the data using the Iconoclust software.
3. Determine the genotype using the PatternMatch algorithm of
the software (see Note 5).
398
Notes
1. Genotyping analysis using the AS assay can be accomplished
within a working day (68 h). This renders the procedure
faster than PCR-RFLP and ompA sequencing. Furthermore,
AS genotyping is easy to handle as it mainly involves standard
laboratory equipment and requires less hands-on time than
PCR-RFLP and less experience than sequencing. The expenses
for consumables are moderate, and the equipment costs considerably less (about 25 %) than that for DNA sequencing. The
microarray technology is manageable in a high-throughput
environment, with up to 32 samples per day and technician.
2. Amplification can also be accomplished using standard PCR
reagents and preparing the reaction mixes in the usual way.
The main arguments in favor of using the present kit are that it
is convenient to use as it contains all reagents and that the
commercial mix is optimized for high yield.
3. Alternatively, buffers can be prepared manually according to
the protocols published previously [14, 15].
4. For the sake of high specificity and stringency of the hybridization reaction, it is extremely important to ensure that the prescribed temperatures are actually attained in the AS vessel itself.
This requires heat transfer from the heatable shaker to the
liquid contents of the AS vessel to be very rapid and efficient.
Most of the commercially available shakers are too slow, so that
too much time (and, consequently, specificity) is lost until the
necessary in-tube temperature has been reached. In our hands,
the Bioshake iQ fulfills the criteria to be used in the hybridization process.
5. The PatternMatch algorithm compares the experimentally
obtained signal pattern with those of reference strains representing the genotypes of C. psittaci or C. trachomatis, respectively.
It provides combined bar diagrams of sample and reference (see
an example in Fig. 1), as well as two numerical parameters to
assess the similarity of two patterns and the accuracy of identification. The matching score (MS) represents the sum of numerical differences between corresponding signal intensities of
sample and theoretical and/or practical reference hybridization
patterns. Thus, the MS value is a measure of the overall dissimilarity between two hybridization patterns. An ideal match of
two patterns based on the same set of oligonucleotide probes
would yield MS = 0, but practical values can be in the order of
100. Prior to the examination of field samples, the user should
run a series of samples of known genotypes in order to determine the practical MS range and set the upper threshold,
above which the best match is no more valid for genotyping.
399
Fig. 1 Identification of the ompA genotype of the C. psittaci strain from the feces sample of a diseased pigeon
(sample ID 11G1376). Using the PatternMatch function of the software, the experimentally obtained hybridization pattern of the sample (black bars) is compared to the closest match of a panel of reference strains, i.e., type
strain CP3 of genotype B (gray bars). The matching score (MS) of 154.12 is a measure of dissimilarity between
sample and reference, and the Delta MS value of 1.2 represents the numerical difference between best and
second best match. These values confirm that the assignment of the present sample to genotype B is valid
The second parameter is the arithmetic difference between best

and second best match, termed Delta MS, and indicates the reliability of a given genotyping result. Values of Delta MS 0.5 are
regarded as representing a sufficient degree of distinction
between best and second best matches.
References
1. Harkinezhad T, Geens T, Vanrompay D (2009)
Chlamydophila psittaci infections in birds: a
review with emphasis on zoonotic consequences. Vet Microbiol 135:6877
2. Gaede W, Reckling K-F, Dresenkamp B et al
(2008) Chlamydophila psittaci infections in
humans during an outbreak of psittacosis from
poultry in Germany. Zoonoses Public Health
55:184188
3. Laroucau K, de Barbeyrac B, Vorimore F et al

(2009) Chlamydial infections in duck farms
associated with human cases of psittacosis in
France. Vet Microbiol 135:8289
4. Andersen AA (1991) Serotyping of Chlamydia
psittaci
isolates
using
serovar-specific
monoclonal antibodies with the microimmunofluorescence test. J Clin Microbiol 29:
707711
400
5. Sayada C, Andersen AA, Storey C et al (1995)

Usefulness of omp1 restriction mapping for
avian Chlamydia psittaci isolate differentiation.
Res Microbiol 146:155165
6. Vanrompay D, Butaye P, Sayada C, Ducatelle
R, Haesebrouck F (1997) Characterization of
avian Chlamydia psittaci strains using omp1
restriction mapping and serovar-specific monoclonal antibodies. Res Microbiol 148:327333
7. Geens T, Dewitte A, Boon N, Vanrompay D
(2005) Development of a Chlamydophila psittaci species-specific and genotype-specific realtime PCR. Vet Res 36:787797
8. Andersen AA (1997) Two new serovars of
Chlamydia psittaci from North American birds.
9. Vanrompay D, Andersen AA, Ducatelle R,
Haesebrouck F (1993) Serotyping of European
isolates of Chlamydia psittaci from poultry and
other birds. J Clin Microbiol 31:134137
10. Geens T, Desplanques A, Van Loock M et al
(2005) Sequencing of the Chlamydophila psittaci ompA gene reveals a new genotype, E/B,
and the need for a rapid discriminatory genotyping method. J Clin Microbiol 43:24562461
11. Wang SP, Grayston JT (1991) Serotyping of

Chlamydia trachomatis by indirect fluorescentantibody staining of inclusions in cell culture
with monoclonal antibodies. J Clin Microbiol
29:12951298
12. Kauffold J, Melzer F, Berndt A et al (2006)
Chlamydiae in oviducts and uteri of repeat
breeder pigs. Theriogenology 66:18161823
13. Sachse K, Kuehlewind S, Ruettger A, Schubert
E, Rohde G (2012) More than classical
Chlamydia psittaci in urban pigeons. Vet
14. Sachse K, Laroucau K, Hotzel H et al (2008)
Genotyping of Chlamydophila psittaci using a
new DNA microarray assay based on sequence
analysis of ompA genes. BMC Microbiol 8:63
15. Sachse K, Laroucau K, Vorimore F et al (2009)
DNA
microarray-based
genotyping
of
Chlamydophila psittaci strains from culture and
clinical samples. Vet Microbiol 135:2230
16. Ruettger A, Feige J, Slickers P et al (2011)
Genotyping of Chlamydia trachomatis strains
from culture and clinical samples using an
ompA-based DNA microarray assay. Mol Cell
Probes 25:1927
Chapter 29
Multiplexed Genotyping ofBacillus anthracis by Luminex
xMap Suspension Array
SimonThierry andSylvianeDerzelle
Abstract
The Luminex xTAG technology is a medium to high throughput, open methodology able to test many single
nucleotide polymorphisms (SNPs) in a single reaction and a minimum time. Multiplex SNPs interrogation are
conducted on the Luminex xMAP system, which uses lasers to read universal tag, color-coded microspheres
that attach to specific nucleic acid sequences. The present method describes a Multiplex Oligonucleotide
Ligation-PCR procedure (MOL-PCR) for the simultaneous interrogation of 13 phylogenetically informative
SNPs within the genome of Bacillus anthracis. The reported 13-plex assay enables efficient B. anthracis genotyping into major sublineages and groups. While cost-effective compared to other monoplex methods, the
present MOL-PCR method also offers a high degree of flexibility and scalability. It can easily accommodate
newly identified SNPs to increase resolving power to the canSNP typing of B. anthracis.
Key words Bacillus anthracis, Genotyping, SNP, MOL-PCR, Suspension microarray, Luminex
1 Introduction
Single nucleotide polymorphisms (SNPs) represent a major source of
genetic variation in Bacillus anthracis. Recently, a set of 14 representative SNPs that define major clades within the B. anthracis species
have been selected and used for assigning an isolate to one sublineages or subgroups [13]. These canonical SNPs (canSNPs) subdivided all B. anthracis isolates into three major lineages (A, B, and C),
with further subdivisions into seven distinct sublineages (C.Br.
A1055, B.Br.KrugerB, B.Br.CNEVA, A.Br.Ames, A.Br.Australia94,
A.Br.Vollum, A.Br.Western North America) and six subgroups (B.
Br.001/002, A.Br.001/002, A.Br.003/004, A.Br.005/006, A.
Br.008/011, A.Br.011/009). CanSNP analysis is currently considered the reference method in B. anthracis genotyping.
Several platforms and methods exist for SNP-based genotyping
[4, 5], including ultra-high-throughput array-based technologies,
such as those offered by Illumina [6] and Affymetrix [7]. But only
few of them are at the same time flexible, rapid (<1day), cost-effective,
401
402
and capable of detecting multiplexed signals simultaneously with

medium to high throughput [810]. The xMAP systems unique
liquid array technology is one of these platforms. This suspension array format implies the use of a set of up to 100 universal
tag-coupled, color-coded microspheres that allow the simultaneous capture and detection of many specific nucleic acid targets
from a sample. Once bound, the target DNA molecules are fluorescently tagged with streptavidin-R-phycoerythrin, and the beads
are individually analyzed by flow cytometry on the Luminex platform. A red laser recognizes the microsphere set, and a green laser
provides a quantitative readout of the reporter dye captured during
the assay [11]. Unlike with flat arrays, xMAP arrays give tight
inter-assay reproducibility. The microarray format exhibits rapid
hybridization kinetics and flexibility in assay design and is costeffective [10]. In addition, suspension microarrays can be compiled as desired by adding or replacing beads and probes without
having to reformat and print new arrays [12]. This represents a
clear advantage, knowing that new diagnostic SNPs that further
resolve B. anthracis population substructure are continuously published following the completion of a growing number of new
genome sequences [1317].
Conceptually related to multiplex ligation-dependent probe
amplification (MLPA) technique [18], the Multiplex
Oligonucleotide Ligation-PCR (MOL-PCR) is a smart method
adapted to the Luminex platform to carry out SNP multilocus
genotyping/SNP interrogation [19, 20]. In MOL-PCR, detection
probes (MOLigoP) consist of modular components that enable
target detection, probe amplification, and subsequent capture onto
microsphere arrays. MOL-PCR uses allele-specific ligation for
allele discrimination, monoplex PCR for signal amplification, and
hybridization to fluorescent microspheres (beads) for signal detection on a flow cytometer (see in Fig.1). The assay consists of three
main steps: (a) annealing of competitive MOLigo pairs P1 and
MOLigoP2 adjacent to each other on target canSNPs sequences
and ligation of the MOLigos by a thermostable DNA ligase if complementary to the target SNP, (b) amplification of the ligation
products (all ligated oligonucleotides) using universal primers, and
(c) hybridization of the amplicons to microspheres using xTAG
sequences complementary to anti-tag probes and signal detection
on the Luminex flow cytometer. In the 13-plex assay designed for
the simultaneous interrogation of 13 out of the 14 reported B.
anthracis lineage-specific canSNPs, a Dual Priming Oligonucleotide
(DPO) system [21] was also coupled to the MOL-PCR procedure
to increase assays specificity [22].
B. anthracis genotyping by Luminex array
Fig. 1 MOL-PCR general scheme
403
404
2 Materials
2.1 DNA Preparation
andBiosafety
Procedures
1. Bacillus anthracis is a class 3 pathogen and should be manipulated

in a BSL3 laboratory. Viability testing should be systematically
performed to assess the complete removal of live forms of B.
anthracis from DNA samples so that subsequent analysis could be
carried out safely at lower levels of biocontainment (see Note 1).
2. Template DNA(s): 510ng genomic DNA (see Note 2). Use
template DNA suitable for PCR in terms of purity, concentration, and absence of PCR inhibitors.
2.2 MOL-PCR
1. 10 Ampligase DNA Ligase Buffer (Epicentre, Madison, USA).

2. Ampligase DNA Ligase, 5U/L (Epicentre, Madison, USA)
(see Note 3).
3. A set of 39 modular single-stranded DNA oligonucleotides
(termed MOLigo probes): a pair of competing allele-specific
probes (MOLigoP1) and one common probe (MOLigoP2)
per canSNP (see Notes 4 and 5). 100M stock solutions
diluted in ultrapure water (see oligonucleotide sequences in
Table1). The 5-end of each MOLigoP2 probe is phosphorylated to enable covalent linkage to MOLigoP1in the presence
of DNA ligase and target DNA.
4. dNTP solution (100M).
5. 10 Taq Buffer (Qiagen, Courtaboeuf, France).
6. Hot Start Taq, 5U/L (Qiagen, Courtaboeuf, France).
7. Biotinylated Universal Forward primer (see primer sequence in
Table 1): 100M stock solutions. The primer is tagged with
three biotin moieties to guarantee sensitivity at the readout step.
8. Universal Reverse primer (see primer sequence in Table1):
100M stock solutions.
9. PCR-grade H2O: ultrapure water prepared by purifying deionized water, nuclease-free.
10. Thermocycler.
2.3 Luminex
Equipment
andReagents
1. Tm Hybridization Buffer 1.1 (THB 1.1): for a final volume

of 250mL, add 27.5mL of 1M TrisHCl, pH8.0; 11mL of
5M NaCl; 0.22mL Triton X-100; to 211.28mL of ultrapure
water (see Note 6). Mix until Triton is completely solubilized.
Filter the solution on a 0.22m membrane and store at 4C.
2. TE pH8: for a final volume of 1L, add 10mL of 1M Tris-
HCl, pH8.0; 2mL of 0.5M EDTA, pH8.0; to 988mL of
ultrapure water. Mix, autoclave, and store at 4C.
BA5 A.Br.006
BA4 A.Br.004
BA3 A.Br.003
A015
A028
B008
A027
A026
A022
A025
A021
A014
BA2 A.Br.002
B007
BA1 A.Br.001
P2
P1
P1
P2
P1
P1
P2
P1
P1
P2
P1
P1
P2
P1
P1
Allele MOLigo
xTAG
canSNP
5'P-AGGCGATGGAATGATCAACAACATATTGA TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT GTTGTAAATTGTAGTAAAGAAGTA
CGTTTTTAAGTTCATCATACCIIIIICATGCACG-3'
5'-ACTCGTAGGGAATAAACCGT TGTAAGTGAAATAGTGAGTTATTT
CGTTTTTAAGTTCATCATACCIIIIICATGCACT-3'
5'P-CCCTAATCCTTCCATAGCTCCACCA TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT GATAGATTTAGAATGAATTAAGTG
GACATCGCCGTCATACTTIIIIITGGAATGC-3'
5'-ACTCGTAGGGAATAAACCGT AAGATGATAGTTAAGTGTAAGTTA
GACATCGCCGTCATACTTIIIIITGGAATGT-3'
(continued)
5'P-TTGAGGTAGAAAAAGGAGGTTTTTATACAATGACA TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT TTTGATTTAAGAGTGTTGAATGTA
TGTATAAAAACCTCCTTTTTCTIIIIIACCTCAAA-3'
5'-ACTCGTAGGGAATAAACCGT GTATGTTGTAATGTATTAAGAAAG
TGTATAAAAACCTCCTTTTTCTIIIIIACCTCAAG-3'
5'P-TGGGCGGCAGTCGCTTTATC TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT GATTGATATTTGAATGTTTGTTTG
AGAAGGAGCAAGTAATGTTATAGIIIIIGTTTAGGT-3'
5'-ACTCGTAGGGAATAAACCGT ATTAAGTAAGAATTGAGAGTTTGA
AGAAGGAGCAAGTAATGTTATAGIIIIIGTTTAGGC-3'
5'P-TTGAAGTCGATGATAAAGGGAAACCGTATTATA TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT ATTGTGAAAGAAAGAGAAGAAATT
CAAATTTAATCTTTAAAGGAAAIIIIIACCGAAAT-3'
5'-ACTCGTAGGGAATAAACCGT AAATTGTGAAAGATTGTTTGTGTA
CAAATTTAATCTTTAAAGGAAAIIIIIACCGAAAC-3'
Sequence (5'-3')a
Table 1
Oligonucleotide sequences of all probes and primers used

405
A038
A036
A034
A035
A033
A018
BA10 B.Br.002 A037
BA9 B.Br.001
BA8 A.Br.009
B009
A030
BA7 A.Br.008
A029
BA6 A.Br.007
P1
P1
P2
P1
P1
P2
P1
P1
P2
P1
P1
P2
P1
P1
Allele MOLigo
xTAG
canSNP
Table 1
(continued)
5'-ACTCGTAGGGAATAAACCGT AGTAAGTGTTAGATAGTATTGAAT
ACCTTCTGTGTTCGTTGTTAAIIIIICGTTACTG-3'
5'-ACTCGTAGGGAATAAACCGT TGTATATGTTAATGAGATGTTGTA
ACCTTCTGTGTTCGTTGTTAAIIIIICGTTACTT-3'
5'P-TCTTCTATTGTACCGATTTCTTTTATGACCG TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT TTGTGTAGTTAAGAGTTGTTTAAT
CGGATATGATACCGATACCTIIIIITCTTATCT-3'
5'-ACTCGTAGGGAATAAACCGT AATAAGAGAATTGATATGAAGATG
CGGATATGATACCGATACCTIIIIITCTTATCC-3'
5'P-AAAGCCGTTCAAAAACAGTGGCC TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT TGATATAGTAGTGAAGAAATAAGT
AGGTATATTAACTGCGGATGIIIIIATGCAAGT-3'
5'-ACTCGTAGGGAATAAACCGT TATTAGAGTTTGAGAATAAGTAGT
AGGTATATTAACTGCGGATGIIIIIATGCAAGC-3'
5'P-CCGCTTGTTAAACGTATATTTGTAACTTTTTCAC TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT GTAATTGAATTGAAAGATAAGTGT
TATACGTTTTAGATGGAGATAIIIIIATTCTTCG-3'
5'-ACTCGTAGGGAATAAACCGT GAATTGTATAAAGTATTAGATGTG
TATACGTTTTAGATGGAGATAIIIIIATTCTTCT-3'
5'P-ATTCAGCTCGAATACTACCACCTTGTAATTC TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT GTGTTATAGAAGTTAAATGTTAAG
AGACGATAAACTGAATAATACCIIIIIATCCTTAC-3'
5'-ACTCGTAGGGAATAAACCGT TTTAAGTGAGTTATAGAAGTAGTA
AGACGATAAACTGAATAATACCIIIIIATCCTTAT-3'
Sequence (5'-3')a
406
P2
P1
P1
P2
P1
P1
P2
P1
P1
5'-ACTCGTAGGGAATAAACCGT-3'
5'BIOT-CGCGGTAGTAAGAAGTGAGA-3'
5'-P-ATTATTTTCAGCGGGAATTCGTTTCTTTTTAG TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT ATTTGTTATGATAAATGTGTAGTG
TTGAAGCAGGAIIIIIGCGCCCCC-3'
5'-ACTCGTAGGGAATAAACCGT TTGTGATAGTAGTTAGATATTTGT
TTGAAGCAGGAIIIIIGCGCCCCT-3'
5'P-TAGAAGTAAAGAAGGTTACCCAAGCACTTG TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT AAATTAGTTGAAAGTATGAGAAAG
TAAAATGAAGATAATGACAAAIIIIICGGGATGG-3'
5'-ACTCGTAGGGAATAAACCGT AGTGAATGTAAGATTATGTATTTG
TAAAATGAAGATAATGACAAAIIIIICGGGATGA-3'
5'P-CTTCACGTTATGGTTCGTTATGAACTTGAG TCTCACTTCTTACTACCGCG-3'
5'-ACTCGTAGGGAATAAACCGT GTGTGTTATTTGTTTGTAAAGTAT
GCATAGAAGCAGATGAGCTTAIIIIICATATCCA-3'
5'-ACTCGTAGGGAATAAACCGT AGTAGAAAGTTGAAATTGATTATG
GCATAGAAGCAGATGAGCTTAIIIIICATATCCG-3'
5'P-CTGTTCCTTTTGCAACTTCTCCTCCA TCTCACTTCTTACTACCGCG-3'
Sequence (5'-3')a
Primer, xTAG, and DNA target sequences of MOLigos are indicated, respectively, by underlined, italic and bold, and light gray sequences. The forward primer is biotinylated
at its 5 end and at two internal T nucleotides (positions are underlined and indicated in bold). The 5-end of each MOLigoP2 probe is phosphorylated
Reverse
A042
Forward
BA14 A.Br.011 A039
A020
A019
BA12 B.Br.004 A013
P2
Allele MOLigo
xTAG
BA11 B.Br.003 A012
canSNP

407
408
3. 26 MagPlex beads (Luminex, Austin, USA) with a unique

spectral signature (see region names and tag-coated sequences
in Table1). Store at 28C.
4. Streptavidin-phycoerythrin (SA-PE) 100 (Bio-Rad, Hercules,
USA) (see Note 3). Store at 28C.Keep away from light.
5. Luminex 200 (Luminex, Austin, USA) or BioPlex 200 platform (Bio-Rad, Hercules, USA).
3 Methods
Carry out all procedures at room temperature.
Each experiment must include two controls for the calculation
of signal-to-noise ratio: a bead-only control that reports background fluorescence obtained from the microspheres alone and a
no template PCR control (H2O) that reports cross reactivity
between MOLigo pairs in the absence of any DNA template.
3.1 MOLPCRMethod
1. Prepare ligation and amplification mixes for all samples,

including two, no template, PCR controls (see Notes 7 and
8), as follows:
2. The ligation mix includes 5U of Ampligase DNA ligase,
0.1nmol of each MOLigo probe (see Table1) and 1
Ampligase DNA Ligase Buffer. Make up to 8l per reaction
with TE buffer.
3. The amplification mix includes 2.5U of Hot Start Taq polymerase, 2.5M of each dNTP, 1 Taq Buffer, 100pmol of biotin-labeled Universal Forward primer, and 2pmol of Universal
Reverse primer. The total PCR volume is 12l per reaction.
4. Aliquot 8L of ligation mix to wells or PCR microtubes and
store the amplification mix at 4C until use.
5. Add 2L of template DNA (sample) to each ligation mix reaction or 2L of ultrapure water to PCR negative controls wells.
6. Run the ligation step using the following thermocycling
parameters: DNA denaturation at 95C for 5min, followed
by 10 ligation cycles of 60C for 5min and 95C for 2min,
and a final ligase denaturation step at 98C for 5min.
7. Aliquot 12L of amplification mix to new PCR microtubes or
multiwell plate.
8. Add 8L of the ligation products.
9. Run the amplification step as follows: 95C for 15min, 45
cycles of 95C for 30s, 55C for 30s, and 72C for 30s.
Reactions are then cooled to 4C and either used immediately
in the bead hybridization step or stored at 20C before proceeding with the hybridization step.
3.2 Hybridization
onBeads andSA-PE
Incubation
409
1. Equilibrate the MagPlex beads and the THB 1.1 at room

temperature (see Note 9).
2. Prepare enough mix of 26 MagPlex beads to perform all analyses in duplicate, including the two no template PCR controls
and an additional bead-only control that reports background
fluorescence obtained from the microspheres alone. Dilute
1,250 magnetic beads of each region (see Note 10) in 32L
of THB 1.1 solution per reaction. A final volume of 45L is
obtained. Turn on the Luminex platform and equilibrate the
calibration beads at room temperature (see Note 11).
3. When the lasers are warmed up, perform a calibration of the
system as recommended by the manufacturer (see Note 12)
and set the platform heater to 52C.
4. Vortex, then sonicate the MagPlex beads, and mix briefly
(about 20s each step).
5. Aliquot 45L of this mix into a multiwell plate. The no template PCR and only-bead controls (in duplicate) have to be
clearly separated from the other samples to avoid cross
contamination.
6. Add 5L of amplicons (or water for the only-beads controls)
to each well. Seal and vortex briefly.
7. Run the bead hybridization thermocycling program: 95C for
2min followed by array hybridization at 52C for 30min.
8. Separate the beads from the supernatant (see Note 13).
9. Prepare a SA-PE mix at a final concentration of 3 by dilution in
THB 1.1. The final volume is 75L per reaction (see Note 14).
10. Resuspend the pelleted MagPlex-TAG microspheres in 75L
SA-PE mix.
11. Briefly vortex the plate until the pellet is totally resuspended.
12. Incubate at 52C for 15min in the Luminex platform.
3.3 Luminex Readout
1. Run the protocol on the Luminex platform, using the reading

of 100 beads per region setting (see Notes 11 and 15).
2. When the run is over, export the results in Excel file for data
analysis.
3. Rinse and shut down the system according to manufacturer
recommendations.
3.4 Data Analysis
The standard workflow to analyze Luminex output data has four

basic steps:
1. Correct raw Mean Fluorescence Intensity (MFI) values by
subtracting the MFI values of the bead-only control. All resulting negative MFI values are set to 1.
410
2. Determine the absolute minimal threshold value of the run by

calculating the median values of all no template PCR controls
(MFIH2O). No template PCR control values (MFIH2O_allele) below
that threshold are replaced by the threshold value in Eq.1. This
step avoids SNP calling failure linked to excessive variations
observed between no template PCR controls values.
3. Calculate an allelic ratio (AR) for each biallelic canSNP and
sample to genotype according to Eq.1 [20]:
( MFI allele1 / MFI H 2O _ allele1 )

AR = ( MFI allele1 / MFI H 2O _ allele1 ) /
+ ( MFI allele 2 / MFI H 2O _ allele 2 )
(1)
4. Assign allele calling using the following general rules: SNP is

called allele 2 if the AR is less than 0.4 (AR<0.4) and allele
1 if it is greater than 0.6 (AR>0.6). Between both AR values,
manual inspection of raw data is used for allele calling.
4 Notes
1. Viability testing can be performed by spreading an aliquot of
each DNA preparation on blood agar Petri Dish and incubation at 37C for 1824h. In case of growth, perform microfiltration and repeat viability step.
2. Assay limit of detection was determined to be 2ng of genomic
DNA per ligation reaction.
3. The supplier of DNA ligase (Epicentre) and streptavidin-
phycoerythrin (Bio-Rad) is critical for the method. Use the
specified products.
4. MOLigoP1 probes contains three functional components that
allow (a) detection of target sequences, (b) universal amplification of successfully ligated probes, and (c) capture of amplified products onto a microsphere array. Each pair contains a
5-end universal PCR Reverse primer sequence common for
all the different MOLigoP1, an internal 24bpxTAG sequence
unique for each MOLigoP1 probe for capture to conjugated
xTAG microsphere, and a 3-end sequence complementary to
the specific target DNA including the allele-specific nucleotide
(SNP) at its 3 end. To improve allele specificity, the 3 specific
target sequence is separated into two distinct priming regions
by a polydeoxyinosine (Poly(I)) linker, according to the DPO
principle [21]. The longer 5 segment initiates stable priming.
The shorter 3 segment determines target-specific extension
and SNP discrimination).
411
5. MoLigoP2 probes consist of two sequences: the 5-end reverse

complement of a Universal Forward primer and a 3-end
locus-specific portion complementary to the specific target
sequence located just after the SNP.
6. Use the reagent at room temperature to facilitate Triton
X-100 mixing.
7. Prepare n+1 ligation and amplification mixes to ensure sufficient volume for all samples (n=number of strains to genotype+2 no template controls).
8. Vortex both mixtures thoroughly; it has to be homogenous as
much as possible.
9. Keep the MagPlex beads away from light as much as possible
during all the processes.
10. The canSNP genotyping assay implies 26 different bead

regions. Two unique anti-xTAG bead regions are associated
with each biallelic-specific canSNP and the corresponding
competitive MOLigoP1 pair (see Table1).
11. The Luminex system needs 30min to warm up the lasers; this
also applies to the calibration beads.
12. We recommend calibrating the system once per day of use.
13. Three different methods of separation are recommended by
the manufacturer: using a magnetic plate separator, an automatic plate washer, or centrifugation. In the last case, pellet
the MagPlex-TAG microspheres by centrifugation at
2,250g for 3min and remove the supernatant.
14. The SA-PE mix is very sensitive to light, so use a dark tube or
keep it in the dark as much as possible.
15. To enhance the signal, use the option Run at High RP1
Target in the software (if available).
Acknowledgments
This research was supported by/executed in the framework of the

EU-project AniBioThreat (Grant Agreement: Home/2009/
ISEC/AG/191) with the financial support from the Prevention of
and Fight against Crime Programme of the European Union,
European CommissionDirectorate General Home Affairs. This
publication reflects the views only of the author, and the European
Commission cannot be held responsible for any use which may be
made of the information contained therein.
412
References
1. Pearson T, Busch JD, Ravel J etal (2004)
Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms
from whole-genome sequencing. Proc Natl
Acad Sci U S A 101:1353613541
2. Marston CK, Allen CA, Beaudry J etal (2011)
Molecular epidemiology of anthrax cases associated with recreational use of animal hides and
yarn in the United States. PLoS One 6:e28274
3. Van Ert MN, Easterday WR, Huynh LY etal
4. Kim S, Misra A (2007) SNP genotyping: technologies and biomedical applications. Annu
Rev Biomed Eng 9:289320
5. Kwok PY (2001) Methods for genotyping single nucleotide polymorphisms. Annu Rev
Genomics Hum Genet 2:235258
6. Gunderson KL, Steemers FJ, Ren H etal
(2006) Whole-genome genotyping. Methods
Enzymol 410:359376
7. Kennedy GC, Matsuzaki H, Dong S etal
(2003) Large-scale genotyping of complex
DNA.Nat Biotechnol 21:12331237
8. Price EP, Matthews MA, Beaudry JA etal
(2010) Cost-effective interrogation of single
nucleotide polymorphisms using the mismatch
amplification mutation assay and capillary electrophoresis. Electrophoresis 31:38813888
9. Bruse S, Moreau M, Azaro M, Zimmerman R,
Brzustowicz L (2008) Improvements to bead-
based oligonucleotide ligation SNP genotyping assays. Biotechniques 45:559571
10. Dunbar SA (2006) Applications of Luminex
xMAP technology for rapid, high-throughput
multiplexed nucleic acid detection. Clin Chim
Acta 363:7182
11. Dunbar SA, Vander Zee CA, Oliver KG, Karem
KL, Jacobson JW (2003) Quantitative, multiplexed detection of bacterial pathogens: DNA
and protein applications of the Luminex
LabMAP system. J Microbiol Methods
53:245252
12. Janse I, Bok JM, Hamidjaja RA, Hodemaekers
HM, van Rotterdam BJ (2012) Development
and comparison of two assay formats for parallel
detection of four biothreat pathogens by using

suspension microarrays. PLoS One 7:e31958
13. Kenefic LJ, Pearson T, Okinaka RT etal (2009)
Pre-Columbian origins for North American
anthrax. PLoS One 4:e4813
14. Kuroda M, Serizawa M, Okutani A, Sekizuka
T, Banno S, Inoue S (2010) Genome-wide
single nucleotide polymorphism typing method
for identification of Bacillus anthracis species
and strains among B. cereus group species. J
15. Birdsell DN, Pearson T, Price EP etal (2012)
Melt analysis of mismatch amplification mutation assays (Melt-MAMA): a functional study
of a cost-effective SNP genotyping assay in
bacterial models. PLoS One 7:e32866
16. Van Ert MN, Easterday WR, Simonson TS etal
(2007) Strain-specific single-nucleotide polymorphism assays for the Bacillus anthracis
Ames strain. J Clin Microbiol 45:4753

17. Girault G, Madani N, Derzelle S (2013)
Anthrax in France: a pangenomic study. In:
Bacillus ACT 2013, Victoria, Canada
18. Schouten JP, McElgunn CJ, Waaijer R etal
(2002) Relative quantification of 40 nucleic
acid sequences by multiplex ligation-dependent
probe amplification. Nucleic Acids Res 30:e57
19. Deshpande A, Gans J, Graves SW etal (2010)
A rapid multiplex assay for nucleic acid-based
diagnostics. J Microbiol Methods 80:155163
20. Stucki D, Malla B, Hostettler S etal (2012)
Two new rapid SNP-typing methods for classifying Mycobacterium tuberculosis complex
into the main phylogenetic lineages. PLoS One
7:e41253
21. Chun JY, Kim KJ, Hwang IT etal (2007) Dual
priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP
genotyping of CYP2C19 gene. Nucleic Acids
Res 35:e40

22. Thierry S, Hamidjaja RA, Girault G etal
(2013) A Multiplex bead-based suspension
array assay for interrogation of phylogenetically
informative single nucleotide polymorphisms
for Bacillus anthracis. J Microbiol Methods
95(3):357365
Part IV
Integrative Omics and High-Throughput Platforms to Unravel
the Biology of Pathogens and Their Interaction with the Host
Chapter 30
Next-Generation Sequencing in Veterinary Medicine: How
Can the Massive Amount of Information Arising from HighThroughput Technologies Improve Diagnosis, Control,
and Management of Infectious Diseases?
Steven Van Borm, Sndor Belk, Graham Freimanis, Alice Fusaro,
Fredrik Granberg, Dirk Hper, Donald P. King, Isabella Monne,
Richard Orton, and Toon Rosseel
Abstract
The development of high-throughput molecular technologies and associated bioinformatics has dramatically
changed the capacities of scientists to produce, handle, and analyze large amounts of genomic, transcriptomic, and proteomic data. A clear example of this step-change is represented by the amount of DNA
sequence data that can be now produced using next-generation sequencing (NGS) platforms. Similarly,
recent improvements in protein and peptide separation efficiencies and highly accurate mass spectrometry
have promoted the identification and quantification of proteins in a given sample. These advancements in
biotechnology have increasingly been applied to the study of animal infectious diseases and are beginning to
revolutionize the way that biological and evolutionary processes can be studied at the molecular level. Studies
have demonstrated the value of NGS technologies for molecular characterization, ranging from metagenomic characterization of unknown pathogens or microbial communities to molecular epidemiology and
evolution of viral quasispecies. Moreover, high-throughput technologies now allow detailed studies of hostpathogen interactions at the level of their genomes (genomics), transcriptomes (transcriptomics), or proteomes (proteomics). Ultimately, the interaction between pathogen and host biological networks can be
questioned by analytically integrating these levels (integrative OMICS and systems biology). The application
of high-throughput biotechnology platforms in these fields and their typical low-cost per information content
has revolutionized the resolution with which these processes can now be studied.
The aim of this chapter is to provide a current and prospective view on the opportunities and challenges associated with the application of massive parallel sequencing technologies to veterinary medicine,
with particular focus on applications that have a potential impact on disease control and management.
Key words Next-generation sequencing, Animal infectious disease management, OMICS
The Epi-SEQ consortium (www.epi-seq.eu)
415
416
Steven Van Borm et al.
Introduction
Genetic characterization of infectious agents plays a central role in
the diagnosis, monitoring, and control of infectious diseases. The
development of rapid DNA sequencing methods based on the
selective incorporation of chain-terminating dideoxynucleotides
([1]; later termed first-generation sequencing technologies) and
the polymerase chain reaction (PCR) DNA amplification technologies ([2]; reviewed in [3]) has paved the way for the study of biological and evolutionary processes at the molecular level. Such
technologies have been extensively applied to the diagnosis and
molecular epidemiology of infectious diseases of livestock and
become important tools for targeted research on host-pathogen
interactions. The most recent versions of these first-generation
sequencing technologies are widely accessible and provide highquality data. However, their application to projects such as whole
genome sequencing is expensive and time-consuming, often
requiring prior knowledge of the target genome for specific template amplification. These limitations have been particularly problematic for large sequencing projects and have motivated the
development of alternative, post-Sanger sequencing technologies
(next-generation sequencing or NGS).
Next-generation sequencing platforms provide unprecedented
throughput, generating hundreds of gigabases of data in a single
experiment. Although the initial capital investment and cost per
experiment remain high, the price per information unit (nucleotide) has been dramatically reduced in comparison with firstgeneration sequencing. Moreover, these technologies allow
unbiased sequencing without prior knowledge of the complete
DNA content in a sample while retaining the flexibility to allow for
targeted sequencing.
This paradigm shift in the scale of DNA sequence data has
revolutionized the way biological and evolutionary processes can
be studied at the molecular level, enabling genome projects previously restricted to high profile model organisms and human
pathogens to target pathogens of lesser economic and medical
significance.
Such advancements are now being increasingly applied to veterinary medicine. As a result, the increasing availability of these
technologies combined with the rapid development of applied
tools and protocols has provided a diverse array of applications for
use in genomics and transcriptomics and even routine diagnostics.
In this chapter, we review recent advances in NGS technologies that are becoming commonplace in many laboratories, with an
emphasis on the applications that have the potential to significantly
impact on diagnosis, prevention, and control of infectious diseases
in animals.
Next-Generation Sequencing in Infectious Disease Management
2
2.1
417
Massive Parallel Sequencing

Technologies
A number of different NGS platforms are currently available, with

each utilizing different sequencing chemistries and detection strategies. This has led to individual systems having their own strengths
and limitations (reviewed in [46]). Second-generation sequencing
platforms vary in technology and chemistry used but have the
following properties in common:
A DNA library is made from the sample. This library is either

representing all DNA in sample without prior knowledge or a
targeted library using PCR amplification or alternative enrichment methods. Adapter sequences are joined to the DNA molecules (by ligation or amplification) and can include a barcode
sequence that allows multiplexing of several samples in an
experiment.
Individual DNA molecules in each library are clonally

amplified.
Clonal DNAs are sequenced by massive parallel sequencing.
Hundreds of thousands of DNA sequence reads result and

need to be processed.
The second-generation sequencing platforms first emerged on

the market with an emphasis on extreme high-throughput sequencing applications and initially were restricted to genome sequencing
centers or core facilities. These technologies use different detection
principles including pyrosequencing (454 Life Sciences, acquired
by Roche, available since 2005, but planned to be discontinued by
mid-2016), Illuminas sequencing by synthesis (previously Solexa,
available since 2007), SOLiD ligation-based sequencing (Life
Technologies, available since 2006), and, more recently, the Ion
Torrent semiconductor sequencing technology. Over the last 57
years, all of the major platforms have made significant improvements, with notable advancements made in terms of protocol complexity, overall performance (including read length, fidelity, lower
input DNA), and cost efficiency. More recently, smaller benchtop
sequencers [7] have become available, making the technology
more accessible for use in routine microbiology laboratories, while
academic core facilities and commercial service providers focused
increasingly upon providing users with access to a wider diversity
of the sequencing technologies available. These developments will
bring NGS technologies within the reach of many more research
groups and diagnostic laboratories where NGS analysis of a single
isolate will generate significant quantities of data, many orders of
magnitude greater than that generated by other typing methods.
In addition to the continuous improvement of existing platforms, newer methodologies are being developed. Third-generation
sequencing technologies are defined as single-molecule sequencers
418
(reviewed in [6, 8]). These approaches promise additional advantages

such as scalability, simplicity, long read length, and low operational
costs and do not require clonal amplification of template DNA molecules, thereby removing potential errors associated with clonal
amplification. A single third-generation platform is currently available
on the market since 2011 (PacBio, Pacific Biosciences) that sequences
long single DNA molecules in real time, known as SMRT sequencing. Other technologies are still under development (e.g., [4]) such
as DNA sequencing in nanopores that offer the potential of simple,
inexpensive, single-molecule sequencing in miniaturized or highly
scalable devices [9]. Although substantial validation data is still
required, these technologies have the potential to make NGS even
more widely available in diagnostic labs.
2.2
Challenges
While the advantages of NGS are numerous (unprecedented scale of

genomic information, scalability, low-cost per information content,
and high throughput), several challenges remain to be addressed.
Several processes in the NGS workflow, from sample selection
to data interpretation, are potentially vulnerable to bias and/or
error introduction (Fig. 1). This includes the error rates of the
Fig. 1 Steps in next-generation sequencing and data analysis workflows where error and bias introduction
may occur
419
Fig. 2 High-throughput technologies can be applied to numerous aspects of animal infectious diseases
sequencing chemistry and library construction, as well as point

mutations and insertions/deletions that may arise during reverse
transcription and PCR amplification. The amplification of DNA by
PCR to obtain clonal template sequences is subject to error introduction [8] and may result in an amplification bias impacting the
relative frequency of sequence variants present in the sample.
Sampling bias can be introduced when a relatively small number of
samples are analyzed per epidemiological unit (e.g., single animal
or herd) due to financial constraints restricting the thorough use of
NGS. When only a small proportion of the nucleic acids in a single
sample are subjected to sequence analysis, technical sampling bias
occurs. While NGS data provides a high resolution of an individual
sample, the resolution of higher epidemiological scales (Fig. 2)
may thus be compromised due to insufficient sampling. Moreover,
as a minimum amount of genetic material is needed as input for
NGS workflows, this can result in bias towards samples with the
highest pathogen titers. Errors and bias may also be introduced by
methods to increase the sensitivity of the workflow, such as targeted
pathogen genome amplification [1012] or enrichment (e.g., [13]).
420
Furthermore, reagent contamination has been reported to interfere with metagenomic analyses [14, 15]. Errors can also be made
during the sequencing process itself via base miscalls by NGS
machines. For example, the loss of synchronicity (dephasing) in a
percentage of the clonally amplified DNA template [16] results in
increased noise and sequencing errors [17, 8]. Each of the different NGS platforms available has its own distinct characteristics in
terms of read and error profiles, with the Illumina platform often
regarded as having the lowest error rate, while other platforms can
produce longer reads [7, 18, 19]. In addition, certain biases and
errors can be introduced during the analysis of NGS datasets, due
to the limitations of the algorithms or reference data used [20, 21].
For example, genomic repeat regions are a well-known problem
for sequence assembly algorithms [22]. However, software
advancements combined with platform and chemistry developments are expected to further reduce operational costs, error rates,
and input DNA quantities, allowing more careful sampling strategies and reducing experimentally introduced error and bias in the
future.
As a result of errors and bias introductions, NGS data needs to
be cleaned. This includes sequence filtering (removing lowquality sequences) and alignment followed by variant calling and
error correction. Discriminating true biological variants from those
due to experimental noise is an important issue when trying to
identify low-frequency variants in a population, for example, in
viral quasispecies or metagenomic analyses, and there are currently
a number of bioinformatics tools to aid in this (e.g., [2326, 19]).
Currently, a multitude of software has been developed to address
different aspects of NGS analyses [27, 28]. However, the available
algorithms for both genome assembly and amplicon analysis can
present some limitations [29], meaning that custom-made scripting and in-house resolution of bioinformatic problems are often
needed to investigate novel datasets and specific hypotheses. In this
context, researchers are frequently faced with the need to acquire
computer skills and bioinformatics expertise. To evaluate the
potential of NGS for a wider group of scientists and diagnosticians,
there is a real need to develop flexible and practical bioinformatics
workflows that can provide user-friendly tools for the analysis of
massive datasets and that become publicly available. Although
some software with a menu-driven approach is available (e.g.,
Geneious, CLC Workbench, Galaxy), most applications are optimized on UNIX-based operating systems and require some bioinformatics expertise. Although less user-friendly, UNIX-based
pipelines are typically freely available to the NGS user community
and are equipped with algorithms that track the high pace of innovation in the NGS field.
A further issue is the scale of genetic data produced by NGS
technologies which presents a physical constraint in terms of data
421
storage and analysis. Although limited datasets (e.g., resulting from

the desktop-range 2nd-generation sequencers) can be managed
using modest computing resources, like high-end desktop computers running virtual Linux machines [4], larger datasets typically
require high-performance computational clusters, which present a
considerable investment and require sufficient information technology (IT) support. Cloud computational resources (i.e., renting
time from commercial high-performance computational clusters)
may be a solution [30] although further developments are needed,
given the data transfer issues resulting from huge file sizes [4].
Another issue for diagnostic laboratories is protection of data from
unauthorized access, which cannot be guaranteed in the cloud, as
data from diagnostic examinations need to be kept confidential. For
labs frequently producing NGS data, data storage and backup costs
can be substantial. Ideally, these huge genetic datasets should be
made publicly available to the scientific community as they provide
a source of information applicable to better understanding disease,
design of targeted assays, systems biology, and integrated OMICS
analysis approaches. To this end, online repositories such as the
Sequence Read Archive (SRA; [31]) have been created to store
both raw NGS and intermediate analysis files.
It will also be important to consider how results from complex
and massive NGS datasets will be communicated to policy groups
and the public and become a decision-supporting tool. To this
end, it is necessary that scientists and diagnosticians develop and
agree on data formats for the communication of NGS results for
analyses that go beyond simple genome sequences, for instance, for
reporting quasispecies compositions.
Application of NGS to Animal Infectious Disease

NGS technology is now being increasingly applied to study the
etiology, genomics, evolution, and epidemiology of animal infectious diseases as well as host-pathogen interactions (Fig. 2). These
applications have provided novel insights and illustrate the potential of this new technology to directly impact on our understanding
and control strategies for animal infectious disease.
NGS platforms have been instrumental in the completion of
large animal genomes and the documentation of genomic variation
(reviewed in [32]). Available livestock genomes now include
bovine, pig, sheep, equine, and avian [32] which provide an important source of knowledge for understanding food production and
animal interaction with infectious pathogens. Additional livestock
genome sequencing efforts have documented genomic variation
providing information for the development of genetic markers
applicable to animal breeding genetics [3335], including traits
422
related to pathogen resistance and interaction with microbial communities in poultry [36]. Others have used novel sequencing technologies for the targeted study of specific gene families occupying
key roles in host immunology (e.g., Toll-like receptor (TLR) gene
family [37]).
The high variability and large size of the mitochondrial genome
(mtDNA) of eukaryotic parasites have been recently explored using
NGS (reviewed by [38]). mtDNA sequences proved very informative in epidemiological studies [38] but also include comparative
mtDNA sequencing of parasites with low and high zoonotic potential [39]. Targeting specific polymorphic genes in the Cryptosporidium
parvum genome using NGS, extensive intra-host genetic diversity
was documented [40]. Studies of the transcriptome (all mRNA
transcripts in an organism, tissue, or cell; also called RNA-Seq) of
different parasite species and/or developmental stages provide
insights into aspects of gene expression, regulation, and function,
which are major steps to understanding their biology (reviewed in
[41]). Examples include the characterization of the transcriptome
from Eimeria sp. from chicken [42] and Taenia sp. from sheep
[43]. In addition, RNA-Seq data have been used to predict potential drug targets [44] and to identify key genes involved in anthelmintic resistance [45].
Over the last five years, NGS has been used as an extremely
important tool in the tracing of transmission, genome characterization, and outbreak management of both viral and bacterial diseases.
The sequencing of these two pathogen types poses very different sets
of challenges and issues, where the large data output expressed typically in the Mb (megabase) to Gb (gigabase) range [4] is particularly
suited for the sequencing of larger bacterial genomes. The high plasticity of some microbial genomes, with large mobile elements, genecoding plasmids, chromosomal genes, and regions of extensive
genetic variability, can frequently complicate genome assembly [46].
While most viral genomes are significantly smaller than their bacterial
counterparts, the viral replication biology (particularly that of RNA
viruses) poses its own unique problems. These involve the inherent
variability of many viral genomes due to replication machinery lacking efficient proofreading mechanisms. This, combined with a short
generation time and high replication rate, results in a complex mix of
differing genomes (a swarm of closely related viruses) within a
single host that are often termed as quasispecies, reviewed in [47].
In addition, recombination and reassortment of segmented viral
genomes frequently occur. NGS techniques offer an unprecedented
step-change increase in the amount of sequence data that can be
generated from both types of these samples.
Figure 3 (different scales of sequence analysis) highlights
where genetic analyses can target different biological scales and
whether these are within an individual host, or between hosts,
423
Fig. 3 The differing levels of intra- and inter-host variation that can be explored using NGS technologies range
from intracellular dynamics to epidemiological applications
resulting in either host variation or inter-herd diversity/outbreak

transmission.
At the level of the quasispecies, NGS technologies can now
determine complete viral genomes to a fine-point resolution, allowing the quantification of viral diversity within samples [48] and
making the sequencing of large numbers of samples economically
feasible. The technology will allow the comparison of genetically
diverse populations from different replication sites within a host
[49, 50]. Wright and colleagues investigated the genetic diversity
424
and resulting quasispecies population after inoculation of foot-andmouth disease virus (FMDV) into a single animal and identified
genetically distinct populations originating from different lesions
[50]. Morelli and colleagues [51] studied the evolution of FMDV
intra-sample sequence diversity during serial transmission in bovine
hosts, providing novel insights into the fine-scale evolution of an
RNA virus. NGS can also provide insights on microevolutionary
processes of viruses at different scales, including the fine-point resolution molecular epidemiology analysis of outbreaks [52].
Recent studies on influenza A viruses have demonstrated that
minority variants present in the donor population can be successfully
transmitted to the recipient host and become prevalent with unpredictable impact on the virus biological properties [53, 54]. These
findings suggest that the use of NGS approaches in RNA virus surveillance will be strategic to promptly detect biologically relevant
viral quasispecies and will help in expanding our understanding of
viral dynamics and emergence and the possible implications of mutation emergence for studies done using isolated viruses [55, 56].
The study of the viral swarm within individual hosts also has
implications for understanding the evolutionary dynamics of viral
populations under selection pressures, e.g., antiviral drugs. This
has been a particularly active field in human medicine, e.g., with
regard to human immunodeficiency virus (HIV) antiviral drugs
response, drug resistance, and viral tropism (reviewed in [5759])
and human influenza A (e.g., [60]) studies. The technologies
application to personalize antiviral treatment as a function of
genetic marker makeup in human medicine is just around the corner [61]. Although at present only an emerging field in veterinary
science, the development of antiviral drugs has the potential to
translate into efficient animal infectious disease control strategies
(e.g., [62, 63]).
The majority of the papers using NGS to investigate animal
infectious disease focus specifically upon the level of animal-toanimal transmission and the characterization of pathogens within a
single host, as this yields the most useful data in terms of outbreak
management and identifying mechanisms/sources of disease transmission. For example, Lefbure and colleagues [64] used NGS to
study genome complexity and horizontal gene transfer in foodborne Campylobacter spp. Biek et al. [65] studied local transmission patterns of Mycobacterium bovis in cattle and wildlife reservoirs
using whole genome sequences from 31 samples originating on
five farms. These demonstrated enough diversity between individual outbreaks to determine evolutionary variation down to herd
level. The identification of novel antimicrobial resistance genes in
the foodborne pathogen Campylobacter coli [66] was possible
using NGS, and the application of NGS technologies during a
recent crisis involving foodborne enterohemorrhagic Escherichia
coli O104:H4 allowed a swift genomic identification [67] that was
425
key to the management of this crisis. Finally, the technology also

proved very informative to study the molecular epidemiology and
evolutionary history of extremely monomorphic Mycoplasma
mycoides subsp. mycoides SC [68] in addition to studies tracing
medically significant pathogens [6971]. Samples from the US
20062007 West Nile virus (WNV) outbreak in birds were characterized using Illumina sequencing, resulting in the identification of
a new genetic variant containing a 13-nucleotide indel [72]. A survey of Chinese domestic fowl using RNA-Seq on an Ion Torrent
identified a novel Coronavirus, providing insights into the diversity
and distribution of avian coronaviruses [73]. A further study has
also investigated the role of Usutu virus in causing epizootic infection in blackbirds in Germany [74].
The advent of NGS has also led to the cost-efficient sequencing of complete viral genomes including avian influenza virus [75
78], classical swine fever virus [79], and bluetongue viruses [80].
An optimized method incorporating 454 sequencing for universal
nonspecific RNA viral genomes from brain and cell culture material was applied to Lyssaviruses [81]. Other groups have reported
the characterization of Louping ill virus in lambs [82], porcine
reproductive and respiratory syndrome virus [83], and herpesviruses from Asian elephants [84]. Furthermore, studies using random
amplification techniques have identified mixed infections of paramyxoviruses and avian influenza in bird populations [77, 85, 78].
Efficient influenza A-specific resequencing strategies [86, 87] have
allowed the study of quasispecies-scale genetic variability with
implications for immune response [88, 89], host cell line adaptation [90, 91], antiviral drug resistance [92], and pathogenicity
[53]. Likewise, efficient targeted CSFV genome sequencing using
NGS has led to insights in classical swine fever virus (CSFV) epidemiology based on isolates from an outbreak in wild boar from
Germany [79] and in the role of quasispecies diversity in CSFV
pathogenicity [93].
NGS technology has also allowed the characterization of complete microbial communities without prior knowledge. For instance,
the unbiased characterization of conserved bacterial ribosomal
RNA-encoding sequences (rRNA profiling) has been applicable to
whole microbial community characterization (e.g., [94, 95]) and
to molecular characterization of (uncultured) bacteria [96].
Metagenomics is the determination of the sequence content of a
complete microbial community (reviewed in [97]). The analysis of
the resulting data can be taxonomy oriented (identification and
quantification of species diversity; [98]) or function based (identification of coding gene diversity, e.g., [99]). The latter has significant
potential, e.g., in the screening for virulence-associated, antibiotic
resistance genes, and vitamin production-associated genes in microbial communities [100]. NGS also offers the potential of unbiased
sequencing of the nucleic acid content of a sample and has been
426
applied to the characterization of the viral metagenome in samples

[101] or the identification of unknown or unexpected viruses in
diseased animals or insect vectors. Furthermore, metagenomic NGS
workflows allow the study of the interaction of treatment with an
animals microbiome [102]. In the microbiology lab, NGS has the
potential for greater diagnostic resolution than any other typing
method, and clinical microbiology labs are currently investigating
its potential for routine diagnosis [103, 104].
Using NGS-based metagenomic approaches, multiple potential
disease agents have been identified in a wide range of both domestic
and wild animals (reviewed in [105109]). Although the common
goal is to identify potential pathogens, the studies can roughly be
divided into three categories: (1) investigations of outbreaks of
unknown etiology, (2) investigations of well-known disorders presumed to be of multifactorial etiology, and (3) metagenomic studies
of reservoir species and vectors. Examples of the first category
include the identification of a novel Orthobunyavirus affecting cattle (described in more detail below), an astrovirus in the brain of
farmed minks suffering from encephalomyelitis [110], and a novel
picornavirus as candidate etiologic agent for turkey viral hepatitis
[111], among others. The second category encompasses investigations aimed at finding contributing infectious agents to complex
diseases, such as colony collapse disorder of honey bees [112, 113]
and postweaning multisystemic wasting syndrome in pigs [114].
Studies in the third category have been performed on diverse
animal species suspected to be important reservoirs, such as bats
[115, 116], African bush pigs [117], and red fox [118], as well as
typical vector organisms, such as ticks [119].
Although it is an important first step, the identification and
genetic characterization of candidate pathogens are not enough to
establish causal relationships or understand how they may be associated with disease. It is therefore necessary to use a synergistic
approach combining molecular diagnostic tools, such as NGSbased metagenomics and follow-up PCR-based assays targeting
detected pathogen sequences, with more conventional diagnostic
methods, including isolation and characterization. This is crucially
important in situations where metagenomic data indicate the
potential presence of multiple pathogens. While PCR-based prevalence studies in matching disease cases and healthy controls can
provide further evidence for disease association, isolation of candidate pathogens is required to assign causality by addressing Kochs
postulates [120]. The assembled data from such a multidisciplinary
(pathology, epidemiology, metagenomic data, PCR prevalence
studies, isolation, characterization, etc.) should be used to identify
the most likely candidate etiologic agent and to make informed
intervention decisions. The synergetic and parallel use of molecular
and classical methods not only results in detection of infectious
agents and development of targeted diagnostic tests but also has
427
the potential to make isolates or strains available shortly after the

occurrence of outbreaks. The availability of isolates or strains is of
special importance to allow the design of effective vaccines or antimicrobial drugs.
The power of NGS to boost the veterinary laboratory communitys responsiveness to emerging diseases was demonstrated
through the discovery of a novel Orthobunyavirus in 2011 associated with fever, decreased milk production, and diarrhea in dairy
cattle. Metagenomics, using 454 technology, allowed the identification of a novel virus, subsequently named Schmallenberg virus
(SBV), in an epidemiological cluster of diseased cattle in Germany
[121]. These viral sequences were used to rapidly design targeted
molecular tests that were used to confirm a clear association between
the presence of the virus and affected animals [110]. International
adoption of these molecular tests identified a widespread occurrence of SBV in European countries (http://www.efsa.europa.eu/
en/supporting/pub/429e.htm) and its detection in stillborn and
malformed lambs [122, 123], as well in insect vectors [124, 125].
The molecular tests were also helpful in targeting samples for isolation of the virus, which ultimately led to the development of a prototype vaccine currently under evaluation [126].
Metagenomic NGS workflows also have the potential use for
quality control of biological products [127] and vaccines [128
132] and provide a powerful approach for the identification and
characterization of unexpected of highly divergent pathogen variants [133, 85] that may remain undetected using targeted diagnostic tests.
The technological possibility to study both the host and the
pathogen with high resolution on the level of their genome,
transcriptome, or proteome opens opportunities to study host/
pathogen interactions at several levels ((genomics, transcriptomics, microRNAs (miRNA)) and ultimately to analytically
integrate these levels (integrative omics or systems biology) aiming to study the interaction of pathogen, microbiome, and host
biological networks with many examples in veterinary science.
Nordentoft and colleagues [134] used NGS metagenomics to
study the influence of livestock management parameters and
infection with Salmonella enteritidis on the microbial community in the chicken intestinal tract. Another study [135] documented the effect of Campylobacter jejuni infection on the
chicken fecal microbiome. The application of metagenomic
techniques in poultry production could lead to the development
of novel alternatives to antibiotic growth promoters and better
understanding of the colonization of food production animals
by foodborne pathogens such as Salmonella enterica and
Campylobacter spp. [36]. Other studies investigated the host
response to pathogen infection. Glass and colleagues [136] used
NGS transcriptomics to document bovine resistance and tolerance
428
traits to parasitic infection. The technology was also used to study

the ferret transcriptome response to influenza infection [137], the
chicken transcriptome response to Mareks disease [138], the swine
response to porcine reproductive and respiratory syndrome virus
infection [139], and the changes in the mouse transcriptome after
Brucella sp. infection [140].
microRNAs are considered to be a key mechanism of gene
regulation in both parasites and viruses. Their characterization
contributes to better understanding the complex biology of pathogens. Wang and coworkers [141] characterized microRNA
sequences from Orientobilharzia turkestanicum, a fluke with zoonotic potential infecting sheep, and identified key target miRNAs
for parasite energy metabolism, transcription initiation factors, signal transduction, and growth factor receptors. Virus-encoded
microRNAs (vmiRNA) regulating viral or cellular transcripts can
be targeted for virus discovery [142, 143]. miRNAs also play
important roles in regulating host-pathogen interactions. NGS has
been applied to investigate whether infection can modulate miRNA
biogenesis and has also been used to identify miRNAs that influence pathogen replication, tropism, and pathogenic potential
[144149]. In particular, cellular miRNAs have been shown to
interact with the viral genomic RNA or mRNA, facilitating or
inhibiting the virus life cycle. These molecules have demonstrated
immense potential as a source of antiviral therapeutics effective
against a number of viruses (adenovirus, rabies, Venezuelan equine
encephalitis, porcine reproductive and syndrome virus [150153])
or for the design of live-attenuated virus vaccine based on miRNAmediated gene silencing [154, 155, 147].
Conclusions
Next-generation sequencing technologies have the potential to
revolutionize our understanding of the complex dimensions of animal infectious disease and infection biology (Fig. 2), ranging from
the intracellular interactions to disease epidemiology. The application of high-throughput biotechnology platforms in these fields
and their typical low-cost per information content has increased
the resolution with which these processes can now be studied.
We now have high-resolution tools that provide veterinary
diagnostic laboratories with the ability to undertake swift and flexible responses to emerging infectious diseases and unexpected
pathogen variants. Moreover, these tools provide an increased resolution for the characterization of pathogens and provide important assets to improve our understanding. Fundamental research
on pathogen evolution, adaptation, and virulence determinants
can now be studied on a scale allowing within and between host
dissections of genetic variability. Moreover, high-throughput tools
429
open new perspectives to study the complex interaction between

pathogen, host, and microbiome with very high resolution and to
deepen our understanding of the key biological processes leading
to protective immunity.
Not only will our increased understanding of pathogens and
their interaction with livestock impact on future disease prevention, control, and management strategies, but the technologies
may themselves become part of the intervention strategies, providing high-resolution data for molecular epidemiology to rapidly
trace the origin and spread of outbreaks, for molecular typing, for
predicting, and for optimizing the outcome of targeted treatment
with antibiotics, antivirals, and anthelmintic.
The ready availability of high-resolution genomic and transcriptomic data will impact upon the targeted development of
novel vaccines and drugs [156, 157], while NGS has the potential
to become a powerful tool for the control of vaccines and other
biological products.
As with any new technology, challenges remain. In the case of
NGS, these include the requirement for expertise in both the laboratory and in the analysis of huge datasets and the current need for
high investment in laboratory and data analysis hardware. As the
technology is ever evolving towards lower cost, user-friendliness,
and accessibility for smaller research and diagnostic labs, efforts are
needed to make the data analysis more accessible to nonexpert
users. This includes proper modeling of the sources of error introduction, solutions for public data storage, development of userfriendly but high standard analysis pipelines for routine applications,
etc. Both the industry and the NGS user community can play a role
in this evolution.
Similarly, recent improvements in protein and peptide separation
efficiencies and highly accurate mass spectrometry have promoted
the identification and quantification of proteins in a given sample
[158]. Directly targeting peptide and protein content in a sample,
proteomic approaches provide important additional information taking known issues, such as the quantitative discrepancy between
mRNA transcript levels and final protein levels and posttranslational
modification, into account [159].
Novel proteomic approaches have been applied to animal
infectious disease research, including the study of E. coli response
to chicken sera [160], proteomic profiling of porcine sera after
FMDV infection [161], host-pathogen interaction during bovine
mastitis [159], and metaproteomic studies characterizing the collective proteome of microbial communities [162].
This section contains excellent contributions exploring the
application of high-throughput technologies to animal infectious
diseases, including functional genomics of tick vectors infected with
eukaryotic parasites, metagenomic approaches to detect bee viral
pathogens, proteomics of vector-host-pathogen interactions, and
NGS applications exploring parasites and intervention strategies.
430
Acknowledgments
The collaboration between the authors was supported by EpiSEQ: a research project supported under the 2nd joint call for
transnational research projects by EMIDA ERA-NET (FP7 project
nr 219235). Additional support for this work in the United
Kingdom was obtained from the Department of Environment,
Food and Rural Affairs (Defra project SE2940) and BBSRC (BB/
I014314/1).
References
1. Sanger F, Nicklen S, Coulson AR (1977) DNA
sequencing with chain-terminating inhibitors.
2. Mullis K, Faloona F, Scharf S et al (1986)
Specific enzymatic amplification of DNA
in vitro: the polymerase chain reaction. Cold
Spring Harb Symp Quant Biol 51:263273
3. Bartlett JM, Stirling D (2003) A short history
of the polymerase chain reaction. Methods
Mol Biol 226:36
4. Glenn TC (2011) Field guide to nextgeneration DNA sequencers. Mol Ecol
Resour 11:759769
5. Radford AD, Chapman D, Dixon L et al
(2012) Application of next-generation sequencing technologies in virology. J Gen Virol 93:
18531868
6. Pareek CS, Smoczynski R, Tretyn A (2011)
Sequencing technologies and genome
sequencing. J Appl Genet 52:413435
7. Loman NJ, Misra RV, Dallman TJ et al (2012)
Performance comparison of benchtop highthroughput sequencing platforms. Nat
8. Schadt EE, Turner S, Kasarskis A (2010) A
window into third-generation sequencing.
Hum Mol Genet 19(R2):R227240
9. Eisenstein M (2012) Oxford Nanopore
announcement sets sequencing sector abuzz.
Nat Biotechnol 30:295296
10. Brodin J, Mild M, Hedskog C et al (2013)
PCR-induced transitions are the major source
of error in cleaned ultra-deep pyrosequencing
data. PLoS One 8:e70388
11. Kim KH, Bae JW (2011) Amplification methods bias metagenomic libraries of uncultured single-stranded and double-stranded
DNA viruses. Appl Environ Microbiol
77:76637668
12. Rosseel T, Van Borm S, Vandenbussche F et al
(2013) The origin of biased sequence depth in
13.
14.
15.
16.
17.
18.
19.
20.
21.
sequence-independent nucleic Acid amplification and optimization for efficient massive parallel sequencing. PLoS One 8:e76144
Pettengill JB, McAvoy E, White JR et al
(2012) Using metagenomic analyses to estimate the consequences of enrichment bias for
pathogen detection. BMC Res Notes 5:378
Lysholm F, Wetterbom A, Lindau C et al
(2012) Characterization of the viral microbiome in patients with severe lower respiratory
tract infections, using metagenomic sequencing. PLoS One 7:e30875
Naccache SN, Greninger AL, Lee D et al
(2013) The perils of pathogen discovery: origin of a novel parvovirus-like hybrid genome
traced to nucleic acid extraction spin columns.
J Virol 87:1196611977
Whiteford N, Skelly T, Curtis C et al (2009)
Swift: primary data analysis for the Illumina
Solexa sequencing platform. Bioinformatics
25:21942199
Metzker
ML
(2010)
Sequencing
technologiesthe next generation. Nat Rev
Genet 11:3146
Quail MA, Smith M, Coupland P et al (2012)
A tale of three next generation sequencing
platforms: comparison of Ion Torrent, Pacific
Biosciences and Illumina MiSeq sequencers.
BMC Genomics 13:341
Zagordi O, Klein R, Daumer M,
Beerenwinkel N (2010) Error correction of
next-generation sequencing data and reliable
estimation of HIV quasispecies. Nucleic
Acids Res 38:74007409
Archer J, Rambaut A, Taillon BE et al (2010)
The evolutionary analysis of emerging low
frequency HIV-1 CXCR4 using variants
through timean ultra-deep approach. PLoS
Comput Biol 6:e1001022
Degner JF, Marioni JC, Pai AA et al (2009)
Effect of read-mapping biases on detecting
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
allele-specific expression from RNA-sequencing

data. Bioinformatics 25:32073212
Treangen TJ, Salzberg SL (2012) Repetitive
DNA and next-generation sequencing: computational challenges and solutions. Nat Rev
Genet 13:3646
Archer J, Baillie G, Watson SJ et al (2012)
Analysis of high-depth sequence data for
studying viral diversity: a comparison of next
generation sequencing platforms using
Segminator II. BMC Bioinformatics 13:47
Macalalad AR, Zody MC, Charlebois P et al
(2012) Highly sensitive and specific detection
of rare variants in mixed viral populations
from massively parallel sequence data. PLoS
Comput Biol 8:e1002417
Quince C, Lanzen A, Davenport RJ,
Turnbaugh PJ (2011) Removing noise
from pyrosequenced amplicons. BMC
Bioinformatics 12:38
Yang X, Chockalingam SP, Aluru S (2013) A
survey of error-correction methods for nextgeneration sequencing. Brief Bioinform 14:
5666
Flicek P, Birney E (2009) Sense from sequence
reads: methods for alignment and assembly.
Nat Methods 6(11 Suppl):S6S12
Horner DS, Pavesi G, Castrignano T et al
(2010) Bioinformatics approaches for genomics and post genomics applications of nextgeneration sequencing. Brief Bioinform 11:
181197
Finotello F, Lavezzo E, Fontana P et al
(2012) Comparative analysis of algorithms for
whole-genome assembly of pyrosequencing
data. Brief Bioinform 13:269280
Angiuoli SV, White JR, Matalka M, White O,
Fricke WF (2011) Resources and costs for
microbial sequence analysis evaluated using
virtual machines and cloud computing. PLoS
One 6:e26624
Leinonen R, Sugawara H, Shumway M
(2011) The sequence read archive. Nucleic
Acids Res 39(Database issue):D1921
Bai Y, Sartor M, Cavalcoli J (2012) Current
status and future perspectives for sequencing
livestock genomes. J Anim Sci Biotechnol 3:8
Aslam ML, Bastiaansen JW, Elferink MG et al
(2012) Whole genome SNP discovery and
analysis of genetic diversity in Turkey (Meleagris
gallopavo). BMC Genomics 13:391
Ramos AM, Crooijmans RP, Affara NA et al
(2009) Design of a high density SNP genotyping assay in the pig using SNPs identified
and characterized by next generation sequencing technology. PLoS One 4:e6524
431
35. Rubin CJ, Zody MC, Eriksson J et al (2010)

Whole-genome resequencing reveals loci
under selection during chicken domestication. Nature 464:587591
36. Diaz-Sanchez S, Hanning I, Pendleton S,
DSouza D (2013) Next-generation sequencing: the future of molecular genetics in poultry production and food safety. Poult Sci
92:562572
37. Fisher CA, Bhattarai EK, Osterstock JB et al
(2011) Evolution of the bovine TLR gene
family and member associations with
Mycobacterium avium subspecies paratuberculosis infection. PLoS One 6:e27744
38. Jex AR, Littlewood DT, Gasser RB (2010)
Toward next-generation sequencing of mitochondrial genomes-focus on parasitic worms
of animals and biotechnological implications.
Biotechnol Adv 28:151159
39. Webb KM, Rosenthal BM (2011) Nextgeneration sequencing of the Trichinella
murrelli mitochondrial genome allows comprehensive comparison of its divergence from
the principal agent of human trichinellosis,
Trichinella spiralis. Infect Genet Evol 11:
116123
40. Grinberg A, Biggs PJ, Dukkipati VS, George
TT (2013) Extensive intra-host genetic diversity uncovered in Cryptosporidium parvum
using Next Generation Sequencing. Infect
Genet Evol 15:1824
41. Cantacessi C, Campbell BE, Gasser RB
(2012) Key strongylid nematodes of animalsImpact of next-generation transcriptomics on systems biology and biotechnology.
42. Matsubayashi M, Hatta T, Miyoshi T et al
(2013) High-throughput RNA sequencing
profiles and transcriptional evidence of aerobic respiratory enzymes in sporulating oocysts
and sporozoites of Eimeria tenella. Infect
43. Wu X, Fu Y, Yang D et al (2012) Detailed
transcriptome description of the neglected
cestode Taenia multiceps. PLoS One 7:e45830
44. Romine NM, Martin RJ, Beetham JK (2013)
Computational cloning of drug target genes
of a parasitic nematode, Oesophagostomum
dentatum. BMC Genet 14:55
45. Cwiklinski K, Merga JY, Lake SL et al (2013)
Transcriptome analysis of a parasitic clade V
nematode: comparative analysis of potential
molecular anthelmintic targets in Cylicostephanus
goldi. Int J Parasitol 43:917927
46. Tritt A, Eisen JA, Facciotti MT, Darling AE
(2012) An integrated pipeline for de novo
432
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.

assembly of microbial genomes. PLoS One
7:e42304
Lauring AS, Andino R (2010) Quasispecies
theory and the behavior of RNA viruses.
PLoS Pathog 6:e1001005
Watson SJ, Welkers MR, Depledge DP et al
(2013) Viral population analysis and minorityvariant detection using short read nextgeneration sequencing. Philos Trans R Soc
Lond B Biol Sci 368:20120205
Stack JC, Murcia PR, Grenfell BT, Wood JL,
Holmes EC (2013) Inferring the inter-host
transmission of influenza A virus using patterns of intra-host genetic variation. Proc Biol
Sci 280:20122173
Wright CF, Morelli MJ, Thebaud G et al
(2011) Beyond the consensus: dissecting
within-host viral population diversity of footand-mouth disease virus by using nextgeneration genome sequencing. J Virol 85:
22662275
Morelli MJ, Wright CF, Knowles NJ et al
(2013) Evolution of foot-and-mouth disease
virus intra-sample sequence diversity during
serial transmission in bovine hosts. Vet Res
44:12
Orton RJ, Wright CF, Morelli MJ et al (2013)
Observing micro-evolutionary processes of
viral populations at multiple scales. Philos
Trans R Soc Lond B Biol Sci 368:20120203
Fusaro A, Monne I, Hughes J, et al. (2013)
Evolution of H7 viruses in poultry: convergent and divergent mutations. Paper presented at the Options for the Control of
Influenza VIII, Cape Town, South Africa
Wilker PR, Dinis JM, Starrett G et al (2013)
Selection on haemagglutinin imposes a bottleneck during mammalian transmission of
reassortant H5N1 influenza viruses. Nat
Commun 4:2636
Szpara ML, Parsons L, Enquist LW (2010)
Sequence variability in clinical and laboratory
isolates of herpes simplex virus 1 reveals new
mutations. J Virol 84:53035313
Wellehan JF Jr, Yu F, Venn-Watson SK et al
(2010) Characterization of San Miguel sea
lion virus populations using pyrosequencingbased methods. Infect Genet Evol 10:
254260
Vrancken B, Lequime S, Theys K, Lemey P
(2010) Covering all bases in HIV research:
unveiling a hidden world of viral evolution.
AIDS Rev 12:89102
Swenson LC, Daumer M, Paredes R (2012)
Next-generation sequencing to assess HIV
tropism. Curr Opin HIV AIDS 7:478485
Swenson LC, Mo T, Dong WW et al (2011)
Deep sequencing to infer HIV-1 co-receptor
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
usage: application to three clinical trials of

maraviroc in treatment-experienced patients.
J Infect Dis 203:237245
Ghedin E, Laplante J, DePasse J et al (2011)
Deep sequencing reveals mixed infection with
2009 pandemic influenza A (H1N1) virus
strains and the emergence of oseltamivir resistance. J Infect Dis 203:168174
Capobianchi MR, Giombini E, Rozera G
(2013) Next-generation sequencing technology in clinical virology. Clin Microbiol Infect
19:1522
Backer JA, Vrancken R, Neyts J, Goris N
(2013) The potential of antiviral agents to
control classical swine fever: a modelling
study. Antiviral Res 99:245250
Lefebvre DJ, De Vleeschauwer AR, Goris N
et al (2013) Proof of Concept for the Inhibition
of Foot-and-Mouth Disease Virus Replication
by the Anti-Viral Drug 2-C-Methylcytidine in
Severe Combined Immunodeficient Mice.
Transbound Emerg Dis. doi:10.1111/
tbed.12069
Lefebure T, Bitar PD, Suzuki H, Stanhope
MJ (2010) Evolutionary dynamics of complete Campylobacter pan-genomes and the
bacterial species concept. Genome Biol Evol
2:646655
Biek R, OHare A, Wright D et al (2012)
Whole genome sequencing reveals local transmission patterns of Mycobacterium bovis in
sympatric cattle and badger populations.
Chen Y, Mukherjee S, Hoffmann M et al
(2013) Whole-Genome Sequencing of
Gentamicin-Resistant Campylobacter coli
Isolated from U.S. Retail Meats Reveals
Novel Plasmid-Mediated Aminoglycoside
Resistance Genes. Antimicrob Agents
Chemother 57:53985405
Mellmann A, Harmsen D, Cummings CA
et al (2011) Prospective genomic characterization of the German enterohemorrhagic
Escherichia coli O104:H4 outbreak by rapid
next generation sequencing technology. PLoS
One 6:e22751
Dupuy V, Manso-Silvan L, Barbe V et al
(2012) Evolutionary history of contagious
bovine pleuropneumonia using next generation sequencing of Mycoplasma mycoides subsp.
mycoides "Small Colony". PLoS One 7:e46821
Das S, Roychowdhury T, Kumar P et al
(2013) Genetic heterogeneity revealed by
sequence analysis of Mycobacterium tuberculosis isolates from extra-pulmonary tuberculosis
patients. BMC Genomics 14:404
Eyre DW, Golubchik T, Gordon NC, et al.
(2012) A pilot study of rapid benchtop
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
sequencing of Staphylococcus aureus and

Clostridium difficile for outbreak detection
and surveillance. BMJ Open 2 (doi: 10.1136/
bmjopen-2012-001124)
Koser CU, Holden MT, Ellington MJ et al
(2012) Rapid whole-genome sequencing for
investigation of a neonatal MRSA outbreak.
N Engl J Med 366:22672275
Grinev A, Chancey C, Anez G et al (2013)
Genetic analysis of West Nile virus isolates
from an outbreak in Idaho, United States,
2006-2007. Int J Environ Res Public Health
10:44864506
Chen GQ, Zhuang QY, Wang KC et al (2013)
Identification and survey of a novel avian
coronavirus in ducks. PLoS One 8:e72918
Becker N, Jost H, Ziegler U et al (2012)
Epizootic emergence of Usutu virus in wild
and captive birds in Germany. PLoS One
7:e32604
Croville G, Soubies SM, Barbieri J et al
(2012) Field monitoring of avian influenza
viruses: whole-genome sequencing and tracking of neuraminidase evolution using 454
pyrosequencing. J Clin Microbiol 50:
28812887
Dugan VG, Dunham EJ, Jin G et al (2011)
Phylogenetic analysis of low pathogenicity
H5N1 and H7N3 influenza A virus isolates
recovered from sentinel, free flying, wild mallards at one study site during 2006. Virology
417:98105
Ramakrishnan MA, Tu ZJ, Singh S et al
(2009) The feasibility of using high resolution genome sequencing of influenza A
viruses to detect mixed infections and quasispecies. PLoS One 4:e7105
Van Borm S, Rosseel T, Vangeluwe D,
Vandenbussche F, van den Berg T, Lambrecht
B (2012) Phylogeographic analysis of avian
influenza viruses isolated from Charadriiformes
in Belgium confirms intercontinental reassortment in gulls. Arch Virol 157:15091522
Leifer I, Ruggli N, Blome S (2013)
Approaches to define the viral genetic basis of
classical swine fever virus virulence. Virology
438:5155
Rao PP, Reddy YN, Ganesh K, Nair SG,
Niranjan V, Hegde NR (2013) Deep sequencing as a method of typing bluetongue virus
isolates. J Virol Methods 193:314319
Marston DA, McElhinney LM, Ellis RJ et al
(2013) Next generation sequencing of viral
RNA genomes. BMC Genomics 14:444
Marston DA, Mansfield KL, Mearns R, Ellis
RJ, Fooks AR, Johnson N (2013) Louping ill
virus genome sequence derived from the spinal
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
433
cord of an infected lamb. Genome Announc 1

(doi:10.1128/genomeA.00454-13)
Kvisgaard LK, Hjulsager CK, Fahnoe U,
Breum SO, Ait-Ali T, Larsen LE (2013) A fast
and robust method for full genome sequencing of Porcine Reproductive and Respiratory
Syndrome Virus (PRRSV) Type 1 and Type
2. J Virol Methods 193:697705
Wilkie GS, Davison AJ, Watson M et al (2013)
Complete genome sequences of elephant
endotheliotropic herpesviruses 1A and 1B
determined directly from fatal cases. J Virol
87:67006712
Rosseel T, Lambrecht B, Vandenbussche F,
van den Berg T, Van Borm S (2011)
Identification and complete genome sequencing of paramyxoviruses in mallard ducks
(Anas platyrhynchos) using random access
amplification and next generation sequencing
technologies. Virol J 8:463
Hoper D, Hoffmann B, Beer M (2011) A
comprehensive deep sequencing strategy for
full-length genomes of influenza A. PLoS
One 6:e19075
Kampmann ML, Fordyce SL, Avila-Arcos
MC et al (2011) A simple method for the
parallel deep sequencing of full influenza A
genomes. J Virol Methods 178:243248
Hoper D, Kalthoff D, Hoffmann B, Beer M
(2012) Highly pathogenic avian influenza virus
subtype H5N1 escaping neutralization: more
than HA variation. J Virol 86:13941404
Hutter J, Rodig JV, Hoper D et al (2013)
Toward animal cell culture-based influenza
vaccine
design:
viral
hemagglutinin
N-glycosylation markedly impacts immunogenicity. J Immunol 190:220230
Bourret V, Croville G, Mariette J et al (2013)
Whole-genome, deep pyrosequencing analysis of a duck influenza A virus evolution in
swine cells. Infect Genet Evol 18:3141
Roedig JV, Rapp E, Hoper D, Genzel Y, Reichl
U (2011) Impact of host cell line adaptation
on quasispecies composition and glycosylation
of influenza A virus hemagglutinin. PLoS One
6:e27989
Wu NC, Young AP, Dandekar SW et al (2013)
Systematic identification of H274Y compensatory mutations in influenza A virus neuraminidase by high-throughput screening.
J Virol 87:11931199
Topfer A, Hoper D, Blome S et al (2013)
Sequencing approach to analyze the role of
quasispecies for classical swine fever. Virology
438:1419
Fouts DE, Szpakowski S, Purushe J et al
(2012) Next generation sequencing to define
434
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
105.
106.

prokaryotic and fungal diversity in the bovine
rumen. PLoS One 7:e48289
Oikonomou G, Machado VS, Santisteban C,
Schukken YH, Bicalho RC (2012) Microbial
diversity of bovine mastitic milk as described
by pyrosequencing of metagenomic 16 s
rDNA. PLoS One 7:e47671
Kolbert CP, Rys PN, Hopkins M et al (2004)
16S ribosomal DNA sequence analysis for
identification of bacteria in a clinical microbiology laboratory. In: Persing DH, Tenover
FD, Versalovic J et al (eds) Molecular microbiology: diagnostic principles and practice.
ASM Press, Washington, DC, pp 361377
Thomas T, Gilbert J, Meyer F (2012)
Metagenomicsa guide from sampling to
data analysis. Microb Inform Exp 2:3
Petrosino JF, Highlander S, Luna RA, Gibbs
RA, Versalovic J (2009) Metagenomic pyrosequencing and microbial identification. Clin
Chem 55:856866
Ferrer M, Ghazi A, Beloqui AV et al (2012)
Functional metagenomics unveils a multifunctional glycosyl hydrolase from the family
43 catalysing the breakdown of plant polymers in the calf rumen. PLoS One 7:e38134
Singh KM, Jakhesara SJ, Koringa PG, Rank
DN, Joshi CG (2012) Metagenomic analysis
of virulence-associated and antibiotic resistance
genes of microbes in rumen of Indian buffalo
(Bubalus bubalis). Gene 507:146151
Day JM, Ballard LL, Duke MV, Scheffler BE,
Zsak L (2010) Metagenomic analysis of the
turkey gut RNA virus community. Virol J
7:313
Danzeisen JL, Kim HB, Isaacson RE, Tu ZJ,
Johnson TJ (2011) Modulations of the
chicken cecal microbiome and metagenome
in response to anticoccidial and growth promoter treatment. PLoS One 6:e27949
Long SW, Williams D, Valson C et al (2013)
A genomic day in the life of a clinical microbiology laboratory. J Clin Microbiol 51:
12721277
Sherry NL, Porter JL, Seemann T et al (2013)
Outbreak
investigation
using
highthroughput genome sequencing within a
diagnostic microbiology laboratory. J Clin
Barzon L, Lavezzo E, Militello V, Toppo S,
Palu G (2011) Applications of next-generation
sequencing technologies to diagnostic virology. Int J Mol Sci 12:78617884
Belak S, Karlsson OE, Blomstrom AL, Berg
M, Granberg F (2013) New viruses in veterinary medicine, detected by metagenomic
approaches. Vet Microbiol 165:95101
107. Bexfield N, Kellam P (2011) Metagenomics

and the molecular identification of novel
viruses. Vet J 190:191198
108. Bishop-Lilly KA, Turell MJ, Willner KM et al
(2010) Arbovirus detection in insect vectors
by rapid, high-throughput pyrosequencing.
PLoS Negl Trop Dis 4:e878
109. Blomstrom AL (2011) Viral metagenomics as
an emerging and powerful tool in veterinary
medicine. Vet Q 31:107114
110. Blomstrom AL, Widen F, Hammer AS, Belak
S, Berg M (2010) Detection of a novel astrovirus in brain tissue of mink suffering from
shaking mink syndrome by use of viral metagenomics. J Clin Microbiol 48:43924396
111. Honkavuori KS, Shivaprasad HL, Briese T
et al (2011) Novel picornavirus in Turkey
poults with hepatitis, California, USA. Emerg
112. Cox-Foster DL, Conlan S, Holmes EC et al
(2007) A metagenomic survey of microbes in
honey bee colony collapse disorder. Science
318:283287
113. Granberg F, Vicente-Rubiano M, RubioGuerri C et al (2013) Metagenomic detection
of viral pathogens in Spanish honeybees: coinfection by Aphid Lethal Paralysis, Israel
Acute Paralysis and Lake Sinai Viruses. PLoS
One 8:e57459
114. Blomstrom AL, Belak S, Fossum C et al
(2009) Detection of a novel porcine boca-like
virus in the background of porcine circovirus
type 2 induced postweaning multisystemic
wasting syndrome. Virus Res 146:125129
115. Ge X, Li Y, Yang X et al (2012) Metagenomic
analysis of viruses from bat fecal samples
reveals many novel viruses in insectivorous
bats in China. J Virol 86:46204630
116. Li L, Victoria JG, Wang C et al (2010) Bat
guano virome: predominance of dietary
viruses from insects and plants plus novel
mammalian viruses. J Virol 84:69556965
117. Blomstrom AL, Stahl K, Masembe C et al
(2012) Viral metagenomic analysis of bushpigs (Potamochoerus larvatus) in Uganda
identifies novel variants of Porcine parvovirus
4 and Torque teno sus virus 1 and 2. Virol J
9:192
118. Bodewes R, van der Giessen J, Haagmans BL,
Osterhaus AD, Smits SL (2013) Identification
of multiple novel viruses, including a parvovirus and a hepevirus, in feces of red foxes.
J Virol 87:77587764
119. Carpi G, Cagnacci F, Wittekindt NE et al
(2011) Metagenomic profile of the bacterial
communities associated with Ixodes ricinus
ticks. PLoS One 6:e25604

120. Fredericks DN, Relman DA (1996) Sequencebased identification of microbial pathogens: a
reconsideration of Kochs postulates. Clin
Microbiol Rev 9:1833
121. Hoffmann B, Scheuch M, Hoper D et al
(2012) Novel orthobunyavirus in Cattle,
Europe, 2011. Emerg Infect Dis 18:469472
122. De Regge N, van den Berg T, Georges L, Cay
B (2013) Diagnosis of Schmallenberg virus
infection in malformed lambs and calves and
first indications for virus clearance in the fetus.
123. van den Brom R, Luttikholt SJ, LievaartPeterson K et al (2012) Epizootic of ovine
congenital malformations associated with
Schmallenberg virus infection. Tijdschr
Diergeneeskd 137:106111
124. De Regge N, Deblauwe I, De Deken R et al
(2012) Detection of Schmallenberg virus in
different Culicoides spp. by real-time
RT-PCR. Transbound Emerg Dis 59:471475
125. Elbers AR, Meiswinkel R, van Weezep E, van
Oldruitenborgh-Oosterbaan MM, Kooi EA
(2013) Schmallenberg virus in Culicoides spp.
biting midges, the Netherlands, 2011. Emerg
126. Wernike K, Nikolin VM, Hechinger S,
Hoffmann B, Beer M (2013) Inactivated
Schmallenberg virus prototype vaccines.
Vaccine 31:35583563
127. Van Borm S, Rosseel T, Steensels M, van den
Berg T, Lambrecht B (2013) Whats in a
strain? Viral metagenomics identifies genetic
variation and contaminating circoviruses in
laboratory isolates of pigeon paramyxovirus
type 1. Virus Res 171:186193
128. Baylis SA, Finsterbusch T, Bannert N, Blumel
J, Mankertz A (2011) Analysis of porcine
circovirus type 1 detected in Rotarix vaccine.
Vaccine 29:690697
129. Farsang A, Kulcsar G (2012) Extraneous
agent detection in vaccines-a review of technical aspects. Biologicals 40:225230
130. Neverov A, Chumakov K (2010) Massively
parallel sequencing for monitoring genetic
consistency and quality control of live viral
vaccines. Proc Natl Acad Sci U S A 107(46):
200638
131. Onions D, Kolman J (2010) Massively parallel sequencing, a new method for detecting
adventitious agents. Biologicals 38:377380
132. Victoria JG, Wang C, Jones MS et al (2010)
Viral nucleic acids in live-attenuated vaccines:
detection of minority variants and an adventitious virus. J Virol 84:60336040
133. Miller PJ, Afonso CL, Spackman E et al
(2010) Evidence for a new avian paramyxovi-
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
435
rus serotype 10 detected in rockhopper penguins from the Falkland Islands. J Virol
84:1149611504
Nordentoft S, Molbak L, Bjerrum L et al
(2011) The influence of the cage system and
colonisation of Salmonella Enteritidis on the
microbial gut flora of laying hens studied by
T-RFLP and 454 pyrosequencing. BMC
Microbiol 11:187
Qu A, Brulc JM, Wilson MK et al (2008)
Comparative metagenomics reveals host specific metavirulomes and horizontal gene
transfer elements in the chicken cecum microbiome. PLoS One 3:e2945
Glass EJ, Crutchley S, Jensen K (2012) Living
with the enemy or uninvited guests: functional genomics approaches to investigating
host resistance or tolerance traits to a protozoan parasite, Theileria annulata, in cattle.
Vet Immunol Immunopathol 148:178189
Leon AJ, Banner D, Xu L et al (2013)
Sequencing, annotation, and characterization
of the influenza ferret infectome. J Virol
87:19571966
Maceachern S, Muir WM, Crosby S, Cheng
HH (2011) Genome-wide identification of
allele-specific expression (ASE) in response to
Mareks disease virus infection using next generation sequencing. BMC Proc 5(Suppl 4):S14
Miller LC, Fleming D, Arbogast A et al
(2012) Analysis of the swine tracheobronchial
lymph node transcriptomic response to infection with a Chinese highly pathogenic strain
of porcine reproductive and respiratory syndrome virus. BMC Vet Res 8:208
Wang F, Hu S, Liu W et al (2011) Deepsequencing analysis of the mouse transcriptome response to infection with Brucella
melitensis strains of differing virulence. PLoS
One 6:e28485
Wang CR, Xu MJ, Fu JH et al (2012)
Characterization of microRNAs from
Orientobilharzia turkestanicum, a neglected
blood fluke of human and animal health significance. PLoS One 7:e47001
Kong BW (2011) Identification of virus
encoding microRNAs using 454 FLX sequencing platform. Methods Mol Biol 733:8191
Ma M, Huang Y, Gong Z et al (2011)
Discovery of DNA viruses in wild-caught
mosquitoes using small RNA high throughput sequencing. PLoS One 6:e24758
Cullen BR (2006) Viruses and microRNAs.
Nat Genet 38(Suppl):S2530
Eulalio A, Schulte L, Vogel J (2012) The
mammalian microRNA response to bacterial
infections. RNA Biol 9:742750
436
146. Gottwein E, Cullen BR (2008) Viral and

cellular microRNAs as determinants of viral
pathogenesis and immunity. Cell Host
Microbe 3:375387
147. Perez JT, Pham AM, Lorini MH et al (2009)
MicroRNA-mediated species-specific attenuation of influenza A virus. Nat Biotechnol
27:572576
148. Wang Y, Brahmakshatriya V, Lupiani B et al
(2012) Integrated analysis of microRNA
expression and mRNA transcriptome in lungs
of avian influenza virus infected broilers.
BMC Genomics 13:278
149. Wang Y, Brahmakshatriya V, Zhu H et al
(2009) Identification of differentially expressed
miRNAs in chicken lung and trachea with
avian influenza virus infection by a deep
sequencing approach. BMC Genomics 10:512
150. Bhomia M, Sharma A, Gayen M, Gupta P,
Maheshwari RK (2013) Artificial microRNAs
can effectively inhibit replication of
Venezuelan equine encephalitis virus. Antiviral
Res 100:429434
151. Ibrisimovic M, Kneidinger D, Lion T, Klein R
(2013) An adenoviral vector-based expression
and delivery system for the inhibition of wildtype adenovirus replication by artificial
microRNAs. Antiviral Res 97:1023
152. Israsena N, Supavonwong P, Ratanasetyuth N,
Khawplod P, Hemachudha T (2009) Inhibition
of rabies virus replication by multiple artificial
microRNAs. Antiviral Res 84:7683
153. Xia B, Song H, Chen Y et al (2013) Efficient
inhibition of porcine reproductive and respiratory syndrome virus replication by artificial
microRNAs targeting the untranslated
regions. Arch Virol 158:5561
154. Barnes D, Kunitomi M, Vignuzzi M, Saksela
K, Andino R (2008) Harnessing endogenous
155.
156.
157.
158.
159.
160.
161.
162.
miRNAs to control virus tissue tropism as a

strategy for developing attenuated virus vaccines. Cell Host Microbe 4:239248
Kelly EJ, Hadac EM, Greiner S, Russell SJ
(2008) Engineering microRNA responsiveness
to decrease virus pathogenicity. Nat Med
14:12781283
Luciani F, Bull RA, Lloyd AR (2012) Next
generation deep sequencing and vaccine
design: today and tomorrow. Trends
Woollard PM, Mehta NA, Vamathevan JJ
et al (2011) The application of next-generation sequencing technologies to drug discovery and development. Drug Discov Today
16:512519
Mann M, Hendrickson R, Pandey A (2001)
Analysis of proteins and proteomes by mass
spectrometry. Annu Rev Biochem 70:
437473
Boehmer JL (2011) Proteomic analyses of
host and pathogen responses during bovine
mastitis. J Mammary Gland Biol Neoplasia
16:323338
Li G, Cai W, Hussein A et al (2012) Proteome
response of an extraintestinal pathogenic
Escherichia coli strain with zoonotic potential
to human and chicken sera. J Proteomics
75:48534862
Liu Y, Zhang K, Zheng H et al (2011)
Proteomics analysis of porcine serum proteins
by LC-MS/MS after foot-and-mouth disease
virus (FMDV) infection. J Vet Med Sci
73:15691572
Kolmeder CA, de Vos WM (2013)
Metaproteomics of our microbiome
Developing insight in function and activity in
man and model systems. J Proteomics
97:316
Chapter 31
Impact of Next-Generation Technologies on Exploring
Socioeconomically Important Parasites and Developing
New Interventions
Cinzia Cantacessi, Andreas Hofmann, Bronwyn E. Campbell,
and Robin B. Gasser
Abstract
High-throughput molecular and computer technologies have become instrumental for systems biological
explorations of pathogens, including parasites. For instance, investigations of the transcriptomes of different
developmental stages of parasitic nematodes give insights into gene expression, regulation and function in
a parasite, which is a significant step to understanding their biology, as well as interactions with their
host(s) and disease. This chapter (1) gives a background on some key parasitic nematodes of socioeconomic importance, (2) describes sequencing and bioinformatic technologies for large-scale studies of the
transcriptomes and genomes of these parasites, (3) provides some recent examples of applications and (4)
emphasizes the prospects of fundamental biological explorations of parasites using these technologies for
the development of new interventions to combat parasitic diseases.
Key words Parasitic nematodes, Genomics, Transcriptomics, Bioinformatics, Next-generation
sequencing, Post-genomics, Anthelmintic resistance, Drug targets, Diagnostic markers
Introduction
Parasitic nematodes (roundworms) of humans and other animals are
of particular significance as pathogens [15]. For example, the soiltransmitted helminths (STHs) Ascaris spp. (large roundworm),
Ancylostoma duodenale, Necator americanus (hookworms) and
Trichuris trichiura (whipworm) are estimated to infect almost one
sixth of all humans [6, 7], and parasitic nematodes of livestock,
including species of Haemonchus, Ostertagia, and Trichostrongylus,
cause substantial losses estimated at billions of dollars per annum, due
to poor productivity, failure to thrive, the costs of anthelmintic treatment and deaths [810]. In addition to their socioeconomic impact,
anthelmintic resistance in nematodes of livestock [1113] has stimulated research towards developing alternative intervention and control
437
438
Cinzia Cantacessi et al.
strategies against these parasites. In spite of some knowledge of parasites

and the diseases that they cause [14, 15], little is known about essential molecular processes and mechanisms in parasitic nematodes.
Gaining an improved understanding of the molecular biology of
these organisms offers a possible pathway for discovering new methods of diagnosis, treatment and control of parasitic diseases.
Advances in genomic and bioinformatic technologies provide
exciting opportunities to explore, for example, basic developmental and reproductive processes in nematodes. In particular, studies
of the transcriptomes of parasites have become instrumental in
various areas, such as gene discovery and characterization, and for
gaining insights into aspects of gene expression, regulation and
function [1619]. The purpose of this chapter is to (1) give a background on some socioeconomically important parasitic nematodes
of animals, (2) describe sequencing and bioinformatic technologies for large-scale studies of the transcriptomes and genomes of
these parasites, (3) provide some recent examples of applications,
and (4) emphasize the prospects of fundamental biological explorations of parasites using these technologies for the development of
new interventions to combat parasitic diseases.
Brief Background on Parasitic Nematodes

As one of the most diverse phyla in the animal kingdom, the phylum Nematoda includes > 28,000 species, of which >16,000 are
parasites of animals or plants [14, 20]. This phylum consists of two
main classes, the Adenophorea and the Secernentea [21]. Within
the Secernentea, species within the orders Ascaridida, Oxyurida,
Spirurida and Strongylida are parasites of humans and other vertebrates [14]. Within the latter order, the superfamily Strongyloidea
includes, among others, some intestinal parasites of pigs, ruminants (Chabertiidae) and equids (family Strongylidae) [14].
Members of this superfamily are characterized by complex buccal
capsules, often with a series of leaflike structures on the border of
the labial region (corona radiata) [22]. In contrast, the buccal capsule, lips, and corona radiata of species of parasitic nematodes of
the superfamily Trichostrongyloidea are greatly reduced or absent
[2325]. Members of this latter superfamily (commonly known as
trichostrongyles) are key parasites of some mammals, particularly ruminants [14, 26]. The superfamily Ancylostomatoidea
(hookworms) includes blood-feeding nematodes, characterized
by large, globular buccal capsules, which enable them to attach to
the intestinal wall to feed on blood [14]. According to a molecular
classification proposed by Blaxter et al. [27], members of the
Strongylida, such as trichostrongyles and hookworms, as well as
the free-living nematodes of the suborder Rhabditina (e.g.,
Caenorhabditis elegans) and order Diplogasterida (e.g., Pristionchus
pacificus), belong to clade V of the Nematoda.
Next-Generation Technologies to Understand Parasites and Develop New Interventions
2.1 Selected
Examples
of Nematodes (Order
Strongylida) of Major
Socioeconomic
Importance
2.1.1 Trichostrongyles
2.1.2 Hookworms
439
Within the superfamily Trichostrongyloidea, Haemonchus contortus (barbers pole worm) and Trichostrongylus spp., for example,
are responsible for substantial production losses in the livestock
industries worldwide [10, 28]. H. contortus is the most important
nematode of small ruminants in subtropical and tropical (summer
rainfall) areas, whereas some Trichostrongylus spp. are often dominant in winter rainfall areas due to their ability to develop and
survive at lower temperatures than H. contortus does [29]. The life
cycles of H. contortus and T. colubriformis are similar and direct,
with eggs being laid by females in the abomasum (H. contortus) or
small intestine (Trichostrongylus) of the host [26, 30, 31]. Under
suitable environmental conditions [30, 32], first-stage larvae (L1s)
hatch from eggs to develop, via the second-stage larvae (L2s), to
infective, third-stage larvae (L3s). The cuticle of the L2 is retained
as a sheath around the L3 and protects it from desiccation [14, 30,
32]. Small ruminants acquire the infection by ingesting L3s from
contaminated pastures. The L3s pass through the forestomachs
and undergo an exsheathment process to then establish, via the
parasitic fourth-stage larvae (L4s), as adult males and females in
the abomasum (H. contortus) or small intestine (Trichostrongylus
spp.) within ~3 weeks [14, 26, 30, 32]. The exsheathment process
is triggered by stimuli within the host and may include (depending
on the species of nematode) dissolved gaseous CO2 and undissociated carbonic acid (H. contortus) or hydrochloric acid and pepsin
(T. colubriformis) in the abomasum. L3s respond to these stimuli
by producing an exsheathment fluid which determines the detachment of the sheath from the bodies of the larvae [5, 3335].
The adults of H. contortus feed on blood from vessels in the
gastric wall. Consequently, the main clinical signs of acute haemonchosis are anemia, variable degrees of edema, as well as lethargy,
decreased live-weight gain, impaired wool/milk production, and
decreased reproductive performance, often leading to death in
severely affected animals [36, 37]. Trichostrongylosis is triggered
by the presence of adult parasites in mucus-covered tunnels in the
epithelial surface of the small intestine [38], usually associated with
extensive villous atrophy, combined with hyperplasia of the submucosal glands, mucosal thickening, and erosion as well as infiltration
of lymphocytes and neutrophils into affected areas [3842]. Clinical
signs of trichostrongylosis include malabsorption, weight loss, progressive emaciation, and diarrhea (scouring or black scour).
The hookworms N. americanus and A. duodenale of humans are
estimated to infect ~1 billion people in rural regions of the subtropics and tropics [1], with the highest prevalence (~17 %)
recorded in areas of sub-Saharan Africa and China [1, 43, 44], and
cause an estimated disease burden of 22 million disability-adjusted
life years (DALYs) [45]. Although N. americanus is the most
widely distributed hookworm of humans globally [1], a related
440
species, A. caninum, is a cosmopolitan hookworm of the small

intestine of dogs and other canids [14, 26]. The life cycle of these
nematodes is direct, with female hookworms excreting thin-shelled
eggs, which are passed in the feces of the host [26, 46]. Under
suitable environmental conditions (i.e., 2333 C), the L1s hatch
from the eggs [26, 46], feed on microbes, and, within 2 days, molt
to L2s and then to L3s within 45 days. The L3 stage retains the
cuticle of the L2 (i.e., sheath) and is called a filariform larva
[46]. Infection occurs when the L3s penetrate the skin of the vertebrate host following cuticular shedding [47]; then, the larvae
enter the subcutaneous tissues and migrate via the circulatory system to the heart and lungs, where they molt to fourth-stage larvae
(L4s). From the lungs, the larvae migrate (via the airways and
pharynx) to the small intestine, where they develop to adult males
and females within 27 weeks, depending on species [14, 26, 48,
49]. The adult stages attach by their buccal capsule to the intestinal
mucosa, rupture capillaries and feed on blood [50, 51]. Although
skin penetration is considered the main route, ingestion of L3s
might also lead to infection [52]. L3s of Ancylostoma spp. can
undergo hypobiosis (developmental arrest) in the somatic tissues
of the vertebrate host and, following activation during pregnancy,
undergo transmammary transmission to the offspring [5355].
Hookworm disease relates mainly to the blood-feeding activity
by the adult worms within the host [50]. Focal lesions caused by
the attachment of the worms are characterized by local hemorrhage, tissue cytolysis and a neutrophilic immune response [50].
The clinical expression of disease relates mainly to iron-deficiency
anemia, which can cause physical and mental retardation and sometimes deaths in children as well as maternal mortality, impaired
lactation, prematurity and low birth rates [3, 56, 57].
2.2 Host Immune
Responses
Various studies have described molecules and cells implicated in

host immune responses against parasitic nematodes [2, 5870].
The primary immunological responses induced by nematodes are
dependent on the processes and mechanisms of invasion of and
establishment in the host [2]. For example, migrating hookworm
L3s stimulate a marked peripheral blood eosinophilia in the mammalian host, both systemic and in the lungs [71, 72]. Conversely,
nematodes that do not undergo extensive tissue migration stimulate a mucosal immune response at the site of infection [73]. For
instance, the invasion of the abomasa of small ruminants by the
larvae of H. contortus and Trichostrongylus axei leads to a localized
IgE-mediated immune response [73]. However, it has been
observed that the infection of pigs with L3s of Oesophagostomum
dentatum is associated with a systemic production of IgG antibodies [7476], followed by the formation of eosinophilic cysts containing the larvae (nodules) within the intestinal mucosa [77].
441
In spite of variation in immune responses induced by larvae of

strongylid nematodes, adult stages appear to stimulate similar
immunological responses in their mammalian host(s). These
responses include (1) increased production of mucus by the gastrointestinal epithelium of the host, (2) eosinophilia and increased
presence of mast cells and leucocytes at the infection site and (3)
production of specific antibodies [2, 60]. Responses against primary infections by gastrointestinal parasitic nematodes are reported
to be linked to a T helper (Th) 2-type immune response which, in
turn, relates to the secretion of multiple types of cytokines, including IL-4, IL-5, IL-9 and IL-13 [2, 62, 68, 7880]. In contrast,
immunological responses in hosts with chronic infections appear to
be regulated mainly by a Th1-type immune response, characterized by a production of IL-2, IL-18 and interferon- [65, 66, 70].
In particular, individuals infected chronically by hookworms show
a significant alteration of the immune response to helminth infections, characterized by a dysfunction of the antigen-presenting
ability of dendritic cells, which results in a hyporesponsiveness of
the antigen-induced proliferation of T lymphocytes [79].
2.3 Drugs
and Vaccine Research
The control of gastrointestinal nematodes relies heavily on the use

of anthelmintic drugs [81]. Such drugs include imidazothiazoles/
tetrahydropyrimidines (e.g., levamisole and pyrantel), benzimidazoles (e.g., albendazole and mebendazole) and macrocyclic lactones (e.g., ivermectin and moxidectin) [81]. Levamisole and
pyrantel act by binding to a subgroup of nematode acetylcholine
receptor ion channels in parasite nerves and muscles of parasitic
nematodes, resulting in an overstimulation, spastic muscle contraction [82] and paralysis of the worms; the parasites are unable to
move in the intestinal tract and are removed by peristalsis.
Benzimidazoles are active against a range of species of nematodes
[83]; they block microtubular matrix formation by binding to
tubulin (cytoskeletal protein), which is essential for various biological processes in the cell, including chromosome movement and
cell division [11, 81, 84]. Macrocyclic lactones act by opening
glutamate-gated chloride channels, thus increasing the flow of
chloride ions and subsequently leading to defects in neurotransmission and flaccid paralysis [84]. Recently, new classes of anthelmintics, including cyclooctadepsipeptides (e.g., emodepside),
amino acetonitrile derivatives (e.g., monepantel) and 2-deoxyparaherquamides (e.g., derquantel) have become available commercially [85]. These compounds act by binding to presynaptic
latrophilin-like receptors (emodepside), some acetylcholine receptors (monepantel) or B-subtype nicotinic acetylcholine receptors
(derquantel) and cause spastic (monepantel) or flaccid (emodepside and derquantel) paralysis of some parasitic nematodes and
subsequent death [85].
442
The relatively low cost, ease of administration and efficacy of

anthelmintic drugs against various gastrointestinal parasitic nematodes of humans and animals have led to their extensive use and,
consequently, to the emergence of resistance [11]. Indeed, resistance in nematodes of livestock to imidazothiazoles/tetrahydropyrimidines, benzimidazoles and macrocyclic lactones has been
reported, particularly in Africa, Australia, New Zealand, Asia and
South America [11, 12, 37, 84, 86]. Three mutations in the gene
encoding the beta-tubulin isotype 1 in H. contortus were proposed
to be involved in the mechanism of benzimidazole resistance [87].
Although it was suggested that a less frequent use of anthelmintics
in humans (compared with their extensive use in livestock) should
reduce the emergence of resistance in parasitic nematodes [88
91], some studies [9297] have reported a reduction in efficacy of
mebendazole and pyrantel in N. americanus and A. duodenale in
areas of Mali, Zanzibar and North Western Australia, proposed to
be attributed to resistance. Given the incomplete knowledge of the
molecular mechanisms associated with resistance in parasitic nematodes [11], much attention is now directed towards the identification of new drug targets and the development of new, effective,
and safe anthelmintics [98, 99] and effective strategies to prevent
drug resistance [100102].
Over the years, considerable research has focused on developing
vaccines against selected parasitic nematodes [8, 9, 57, 80, 103
108]. For instance, irradiated larvae were used as the basis for a
vaccine against H. contortus and A. caninum infection in sheep and
dogs, respectively [109112]. More recently, various proteins of
the epithelial cell-surface membrane of the digestive tract of some
gastrointestinal nematodes have been evaluated as vaccine candidates in experimental murine models or in livestock [9, 106, 107,
113]. For example, a 110 kDa integral membrane aminopeptidase
of H. contortus, which is heavily glycosylated and localized in the
brush border of the epithelial cells of the gut of the adult worm, was
shown to be effective in reducing the intensity of H. contortus infection in different breeds and ages of sheep [114117]. However,
protection is limited to native proteins, administered multiple times,
usually in Freunds adjuvant [118]. Another peptidase complex
(P1), separated from the membrane aminopeptidase H11 by ionexchange chromatography, was identified and shown to represent a
ubiquitous component of the microvillar membrane of the intestinal cells of H. contortus [119]. Although vaccination with this protein complex resulted in a significant reduction (69 %) in the
number of H. contortus eggs in the feces of vaccinated sheep following H. contortus challenge infection, P1 led only to an ~2238 %
reduction of infection intensity (parasite burden) [115]. On the
other hand, vaccination with the glucose-binding glycoprotein
complex (H-gal-GP), separated by lectin affinity chromatography
443
from other integral membrane proteins from the gut of adult H.

contortus, achieved ~5372 % protection and a >90 % reduction in
the number of eggs in the feces of vaccinated sheep [120]. However,
the vaccination of lambs (9 months of age) with prokaryotically
expressed recombinant H-gal-GP failed to induce protective immunity against challenge infection with H. contortus L3s [121].
Other vaccine candidates have been derived from the excretory/secretory products (ES) from worms [57, 80, 106, 122]. For
example, proteases in ES from parasitic nematodes have been a
major focus for vaccine development, given their inferred roles in
the digestion of nutrients acquired from the host and/or during
the penetration and migration through host tissues [122].
Metalloproteases, aspartic proteases and cysteine proteases have
received considerable attention for blood-feeding nematodes, such
as H. contortus, A. caninum, and N. americanus [57, 106, 123
128]. For instance, vaccination with a cysteine protease-enriched
fraction from membrane extracts from the microvillar surface of
intestinal cells from adult H. contortus [129] was demonstrated to
reduce infection intensity by 47 % and the number of eggs in feces
by 77 % in sheep following a single challenge infection [130].
Similarly, the vaccination of dogs with recombinant forms of a cysteine or aspartic protease from A. caninum (designated Ac-CP-2
and Ac-APR-1, respectively) resulted in partial protection against
this hookworm, characterized by an absence of clinical signs and a
reduced fecundity of the adult worms in dogs [126, 131]. In addition, vaccination of hamsters with the N. americanus homologue
of Ac-CP-2 (i.e., Na-CP-2) was shown to induce partial protection, achieving an ~3046 % reduction of infection intensity, following challenge infection with L3s [132].
Proteases from larval stages have also been the focus of vaccine
research, because of their proposed role(s) in host invasion [80,
133]. In ES from hookworm larvae, for example, an astacin-like
zinc metalloprotease from A. caninum, called Ac-MTP-1, has
been demonstrated to degrade fibronectin, laminin, and collagen
[134, 135]. Based on the results of a vaccine trial in hamsters, this
protein was proposed as a potential candidate for the development
of a multi-epitope vaccine [132]. In addition, two cysteine-rich
secretory proteins, known as Ancylostoma-secreted proteins
(ASPs) [136139], major components of ES of hookworm L3s,
can represent vaccine candidates [140]. However, the development of ASP-based vaccines has been impaired by evidence that
such molecules can cause allergic reactions in humans previously
infected with N. americanus hookworms [141, 142].
Collectively, the results of studies focusing on the identification of suitable immunogens and the development of effective
vaccines against gastrointestinal parasitic nematodes show that
progress has been made over the years. However, there is still lim-
444
ited information on parasite-host interactions at the molecular

level. Clearly, advanced molecular technologies provide unique
opportunities to explore the molecular biology of parasitic nematodes, parasite-host interactions and diseases on a global scale and
should thus underpin the discovery of new intervention strategies.
Indeed, high-throughput technologies are revolutionizing the
way biology is done, allowing systems biological investigations of
parasites and other pathogens. This statement applies to many
areas, including genomics, proteomics and metabolomics, but
also the detailed explorations of transcriptomes and associated
molecular processes.
3 Some Key Techniques for Transcriptomic Investigations of Parasitic

Nematodes
3.1 Conventional
Methods
The genome of any living organism includes coding regions that

are transcribed into mRNAs, which are subsequently translated
into proteins. Techniques, such as Northern blot [143], quantitative real-time, reverse transcription PCR (qRT-PCR; 144) and differential display (DD; 145), have been used to define patterns of
transcription for single genes or small numbers of molecules in
parasitic nematodes, such as species of Trichostrongylus,
Haemonchus, Oesophagostomum, and Ostertagia [146153].
Another approach is the serial analysis of gene expression (SAGE)
[154], which is based on the generation of a short specific tag (14
bp) from each mRNA present in the sample; these tags are used for
the construction of a SAGE library. The sequencing of these tags
allows a relatively high-throughput determination of their frequencies in the library, which are correlated with relative amounts of the
corresponding mRNAs. Despite its demonstrated utility in studies
of yeast [155] and humans [156, 157], the application of SAGE
for investigations of transcription in parasitic nematodes has
remained limited [158]. A single study [159] used SAGE to
sequence and analyze ~3,000 transcripts from adult H. contortus,
of which ~60 % had homologues in public databases.
The analysis of conventional expressed sequence tag (EST)
datasets has been a widely used approach for investigations of the
transcriptomes of parasitic nematodes. In vitro, mRNAs are
reverse-transcribed, resulting in stable complementary DNAs
(cDNAs); ESTs usually represent single-pass DNA sequence reads
derived from cloned cDNAs [160, 161]. Traditional sequencing
[162, 163] involves the use of a DNA polymerase, an oligonucleotide primer and four deoxyribonucleotide triphosphates (dNTPs)
to synthesize the complementary strand to the template sequence
[162164]. The advent of EST sequencing marked a revolution in
the field of parasitology and has been used in a range of studies
445
aimed at investigating fundamental molecular processes in parasitic

nematodes as well as drug and vaccine target discovery (e.g., 17,
165172). For nematodes of animals, applications range from the
analyses of stage- and gender-enriched molecules (e.g., 149, 153,
167, 173, 174) to global analyses of gene transcription (e.g., 166,
170, 175177).
The cDNA microarray technology [178] was a significant
advance for large-scale studies of the transcriptomes of parasitic
nematodes [179]. In microarrays, thousands of oligonucleotides,
usually cDNAs, EST clones or fragments of PCR products (which
correspond to previously characterized genes/transcripts), are
spotted (arrayed) on to glass slides or chips in precise positions. The mRNAs from different stages or tissues are labeled with
different fluorescent or radioactive markers and hybridized to the
spots on the array. The relative abundance of hybridization for
each mRNA population is then determined by comparing the relative signal intensity of each marker [178]. Supported by the
increasing amount of sequence data available in public databases,
microarray technology has allowed comparisons of levels of transcription of large numbers of mRNAs in, for instance, different
tissues, developmental stages, and sexes of these nematodes to be
performed, ultimately providing researchers with the opportunity
to identify molecules considered to play essential roles in fundamental biological pathways of survival, development, and reproduction [9, 179, 180]. The use of microarray technology has
resulted in an expanded knowledge of the transcriptomes of socioeconomically important strongylids, including H. contortus, T. vitrinus, O. dentatum, Teladorsagia circumcincta and A. caninum
[153, 174, 181185]. In addition, the combined application of
suppressive-subtractive hybridization (SSH) and microarray analysis has been useful in enabling rapid comparisons of transcriptional
profiles between/among life cycle stages, genders and/or species
of parasitic nematodes [153, 183, 184, 186188].
Knowledge of the complement of molecules transcribed in the
larval stages of strongylid nematodes should also aid the elucidation of pathways associated with infectivity and interactions with
the vertebrate host. The molecular mechanisms that regulate the
transition from the free-living stage to the parasitic stage of nematodes may allow the development of novel strategies to disrupt this
transition. Previous studies have analyzed differences in transcription between the ensheathed, free-living L3 and exsheathed L3 of
H. contortus [152, 167, 189] and the related strongylid, A. caninum [182, 183]. The results of a cDNA microarray analysis, complemented by qRT-PCR of differentially transcribed molecules,
showed that, among others, most transcripts encoding ASPs were
upregulated in free-living L3s compared with parasitic, serumstimulated larvae of A. caninum [182]. However, a study using
446
SSH-based microarray analysis [183] showed a substantial upregulation in the numbers and levels of transcripts encoding ASPs in
serum-activated L3s [183].
To date, molecular studies of hookworms have mainly involved
A. caninum, because of its use as a model for species infecting
humans [182, 183, 190192]. Clearly, detailed knowledge and
understanding of the molecules transcribed in all stages of different
species of hookworms, including N. americanus and A. duodenale
of humans, should facilitate the identification of conserved pathways linked to development, survival, reproduction, parasite interactions and disease, and could assist in the discovery of new
intervention strategies.
3.2 High-Throughput
Sequencing
Techniques
Recent advances in sequencing technologies [193196]; Table 1)

now provide the unique opportunity to perform de novo analyses
of the whole transcriptomes of different species, sexes and/or
developmental stages of nematodes of socioeconomic importance.
Currently available massively parallel sequencing platforms include
the 454/Roche [193]; www.454.com), Illumina/Solexa [194];
www.illumina.com), and SOLiD (Supported Oligonucleotide
Ligation and Detection) [195]; http://www.invitrogen.com/site/
us/en/home/Products-and-Services/Applications/Sequencing/
Next-Generation-Sequencing.html) platforms (Table 1). Due to
their capacity of generating millions or hundreds of millions of
Table 1
Technical features of next-generation sequencing platforms (i.e., 454/Roche, Illumina/Solexa, and SOLiD)a
Description
454/Roche
Illumina/Solexa
SOLiD
Platform
Genome Sequencer FLX
Genome Analyzer IIx
SOLiD 3 Plus System
Sequencing
method
Emulsion PCR of beadbound oligos
Isothermal bridge
amplification on flow
cell
Emulsion PCR of
bead-bound oligos
Sequencing
chemistry
Pyrosequencing using
polymerase
Ligation (dual-base
encoding octamers)
Reversible terminator
using polymerase
Reads per run
~1 million
Up to 3 billion
1.2 to 1.4 billion
Read length
1,000 bp
50250 bp
100 bp
Run time
~12 h
~29 days
~3 days
Peer-reviewed
manuscripts
++++
+++
++
Examples of
applications
De novo sequencing,
metagenomics, targeted
sequencing
Resequencing, RNA-Seq,
DNA methylation
studies
Resequencing, RNA-Seq
Based on information available on July 2012
447
sequences simultaneously, these platforms have been at the forefront of the genomic and transcriptomic research [197199] and
are powerful tools for investigating the transcriptomes of parasitic
nematodes on an unprecedented scale.
The 454/Roche platform [193] uses a sequencing-by-synthesis
approach. For transcriptomic studies, cDNA is randomly fragmented (by nebulization) into sections of variable size; adaptors
are ligated to each end of these fragments, which are then mixed
with a population of agarose beads whose surfaces anchor oligonucleotides complementary to the 454-specific adapter sequence,
such that each bead is associated with a single fragment. Each of
these complexes is transferred into individual oilwater micelles
containing amplification reagents and is then subjected to an emulsion PCR (emPCR) step, during which ~10 million copies of each
cDNA are produced and bound to individual beads. Subsequently,
in the sequencing phase, the beads anchoring the cDNAs are
deposited on a picotiter plate, together with other enzymes
required for the pyrophosphate sequencing reaction (i.e., ATP sulfurylase and luciferase), and sequencing is carried out by flowing
the reagents (nucleotides and buffers) over a plate [200].
Following the introduction of the 454 technology, the first
Illumina (formerly Solexa) sequencer became available [194]. This
technology involves fragmentation of cDNA sample into a shotgun
library, followed by the in vitro ligation of Illumina-specific adaptors to each cDNA template; the termini of the template are covalently attached to the surface of a glass slide (or flow cell). Attached
to the flow cell are primers complementary to the other end of the
template, which bend the cDNAs to form bridge-like structures.
During the amplification step (bridge-PCR), clonal clusters, each
consisting of ~1,000 amplicons, are generated; subsequently, the
cDNAs are linearized, and the sequencing reagents are directly
added to the flow cell, with four types of fluorescently labeled
nucleotides. After the incorporation of a fluorescent base, the flow
cell is interrogated with a laser in several locations, which results in
several image acquisitions at the end of a single synthesis cycle
[200]. This technology is considered ideal for both de novo and
resequencing projects, targeted sequencing, single-nucleotide
polymorphism (SNP) analyses and gene transcription studies.
The sequencing process of the SOLiD platform [195] employs
the enzyme DNA ligase, instead of a polymerase [200]. Briefly, after
an emPCR step, the adaptor sequences of the cDNA templates bind
to complementary primers that are covalently anchored to a glass
slide. Subsequently, a set of four fluorescently labeled di-probes
(octamers of random sequence, except known dinucleotides at the
3-terminus) are added to the sequencing reaction. In case an
octamer is complementary to the template, it will be ligated, and the
two specific nucleotides can be called; subsequently, an image is acquired
448
and the fluorescent dye is removed, so that other octamers can be

ligated. After multiple ligations (e.g., seven ligations for a 35 bp
read), the newly synthesized cDNA is removed and the primer is
inactivated. This process is repeated multiple times from different
starting points of the cDNA templates, so that each position is
sequenced at least twice. This technique, known as two-base calling, allows the correction of sequencing errors, thus providing
accurate base calling [200]. Because of the short read length, the
range of applications of the SOLiD system is considered similar to
that of the Illumina technology and includes (targeted) resequencing projects, SNP detection and gene transcription studies.
In the past few years, numerous studies have demonstrated the
utility of high-throughput sequencing for investigating, for example, aspects of the systematics, population genetics and molecular
biology of helminths [192, 201211]. For instance, Illumina technology alone has been used to sequence the entire genomes of
Ascaris suum [202] and the human blood fluke, Schistosoma haematobium [211], whereas the 454 technology has been instrumental
for de novo sequencing of the transcriptomes of important parasitic
worms, such as N. americanus, Clonorchis sinensis, Opisthorchis
viverrini, Fasciola hepatica and F. gigantica of humans and other
animals [205, 208210]. Several thousands of unique and novel
sequences were characterized for each of these parasites, demonstrating the capacity of this technology to generate large and informative datasets. The development of suitable bioinformatic tools
has become crucial for the detailed analyses of such datasets.
3.3
Bioinformatics
3.3.1 Assembly
The increasing number of high-throughput sequence datasets in

public databases has been accompanied by an expansion of bioinformatic tools for the analysis of such datasets, at the cDNA,
genomic DNA and protein levels. This expansion has resulted in
the development of a number of web-based programs and/or integrated pipelines [16, 206, 212218]. In brief, following the acquisition of sequence data, these are firstly screened for sequence
repeats, contaminants and/or adaptor sequences [215, 219].
Following the preprocessing, sequences are clustered (assembled) into contiguous sequences (of maximum length) based on
sequence similarity.
The main goal of sequence assembly is to determine, with confidence, the sequence of a target transcript/gene. This process
involves the alignment and merging of fragments of nucleic acids
to form long, contiguous sequences (i.e., contigs) [18, 215]. Long
(e.g., generated by Sanger sequencing or 454 technology) and
short reads (e.g., Illumina or SOLiD platform) are assembled using
algorithms for overlap-layout consensus [220] and de Bruijn
graph [221, 222], respectively.
449
For the former algorithm [220], all pairwise overlaps among

reads are computed and stored in a graph; all graphs are used to
compute a layout of reads and then a consensus sequence of contigs [223, 224]. Some of the assemblers designed to support longread assembly include PHRAP [225], the contig assembly program
v.3 (CAP3; 212), the TIGR assembler [226], the parallel contig
assembly program (PCAP; 227) and the mimicking intelligent
read assembly program (MIRA; 228).
For the de Bruijn graph [221, 222], reads are fragmented
into short segments, called k-mers, where k represents the
number of nucleotides in each segment. Overlaps between or
among k-mers are captured and stored in graphs, which are subsequently used to generate the consensus sequences [223, 224].
Examples of programs specifically designed for the assembly of
short reads include the short sequence assembly by k-mer search
and 3-read extension (SSAKE; 229), Velvet [222], Oases [230],
the exact de novo assembler (EDENA; 231), Euler-SR [232], the
assembly by short sequencing (ABYSS; 233), the short oligonucleotide analysis package (SOAP; 234) and Trinity [235].
3.3.2 Annotation
and Analyses
Following assembly, the contigs and single reads (or singletons) are
compared with known sequence data available in public databases,
in order to assign a predicted identity to each query sequence if
significant matches are found [206, 215]. In addition, assembled
nucleotide sequences are usually conceptually translated into predicted proteins using algorithms that identify protein-coding
regions (open reading frames, ORFs) from individual contigs.
Examples of such algorithms are OrfPredictor [236], ESTScan
[213], DECODER [237] and ORFcor [238]. Once peptide
sequences are predicted, they are compared with amino acid
sequence data available in public databases to identify protein
domains [206, 215]. For instance, the software InterProScan
[216] provides an integrated tool for the characterization of a protein family or an individual protein sequence, domain and/or
functional site by comparing sequences with information available
in the databases PROSITE [239], PRINTS [240], Pfam [241],
ProDom [242], SMART [243] and/or Gene Ontology (GO;
244). In addition, other programs are available for the prediction
of transmembrane domains (e.g., TMHMM; 245) and/or signal
peptide motifs (e.g., SignalP; 246).
Different types of the Basic Local Alignment Software Tool
(BLAST; 247) are used for comparing the nucleotide sequence data
with DNA or cDNA (BLASTn) or amino acid (BLASTx) sequences
or conceptually translated peptides with protein sequences
(BLASTp), available in databases [206, 215]. Public databases represent comprehensive collections of nucleotide and amino acid
sequences. Due to the rapid progress in the discovery and character-
450
ization of novel genes and proteins, online public databases have

become primary sources for sequence data storage, analysis and
annotation. For example, the International Nucleotide Sequence
Database Collaboration includes three sister databases, namely
GenBank [248], the Enterprise Management Technology Transfer
nucleotide database curated by the European Molecular Biology
Laboratory (EMBL; 249) and the DNA Data Bank of Japan (DDBJ;
250). In these databases, all publicly available nucleotide sequences
are stored and curated; in addition, each sequence is stored as a separate record and linked to information, such as primary source references and predicted and/or experimentally verified biological
features. For high-throughput sequencing projects, raw sequence
data are often stored in subdivisions of these nucleotide databases,
such as UniGene [251] and the Sequence Read Archive [252].
Various databases, which exclusively store known amino acid
sequence data, are also available. For instance, the Protein Data
Bank (PDB; 253), maintained by the Research Collaboratory for
Structural Bioinformatics, represents the primary source for protein
structures, whereas the SWISS-PROT database [254] is a protein
sequence database for a number of prokaryotes and eukaryotes. The
TrEMBL [255] division of SWISS-PROT contains a non-redundant
set of translations for all coding sequences in the EMBL nucleotide
sequence database that do not correspond to existing SWISS-PROT
entries. In addition to these comprehensive general databases, there
is a number of specialized collections of gene and protein information on particular organisms. Examples include the databases for
Saccharomyces cerevisiae (yeast) (www.yeastgenome.org; 256),
Drosophila melanogaster (vinegar fly) (http://flybase.org; 257),
Mus musculus (mouse) (www.informatics.jax.org; 258) and C. elegans (free-living nematode) (WormBase at www.wormbase.org;
259). WormBase is a comprehensive repository of information on C.
elegans and related nematodes, such as C. briggsae [259]. Here,
essentially all information and data on classical genetics, cellular biology, and structural and functional genomics of these free-living
nematodes are stored and continually curated [259262].
The functional annotation of sequence data for parasitic nematodes has often relied on pairwise homology-based comparative
analyses with already annotated and curated sequence datasets for
a range of organisms [203, 204]. However, many genes, transcripts
and gene products of these worms (often 50 %) cannot be functionally annotated using this approach, because closely related,
homologous molecules do not exist in transcriptomic and/or
genomic datasets available in public databases and/or because
sequence datasets are incomplete. In addition, as functional
genomic tools are not yet practical or established for most parasitic
helminths, improved bioinformatic approaches need to be established and continually enhanced to achieve enhanced functional
451
annotation of genes and gene products. Recently, Mangiola et al.

[263] tackled this issue and compiled transcriptomic datasets of
key, socioeconomically important parasitic helminths, constructed
and validated a curated database (HelmDB; www.helmdb.org),
and showed how data integration and clustering can achieve
improved functional annotations. HelmDB provides a practical
and user-friendly toolkit for sequence browsing and comparative
analyses among divergent helminth groups (including nematodes
and trematodes) and should be readily adaptable and applicable to
a wide range of parasites.
Caenorhabditis elegans as Major Resource for Comparative Studies

The annotation and analysis of sequence data derived from many
parasitic nematodes, particularly Strongylida, relies on information
available for C. elegans (in WormBase). The latter nematode is simple in its anatomy (959 somatic cells in the hermaphrodite and
1,031 in the male), has a short life cycle (~3 days) and is easy to
culture in vitro [264]. The genome of C. elegans is ~100 Mb in
size [265]. Currently, WormBase contains detailed and curated
information on ~20,000 C. elegans genes and associated data on,
for instance, transcription/expression profiles in different developmental stages, tissues and cells, mutants and their phenotypes,
genetic and physical maps, SNPs, information on gene-gene and
protein-protein interactions, as well as all peer-reviewed literature
pertaining to C. elegans.
The advent of double-stranded RNA interference (RNAi; 266)
has revolutionized the study of gene function in metazoan organisms and led to detailed information on the functions of ~96 %
genes in C. elegans [267271]. The principle of RNAi relies on the
introduction of double-stranded RNA (dsRNA) into the cells of a
living organism, which induces the degradation of the homologous (target) mRNA [266]. The dsRNA can be introduced directly
into C. elegans by injection [266], by soaking worms in solution
[272] or by feeding worms Escherichia coli expressing a dsRNA
fragment of a target gene [273]; it can also be introduced using a
transgene expressing dsRNA [274, 275]. This gene silencing
approach opened up avenues for large-scale studies of molecular
function in C. elegans [267270, 274, 276, 277] as well as for
comparative studies (e.g., comparison with parasitic nematodes or
humans) [278282].
Transgenesis of C. elegans has also been widely used for assessing gene function [283, 284]. This technique can involve the
microinjection of expression constructs, which usually comprise
plasmid or cosmid DNA, often incorporating green fluorescent
protein (GFP; 285) into the syncytium (mitotically active) region
of the adult hermaphrodite gonad (gonadal microinjection);
452
alternatively, the DNA constructs can be transferred directly into

target cells via high-density microparticles of gold or tungsten
(biolistics or particle bombardment) [286]. Introduced DNA
does not usually integrate into the chromosome, but rather it
forms a multi-copy extrachromosomal array which can be inherited. Labeling with GFP allows the study of a number of (temporal
and spatial) biological processes, including gene expression, protein localization and dynamics, protein-protein interactions, cell
division, chromosome replication and organization, intracellular
transport pathways, organelle inheritance and biogenesis [287].
In addition to investigations of gene expression and localization, patterns of gene transcription during key developmental and
reproductive processes have also been studied in C. elegans,
employing microarray technology [288290]. In an early study
[288], various groups of molecules were demonstrated to have
high expression levels in the germ-line tissues of C. elegans, i.e., the
germ-line-intrinsic molecules (expressed in the germ line of hermaphrodites producing either sperm or oocytes and proposed to
play key roles in biological processes linked to meiosis, stem cell
recombination and germ-line development), and molecules highly
expressed either in oocyte-producing or sperm-producing hermaphrodites [288]. The latter group included a large number of
molecules, such as protein kinases and phosphatases, associated
with spermatogenesis, in accordance with other studies investigating gender-enriched transcriptional patterns in parasitic nematodes
(e.g., 153, 174, 181). Previously, genetic studies had indicated
that ~5070 % of genes in parasitic nematodes have orthologues in
C. elegans [27, 171], which supported the grouping of this freeliving nematodes into clade V of the phylum Nematoda, together
with parasitic nematodes of the order Strongylida [27, 291]. These
results, together with similarities in various characteristics (such as
body plan and molting) between C. elegans and some parasitic
nematodes (e.g., 5, 292), indicate that this free-living nematode
provides a useful system for comparative investigations of many
conserved biochemical and molecular pathways linked to development in related nematodes.
5 Understanding Nematodes of Socioeconomic Importance Through Genomics

and Transcriptomics: Examples
High-throughput sequencing technologies (Table 1) and improved
bioinformatic tools are providing unparalleled opportunities for
global analyses of the genomes and transcriptomes of key nematodes, such as A. suum [202] and Trichinella spiralis (trichina;
293). Recent studies have utilized such technologies to explore the
transcriptomes of different developmental stages and both sexes of
453
key strongylid nematodes, including N. americanus, H. contortus,

T. colubriformis and O. dentatum [203206].
Although human hookworms are of major socioeconomic
importance [1, 3, 6, 7], genomic and molecular studies have mostly
involved A. caninum (e.g., 182, 183, 190192). Recently, 454
sequencing and bioinformatic analyses were conducted to investigate, for the first time on a large scale, the transcriptome of the
adult stage of N. americanus [205]. The results showed that transcripts encoding proteases and Kunitz-type protease inhibitors
were most abundantly represented in the transcriptome of this
nematode, supporting the fundamental roles that these molecules
play in multi-enzyme cascades to digest hemoglobin and other
serum proteins [294, 295], and in preventing homeostasis and
inhibiting host proteases [296, 297]. Using a combination of
orthology-mapping and functional data available for C. elegans,
Cantacessi et al. [205] predicted 18 potential drug targets in the
transcriptome of the adult stage of N. americanus, which included,
for instance, mitochondria-associated proteins known to be essential in C. elegans [298].
In H. contortus, high-throughput sequencing and bioinformatic analyses were used to explore differences in gene transcription between the free-living (L3) and the parasitic (xL3) third
larval stages and to predict the roles that key transcripts play in the
metabolic pathways linked to larval development [204]. These
analyses revealed that transthyretin-like proteins (TTLs) and
calcium-binding proteins were highly represented in the transcriptome of both H. contortus L3 and xL3, whereas selected transcripts
encoding collagens and neuropeptides were present exclusively in
L3 and proteases in xL3 [204]. In nematodes, the synthesis of collagens has been observed to increase significantly prior to a molt
[299], whereas proteins involved in the development of the nervous system are essential in the cascade of events that lead to the
growth and development of the larval stages [300]. Therefore,
increased transcription of neuropeptides in L3s of H. contortus
might relate to axon guidance and synapse formation during the
L3s transition to parasitism [204]. This statement is supported by
the fact that, in H. contortus, the transition from the free-living L3
to the parasitic L3 is triggered by gaseous CO2, detected by chemosensory neurons of amphids, which are located in the anterior
end of the L3 stage, ultimately leading to the secretion of the neurotransmitter noradrenaline [5]. Conversely, the largest number of
C. elegans orthologues of H. contortus xL3-specific transcripts
encoded peptidases and other enzymes involved in amino acid
catabolism, supporting previous evidence that cysteine proteases
play a crucial role in the catabolism of globin, as is the case for A.
caninum and N. americanus [146, 294, 295, 301]. A similar
spectrum of proteases and other molecules linked to catalytic activity
454
had been shown also to be highly represented in the transcriptomes of

activated xL3 stages of both H. contortus and A. caninum in comparison with their L3s [183, 204]. This finding, for two hematophagous bursate nematodes with differing life histories, is likely
to reflect the key roles that these molecules play in host tissue invasion, degradation and/or digestion.
In the transcriptome of T. colubriformis, molecules encoding
peptides which are predicted to be associated with the nervous
system (i.e., transthyretin-like and neuropeptide-like proteins
(TTLs and NLPs, respectively)), digestion of host proteins, or
inhibition of host proteases (i.e., proteases and protease inhibitors,
respectively) were highly represented [203], with serine and metalloproteases and Kunitz-type protease inhibitors being the vast
majority of molecules characterized [203]. In strongylid nematodes, these molecules play fundamental roles in the invasion of the
vertebrate host by mediating, for example, tissue penetration, feeding and/or immune evasion by (1) digesting antibodies, (2) cleaving cell-surface receptors for cytokines and/or (3) causing the
direct lysis of immune cells [302306].
In an effort to predict and prioritize molecules that could represent novel drug targets and are expressed across different stages
of development, Cantacessi et al. [206] employed high-throughput
sequencing and predictive algorithms to explore similarities and
differences in the transcriptomes of the L3, L4, and adult male and
female of O. dentatum [206]. Most of the molecules unique to the
adult male and female of O. dentatum could be linked to pathways
associated with reproductive processes. For instance, a large number of O. dentatum male-specific molecules encoded major sperm
proteins (MSPs), in accordance with previous studies of maleenriched datasets of other species of trichostrongylid nematodes,
including T. vitrinus and H. contortus [174, 181]. Based on the
observation that MSPs from various nematodes, including C. elegans, are characterized by significant amino acid sequence conservation (~67 %; 307), a similar role has been proposed for these
proteins in processes linked to the maturation of oocytes in the
uterus of female nematodes [308, 309]. In addition, a large proportion (17 %) of molecules unique to the larval stages of O. dentatum represented proteases that, in this species, have been
reported to evoke immunological and/or inflammatory reactions
(including infiltrations of neutrophils and eosinophils) surrounding the encapsulated larvae [77, 180]. In addition, somatic extracts
of and supernatants from in vitro maintenance cultures of O. dentatum L4s have been shown to induce the proliferation of porcine
mononuclear cells in vitro [310], which supports the hypothesis
that L4-specific proteases play an active role in the modulation of
the hosts immune response [302304]. The results from a recent
study showed also that a high proportion (2732 %) of transcripts
455
encoding protein kinases and phosphatases were common among

all developmental stages of O. dentatum investigated [206].
Supported by investigations of the free-living nematode C. elegans,
other studies have predicted, for instance, that some kinases and
phosphatases could represent targets for novel nematocidal drugs
[99, 311]. Some cantharidin/norcantharidin analogues [312
314] are known to display exquisite and specific inhibitory activity
against PP1 and PP2A phosphatases, which indicated that some of
them could be designed to selectively inhibit essential serine/threonine phosphatase (STPs) of nematodes [311] (see Subheading 6).
In addition to phosphatases, other molecules, such as chitinbinding proteins or proteases, might be interesting drug target
candidates, given that they are proposed to have crucial roles in
pathways linked to developmental and reproductive processes in
some nematodes [180, 206, 315].
Highly represented in the transcriptomes of a number of strongylid nematodes [203206] are proteins containing a spermcoating protein (SCP)-like extracellular domain (InterPro:
IPR014044), also called SCP/Tpx-1/Ag5/PR-1/Sc7 (SCP/
TAPS, Pfam accession number no. PF00188), or ASPs [139]. Due
to their abundance in the excretory/secretory products from
serum-activated L3s (aL3s) of A. caninum and high transcriptional
levels of mRNAs encoding ASPs in activated L3s compared with
non-activated, ensheathed L3s, these molecules have been hypothesized to play a major role in the transition from the free-living to
the parasitic stages of this hookworm [137, 183]. Other ASP
homologues have been characterized for the adult stage of hookworms and are proposed to play a role in the initiation, establishment and/or maintenance of the host-parasite relationship [183,
316, 317]. Due to the immunogenic properties of ASPs, one
member of this protein group (i.e., Na-ASP-2) has been under
investigation as a vaccine candidate against necatoriasis in humans
[57, 132, 318320]. Whether SCP/TAPS proteins or their genes
represent drug target candidates still remains to be determined.
For ASPs, a focus of future research could be on studying their
structure and function in parasitic helminths, to pave the way for
applied outcomes, such the development of vaccines and/or drugs
[321].
Opportunities for Drug Discovery Using Global Datasets

For parasitic nematodes, the prediction of drug target candidates
from global genomic and transcriptomic datasets can be assisted by
using extensive information on the functionality and essentiality of
homologues in C. elegans, D. melanogaster, M. musculus and/or
S. cerevisiae (accessible via public databases www.wormbase.org,
456
http://flybase.org, www.informatics.jax.org, and www.yeastgenome.org)

[202206, 211]. Since most effective drugs achieve their activity
by competing with endogenous small molecules for a binding site
on a target protein [322], the amino acid sequences produced
from essential genes can be screened for the presence of conserved
ligand-binding domains [322, 323] and lists of prioritized inhibitors compiled [323]. The comparison of various studies shows
consistently that some proteases, G protein-coupled receptors
(GPCRs), guanosine triphosphatases (GTPases), kinases and phosphatases are salient among essential molecules and, thus, represent
potential targets for nematocides [202206].
Protein kinases (PTKs) have shown considerable promise as
drug targets in protozoa, such as Plasmodium and Giardia [324
326] and in helminths, including Schistosoma mansoni and
Echinococcus multilocularis [327]. In the latter two species, for
example, PTK inhibitors (i.e., tyrphostins AG1024 and AG538)
have been shown to affect the survival and development of the parasite through the inhibition of glucose uptake [327]. In another
study, the inactivation of S. mansoni PTKs with herbimycin A (an Src
kinase inhibitor) was shown to disrupt mitosis, thus reducing the
expression of proteins essential for egg production, including the
formation of the eggshell, in adult females [328]. Although crystal
structures of PTKs from parasitic nematodes have not yet been
determined, some advances have been made in the identification and
design of effective inhibitors based on homology models for protein
kinases from humans [327]. There is evidence that the active sites of
parasite PTKs display a variable degree of structural divergence compared with their human counterparts [326, 327], which seems
promising for designing selective kinase inhibitors for helminths.
Recent work has also shown potential for atypical protein
kinases (aPKs; 324) as targets for the development of novel intervention strategies. Among these aPKs, the RIO kinases (RIOKs:
RIOK-1, RIOK-2 and RIOK-3) are considered essential for life
[329]. RIOKs of parasitic strongylid nematodes have close homologues in C. elegans [329, 330]; however, almost nothing is known
about the function or biology of RIOKs in parasitic nematodes and
in most other metazoans. Although there are some conserved elements in each of the three RIOKs of different organisms, these
aPKs from nematodes cluster, with high statistical support, to the
exclusion of those of other eukaryotic organisms, including mammals [329], indicating prospects for the design of a new class of
nematode-specific inhibitors of these aPKs. Using in silico screening of the SPECS database (www.specs.net), Campbell et al. [329]
identified compounds that bind in silico to RIOK-1 of H. contortus
(Hc-RIOK-1). For some of these compounds, multiple, highly
scored binding modes were observed, indicating an increased likelihood that these aPKs would display productive interactions in an
457
in vitro assay [329]. In addition, the hydrogen-bond interactions

between the compounds identified and the Hc-RIOK-1 model
involved multiple conserved side chains in the active site (including
the P-loops, catalytic loops, and metal-binding loops); however, all
compounds identified were also involved in interactions with residues that are not conserved and specific to Hc-RIOK-1 [329] and
are thus considered important for the design of selective inhibitors
of Hc-RIOK-1. A screen of the BRENDA database (www.brendaenzymes.org; 322) for compounds with similar chemical structures
to known kinase effectors identified two molecules with significant
similarity to the protein kinase inhibitor emodol (an anthraquinone
found in several plants), providing a useful starting point for drug
development [329]. Also identified were molecules with some
structural similarity to known kinase effectors, such as the flavonoids apigenin and kaempferol (known to possess cancer-protective
effects; 331333) and prunitrin, a naturally occurring isoflavonoid
in species of Trifolium (clover) and Prunus, characterized by a
naphthoquinone scaffold and a carbohydrate moiety [329]. In the
future, an integrated approach, using advanced functional genomic,
bioinformatic, chemoinformatic and structural biological tools,
could be used to elucidate the functions and structures of RIOKs,
whose roles are proposed to be essential and involved intimately in
developmental processes.
From a functional perspective, current information on C. elegans shows that riok-1 encodes two isoforms (via alternative splicing) required for viability, fertility, endocytosis, and fat storage. C.
elegans riok-2 also encodes a RIOK required for viability and fertility, and riok-3 encodes a RIOK expressed in the larval and adult
intestine of C. elegans [329]. In addition, preliminary experiments
have predicted null mutations in riok-1 and riok-2, both of which
are lethal, and an uncharacterized predicted null allele of riok-3
(unpublished). From a structural biology perspective, preliminary
comparisons show that the RIOK domain harboring the catalytic
site is a conserved fold for nematode RIOKs. However, despite this
fold, there are several amino acid substitutions in functionally
important, conserved secondary structure elements, whose impact
can only be assessed from three-dimensional structures determined
experimentally [329]. Thus, structural studies need to assess the
particular binding modes of ligands, particularly the phosphatedonating nucleotides, to provide a solid basis for structure-based
drug design. Furthermore, the mechanistic aspects of RIOKs are
poorly understood, thus requiring detailed structural information.
The working model described by Campbell et al. [329] assumes
that the two flexible elements in the RIOK domain, the hinge and
the flexible loop, serve as docking points for the substrate and
might undergo conformational change in the substrate-bound
state. Such a process may be further aided by phosphorylation of
458
Ser165 (in relation to RIOK-1), which is located in the flexible

loop and seems to be a conserved residue for RIOKs. Crystal structures of substrate-bound and phosphorylated nematode RIOKs
should assist in elucidating the biology of these proteins, providing
clues as to how to best design selective and specific inhibitors.
Serine/threonine phosphatases (STPs) are also proposed to be
involved in essential biological pathways and, thus, might represent viable anthelmintic targets [99]. In silico structural comparisons between Hc-STP-1 and homologues from other parasitic
nematodes, including O. dentatum and T. vitrinus, have revealed
conservation of residues and features putatively involved in catalytic activity, whereas phylogenetic analyses of STP sequence data
from a range of eukaryotes confirmed the close relationship of
nematode STPs, which clustered to the exclusion of homologues
from other organisms [99]. In one study, Campbell et al. [311]
tested the activity of a series of norcantharidin-derived analogues
against H. contortus; cf. Subheading 5). Three of these analogues
reproducibly displayed 99100 % lethality against H. contortus in a
larval development assay [311] and no toxic effects on multiple,
independent mammalian (human cancer) cell lines. However,
given the difference in structure between these analogues and the
original norcantharidin chemotype, it was proposed that these
molecules might have targets other than STPs [311]. Further studies are needed to establish the precise mode of action of these
effective norcantharidin-derived compounds in nematodes, which
show considerable promise as anthelmintics.
Challenges and Prospects

Due to the lack of complete genomic sequences for most parasitic
nematodes, newly generated transcriptomic and genomic sequence
datasets need to be assembled de novo, which means that pooled
reads are assembled without a bias towards known sequences
[222]. Due to the amount of RNA required for high-throughput
sequencing (~510 g; 334, 335), transcriptomes from small nematodes usually originate from multiple individuals, potentially leading to an increased complexity of the sequence data acquired
(linked, for instance, to single-nucleotide polymorphisms and
other types of sequence variation) and posing some challenges for
the assembly. In terms of complexity, and computational and time
requirements, de novo assemblies are orders of magnitude slower
and much more computationally intensive than knowledge-based
(mapping) assemblies, in which reads are aligned and assembled
against an existing backbone sequence [336]. In addition, reliable de novo assemblies are heavily dependent on the availability of
long reads (>100 bases) and of high-coverage, paired-end sequence
459
data [336, 337]. In previous studies, the complementary nature of

the 454 and Illumina sequencing platforms has allowed the
assembly of raw reads into large scaffolds without need for a reference sequence [338340]. Thus, clearly, the 454 sequence data
assembled in previous studies [203206] should assist future de
novo assemblies of Illumina data (both transcriptomic and
genomic) for the species investigated to date.
Some transcriptomic studies have employed 454 sequencing of
normalized cDNA libraries [203206]. Normalization allows transcripts to be studied qualitatively, but this approach does not allow
differential gene expression to be investigated quantitatively [203
206]. Exploring differential transcription among stages, sexes and
tissues of parasitic nematodes and other helminths provides unique
insights into molecular changes occurring, for example, during
development and reproduction. Future studies involving the
sequencing of non-normalized cDNA libraries by, for instance,
Illumina technology [194] will provide an avenue to explore essential biological pathways in parasitic nematodes, such as those linked
to the development of neuronal tissue, the formation of cuticle,
and the digestion of host hemoglobin in H. contortus [204] and in
mitochondrial and amino acid metabolism in N. americanus [205].
However, the incorporation of gene expression data will inevitably
pose new computational challenges for the correct assembly and
analysis of sequence datasets and, for instance, for the accurate prediction of alternatively spliced transcripts.
The accurate assembly of ESTs is a crucial step for examining
coding genes and, ultimately, addressing biological questions
regarding gene and protein function [263]. Knowledge of the
function of genes and gene products from organisms is predicted
using a process known as sequence annotation, which has been
defined as the process of gathering available information and
relating it to the sequence assembly both by experimental and
computational means [341]. Currently, the annotation of
sequence data from parasitic nematodes is primarily based on comparisons with data available in public databases available via multiple portals [203206] and updated at different rates. The
Swiss-Prot database (http://au.expasy.org/sprot), for instance,
accepts corrections from its user community, whereas GenBank
(www.ncbi.nlm.nih.gov/genbank) only accepts corrections from
the author of an entry [342], thus significantly affecting the accuracy and speed with which new sequences are annotated. In addition, some information-management systems evolve to efficiently
incorporate data from large-scale projects, but often, the annotation of single records from the literature is slow and cumbersome
[343]. Given that, presently, the annotation of sequence data for
parasitic nematodes relies heavily on the use of bioinformatic
approaches and already annotated/curated sequence data for a
460
wide range of organisms [203206], these observations are

particularly crucial and deserve further consideration. For instance,
the analyses and annotation of large-scale transcriptomic sequence
datasets for parasitic nematodes could be considerably facilitated
through the establishment of a reference website, which could
provide regular releases of newly developed and validated bioinformatic pipelines for the analyses of sequence datasets as well as links
to regularly updated databases. In the future, the establishment of
a centralized consortium to facilitate the sharing and optimization of bioinformatic pipelines for sequence processing and annotation and, more broadly, to allow access to new sequence data, as
well as experimental protocols and relevant literature, would be
very useful to the scientific community.
Typically, the annotation of peptides inferred from the transcriptomes of parasitic nematodes is performed by assigning
predicted biological function(s) based on comparison with
existing information available for C. elegans and for other organisms in public databases (e.g., WormBase; InterPro, www.ebi.
ac.uk/interpro; Gene Ontology, www.geneontology.org;
OrthoMCL, www.orthomcl.org; BRENDA, www.brendaenzymes.org) [203206]. Using this approach, predictions for
key groups of molecules were made in relation to their function
and essential roles in biological processes [203206]. Such
groups included the SCP/TAPS proteins and molecules linked
to the physiology of the nervous system, the formation of the
cuticle, proteases and protease inhibitors, and protein kinases
and phosphatases [203206]. However, in order to support
data inferred from bioinformatic analyses of sequence data,
experimental validation is now required. In particular, extensive
laboratory experiments need to be conducted to evaluate the
functions of molecules in the parasites studied and/or in a suitable surrogate organism. RNAi has been applied to a number of
strongylid nematodes of animals, but success has been relatively
limited (e.g., 279, 344351). Current evidence suggests that a
number of nematodes of animals, including H. contortus, lack
critical components of the RNAi machinery [279, 349, 350,
352]. Transgenesis and gene complementation studies have
shown considerable promise for evaluating the function of genes
from some parasitic nematodes (e.g., 353355). Indeed, a study
demonstrating successful transgenesis in the parasitic nematode
Parastrongyloides trichosuri (Rhabditida) [356] as well as the
use of C. elegans as a surrogate system for the analysis of the
function of some genes from selected members of the Strongylida
and Rhabditida [353355] provides substantial promise and
scope for the application of this methodology to functional
genetic studies of selected groups of parasitic nematodes.
461
In the future, improved bioinformatic prediction and prioritization

of potential drug targets in parasitic nematodes will depend on the
availability of complete genome sequences. Global repertoires of
drug targets could be inferred. For instance, the parasite kinome
(the complete set of kinase genes in the genome) could represent a
unique opportunity for the design of parasite-selective inhibitors
[327]. In addition, the integration of genomic, transcriptomic, and
proteomic data will be crucial to identify groups of molecules essential to parasite survival and development, which could represent
drug target candidates. Clearly, high-throughput sequencing, such
as Illumina, provides the efficiency and depth of coverage required
to rapidly define genomes and transcriptomes of eukaryotic pathogens of socioeconomic importance [202, 211, 293]. The combined
use of innovative bioinformatic tools will open the door to understanding the molecular biology of parasites and other pathogens on
an unprecedented scale. A deep understanding of these pathogens
at the molecular level will provide exciting opportunities for the
development of novel interventions and diagnostic methods.
Update on Next-Generation Sequencing Technologies

In October 2013, Roche announced the closure of its subsidiary 454
Life Sciences and the discontinuation of the 454 sequencer (http://
www.bio-itworld.com/2013/10/16/six-years-after-acquisitionroche-quietly-shutters-454.html); this outcome has been attributed
largely to major competition by Illumina and Life Technologies, with
the release of their respective Personal Genome Machine (PGM),
MiSeq, and Ion Torrent sequencing platforms. While, to the best of
our knowledge, the latter platform is yet to be utilized for highthroughput sequencing studies of parasites of animals and humans,
the high sequencing speed, low cost of sample sequencing, and small
instrument size [357] will undoubtedly represent substantial advantages in the quest to fight neglected diseases.
Acknowledgments
Funding from the Australian Research Council, the National
Health and Medical Research Council, the Australian Academy of
Science, the Alexander von Humboldt Foundation, and Melbourne
Water Corporation is gratefully acknowledged (RBG). Our
research program was also supported by the Victorian Life Sciences
Computation Initiative (grant number VR0007) on its Peak
Computing Facility at the University of Melbourne, an initiative of
the Victorian Government (RBG).
462
References
1. de Silva NR, Brooker S, Hotez PJ et al (2003)
Soil-transmitted helminth infections: updating the global picture. Trends Parasitol
19:547551
2. Artis D (2006) New weapons in the war on
worms: identification of putative mechanisms
of immune-mediated expulsion of gastrointestinal nematodes. Int J Parasitol 36:723733
3. Bethony J, Brooker S, Albonico M et al
(2006) Soil-transmitted helminth infections:
ascariasis, trichuriasis, and hookworm. Lancet
367:15211532
4. Brooker S, Clements AC, Bundy DA (2006)
Global epidemiology, ecology and control of
soil-transmitted helminth infections. Adv
Parasitol 62:221261
5. Nikolaou S, Gasser RB (2006) Prospects for
exploring molecular developmental processes
in Haemonchus contortus. Int J Parasitol
36:859868
6. Hotez PJ, Fenwick A, Savioli L et al (2009)
Rescuing the bottom billion through control
of neglected tropical diseases. Lancet
373:15701575
7. OHarhay MO, Horton J, Olliaro PL (2010)
Epidemiology and control of human gastrointestinal parasites in children. Expert Rev Anti
Infect Ther 8:219234
8. Newton SE, Munn EA (1999) The development of vaccines against gastrointestinal nematode parasites, particularly Haemonchus
contortus. Parasitol Today 15:116122
9. Newton SE, Meeusen EN (2003) Progress
and new technologies for developing vaccines
against gastrointestinal nematode parasites of
sheep. Parasite Immunol 25:283296
10. Roeber F, Jex AR, Gasser RB (2013) Advances
in the diagnosis of key gastrointestinal nematode infections of livestock, with an emphasis
on small ruminants. Biotechnol Adv
31(8):11351152.
doi:10.1016/j.biotechadv.2013.01.008,
pii:
S0734-9750(13)00010-4
11. Wolstenholme AJ, Fairweather I, Prichard R
et al (2004) Drug resistance in veterinary helminths. Trends Parasitol 20:469476
12. Gilleard JS (2006) Understanding anthelmintic resistance: the need for genomics and
genetics. Int J Parasitol 36:12271239
13. Wolstenholme AJ, Kaplan RM (2012)
Resistance to macrocyclic lactones. Curr
Pharm Biotechnol 13:873887
14. Anderson RC (2000) Nematode parasites of
vertebrate. Their development and transmission, 2nd edn. CABI Publishing, Wallingford
15. Kennedy MW, Harnett W (2001) Parasitic

nematodes: molecular biology, biochemistry
and immunology. CABI Publishing, New York
16. Nagaraj SH, Gasser RB, Ranganathan S
(2007) A hitchhikers guide to expressed
sequence tag (EST) analysis. Brief Bioinform
8:621
17. Parkinson J, Blaxter M (2009) Expressed
sequence tags: an overview. Methods Mol
Biol 533:112
18. Ranganathan S, Menon R, Gasser RB (2009)
Advanced in silico analysis of expressed
sequence tag (EST) data for parasitic nematodes of major socio-economic importancefundamental insights toward biotechnological
outcomes. Biotechnol Adv 27:439448
19. Cantacessi C, Campbell BE, Gasser RB
(2012) Key strongylid nematodes of animals Impact of next-generation transcriptomics on systems biology and biotechnology.
20. Hugot JP, Baujard P, Morand S (2001)
Biodiversity in helminths and nematodes as a field
of study: an overview. Nematology 3:199208
21. Chitwood BG (1950) An outline classification of the Nematoda. In: Chitwood BG,
Chitwood MB (eds) Introduction to nematology. University Park Press, Baltimore, MD,
pp 1225
22. Lichtenfels JR (1980) Keys to the genera of
the Superfamily Strongyloidea. In: Anderson
RC, Chabaud AG, Willmott S (eds) CIH
Keys to the nematode parasites of vertebrate.
CAB International, Wallingford, pp 141
23. Durette-Desset MC, Chabaud AG (1977)
Essai de classification des nmatodes
Trichostrongyloidea. Ann Parasitol Hum
Comp 52:539558
24. Durette-Desset MC, Chabaud AG (1981)
Nouvel essai de classification de nematode
Trichostrongyloidea. Ann Parasitol Hum
Comp 56:297312
25. Durette-Desset MC (1983) Keys to the genera of the superfamily Trichostrongyloidea.
In: Anderson RC, Chabaud AG, Willmott S
(eds) CIH Keys to the nematode parasites of
vertebrate. CAB International, Wallingford,
pp 168
26. Skrjabin KI, Sobolev AA, Ivashkin VM (1967)
Principles of Nematology. Izdatelsto
Akademii Nauk SSSR. Israel Program for
Scientific Translations, Washington
27. Blaxter ML, De Ley P, Garey JR et al (1998)
A molecular evolutionary framework for the
phylum Nematoda. Nature 392:7175

28. OConnor LJ, Walkden-Brown SW, Kahn LP
(2006) Ecology of the free-living stages of
major trichostrongylid parasites of sheep. Vet
Parasitol 142:115
29. Anderson N, Dash KM, Donald AD et al
(1978) Epidemiology and control of nematode infections. In: Donald AD, Southcott
WH, Dineen JK (eds) The epidemiology and
control of gastrointestinal parasites of sheep
in Australia. CSIRO, Australia, pp 2351
30. Veglia F (1915) The anatomy and life-history
of the Haemonchus contortus (Rud.). Rep Dir
Vet Res 34:347500
31. Monnig HO (1926) The life histories of
Trichostrongylus instabilis and T. rugatus of
sheep in South Africa. 11-12th Annual Report
of the Director of Veterinary Education and
Research, Union of South Africa, pp. 231251
32. Olsen OW (1986) Animal parasites. Their life
cycles and ecology. The quarterly review of biology. University of Chicago Press, Chicago, IL
33. Sommerville RI (1957) The exsheathing
mechanism of nematode infective larva. Exp
Parasitol 6:1830
34. Rogers WP, Sommerville RI (1963) The
infective stage of nematode parasites and its
significance in parasitism. Adv Parasitol
1:109177
35. Rogers WP, Sommerville RI (1968) The
infectious process, and its relation to the
development of early parasitic stages of nematodes. Adv Parasitol 6:327348
36. Noble ER, Noble GA (1982) Parasitology:
the biology of animal parasites, 5th edn. Lea
& Febiger, Philadelphia, PA
37. Waller PJ (1997) Anthelmintic resistance. Vet
Parasitol 72:391412
38. Holmes PH (1985) Pathogenesis of trichostrongylosis. Vet Parasitol 18:89101
39. Barker IK (1973) Scanning electron microscopy of duodenal mucosa of lambs infected
with
Trichostrongylus
colubriformis.
40. Barker IK (1975) Intestinal pathology associated with Trichostrongylus colubriformis infection in sheep histology. Parasitology
70:165171
41. Beveridge I, Pullman AL, Phillips PH et al
(1989) Comparison on the effects of infection
with
Trichostrongylus
colubriformis,
Trichostrongylus vitrinus and Trichostrongylus
rugatus in Merino lambs. Vet Parasitol
32:229245
42. Garside P, Kennedy MW, Wakelin D et al
(2000) Immunopathology of intestinal helminth
infection.
Parasite
Immunol
22:605612
463
43. Xu LQ, Yu SH, Jiang ZX et al (1995)

Soil-transmitted helminthiases: nationwide survey
in China. Bull World Health Organ 73:507513
44. Schneider B, Jariwala AR, Periago MV et al
(2011) A history of hookworm vaccine development. Hum Vaccin 7:12341244
45. Hotez PJ, Bethony J, Bottazzi ME et al
(2006) New technologies for the control of
human hookworm infection. Trends Parasitol
22:327331
46. Schad GA, Warren KS (eds) (1990)
Hookworm disease: current status and new
directions. Taylor & Francis, London
47. Looss A (1898) Zur Lebensgeschichte des
Ancylostoma duodenale. Eine Erwiederung an
Herrn Prof Dr Leichtenstern. Zentralblatt fur
Bakteriologie 24:442449
48. Bruni A, Passalaqua A (1954) Sulla presenza
di una mesomucinasi (jaluronidasi) in
Ancylostoma duodenale. Boll Soc Ital Biol
Sper 30:789791
49. Lewert RM, Lee CL (1954) Studies on the
passage of helminth larvae through host tissues. I Histochemical studies on extracellular
changes caused by penetrating larvae II
Enzymatic activity of larvae in vitro and
in vivo. J Infect Dis 95:1351
50. Gilman RH (1982) Hookworm disease: hostpathogen biology. Rev Infect Dis 4:824829
51. Gasser RB, Cantacessi C, Loukas A (2008)
DNA technological progress toward advanced
diagnostic tools to support human hookworm
control. Biotechnol Adv 26:3545
52. Foster AO, Cross SX (1934) The direct development of hookworms after oral infection.
Am J Trop Med 14:565573
53. Schad GA, Chowdhury AB, Dean CG et al
(1973) Arrested development in human
hookworm infections: an adaptation to a seasonally unfavourable external environment.
Science 180:500501
54. Gibbs HC (1986) Hypobiosis in parasitic
nematodes an update. Adv Parasitol
25:129174
55. Arasu P, Kwak D (1999) Developmental
arrest and pregnancy-induced transmammary
transmission of Ancylostoma caninum larvae
in the murine model. J Parasitol 85:779784
56. Hotez PJ, Brooker S, Bethony J et al (2004)
Hookworm infection. N Engl J Med
351:799807
57. Loukas A, Bethony J, Brooker S et al (2006)
Hookworm vaccines: past, present, and
future. Lancet Infect Dis 6:733741
58. Gasbarre LC, Nansen P, Monrad J et al
(1993) Serum anti-trichostrongyle antibody
464
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.

responses to first and second season grazing
calves. Res Vet Sci 54:340344
Klei TR (1997) Immunological control of
gastrointestinal nematode infections. Vet
Parasitol 72:507523
Balic A, Bowles VM, Meeusen ELT (2000)
The immunobiology of gastrointestinal nematode infections in ruminants. Adv Parasitol
45:181241
Loukas A, Prociv P (2001) Immune responses
in hookworm infection. Clin Microbiol Rev
14:689703
Loukas A, Constant SL, Bethony JM (2005)
Immunobiology of hookworm infection.
FEMS Immunol Med Microbiol 43:115124
Gause WC, Urban JF Jr, Stadecker MJ (2003)
The immune response to parasitic helminths:
insights from murine models. Trends
Immunol 24:269277
Liu Z, Liu Q, Pesce J et al (2004)
Requirements for the development of IL-4producing T cells during intestinal nematode
infections: what it takes to make a Th2 cell
in vivo. Immunol Rev 201:5774
Maizels RM, Yazdanbakhsh M (2003)
Immune regulation by helminth parasites:
cellular and molecular mechanisms. Nat Rev
Immunol 3:733744
Maizels RM, Balic A, Gomez-Escobar N et al
(2004) Helminth parasitesmasters of regulation. Immunol Rev 201:89116
Anthony RM, Rutitzky LI, Urban JF Jr et al
(2007) Protective immune mechanisms in
helminth infection. Nat Rev Immunol
7:975987
Patel N, Kreider T, Urban JF Jr et al (2009)
Characterization of effector mechanisms at
the host: parasite interface during the immune
response to tissue-dwelling intestinal nematode parasites. Int J Parasitol 39:1321
Liu Q, Kreider T, Bowdridge S et al (2010) B
cells have distinct roles in host protection
against different nematode parasites. J
Immunol 184:52135223
Allen JE, Maizels RM (2011) Diversity and
dialogue in immunity to helminths. Nat Rev
Immunol 11:375388
White CJ, Maxwell CJ, Gallin JI (1986)
Changes in the structural and functional
properties of human eosinophils during
experimental hookworm infection. J Infect
Dis 154:778783
Maxwell C, Hussain R, Nutman TB et al
(1987) The clinical and immunological
responses of normal human volunteers to low
dose hookworm (Necator americanus) infection. Am J Trop Med Hyg 37:126134
73. Miller
JE,
Horohov
DW
(2006)
Immunological aspects of nematode parasite
control in sheep. J Anim Sci 84:E124E132
74. Larsen RH, Christensen CM, Lind P (1997)
Serological assays for the identification of
Oesophagostomum dentatum infections in
pigs. Res Vet Sci 63:510
75. Joachim A, Ruttkowski B, Daugschies A
(1998) Changes in antigen and glycoprotein
patterns during the development of
Oesophagostomum dentatum. Int J Parasitol
28:18531860
76. Joachim A, Ruttkowski B, Christensen CM
et al (1999) Identification, isolation and characterisation of a species-specific 30 kDaantigen of Oesophagostomum dentatum.
Parasitol Res 85:307311
77. Stockdale PH (1970) Necrotic enteritis of
pigs caused by infection with Oesophagostomum
spp. Br Vet J 126:526530
78. Haussler M (1996) Immunhistologische
Untersuchungen an der Dickdarmschleimhaut
bei der Oesophagostomum dentatum-infektion
des
Schweines
zu
unterschiedlichen
Zeitpunkten nach experimenteller infection.
Dr Med. Vet. Thesis, Tierartzliche
Hochschule, Hannover, Germany
79. McSorley HJ, Loukas A (2010) The immunology of human hookworm infections.
Parasite Immunol 32:549559
80. Pearson MS, Tribolet L, Cantacessi C et al
(2012) Molecular mechanisms of hookworm
disease stealth, virulence, and vaccines. J
Allergy Clin Immunol 130:1321
81. Holden-Dye
L,
Walker
RJ
(2007)
Anthelmintic drugs. WormBook, ed. The C.
elegans Research Community, doi:/10.1895/
wormbook.1.143.1,
http://www.wormbook.org
82. Robertson AP, Clark CL, Martin RJ (2010)
Levamisole and ryanodine receptors. I: A
contraction study in Ascaris suum. Mol
Biochem Parasitol 171:17
83. Keiser J, Utzinger J (2008) Efficacy of current
drugs against soil-transmitted helminth infections: systematic review and meta-analysis.
JAMA 299:19371948
84. Stepek G, Buttle DJ, Duce IR et al (2006)
Human gastrointestinal nematode infections:
are new control methods required? Int J Exp
Pathol 87:325341
85. Epe C, Kaminsky R (2013) New advancement in anthelmintic drugs in veterinary
medicine. Trends Parasitol 29:129134
86. Gilleard JS, Beech RN (2007) Population
genetics of anthelmintic resistance in parasitic
nematodes. Parasitology 134:11331147

87. Kwa MS, Veenstra JG, Roos MH (1993)
Molecular characterisation of beta-tubulin
genes present in benzimidazole-resistant populations of Haemonchus contortus. Mol
88. Geerts S, Coles GC, Gryssels B (1997)
Anthelmintic resistance in human helminths:
learning from problems with worm control in
livestock. Parasitol Today 13:149151
89. Roos MH (1997) The role of drugs in the
control of parasitic nematode infections: must
we do without? Parasitology 114:S137S144
90. Geerts S, Gryssels B (2001) Anthelmintic
resistance in human helminths: a review. Trop
Med Int Health 6:915921
91. Horton J (2003) Human gastrointestinal helminth infections: are they now neglected diseases? Trends Parasitol 19:527531
92. Albonico M, Smith PG, Hall A et al (1994) A
randomized controlled trial comparing
mebendazole and albendazole against Ascaris,
Trichuris and hookworm infections. Trans R
Soc Trop Med Hyg 88:585589
93. Albonico M, Bickle Q, Ramsan M et al (2003)
Efficacy of mebendazole and levamisole alone
or in combination against intestinal nematode
infections after repeated targeted mebendazole treatment in Zanzibar. Bull World Health
Org 81:343352
94. de Clercq D, Sacko M, Behnke J et al (1997)
Failure of mebendazole in treatment of
human hookworm infections in the southern
region of Mali. Am J Trop Med Hyg
57:2530
95. Reynoldson JA, Behnke JM, Gracey M et al
(1997) Failure of pyrantel in treatment of
human hookworm infections (Ancylostoma
duodenale) in the Kimberley region of North
West Australia. Acta Trop 68:301312
96. Sacko M, de Clercq D, Behnke JM et al
(1999) Comparison of the efficacy of mebendazole, albendazole and pyrantel in treatment
of human hookworm infections in the southern region of Mali, West Africa. Trans R Soc
Trop Med Hyg 93:195203
97. Kotze AC, Kopp SR (2008) The potential
impact of density dependent fecundity on the
use of the faecal egg count reduction test for
detecting drug resistance in human hookworms. PLoS Negl Trop Dis 2:e297
98. Besier B (2007) New anthelmintics for livestock: the time is right. Trends Parasitol
23:2124
99. Campbell BE, Hofmann A, McCluskey A et al
(2010) Serine/threonine phosphatases in
socioeconomically important parasitic nema-
100.
101.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
465
todesprospects as novel drug targets?

Albonico M (2003) Methods to sustain drug
efficacy in helminth control programmes.
Acta Trop 86:233242
Smits HL (2009) Prospects for the control of
neglected tropical diseases by mass drug
administration. Expert Rev Anti Infect Ther
7:3756
Morgan ER, Coles GC (2010) Nematode
control practices on sheep farms following an
information campaign aiming to delay anthelmintic resistance. Vet Rec 166:301303
Knox DP (2000) Development of vaccines
against
gastrointestinal
nematodes.
Parasitology 120:S43S61
Dalton JP, Mulcahy G (2001) Parasitevaccinesa reality? Vet Parasitol 98:149167
Claerebout E, Knox DP, Vercruysse J (2003)
Current research and future prospects in the
development of vaccines against gastrointestinal nematodes in cattle. Expert Rev Vaccines
2:147157
Bethony JM, Loukas A, Hotez PJ et al (2006)
Vaccines against blood-feeding nematodes of
humans
and
livestock.
Parasitology
133:S63S79
Diemert DJ, Bethony JM, Hotez PJ (2008)
Hookworm vaccines. Clin Infect Dis
46:282288
Hotez PJ, Bethony JM, Oliveira SC et al
(2008) Multivalent anthelmintic vaccine to
prevent hookworm and schistosomiasis.
Expert Rev Vaccines 7:745752
Jarrett WFH, Jennings FW, McIntyre WIM
et al (1959) Studies on immunity to
Haemonchus contortus infectionvaccination
of sheep using a single dose of X-irradiated
larvae. Am J Vet Res 20:527531
Jarrett WFH, Jennings FW, McIntyre WIM
et al (1961) Studies on immunity to
Haemonchus contortus infectiondouble vaccination of sheep with irradiated larvae. Am J
Vet Res 22:186188
Miller TA (1971) Vaccination against the canine
hookworm disease. Adv Parasitol 9:153183
Smith WD, Angus KW (1980) Haemonchus
contortus: attempts to immunize lambs with
irradiated larvae. Res Vet Sci 29:4550
Hotez PJ, Zhan B, Bethony JM et al (2003)
Progress in the development of a recombinant
vaccine for human hookworm disease: the
Human Hookworm Vaccine Initiative. Int J
Munn EA, Smith TS, Graham M et al (1993)
Vaccination of merino lambs against haemon-
466
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.

chosis with membrane-associated proteins
from the adult parasite. Parasitology
106:6366
Newton SE (1995) Progress on vaccination
against Haemonchus contortus. Int J Parasitol
25:12811289
Newton SE, Morrish LE, Martin PJ et al
(1995) Protection against multiply drugresistant and geographically distant strains of
Haemonchus contortus by vaccination with
H11, a gut membrane-derived protective
antigen. Int J Parasitol 25:511521
Smith WD, van Wyk JA, van Strijp MF (2001)
Preliminary observations on the potential of
gut membrane proteins of Haemonchus contortus as candidate vaccine antigens in sheep
on naturally infected pasture. Vet Parasitol
98:285297
Knox DP, Smith WD (2001) Vaccination
against gastrointestinal nematode parasites of
ruminants using gut-expressed antigens. Vet
Parasitol 100:2132
Smith TS, Munn EA, Graham M et al (1993)
Purification and evaluation of the integral
membrane protein H11 as a protective antigen against Haemonchus contortus. Int J
Parasitol 23:271277
Smith WD, Smith SK, Murray JM (1994)
Protection studies with integral membrane
fractions of Haemonchus contortus. Parasitol
Immunol 16:231241
Cachat E, Newlands GF, Ekoja SE et al
(2010) Attempts to immunize sheep against
Haemonchus contortus using a cocktail of
recombinant proteases derived from the protective antigen, H-gal-GP. Parasite Immunol
32:414419
Pearson MS, Ranjit N, Loukas A (2010)
Blunting the knife: development of vaccines
targeting digestive proteases of blood-feeding
helminth parasites. Biol Chem 391:901911
Skuce PJ, Redmond DL, Liddell S et al
(1999) Molecular cloning and characterization of gut-derived cysteine proteinases associated with a host protective extract from
Haemonchus
contortus.
Parasitology
119:405412
Williamson AL, Brindley PJ, Abbenante G
et al (2003) Hookworm aspartic protease,
Na-APR-2, cleaves human hemoglobin and
serum proteins in a host-specific fashion. J
Smith WD, Newlands GF, Smith SK et al
(2003) Metalloendopeptidases from the
intestinal brush border of Haemonchus contortus as protective antigens for sheep. Parasite
Immunol 25:313323
126. Loukas A, Bethony JM, Williamson AL et al

(2004) Vaccination of dogs with a recombinant cysteine protease from the intestine of
canine hookworms diminishes the fecundity
and growth of worms. J Infect Dis
189:19521961
127. Redmond DL, Knox DP (2004) Protection
studies in sheep using affinity-purified and
recombinant cysteine proteinases of adult
Haemonchus contortus. Vaccine 22:42524261
128. Pearson MS, Bethony JM, Pickering DA et al
(2009) An enzymatically inactivated hemoglobinase from Necator americanus induces
neutralizing antibodies against multiple hookworm species and protects dogs against heterologous hookworm infection. FASEB J
23:30073019
129. Knox DP, Smith SK, Redmond DL et al
(2005) Protection induced by vaccinating
sheep with a thiol-binding extract of
Haemonchus contortus membranes is associated with its protease components. Parasite
Immunol 27:121126
130. Knox DP, Smith SK, Smith WD (1999)
Immunization with an affinity purified protein extract from the adult parasite protects
lambs against infection with Haemonchus contortus. Parasite Immunol 21:201210
131. Loukas A, Bethony JM, Mendez S et al
(2005) Vaccination with recombinant aspartic
hemoglobinase reduced parasite load and
blood loss after hookworm infection. PLoS
Med 2:e295
132. Xiao S, Zhan B, Xue J et al (2008) The evaluation of recombinant hookworm antigens as
vaccine in hamsters (Mesocricetus auratus)
challenged with human hookworm, Necator
americanus. Exp Parasitol 118:3240
133. Pearson MS, Pickering DA, Tribolet L et al
(2010) Neutralizing antibodies to the hookworm hemoglobinase Na-APR-1: implications for a multivalent vaccine against
hookworm infection and schistosomiasis. J
Infect Dis 201:15611569
134. Hotez P, Haggerty J, Hawdon J et al (1990)
Metalloproteases of infective Ancylostoma
hookworm larvae and their possible functions
in tissue invasion and ecdysis. Infect Immun
58:38833892
135. Williamson AL, Lustigman S, Oksov Y et al
(2006) Ancylostoma caninum MTP-1, an
astacin-like metalloprotease secreted by infective hookworm larvae, is involved in tissue
migration. Infect Immun 74:961967
136. Hawdon JM, Hotez PJ (1996) Hookworm:
developmental biology of the infection process. Curr Opin Genet Dev 6:618623

137. Hawdon JM, Jones BF, Hoffman DR et al
(1996) Cloning and characterization of
Ancylostoma-secreted protein. A novel protein associated with the transition to parasitism by infective hookworm larvae. J Biol
Chem 22:66726678
138. Hawdon JM, Narasmihan S, Hotez PJ (1999)
Ancylostoma secreted protein 2: cloning and
characterization of a second member of a family of nematode secreted proteins from
Ancylostoma caninum. Mol Biochem Parasitol
30:149165
139. Cantacessi C, Campbell BE, Visser A et al
(2009) A portrait of the SCP/TAPS proteins of eukaryotes developing a framework
for fundamental research and biotechnological outcomes. Biotechnol Adv 27:376388
140. Brooker S, Bethony J, Hotez PJ (2004)
Human hookworm infection in the 21st century. Adv Parasitol 58:197288
141. Diemert DJ, Pinto AG, Freire J et al (2012)
Generalized urticaria induced by the
Na-ASP-2 hookworm vaccine: implications
for the development of vaccines against helminths.
J
Allergy
Clin
Immunol
130:169176
142. Zhan B, Santiago H, Keegan B et al (2012)
Fusion of Na-ASP-2 with human immunoglobulin Fc abrogates histamine release from
basophils
sensitized
with
anti-NaASP-2 IgE. Parasite Immunol 34:404411
143. Alwine JC, Kemp DJ, Stark GR (1977)
Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethylpaper and hybridization with DNA probes.
144. Higuchi R, Fockler C, Dollinger G et al
(1993) Kinetic PCR analysis: real-time monitoring of DNA amplification reactions.
Biotechnology 11:10261030
145. Liang P, Pardee AB (1992) Differential display of eukaryotic messenger RNA by means
of the polymerase chain reaction. Science
257:967971
146. Pratt D, Cox GN, Milhausen MJ et al (1990)
A developmentally regulated cysteine protease gene family in Haemonchus contortus. Mol
147. Savin KW, Dopheide TA, Frenkel MJ et al
(1990) Characterization, cloning and hostprotective activity of a 30-kilodalton glycoprotein secreted by the parasitic stages of
Trichostrongylus colubriformis. Mol Biochem
Parasitol 41:167176
148. Sangster NC, Bannan SC, Weiss AS et al
(1999) Haemonchus contortus: sequence heterogeneity of internucleotide binding
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
161.
467
domains from P-glycoproteins. Exp Parasitol

91:250257
Boag PR, Newton SE, Hansen NP et al
(2000) Isolation and characterization of sexspecific transcripts from Oesophagostomum
dentatum
by
RNA
arbitrarily-primed
PCR. Mol Biochem Parasitol 108:217224
Moore J, Tetley L, Devaney E (2000)
Identification of abundant mRNAs from the
third stage larvae of the parasitic nematode,
Ostertagia ostertagi. Biochem J 347:763770
Nikolaou S, Hartman D, Presidente PJ et al
(2002) HcSTK, a Caenorhabditis elegans
PAR-1 homologue from the parasitic nematode, Haemonchus contortus. Int J Parasitol
32:749758
Hartman D, Cottee PA, Savin KW et al
(2003) Haemonchus contortus: molecular
characterisation of a small heat shock protein.
Exp Parasitol 104:96103
Cottee PA, Nisbet AJ, Abs El-Osta YG (2006)
Construction of gender-enriched cDNA
archives for adult Oesophagostomum dentatum
by suppressive subtractive hybridization and a
microarray analysis of expressed sequence
tags. Parasitology 132:691708
Velculescu VE, Zhang L, Vogelstein B et al
(1995) Serial analysis of gene expression.
Science 270:484487
Velculescu VE, Zhang L, Zhou W et al (1997)
Characterization of the yeast transcriptome.
Cell 88:243251
Boon K, Osorio EC, Greenhut SF et al (2002)
An anatomy of normal and malignant gene
expression. Proc Natl Acad Sci U S A
99:1128711292
Liang P (2002) SAGE Genie: a suite with
panoramic view of gene expression. Proc Natl
Acad Sci U S A 99:1154711548
Datson NA, van der Perk-de Jong J, van der
Perk-de Jong MP et al (1999) MicroSAGE: a
modified procedure for serial analysis of gene
expression in limited amounts of tissue.
Skuce PJ, Yaga R, Lainson FA et al (2005) An
evaluation of serial analysis of gene expression
(SAGE) in the parasitic nematode, Haemonchus
contortus. Parasitology 130:553559
Adams MD, Kelley JM, Gocayne JD et al
(1991) Complementary DNA sequencing:
expressed sequence tags and human genome
project. Science 252:16511656
McCombie WR, Adams MD, Kelley JM et al
(1992) Caenorhabditis elegans expressed
sequence tags identify gene families and
potential gene homologues. Nat Genet
1:124131
468
162. Sanger F, Nicklen S, Coulson AR (1977)

DNA sequencing with chain-terminating
inhibitors. Proc Natl Acad Sci U S A
74:54635467
163. Sanger F, Air GM, Barrell BG et al (1977)
Nucleotide sequence of bacteriophage phi
X174 DNA. Nature 265:687695
164. Clifton SW, Mitreva M (2009) Strategies for
undertaking expressed sequence tag (EST)
projects. Methods Mol Biol 533:1332
165. Blaxter ML, Raghavan N, Ghosh I et al
(1996) Genes expressed in Brugia malayi
infective third stage larvae. Mol Biochem
Parasitol 77:7796
166. Daub J, Loukas A, Pritchard DI et al (2000)
A survey of genes expressed in adults of the
human hookworm, Necator americanus.
167. Hoekstra R, Visser A, Otsen M et al (2000)
EST sequencing of the parasitic nematodes
Haemonchus contortus suggests a shift in gene
expression during transition to the parasitic
stages. Mol Biochem Parasitol 110:5368
168. McCarter JP, Abad J, Jones JT et al (2000)
Rapid gene discovery in plant parasitic nematodes via gene discovery. Nematology
2:719731
169. Williams SA, Lizotte-Waniewski MR, Foster J
et al (2000) The filarial genome project:
analysis of the nuclear, mitochondrial and
endosymbiont genomes of Brugia malayi. Int
J Parasitol 30:411419
170. Parkinson J, Whitton C, Guiliano D et al
(2001) 200,000 nematode ESTs on the net.
Trends Parasitol 17:394396
171. Parkinson J, Mitreva M, Whitton C et al
(2004) A transcriptomic analysis of the phylum Nematoda. Nat Genet 36:12591267
172. Doyle MA, Gasser RB, Woodcroft BJ et al
(2010) Drug target prediction and prioritization: using orthology to predict essentiality in
parasite genomes. BMC Genomics 11:222
173. Hartman D, Donald DR, Nikolaou S et al
(2001) Analysis of developmentally regulated
genes of the parasite Haemonchus contortus.
174. Campbell BE, Nagaraj SH, Hu M et al (2008)
Gender-enriched transcripts in Haemonchus
contortuspredicted functions and genetic
interactions based on comparative analyses
with Caenorhabditis elegans. Int J Parasitol
38:6583
175. Ranjit N, Jones MK, Stenzel DJ et al (2006)
A survey of the intestinal transcriptomes of
the hookworms, Necator americanus and
Ancylostoma caninum, using tissues isolated
176.
177.
178.
179.
180.
181.
182.
183.
184.
185.
186.
by laser-dissection microscopy. Int J Parasitol

36:701710
Yin Y, Martin J, Abubucker S et al (2008)
Intestinal transcriptomes of nematodes: comparison of the parasites Ascaris suum and
Haemonchus contortus with the free-living
Caenorhabditis elegans. PLoS Negl Trop Dis
2:e269
Rabelo EM, Hall RS, Loukas A et al (2009)
Improved insights into the transcriptome of
the human hookworm Necator americanusfundamental and biotechnological implications. Biotechnol Adv 27:122132
DeRisi J, Penland L, Brown PO et al (1996)
Use of a cDNA microarray to analyse gene
expression patterns in human cancer. Nat
Genet 14:457460
Grant WN, Viney ME (2001) Post-genomic
nematode parasitology. Int J Parasitol
31:879888
Gasser RB, Cottee P, Nisbet AJ et al (2007)
Oesophagostomum dentatum: potential as a
model for genomic studies of strongylid nematodes, with biotechnological prospects.
Nisbet AJ, Gasser RB (2004) Profiling of
gender-specific
gene
expression
for
Trichostrongylus
vitrinus
(Nematoda:
Strongylida) by microarray analysis of
expressed sequence tag libraries constructed
by suppressive-subtractive hybridization. Int J
Parasitol 34:633643
Moser JM, Freitas T, Arasu P et al (2005)
Gene expression profiles associated with the
transition to parasitism in Ancylostoma caninum larvae. Mol Biochem Parasitol
143:3948
Datu BJ, Gasser RB, Nagaraj SH et al (2008)
Transcriptional changes in the hookworm,
Ancylostoma caninum, during the transition
from a free-living to a parasitic larva. PLoS
Negl Trop Dis 2:e130
Nisbet AJ, Redmond DL, Matthews JB et al
(2008) Stage-specific gene expression in
Teladorsagia
circumcincta
(Nematoda:
Strongylida) infective larvae and early parasitic stages. Int J Parasitol 38:829838
Cantacessi C, Loukas A, Campbell BE et al
(2009) Exploring transcriptional conservation between Ancylostoma caninum and
Haemonchus contortus by oligonucleotide
microarray and bioinformatic analyses. Mol
Cell Probes 23:19
Yang GP, Kuang WW, Weigel RJ (1999)
Combining SSH and cDNA microarrays for
rapid identification of differentially expressed
genes. Nucleic Acids Res 27:15171523

187. Liu MY, Wang XL, Fu BQ et al (2007)
Identification of stage-specifically expressed
genes of Trichinella spiralis by suppression
subtractive
hybridization.
Parasitology
134:14431455
188. Huang CQ, Gasser RB, Cantacessi C et al
(2008) Genomic-bioinformatic analysis of
transcripts enriched in the third-stage larva of
the parasitic nematode Ascaris suum. PLoS
189. Geldhof P, Whitton C, Gregory WF et al
(2005) Characterisation of the two most
abundant genes in the Haemonchus contortus
expressed sequence tag dataset. Int J Parasitol
35:513522
190. Mitreva M, McCarter JP, Arasu P et al (2005)
Investigating hookworm genomes by comparative analysis of two Ancylostoma species.
BMC Genomics 26:58
191. Abubucker S, Martin J, Yin Y et al (2008)
The canine hookworm genome: analysis and
classification of Ancylostoma caninum survey
sequences.
Mol
Biochem
Parasitol
157:187192
192. Wang Z, Abubucker S, Martin J et al (2010)
Characterizing Ancylostoma caninum transcriptome and exploring nematode parasitic
adaptation. BMC Genomics 11:307
193. Margulies M, Egholm M, Altman WE et al
(2005) Genome sequencing in microfabricated high-density picolitre reactors. Nature
437:376380
194. Bentley DR, Balasubramanian S, Swerdlow
HP et al (2008) Accurate whole human
genome sequencing using reversible terminator chemistry. Nature 456:5359
195. Harris TD, Buzby PR, Babcock H et al
(2008) Single-molecule DNA sequencing of a
viral genome. Science 320:106109
196. Pandey V, Nutter RC, Prediger E (2008)
Applied Biosystems SOLiD System:
Ligation-Based Sequencing. In: Milton JM
(ed) Next generation genome sequencing:
towards personalized medicine. Wiley,
Australia, pp 2941
197. Mardis ER (2008) The impact of nextgeneration sequencing technology on genetics. Trends Genet 24:133141
198. Wang Z, Gerstein M, Snyder M (2009) RNAseq: a revolutionary tool for transcriptomics.
Nat Rev Genet 10:5763
199. Marguerat S, Bahler J (2010) RNA-seq: from
technology to biology. Cell Mol Life Sci
67:569579
200. Mardis ER (2008) Next-generation DNA
sequencing methods. Ann Rev Genom
Human Genet 9:387402
469
201. Jex AR, Hu M, Littlewood DT et al (2008)

Using 454 technology for long-PCR based
sequencing of the complete mitochondrial
genome from single Haemonchus contortus
(Nematoda). BMC Genomics 9:11
202. Jex AR, Li B, Young ND et al (2011) Ascaris
suum draft genome. Nature 479:529533
203. Cantacessi C, Mitreva M, Campbell BE et al
(2010) First transcriptomic analysis of the
economically important parasitic nematode,
Trichostrongylus colubriformis, using a nextgeneration sequencing approach. Infect
204. Cantacessi C, Campbell BE, Young ND et al
(2010) Differences in transcription between
free-living and CO2-activated third-stage larvae of Haemonchus contortus. BMC Genomics
11:266
205. Cantacessi C, Mitreva M, Jex AR et al (2010)
Massively parallel sequencing and analysis of
the Necator americanus transcriptome. PLoS
206. Cantacessi C, Jex AR, Hall RS et al (2010) A
practical, bioinformatic workflow system for
large data sets generated by next-generation
sequencing. Nucleic Acids Res 38:e171
207. Cantacessi C, Gasser RB, Strube C et al
(2011) Deep insights into Dictyocaulus
viviparus transcriptomes provides unique
prospects for new drug targets and disease
intervention. Biotechnol Adv 29:261271
208. Young ND, Campbell BE, Hall RS et al
(2010) Unlocking the transcriptomes of two
carcinogenic parasites, Clonorchis sinensis and
Opisthorchis viverrini. PLoS Negl Trop Dis
4:e719
209. Young ND, Hall RS, Jex AR et al (2010)
Elucidating the transcriptome of Fasciola
hepaticaa key to fundamental and biotechnological discoveries for a neglected parasite.
210. Young ND, Jex AR, Cantacessi C et al (2011)
A portrait of the transcriptome of the
neglected trematode, Fasciola gigantica
biological and biotechnological implications.
PLoS Negl Trop Dis 5:e1004
211. Young ND, Jex AR, Li B et al (2012) Wholegenome sequence of Schistosoma haematobium. Nat Genet 44:221225
212. Huang X, Madan A (1999) CAP3: a DNA
sequence assembly program. Genome Res
9:868877
213. Iseli C, Jongeneel CV, Bucher P (1999)
ESTScan: a program for detecting, evaluating, and reconstructing potential coding
regions in EST sequences. Proc Int Conf
Intell Syst Mol Biol 1:138148
470
214. Conesa A, Gotz S, Garcia-Gomez JM et al (2005)

Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics
research. Bioinformatics 21:36743676
215. Nagaraj SH, Deshpande N, Gasser RB et al
(2007) ESTExplorer: an expressed sequence
tag (EST) assembly and annotation platform.
Nucleic Acids Res 35:W135W147
216. Hunter S, Apweiler R, Attwood TK et al
(2009) InterPro: the integrative protein signature database. Nucleic Acids Res
37:D211D215
217. Soderlund C, Johnson E, Bomhoff M et al
(2009) PAVE: program for assembling and
viewing ESTs. BMC Genomics 10:400
218. Nagasaki H, Michizuki T, Kodama Y et al
(2013) DDJB Read Annotation Pipeline: a
cloud computing-based pipeline for highthroughput analysis of next-generation
sequencing data. DNA Res 20(4):383390
219. Falgueras J, Lara AJ, Fernandez-Poso N et al
(2010) SeqTrim: a high throughput pipeline
for pre-processing any type of sequence read.
BMC Bioinformatics 11:38
220. Myers EW (1995) Toward simplifying and
accurately formulating fragment assembly. J
Comput Biol 2:275290
221. Idury RM, Waterman MS (1995) A new algorithm for DNA sequence assembly. J Comput
Biol 2:291306
222. Zerbino DR, Birney E (2008) Velvet: algorithms for de novo short read assembly using
de Bruijn graphs. Genome Res 18:821829
223. Scheibye-Alsing K, Hoffmann S, Frankel A
et al (2009) Sequence assembly. Comput Biol
Chem 33:121136
224. Miller JR, Koren S, Sutton G (2010) Assembly
algorithms for next-generation sequencing
data. Genomics 95:315327
225. Green P (1996) Documentation for
PHRAP. Genome Center, University of
Washington, Seattle, http://www.phrap.
org/phredphrap/phrap.html, USA
226. Sutton GG, White O, Adams MD et al (1995)
TIGR assembler: a new tool for assembling
large shotgun sequencing projects. Genome
Sci Technol 1:919
227. Huang X, Wang J, Aluru S et al (2003) PCAP:
a whole genome assembly program. Genome
Res 13:21642170
228. Chevreux B (2005) MIRA: an automated
genome and EST assembler. Ph.D Thesis,
German Cancer Research Center Heidelberg,
Duisburg, Germany
229. Warren RL, Sutton GC, Jones SJM et al
(2007) Assembling millions of short DNA
sequences using SSAKE. Bioinformatics
23:500501
230. Schulz MH, Zerbino DR, Vingron M et al
(2012) Oases: robust de novo RNA-seq
231.
232.
233.
234.
235.
236.
237.
238.
239.
240.
241.
242.
243.
244.
245.
246.
assembly across the dynamic range of expression levels. Bioinformatics 28:10861092

Hernandez D, Franois P, Farinelli L et al
(2008) De novo bacterial genome sequencing:
millions of very short reads assembled on a
desktop computer. Genome Res 18:802809
Pevzner PA, Tang H, Waterman MS (2001)
An Eulerian path approach to DNA fragment
assembly. Proc Natl Acad Sci U S A
98:97489753
Simpson JT, Wong K, Jackman SD et al (2009)
ABySS: a parallel assembler for short read
sequence data. Genome Res 19:11171123
Li R, Li Y, Kristiansen K et al (2008) SOAP:
short oligonucleotide alignment program.
Grabherr MG, Haas BJ, Yassour M et al
(2011) Full-length transcriptome assembly
from RNA-Seq data without a reference
genome. Nat Biotechnol 29:644652
Min XJ, Butler G, Storms R et al (2005)
OrfPredictor: predicting protein-coding
regions in EST-derived sequences. Nucleic
Acids Res 33:W677W680
Fukunishi Y, Hayashizaki Y (2001) Amino
acid translation program for full-length cDNA
sequences with frameshift errors. Physiol
Genomics 5:8187
Klassen JL, Currie CR (2013) ORFcor: identifying and accommodating ORF prediction
inconsistencies for phylogenetic analysis.
PLoS One 8:e58387
Hofmann K, Bucher P, Falquet L et al (1999)
The Prosite Database, its status in 1999.
Attwood TK, Croning MD, Flower DR et al
(2000) Prints-S: the database formerly known
as prints. Nucleic Acids Res 28:225227
Bateman A, Birney E, Durbin R et al (2000)
The Pfam protein families database. Nucleic
Acids Res 28:263266
Corpet F, Gouzy J, Kahn D (1999) Recent
improvements of the ProDom database of
protein domain families. Nucleic Acids Res
27:263267
Schultz J, Copley RR, Doerks T et al (2000)
Smart: a web-based tool for the study of
genetically mobile domains. Nucleic Acids
Res 28:231234
Ashburner M, Ball CA, Blake JA et al (2000)
Gene ontology: tool for the unification of
biology. The gene ontology consortium. Nat
Genet 25:2529
Krogh A, Larsson B, von Heijne G et al
(2001) Predicting transmembrane protein
topology with a hidden Markov model: application to complete genomes. J Mol Biol
305:567580
Nielsen H, Engelbrecht J, Brunak S et al
(1997) A neural network method for the
247.
248.
249.
250.
251.
252.
253.
254.
255.
256.
257.
258.
259.
260.
261.
262.
263.
identification of prokaryotic and eukaryotic

signal peptides and prediction of their cleavage sites. Int J Neural Syst 8:581599
Altschul SF, Gish W, Miller W et al (1990)
Basic local alignment search tool. J Mol Biol
215:403410
Benson DA, Karsch-Mizrachi I, Lipman DJ et al
(2002) GenBank. Nucleic Acids Res 30:1720
Stoesser G, Baker W, van den Broek A et al
(2002) The EMBL nucleotide sequence database. Nucleic Acids Res 30:2126
Tateno Y, Imanishi S, Miyazaki S et al (2002)
DNA Data Bank of Japan (DDBJ) for genome
scale research in life sciences. Nucleic Acids
Res 30:2730
Wheeler DL, Church DM, Lash AE et al
(2001) Database resources of the national
center for biotechnology information. Nucleic
Acids Res 29:1116
Shumway M, Cochrane G, Sugawara H
(2010) Archiving next generation sequencing
data. Nucleic Acids Res 38:D870D871
Berman HM, Westbrook J, Feng Z et al
(2000) The protein data bank. Nucleic Acids
Res 28:235242
Bairoch A, Apweiler R (2000) The SWISSPROT protein sequence database and its supplement TrEMBL in 2000. Nucleic Acids Res
28:4548
Bairoch A, Apweiler R (1996) The SWISSPROT protein sequence data bank and its
new supplement TREMBL. Nucleic Acids
Res 24:2125
Cherry JM, Ball C, Weng S et al (1997)
Genetic and physical maps of Saccharomyces
cerevisiae. Nature 387:6773
Tweedie S, Ashburner M, Falls K et al (2009)
FlyBase:
enhancing
Drosophila
Gene
Ontology annotations. Nucleic Acids Res
37:D555D559
Bult CJ, Epping JT, Kadin JA et al (2008)
The Mouse Genome Database (MGD):
mouse biology and model systems. Nucleic
Acids Res 36:D724D728
Harris TW, Antoshechkin I, Bieri T et al
(2010) WormBase: a comprehensive resource
for nematode research. Nucleic Acids Res
38:D463D467
Bieri T, Blasiar D, Ozersky P et al (2006)
WormBase: new content and better access.
Nucleic Acids Res 35:D506D510
Schwarz EM, Antoshechkin I, Bastiani C et al
(2006) WormBase: better software, richer
content. Nucleic Acids Res 34:D475D478
Yook K, Harris TW, Bieri T et al (2012)
WormBase 2012: more genomes, more data,
new website. Nucleic Acids Res 40:D735D741
Mangiola S, Young ND, Korhonen P et al
(2013) Getting the most out of parasitic hel-
264.
265.
266.
267.
268.
269.
270.
271.
272.
273.
274.
275.
276.
277.
278.
279.
471
minth transcriptomes using HelmDB: implications for biology and biotechnology.

Biotechnol
Adv
31(8):11091119.
doi:10.1016/j.biotechadv.2012.12.004, pii:
S0734-9750(12)00197-8
Brenner S (1974) The genetics of
Caenorhabditis elegans. Genetics 77:7194
The C. elegans Sequencing Consortium
(1998) Genome sequence of the nematode C.
elegans: a platform for investigating biology.
Science 282:20122018
Fire A, Xu S, Montgomery MK et al (1998)
Potent and specific genetic interference by
double-stranded RNA in Caenorhabditis elegans. Nature 391:806811
Barstead R (2001) Genome-wide RNAi. Curr
Opin Chem Biol 5:6366
Kamath RS, Ahringer J (2003) Genome-wide
RNAi screening in Caenorhabditis elegans.
Methods 30:313321
Simmer F, Moorman C, van der Linden AM
et al (2003) Genome-wide RNAi of C. elegans
using the hypersensitive rrf-3 strain reveals
novel gene functions. PLoS Biol 1:E12
Sugimoto A (2004) High-throughput RNAi
in Caenorhabditis elegans: genome-wide
screens
and
functional
genomics.
Differentiation 72:8191
Sonnichsen B, Koski LB, Walsh A et al (2005)
Full-genome RNAi profiling of early embryogenesis in Caenorhabditis elegans. Nature
434:462469
Tabara H, Grishok A, Mello CC (1998) RNAi
in C. elegans: soaking in the genome sequence.
Science 282:430431
Timmons L, Fire A (1998) Specific interference by ingested dsRNA. Nature 395:854
Tabara H, Sarkissian M, Kelly WG et al (1999)
The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99:123132
Tavernarakis N, Wang SL, Dorovkov M et al
(2000) Heritable and inducible genetic interference by double-stranded RNA encoded by
transgenes. Nat Genet 24:180183
Maeda I, Kohara Y, Yamamoto M et al (2001)
Large-scale analysis of gene function in
Caenorhabditis elegans by high-throughput
RNAi. Curr Biol 11:171176
Ashrafi K, Chang FY, Watts JL et al (2003)
Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421:268272
Britton C, Murray L (2006) Using
Caenorhabditis elegans for functional analysis
of genes of parasitic nematodes. Int J Parasitol
36:651659
Geldhof P, Visser A, Clark D et al (2007)
RNA interference in parasitic helminths: current situation, potential pitfalls and future
prospects. Parasitology 134:609619
472
280. Morris KV (2008) RNA-mediated transcriptional gene silencing in human cells. Curr Top
Microbiol Immunol 320:211224
281. Rosso MN, Jones JT, Abad P (2009) RNAi
and functional genomics in plant parasitic
nematodes.
Annu
Rev
Phytopathol
47:207232
282. Serkirk ME, Huang SC, Knox DP et al (2012)
The development of RNA interference
(RNAi) in gastrointestinal nematodes.
283. Stinchcomb DT, Shaw JE, Carr SH et al
(1985) Extrachromosomal DNA transformation of Caenorhabditis elegans. Mol Cell Biol
5:34843496
284. Fire A (1986) Integrative transformation of
Caenorhabditis
elegans.
EMBO
J
5:26732680
285. Chalfie M, Tu Y, Euskirchen G et al (1994)
Green fluorescent protein as a marker for
gene expression. Science 263:802805
286. Lok JB, Artis D (2008) Transgenesis and neuronal ablation in parasitic nematodes: revolutionary new tools to dissect host-parasite
interactions. Parasite Immunol 30:203214
287. Hobert O, Loria P (2006) Uses of GFP in
Caenorhabditis elegans. Methods Biochem
Anal 47:203226
288. Reinke V, Smith HE, Nance J et al (2000) A
global profile of germline gene expression in
C. elegans. Mol Cell 6:605616
289. Kim SK, Lund J, Kiraly M et al (2001) A gene
expression map for Caenorhabditis elegans.
Science 293:20872092
290. Jiang M, Ryu J, Kiraly M et al (2001)
Genome-wide analysis of developmental and
sex-regulated gene expression profiles in
Caenorhabditis elegans. Proc Natl Acad Sci U
S A 98:218223
291. Chilton NB (2004) The use of nuclear ribosomal DNA markers for the identification of
bursate nematodes (order Strongylida) and
for the diagnosis of infections. Anim Health
Res Rev 5:173187
292. Brglin TR, Lobos E, Blaxter ML (1998)
Caenorhabditis elegans as a model for parasitic
nematodes. Int J Parasitol 28:395411
293. Mitreva M, Jasmer JP, Zarlenga DS et al
(2011) The draft genome of the parasitic
nematode Trichinella spiralis. Nat Genet
43:228243
294. Williamson AL, Lecchi P, Turk BE et al
(2004) A multi-enzyme cascade of hemoglobin proteolysis in the intestine of bloodfeeding
hookworms.
J
Biol
Chem
279:3595035957
295. Ranjit N, Zhan B, Hamilton B et al (2009)

Proteolytic degradation of hemoglobin in the
intestine of the human hookworm Necator
americanus. J Infect Dis 199:904912
296. Furmidge BA, Horn LA, Pritchard DI (1996)
The anti-haemostatic strategies of the human
hookworm Necator americanus. Parasitology
112:8187
297. Milstone AM, Harrison LM, Bungiro RD
et al (2000) A broad spectrum kunitz type
serine protease inhibitor secreted by the
hookworm Ancylostoma ceylanicum. J Biol
Chem 275:2939129399
298. Grad LI, Sayles LC, Lemire BD (2007)
Isolation and functional analysis of mitochondria from the nematode Caenorhabditis elegans. Methods Mol Biol 372:5166
299. Fetterer RH (1996) Growth and cuticular
synthesis in Ascaris suum larvae during development from third to fourth stage in vitro.
Vet Parasitol 65:275282
300. Quinn CC, Pfeil DS, Wadsworth WG (2008)
CED-10/Rac1 mediates axon guidance by
regulating the asymmetric distribution of
MIG-10/lamellipodin.
Curr
Biol
18:808813
301. Ranjit N, Zhan B, Stenzel DJ et al (2008) A
family of cathepsin B cysteine proteases
expressed in the gut of the human hookworm,
Necator americanus. Mol Biochem Parasitol
160:9099
302. Robinson BW, Venaille TJ, Mendis AH et al
(1990) Allergens as proteases: an Aspergillus
fumigatus proteinase directly induces human
epithelial cell detachment. J Allergy Clin
Immunol 86:726731
303. Bjrnberg F, Lantz M, Gullberg U (1995)
Metalloproteases and serineproteases are
involved in the cleavage of the two tumour
necrosis factor (TNF) receptors to soluble
forms in the myeloid cell lines U-937 and
THP-1. Scand J Immunol 42:418424
304. Hotez PJ, Prichard DI (1995) Hookworm
infection. Sci Am 6:4248
305. Shaw RJ, McNeill MM, Maass DR et al
(2003) Identification and characterisation of
an aspartyl protease inhibitor homologue as a
major allergen of Trichostrongylus colubriformis. Int J Parasitol 33:12331243
306. Williamson AL, Brindley PJ, Knox DP et al
(2003) Digestive proteases of blood-feeding
nematodes. Trends Parasitol 19:417423
307. Cottee PA, Nisbet AJ, Boag PR et al (2004)
Characterization of major sperm protein
genes and their expression in Oesophagostomum
dentatum
(Nematoda;
Strongylida).

308. Miller MA, Nguyen VQ, Lee MH et al (2001)
A sperm cytoskeletal protein that signals
oocyte meiotic maturation and ovulation.
Science 291:21442147, Erratum in: Science
292, 639
309. Miller MA, Ruest PJ, Kosinski M et al (2003)
An Eph receptor sperm-sensing control
mechanism for oocyte meiotic maturation in
Caenorhabditis
elegans.
Genes
Dev
17:187200
310. Freigofas R, Leibold W, Daugschies A et al
(2001) Products of fourth-stage larvae of
Oesophagostomum dentatum induce proliferation in nave porcine mononuclear cells. J Vet
Med B Infect Dis Vet Public Health
48:603611
311. Campbell BE, Tarleton M, Gordon CP et al
(2011) Norcantharidin analogues with nematocidal activity in Haemonchus contortus.
Bioorg Med Chem Lett 21:32773281
312. McCluskey A, Keane MA, Walkom CC et al
(2002) The first two cantharidin analogues
displaying PP1 selectivity. Bioorg Med Chem
Lett 12:391393
313. Hill TA, Stewart SG, Sauer B et al (2007)
Heterocyclic substituted cantharidin and norcantharidin analoguessynthesis, protein
phosphatase (1 and 2A) inhibition, and anticancer activity. Bioorg Med Chem Lett
17:33923397
314. Stewart SG, Hill TA, Gilbert J et al (2007)
Synthesis and biological evaluation of norcantharidin analogues: towards PP1 selectivity.
Bioorg Med Chem 15:73017310
315. Olson SK, Bishop JR, Yates JR et al (2006)
Identification of novel chondroitin proteoglycans in Caenorhabditis elegans: embryonic cell
division depends on CPG-1 and CPG-2. J
Cell Biol 173:985994
316. Zhan B, Liu Y, Badamchian M et al (2003)
Molecular characterisation of the Ancylostomasecreted protein family from the adult stage of
Ancylostoma caninum. Int J Parasitol
33:897907
317. Mulvenna J, Hamilton B, Nagaraj S et al
(2009) Proteomic analysis of the excretory/
secretory component of the blood-feeding
stage of the hookworm, Ancylostoma caninum. Mol Cell Proteomics 8:109121
318. Bethony J, Loukas A, Smout M et al (2005)
Antibodies against a secreted protein from
hookworm larvae reduce the intensity of
hookworm infection in humans and vaccinated laboratory animals. FASEB J
19:17431745
319. Bethony JM, Simon G, Diemert DJ et al
(2008) Randomized, placebo-controlled,
320.
321.
322.
323.
324.
325.
326.
327.
328.
329.
330.
331.
332.
473
double-blind trial of the Na-ASP-2 hookworm vaccine in unexposed adults. Vaccine

26:24082417
Mendez S, Samuel A D, Antoine AD et al
(2008) Use of the air pouch model to investigate immune responses to a hookworm vaccine containing the Na-ASP-2 protein in rats.
Parasite Immunol 30:5356
Osman A, Wang CK, Winter A et al (2012)
Hookworm SCP/TAPS protein structure - a
key to understanding host-parasite interactions and developing new interventions.
Hopkins AL, Groom CR (2002) The druggable genome. Nature 1:727730
Chang A, Scheer M, Grote A et al (2009)
BRENDA, AMENDA and FRENDA the
enzyme information system: new content and
tools in 2009. Nucleic Acids Res
37:D588D592
Manning G, Whyte DB, Martinez R et al
(2002) The protein kinase complement of the
human genome. Science 298:19121934
Manning G, Reiner DS, Lauwaet T et al
(2011) The minimal kinome of Giardia lamblia illuminates early kinase evolution and
unique parasite biology. Genome Biol 12:R66
Lucet IS, Tobin A, Drewry D et al (2012)
Plasmodium kinases as targets for newgeneration antimalarials. Future Med Chem
4:22952310
Liotta F, Siekierka JJ (2010) Apicomplexa,
trypanosoma and parasitic nematode protein
kinases as antiparasitic therapeutic targets.
Curr Opin Invest Drugs 11:147156
Knobloch J, Kunz W, Grevelding CG (2006)
Herbimycin A suppresses mitotic activity and
egg production of female Schistosoma mansoni. Int J Parasitol 36:12611272
Campbell BE, Boag PR, Hofmann A et al
(2011) Atypical (RIO) protein kinases from
Haemonchus contortus Promise as new targets for nematocidal drugs. Biotechnol Adv
29:338350
Hu M, Laronde-Leblanc N, Sternberg PW
et al (2008) Tv-RIO1 an atypical protein
kinase from the parasitic nematode
Trichostrongylus vitrinus. Parasit Vectors 1:34
Ferreira CV, Gusto GZ, Sousa AC et al (2006)
Natural compounds as source of protein
phosphatase inhibitors: application to the
rational design of small-molecule derivatives.
Biochemie 88:18591873
Cho YY, Yao K, Kim HG et al (2007)
Ribosomal S6 kinase 2 is a key regulator in
tumor promoter induced cell transformation.
Cancer Res 67:81048112
474
333. Nthlings U, Murphy SP, Wilkens LR et al

(2007) Flavonoids and pancreatic cancer risk.
Am J Epidemiol 166:924931
334. Meyer M, Briggs AW, Maricic T et al (2007)
From micrograms to picograms: quantitative
PCR reduces the material demands in high
throughput sequencing. Nucleic Acids Res
1:16
335. Jarvie T, Harkins T (2008) Transcriptome
sequencing with the Genome Sequencer FLX
system. Nat Methods 5:68
336. Flicek B, Birney E (2009) Sense from
sequence reads, methods for alignment and
assembly. Nat Methods 6:S6S12
337. Pepke S, Wold B, Mortazavi A (2009)
Computational approaches to the analysis of
ChIP-seq and RNA-seq data. Nat Methods
6:S22S32
338. Reinhardt JA, Baltrus DA, Nishimura MT
et al (2009) De novo assembly using lowcoverage short read sequence data from the
rice pathogen Pseudomonas syringae pv. oryzae. Genome Res 19:294305
339. Nagarajan H, Butler JE, Klimes A et al (2010)
De novo assembly of the complete genome of
an enhanced electricity-producing variant of
Geobacter sulfurreducens using only short
reads. PLoS One 5:e10922
340. Tsai IJ, Otto TD, Berriman M (2010)
Improving draft assemblies by iterative mapping and assembly of short reads to eliminate
gaps. Genome Biol 11:R41
341. Gregory SG, Barlow KF, McLay KE et al
(2006) The DNA sequence and biological
annotation of human chromosome 1. Nature
441:315321
342. Karp PD (1998) What we do not know about
sequence analysis and sequence databases.
343. Benitez-Paez A (2009) Considerations to
improve functional annotations in biological
databases. OMICS 13:527535
344. Boag PR, Ren P, Newton SE et al (2003)
Molecular characterisation of a male-specific
serine/threonine
phosphatase
from
Oesophagostomum dentatum (Nematoda:
Strongylida), and functional analysis of homologues in Caenorhabditis elegans. Int
345. Issa Z, Grant WN, Stasiuk S et al (2005)
Development of methods for RNA interference in the sheep gastrointestinal parasite,
346.
347.
348.
349.
350.
351.
352.
353.
354.
355.
356.
357.
Trichostrongylus colubriformis. Int J Parasitol

35:935940
Geldhof P, Murray L, Couthier A et al (2006)
Testing the efficacy of RNA interference in
Haemonchus contortus. Int J Parasitol 36:801810
Kotze AC, Bagnall NH (2006) RNA interference in Haemonchus contortus: suppression of
beta-tubulin gene expression in L3, L4 and
adult worms in vitro. Mol Biochem Parasitol
145:101110
Visser A, Geldhof P, DeMaere V et al (2006)
Efficacy and specificity of RNA interference in
larval life-stages of Ostertagia ostertagi.
Zawadzki JL, Presidente PJ, Meeusen EN
et al (2006) RNAi in Haemonchus contortus: a
potential method for target validation. Trends
Parasitol 22:495499
Knox DP, Geldhof P, Visser A et al (2007)
RNA interference in parasitic nematodes of
animals: a reality check? Trends Parasitol
23:107117
Samarasinghe B, Knox DP, Britton C (2011)
Factors affecting susceptibility to RNA interference in Haemonchus contortus and in vivo
silencing of an H11 aminopeptidase gene. Int
J Parasitol 41:5159
Viney ME, Thompson FJ (2008) Two
hypotheses to explain why RNA interference
does not work in animal parasitic nematodes.
Lok JB (2009) Transgenesis in parasitic nematodes: building a better array. Trends
Parasitol 25:345347
Hu M, Lok JB, Ranjit N et al (2010)
Structural and functional characterisation of
the fork head transcription factor-encoding
gene, Hc-daf-16, from the parasitic nematode
Haemonchus contortus (Strongylida). Int
Stepek G, McCormack G, Page AP (2010)
Collagen processing and cuticle formation is
catalysed by the astacin metalloprotease DPY31 in free-living and parasitic nematodes. Int
Grant WN, Skinner SJ, Newton-Howes J et al
(2006)
Heritable
transgenesis
of
Parastrongyloides trichosuri: a nematode parasite of mammals. Int J Parasitol 36:475483
Liu L, Li Y, Li S et al (2012) Comparison of
next-generation
sequencing
systems.
J Biomed Biotechnol 2012:251364
Chapter 32
Functional Genomics of Tick Vectors Challenged
with the Cattle Parasite Babesia bigemina
Ana Domingos, Sandra Antunes, Margarita Villar, and Jos de la Fuente
Abstract
Ticks are obligate hematophagous ectoparasites considered as vectors of animal diseases, having a huge
economic impact in cattle industry. Babesia spp. are tick-borne pathogens that cause a disease called babesiosis in a wide range of animals and in humans. Control of tick infestations is mainly based on the use of
acaricides, which have limited efficacy reducing tick infestations, mostly due to wrong usage, and is often
accompanied by the selection of acaricide-resistant ticks, environmental contamination, and contamination
of milk and meat products. Vaccines affecting both vector and pathogens constitute new control strategies
for tick and tick-borne diseases and are, therefore, a good alternative to chemical control.
In this chapter we describe the identification of Rhipicephalus (Boophilus) annulatus genes differentially expressed in response to infection with B. bigemina by using suppression-subtractive hybridization
(SSH), which allows the identification of differentially expressed genes. The results of the SSH studies are
validated by real-time reverse transcription (RT)-PCR. Functional analyses are conducted by RNAi on
selected R. annulatus genes to determine their putative role in B. bigeminatick interactions. Gathered
data may be useful for the future development of improved vaccines and vaccination strategies to control
babesiosis.
Key words Tick, Genomics, Babesia, Rhipicephalus, Boophilus, Subtractive hybridization, RNA
interference, Vaccines
Introduction
Tick-borne pathogens of the genus Babesia are Apicomplexan parasites responsible for a disease called babesiosis that affects a wide
range of animals and, occasionally, humans. The major economic
impact of babesiosis is on cattle industry, caused mainly by Babesia
bovis and B. bigemina. Rhipicephalus (Boophilus) spp. ticks are their
principal vectors, being considered one of the most important cattle ectoparasites due to the direct impact affecting leather quality,
meat and milk production and, most importantly, pathogen transmission capacity [1].
In the last decades, new tools have been developed in the
molecular biology field, leading to a better knowledge of genes
475
476
Ana Domingos et al.
involved in the control of biological functions in numerous

organisms, such as vector ticks and pathogens transmitted to man
and animals. Genomics continues to contribute greatly to this
cause by (a) bringing new information about genomes and development of new technologies, (b) allying these new resources to
traditional techniques, and (c) enabling the development of new
practical interventions in the triangle vectorhostpathogen. Few
complete genomes are known for either vector or pathogen but
information regarding partial and complete nucleotide sequences
from both organisms is being progressively more available.
Moreover, sialomes and transcriptomes of different ticks are now
accessible. New findings on the genomic field do not replace older
strategies developed to study tick and tick-borne pathogens but
rather complement them, improving research outputs. As examples, there are techniques such as artificial feeding or cellular lines
that remain extremely useful to determine biological effects in cells
and organisms.
Within new control strategies for tick and tick-borne diseases,
vaccines arise as important alternatives to chemical control since
they may affect both vector and pathogen. Molecular interactions
at the tickpathogen interface ensure survival and development of
both the pathogen and tick vector. Recent studies demonstrated
that tick vaccines reduce tickpathogen infection when using antigens found to be related with pathogen infection/multiplication,
illustrating the complexity of tickpathogen coevolution [2].
Other experiments have demonstrated that tick gene expression is
modified in response to pathogen infection [312], but information on the function of differentially expressed genes is limited
[711, 1315] mainly because the identification of potential vaccine candidates is not simple, being a crucial step.
In the present example, it is our aim to demonstrate how gene
functional analysis can support the identification of genes that are
involved in the vectorpathogen interaction using as model the
vector R. annulatus and the pathogen B. bigemina.
To infer about the pressure of infection in the vector, first,
two different tick populations had to be produced: a B. bigeminainfected population and an uninfected one. Factors like gender,
time point in the life cycle, and similar feeding conditions have to
be considered and controlled. The only feature that should be
different in these samples is the presence of infection that eventually will induce a differential expression of the genes reflecting the
effect of the pathogen in the tick organism. Secondly, the differences between these populations have to be identified and measured. The subtractive suppression hybridization (SSH) method
allows the detection of transcripts differently expressed in two
related mRNA populations with no prior knowledge of these
mRNA. This technique relies on the hybridization of equal
Tick Functional Genomics Towards Vaccine Development
477
mRNA present on two different populations, followed by the

enrichment of different mRNA (present in only one of the populations) by traditional PCR. When using SSH, the differentially
expressed genes need to be quantitatively validated in order to
point which are the most relevant transcripts in the picture.
Microarrays can appear as a valid option, but due to the costs
linked to this technique, the gain must be well weighted. For
example, if the objective of the study is to analyze gene expression profiles in different situations, a microarray chip can be a
solution, but if the target is the punctual identification of relevant
genes, then the real-time PCR technique is a more suitable and
simpler way to quantify mRNA.
Another conceptually similar technique to SSH is the direct
sequencing of mRNA also known as RNA-Seq. This high-throughput technique offers a complete image of what is happening in the
transcriptome in a determined time point, so when comparing an
mRNA population corresponding to infected and healthy populations, the transcriptome differences will arise. An extremely important task in the identification of transcripts is the sequence analysis
steps. Various tools are accessible online in which a comparison to
available datasets is done. The cDNA Annotation System software
(dCAS) [16] is a good option for performing an automated
sequence clean-up, assembly, and BLAST analysis against the nonredundant (nr) sequence database. Manual curation is imperative
after the automated analysis to complete this step. From this step
on, it is possible to identify differentially expressed genes that can
be further characterized.
The third, and last step, on finding new antigens involved in
infection processes, within the example of B. bigemina-infected
R. annulatus ticks, concerns to the functional analysis. These assays
allow demonstrating the active role of antigens in a specific process.
RNAi or posttranscriptional gene silencing is a conserved and natural process that cells use to turn down, or silence, specific genes
[17, 18]. Small interfering RNAs (siRNAs) are the effector molecules of the RNAi pathway that is initiated by double-stranded
RNA (dsRNA) and results in a potent sequence-specific degradation of cytoplasmic mRNAs containing the same sequence as the
dsRNA trigger [8, 19]. RNAi revealed to be a valuable tool for
studying tick gene function, the characterization of the tickpathogen
interface and the screening and characterization of tick-protective
antigens [20]. RNAi process in ticks has not yet been revealed but
a model has been proposed based in the information available for
Drosophila melanogaster and Anopheles gambiae [21]. This technique has been used to study the function of tick
proteins at the tickpathogen interface in a number of tick species
[12, 2225]. In ticks, depending on the experimental design and
478
Ana Domingos et al.
targets, four different techniques of dsRNA delivery are known:

(a) injection, the most common method; (b) soaking of isolated
tissues; (c) the RNAi-inducing capillary feeding; and (d) virus production of dsRNA. Herein, the selected method was the injection
of dsRNA directly in the hemolymph in adult female ticks since it
was vital that ticks would feed normally after gene silencing. The
evaluation of gene knockdown in biological parameters like weight
and reproduction success, or even, as in the present case, the infection level, elucidates on the effect gene disruption.
2
2.1
Materials
Organisms
1. Rhipicephalus annulatus ticks.

2. Babesia bigemina (Moledet strain, provided by Kimron
Veterinary Institute, Israel).
3. HolsteinFriesian calves.
2.2 General
Laboratory
Consumables,
Materials,
and Equipment
1. Sterile 1 ml syringes and needles with different gauges.

2. Sterile 1.5 ml and 2 ml microcentrifuge tubes.
3. 96 wells plates for PCR.
4. Micropipettes and filter tips.
5. Agar plates (LB Agar, 20 g/L, with appropriate antibiotics and
supplements).
6. 1 TAE (Tris-acetate buffer): 40 mM TrisHCl, 20 mM acetic
acid, and 1 mM EDTA.
7. PBS (phosphate buffered saline): 0.027 M potassium chloride,
0.137 M sodium chloride, and 1.76 mM potassium
phosphate.
8. 0.5 TBE (Tris-borate-EDTA buffer): 45 mM Tris, 45 mM
boric acid, 1 mM EDTA, pH 8.3.
9. Agarose.
10. Nuclease-free water.
11. Refrigerated centrifuge.
12. Thermocycler (e.g., GeneAmp PCR System 2700, Applied
Biosystems Life Technologies, Foster City, CA, USA).
13. Real-time thermal detection system (e.g., IQ5 thermo-cycler,
BioRad, Hercules, CA, USA).
14. NanoDrop ND-1000 (Thermo Fischer Scientific, Waltham,
MA, USA).
15. Stereo microscope.
16. Humidity chamber.
2.3 Suppression
Subtractive
Hybridization (SSH)
Library Construction
479
DNA and RNA Extraction

1. RNAlater solution (Ambion Life Technologies, Carlsbad,
CA, USA).
2. TRI Reagent (Sigma-Aldrich, St. Louis, MO, USA).
Additional reagents needed: chloroform, isopropanol, absolute
ethanol, 75 % ethanol, 1 mM sodium citrate in 10 % ethanol,
and 8 mM NaOH.
Detection of Babesia bigemina Infection in Ticks
1. R. annulatus DNA.
2. PCR Master Mix (Promega, Fitchburg, WI, USA).
3. Specific primers for B. bigemina (e.g., 5-AGC TTG CTT TCA
CAA CTC GCC-3 and 5-TTG GTG CTT TGA CCG ACG
ACA T-3).
SSH Library Construction
1. Infected and uninfected tick total RNA.
2. FastTrack 2.0 mRNA Isolation Kit (Invitrogen Life
Technologies, Carlsbad, CA, USA).
3. PCR-Select cDNA Subtraction Kit (Clontech Laboratories
Inc., Mountain View, CA, USA).
4. Advantage 2 PCR polymerase mix with TITANIUM Taq DNA
Polymerase (Clontech-Takara, Mountain View, CA, USA).
cDNA Library Cloning
1. TOPO TA Cloning Kit for sequencing (Invitrogen Life
2. One Shot TOP10 competent cells (Invitrogen Life
3. PCR Master Mix (Promega, Fitchburg, WI, USA).
4. Universal T3 and T7 primers.
5. Illustra plasmidPrep Mini
Buckinghamshire, UK).
2.4 Sequence
Analysis and
Database Search
Spin
Kit
(GE
Healthcare,
1. Sequences from SSH clones.

2. cDNA Annotation System software (dCAS; Bioinformatics
and Scientific IT Program (BSIP), Office of Technology
Information Systems (OTIS), National Institute of Allergy and
Infectious Diseases (NIAID), Bethesda, MD, USA) (http://
exon.niaid.nih.gov).
3. AlignX (included in the Vector NTI Suite V 5.5 software,
Invitrogen Life technologies, North Bethesda, MD, USA).
4. CLUSTAL 2.1 /W multiple sequence alignment tool (http://
www.clustal.org/).
480
Ana Domingos et al.
2.5 Validation
of SSH Results
1. Infected and uninfected R. annulatus RNA.

2. iScript cDNA Synthesis Kit (BioRad, Hercules, CA, USA).
3. iQ SYBR Green Supermix (BioRad, Hercules, CA, USA).
4. Specific and housekeeping primers.
2.6 Functional Tick

Gene Analysis by RNA
Interference
dsRNA Synthesis
1. R. annulatus RNA.
2. Specific primers for target genes with T7 extension.
3. Access RT-PCR system (Promega, Madison, USA).
4. PCR products purification kit (e.g., PureLink PCR
Purification Kit, Life Technologies, Carlsbad, CA, USA).
5. MEGAscript T7 Kit (Ambion Life Technologies, Carlsbad,
CA, USA).
Injection in Ticks
1. Specific dsRNA.
2. Hamilton syringe, with 1 in., 33 G needle.
3. Forceps/tweezers.
4. Double face duck tape.
5. Dental wax plates.
6. Control buffer: 10 mM TrisHCl, pH 7, 1 mM EDTA.
Tick Feeding
1. Infected B. bigemina calf.
2. Freshly molted female R. annulatus.
3. Contact glue.
4. Cotton sleeves.
5. Razor blade.
Gene Knockdown Assessment and Infection Assessment
1. R. annulatus ticks treated with dsRNA.
2. iScript One-Step RT-PCR Kit with SYBR Green (Biorad,
Hercules, CA, USA).
3. Gene-specific and housekeeping primers.
3
3.1
Methods
Ticks Processing
3.1.1 Uninfected
and Babesia bigeminaInfected Ticks for SSH
Library Construction
Obtain B. bigemina-infected and uninfected R. annulatus

female ticks from experimentally infected and babesiosis-free
3 to 4-month-old male HolsteinFriesian calves, respectively
(see Note 1).
481
1. Prior to tick infestation, test calves for antibodies against

Babesia spp. infection, maintained under strict tick-free conditions, using an indirect fluorescent antibody (IFA) assay [26].
2. Inoculate one calf intravenously with 2 108 B. bigemina cryopreserved parasites (Moledet strain).
3. Monitor calf clinical responses by means of daily examinations
of body temperature, packed cell volume (PCV) and of Giemsastained blood films.
4. Collect engorged adult female ticks from both infected and
uninfected calves after feeding and maintain ticks at controlled
conditions (temperature 2225 C and relative humidity > 85 %) for blood meal digestion during 45 days.
3.1.2 Uninfected
R. annulatus for RNA
Interference Studies
1. Use a 34-month-old male Holstein calf free of babesiosis to

obtain uninfected R. annulatus freshly molted adult female
ticks.
2. Infest the calf with 1 g of tick eggs at day zero (0). Retrieve the
freshly molted females from the bovine host at day 21 using
fine forceps. Thereafter, observe, clean, and place ticks in a
controlled humidity and temperature chamber until dsRNA
injection.
3. Glue tick-feeding sleeves (450 mm 400 mm) (cotton fabric)
to calf shaved skin one day prior to infestation with dsRNAinjected ticks.
3.2 SSH Library

Construction
and Sequencing
3.2.1 Tick Total RNA
and DNA Extraction
3.2.2 Detection
of Babesia bigemina
in Ticks by PCR
1. Dissect each tick and place tissues in a tube containing 1 ml of

TRI Reagent. Homogenize using a 21 G 1 (0.8 40 mm)
needle and 1 ml syringe tube. Isolate total RNA and DNA
according to the manufacturers protocol (see Notes 2 and 3).
2. Dissolve the RNA and DNA in 30 l of nuclease-free water
and measure the concentration of each sample spectrophotometrically with a NanoDrop ND-1000 (see Note 3).
1. Perform a PCR using the following reaction mixture: final volume of 25 L including 1 PCR Master Mix, 1 M of forward
and reverse primers specific for B. bigemina, and 50 ng of tick
DNA; and the thermal cycling conditions: initial denaturation
step at 95 C for 10 min followed by 40 cycles of 30 s at 94 C,
45 s at 64 C, and 1 min at 72 C, with a final extension step
of 10 min at 72 C (see Note 4).
2. Analyze the amplification products in a 1 % TAE agarose gel
electrophoresis.
3.2.3 Complementary
DNA (cDNA) Library
Construction and SSH
1. Check the RNA integrity before proceeding with cDNA synthesis (see Note 5).
2. Create two pools corresponding to the infected and uninfected
tick populations. Seven to ten ticks are enough to obtain sufficient RNA for each pool.
482
Ana Domingos et al.
3. Isolate poly A + RNA using the FastTrack 2.0 mRNA Isolation

Kit, according to the manufacturers instructions. After this isolation, check the integrity of poly A + RNA by electrophoresis.
4. Construct the SSH library using the PCR-Select cDNA
Subtraction Kit. The procedure is thoroughly explained in the
manufacturer instructions. Briefly:
(a) After the two strands of cDNA are synthesized, digest the
molecules into small blunt-ended fragments with the
restriction enzyme RsaI.
(b) Submit the tester sample and part of the control sample to
adaptors ligation.
(c) Perform the first hybridization by mixing the tester
samples with different adaptors and each of these with
driver cDNA. Denature with heat and allow annealing/
hybridization.
(d) Second hybridization: mix the two samples obtained from
the first hybridization and add fresh denatured cDNA
driver. The new formed hybrid molecules consist now of
differentially expressed cDNA with different adaptors on
each end.
(e) Amplify selectively the differentially expressed cDNAs during two PCR reactions using the Advantage 2 PCR polymerase mix with TITANIUM Taq DNA polymerase.
(f) Prior to thermal cycling, fill the missing strands of the
adaptors by a brief incubation which creates binding sites
for the primers used in the PCR. In this first amplification,
only double-stranded cDNA with different adaptors
sequences on each end is exponentially amplified.
(g) In the second amplification, nested PCR was used to reduce
the background (unwanted PCR products) and improving
enrichment of the differentially expressed sequences in the
tester sample or infected population (see Note 6).
3.2.4 cDNA Library
Cloning
1. Clone the enriched cDNAs for sequencing with the TOPO TA

Cloning Kit, and transform One Shot TOP10 competent
Escherichia coli cells, following the manufacturers instructions
(see Note 7).
2. Prepare agar plates with the appropriate antibiotic (100 g/ml
of ampicillin) and supplement it with 0.5 mM of Isopropyl
-D-1-thiogalactopyranoside (IPTG). Spread 75 l and 150 l
of cell culture in each plate.
3. Incubate plates overnight at 37 C.
4. Perform colony PCR to randomly selected colonies for insertion confirmation analysis.
483
5. Colonies should be picked from the agar plate with a sterile

pipette tip and resuspended in 20 l of PCR reaction mix,
which should include the universal T3/T7 primers at a final
concentration of 1 M.
6. PCR conditions should be: 10 min at 95 C followed by 30
cycles of 30 s at 94 C, 45 s at 64 C, and 1 min at 72 C and
a final extension step of 10 min at 72 C.
7. Analyze the PCR products on a 1.2 % TAE agarose gel.
8. Prepare the cDNA library for sequencing by inoculating 1 ml
of LB medium with plated SSH clones and incubate overnight
at 37 C and 200 rpm to ensure high growth of transformed
bacteria.
3.2.5 Plasmid
Purification for Sequencing
1. Purify plasmids from the bacterial culture using Illustra plasmidPrep Mini Spin Kit, following the manufacturers
instructions.
2. Randomly select and sequence clones obtained from the
SSH library using traditional Sanger sequencing approaches
(see Note 8).
3.3 Sequence
Analysis and
Database Search
1. Use the available means for automated sequence clean-up, assembly, and BLAST analysis against nonredundant sequence database
(nr) and databases of tick-specific sequences (see Note 9).
3.3.1 Sequencing
and Analysis of SSH Clones
2. Analyze protein/gene ontology using a protein reference database (see Note 9).
3. Align nucleotide and protein sequences using widely available
software like CLUSTAL 2.1 multiple sequence alignment tool.
3.3.2 Confirmation
of Differential Gene
Expression by
Real-Time RT-PCR
1. Design appropriate primers manually or using available programs for the selected differentially expressed candidate genes.
2. Use total RNA from uninfected and B. bigemina-infected
R. annulatus female ticks to construct cDNA using the
iScript cDNA Synthesis Kit following the manufacturers
instructions.
3. Use the previously synthesized cDNA to perform quantitative
real-time PCR. iQ SYBR Green Supermix can be used for the
real-time PCR following the manufacturers recommendations, including forward and reverse primers at a final concentration of 500 mM and cDNA at a final concentration of
2025 ng (500 ng).
4. PCR conditions include an initial denaturation and enzyme
activation step at 95 C for 2 min, followed by 40 cycles of 15
s at 95 C, 15 s at the primers annealing temperature, and 15 s
at 62 C for extension.
484
Ana Domingos et al.
5. The mRNA levels should be normalized against the tick -actin

and 16S rRNA transcripts using the ddCT method [27, 28].
In all cases, the mean of the duplicate values should be used.
6. Compare the data from infected and uninfected ticks using the
Students t-test (P = 0.05).
3.4 Functional Tick
Gene Analysis by RNA
Interference
3.4.1 dsRNA Synthesis
1. Based in the SSH clone sequences, design specific primers containing T7 promoter sequences (5-TAA TAC GAC TCA CTA
TAG GGT ACT-3) at the 5-end. Long fragments are desired.
2. Use RNA as template to amplify the fragments of interest by
RT-PCR, using the Access RT-PCR system according to
instructions given by the manufacturer, including 1 M of
each primer and 200 ng of template RNA. Conditions of the
RT-PCR should be: first-strand synthesis performed at 45 C
for 45 min and AMV reverse transcriptase inactivation performed at 94 C for 3 min, followed by PCR cycling for 40
cycles of 30 s at 94 C, 30 s at 55 C, and 90 s at 68 C with a
final extension step of 7 min at 68 C.
3. Analyze amplification products on a 0.5 TBE, 1.2 % agarose gel.
4. Purify the PCR products using an appropriated kit like the
PureLink PCR Purification Kit.
5. Use the MEGAscript T7 Kit to synthesize dsRNA according
to the manufacturers instructions.
6. Purify and quantify by spectrometry the resulting dsRNA and
check it on a 1.2 % TBE agarose gel.
3.4.2 dsRNA
Injection in Ticks
1. Obtain freshly molted R. annulatus adult female ticks from the

bovine host, using fine forceps.
2. Observe, clean, and place the ticks ventral side up on double
sticky tape affixed to a 3 6 sheet of red dental wax. Position
them together in groups of 10 leaving the body exposed.
3. Inject the ticks with 0.4 l of dsRNA (1 1011 to 1 1012 mol/l)
in the lower right quadrant of the ventral surface of the tick
exoskeleton [29] (see Note 10).
4. Inject at least 30 female ticks per group using a Hamilton
syringe with a 1 in., 33 G needle.
5. Inoculate control ticks solely with control buffer (see Note 11).
3.4.3 Treatment of Ticks

After Injection and Tick
Feeding
1. Keep injected ticks in a recovery plastic container to wait for

tick activation and then place them in a humidity chamber
(12 h light/12 h dark photoperiod at 2225 C and 95 % relative humidity) for 24 h.
2. Allow the ticks to feed in separated circular patches, for test
groups and controls, on a calf experimentally infected with
2 108 B. bigemina parasites.
485
3. Glue patches with inner diameter of 150 mm used for tick

feeding to the shaved back of the calf using contact glue.
4. Monitor cattle infection to ensure that feeding occurs at the
peak of host parasitemia and perform visual examination of
blood smears. Remember to place male ticks together with
each group to allow mating.
5. Remove unattached ticks 2 days after infestation and all
attached ticks after 7 days of feeding.
6. Keep the ticks in a humidity chamber for 4 days to allow digestion of the blood meal.
3.4.4 Analysis of Ticks
After RNA Interference
1. Evaluate the number of ticks that survived as well as tick

weighs. Tick mortality is evaluated as the ratio of dead ticks to
the total number of fed ticks on the calf. To analyze tick mortality, the Chi-square test (P = 0.05) can be used with the null
hypothesis that tick mortality was not dependent on gene
knockdown.
2. After allowing blood digestion, ticks should be dissected and
whole internal organs stored in RNAlater solution for further
DNA and RNA extraction.
3. Extract DNA and RNA using the TRI Reagent as described
above.
3.4.5 Gene Knockdown

Assessment by Real-Time
RT-PCR and Infection
Quantification
1. Use the previously extracted RNA to perform real-time

RT-PCR.
2. Evaluate gene knockdown of the selected genes by real-time
RT-PCR using sequence-specific primers. The iScript OneStep RT-PCR Kit with SYBR Green can be used to perform
mRNA quantification. Manufacturer recommendations should
be followed including primers at a final concentration of
500 mM and RNA at a final concentration of at least 25 ng/l.
3. Incubate the reaction mix in a real-time thermal cycling detection system as follows: 10 min at 50 C for cDNA synthesis;
5 min at 95 C for reverse transcriptase inactivation; 40 cycles
of 15 s at 95 C followed by 15 s at primers annealing temperature and 15 s at 62 C for extension.
4. The mRNA levels should be normalized against tick 16S rRNA
transcripts using ddCT method.
5. Compare normalized mRNA levels between dsRNA-injected and
control ticks using the Students t-test (P = 0.05) (see Note 12).
6. Determine the B. bigemina infection levels by quantitative PCR.
The 18S rDNA gene can be used as a genomic target using the
specific primers 5-AAT AAC AAT ACA GGG CTT TCG TCT3 and 5-AAC GCG AGG CTG AAA TAC AAC T-3.
486
Ana Domingos et al.
7. Normalize against the tick 16S rDNA gene using the ddCT
method [27, 28].
8. Compare the B. bigemina infection levels in ticks between
dsRNA and control ticks using t-student test (P = 0.05).
Notes
General note: A project having as target the identification of new
vaccine candidates has to be carefully designed and has to surpass
different milestones. Experiments have to be properly designed
and the obtained biological samples must be in good conditions.
1. Ticks must be reared in a certified laboratory according to animal welfare guidelines. Individual features as tick life cycle
must be considered, for instance, if its a one, two, or three
hosttick species. When dealing with cattle ticks like R. microplus and R. annulatus, some constrains can arise due to their
host specificity [30]. Plus, cattle are most of the times a requirement for the conduction of laboratorial experiments. Other
species are less selective and smaller vertebrates like rabbits can
be used to establish tick colonies. The tick infection can be
obtained in different ways such as artificial feeding or even
injection of pathogen, but the best way of copying natural
infections is to infect the host and promote ordinary feeding.
2. DNA derived from nontarget organisms present on the surface
of ticks may yield amplicons with some primers. To overcome
this problem, the ticks may be rinsed two times individually in
distilled water, once in 75 % ethanol and once more in water.
3. The TRI Reagent is a mixture of guanidine thiocyanate and
phenol that uses a convenient single-step liquid phase separation resulting in the simultaneous isolation of RNA, DNA, and
proteins. After adding chloroform or 1-bromo-3-chloropropane
and centrifuging, the mixture separates into 3 phases: an aqueous phase containing the RNA, the interphase containing
DNA, and an organic phase containing proteins. Each component can then be isolated after separating the three phases.
This reagent extracts total RNA, but when poly A + RNA is the
target, it is necessary to separate this last type of RNA from the
remaining existent RNA in a cell (rRNA and tRNA).
4. A one step PCR can be used to detect the presence of B. bigemina in sampled ticks. The example shown here uses primers
Bbi400F: 5-AGC TTG CTT TCA CAA CTC GCC-3 and
Bbi400R: 5-TTG GTG CTT TGA CCG ACG ACA T-3 that
amplify a 400 bp fragment within the conserved region of the
five rap-1a paralogous genes [31, 32], but the detection of
pathogen infection in ticks can be done using different protocols
487
and/or using different PCR mixtures. When dealing with low

parasitemias, the use of a nested PCR is recommended.
5. RNA quality should be checked by gel electrophoresis to confirm the integrity of RNA preparations since high-quality, pure,
and intact total RNA is critical to perform fundamental downstream molecular biology experiments.
6. For SSH library construction, following the manufacturers
protocol usually is sufficient to achieve good results, but small
modifications or optimizations can be done that normally are
stated in the protocol. It is fundamental to always read the
entire protocol before starting any procedure in order to carefully plan the experiments (e.g., the reagents within the PCRSelect cDNA Subtraction Kit are limited).
7. The TOPO TA Cloning Kit uses the pCR4-TOPO vector
which allows the selection of successful transformants by antibiotic and directly by disruption of the lethal E. coli gene, ccdB
[33]. The vector contains the ccdB gene fused to the C-terminus
of the LacZ fragment. The ligation of a PCR product disrupts
expression of the lacZ-ccdB gene fusion permitting growth of
only positive recombinants upon transformation. Cells that
contain nonrecombinant vector are killed upon plating.
Therefore, blue/white screening is not required.
8. The number of clones obtained from SSH library varies from
assay to assay and might be necessary to make a random selection of clones to sequence, facing the high sequencing costs.
As dealing with products of PCR, many clones are expected to
be repeated. Sequencing of clones can be done in house or
using available outsource academic or commercial sequencing
facilities.
9. The cDNA Annotation System software (dCAS) [16] may be
used for automated sequence clean-up, assembly, and BLAST
analysis against nonredundant sequence database (nr) and databases of tick-specific sequences (http://www.proteinlounge.
com, http://www.ncbi.nlm.nih.gov and http://www.vectorbase.org/index.php) and gene ontology (GO) assignments.
10. For visualization of tick gene silencing procedures, please visit:
http://www.jove.com/video/2474/rna-interference-in-ticks?
ID = 2474.
11. Control ticks can be injected with an unrelated dsRNA to control the effect of dsRNA injection in the tick, with a control
buffer or even with PBS.
12. In the present study, it was unnecessary to determine the absolute transcript copy number, so the relative change in gene
expression suffices. Relative quantification describes the
changes in the expression of target genes in the infected tick
population relatively to the reference group, the uninfected
tick population.
488
Ana Domingos et al.
References
1. Bock R, Jackcon L, de Vos A, Jorgensen W
(2004) Babesiosis of cattle. Parasitology 129:
S247S269
2. de la Fuente J, Moreno-Cid JA, Canales M
et al (2011) Targeting arthropod subolesin/
akirin for the development of a universal vaccine for control of vector infestations and
pathogen transmission. Vet Parasitol 181:
1722
3. Macaluso KR, Mulenga A, Simser JA et al
(2003) Differential expression of genes in
uninfected and rickettsia-infected Dermacentor
variabilis ticks as assessed by differentialdisplay PCR. Infect Immun 71:61656170
4. Mulenga A, Macaluso KR, Simser JA et al
(2003) Dynamics of Rickettsia-tick interactions: identification and characterization of
differentially expressed mRNAs in uninfected
and infected Dermacentor variabilis. Insect
Mol Biol 12:185193
5. Nene V, Lee D, Kanga S, Skilton R et al
(2004) Genes transcribed in the salivary glands
of female Rhipicephalus appendiculatus ticks
infected with Theileria parva. Insect Biochem
Mol Biol 34:11171128
6. Rudenko N, Golovchenko M, Edwards MJ
et al (2005) Differential expression of Ixodes
ricinus tick genes induced by blood feeding or
Borrelia burgdorferi infection. J Med Entomol
42:3641
7. de la Fuente J, Blouin EF, Manzano-Roman
NR et al (2007) Functional genomic studies of
tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics
90:712722
8. de la Fuente J, Kocan KM, Almazan C et al
(2007) RNA interference for the study and
genetic manipulation of ticks. Trends Parasitol
23:427433
9. Villar M, Torina A, Nunez Y et al (2010)
Application of highly sensitive saturation labeling to the analysis of differential protein
expression in infected ticks from limited samples. Proteome Sci 8:43
10. Zivkovic Z, Esteves E, Almazan C et al (2010)
Differential expression of genes in salivary
glands of male Rhipicephalus (Boophilus)
microplus in response to infection with
Anaplasma marginale. BMC Genomics
11:186
11. Mercado-Curiel RF, Palmer GH, Guerrero FD
et al (2011) Temporal characterisation of the
organ-specific Rhipicephalus microplus transcriptional response to Anaplasma marginale
infection. Int J Parasitol 41:851860
12. Antunes S, Golovchenko M, Rudenko N et al

(2012) Gene silencing of the tick antigens
selected after infection with Babesia bigemina,
in the host tick Rhipicephalus annulatus by
RNA interference. Int J Parasitol 42:187195
13. Zivkovic Z, Torina A, Mitra R et al (2010)
Subolesin expression in response to pathogen
infection in ticks. BMC Immunol 11:7
14. de la Fuente J, Maritz-Olivier C, Naranjo V
et al (2008) Evidence of the role of tick subolesin in gene expression. BMC Genomics
9:372
15. Kocan KM, Zivkovic Z, Blouin EF et al (2009)
Silencing of genes involved in Anaplasma
marginaletick interactions affects the pathogen developmental cycle in Dermacentor variabilis. BMC Dev Biol 9:42
16. Guo YJ, Ribeiro JMC, Anderson JM et al
(2009) dCAS: a desktop application for cDNA
sequence
annotation.
Bioinformatics
25:11951196
17. Fire A, Xu S, Montgomery MK, Kostas SA
et al (1998) Potent and specific genetic interference by double-stranded RNA in
Caenorhabditis elegans. Nature 391:806811
18. Montgomery MK, Xu SQ, Fire A (1998) RNA
as a target of double-stranded RNA-mediated
genetic interference in Caenorhabditis elegans.
19. Mello CC, Conte D (2004) Revealing the world
of RNA interference. Nature 431:338342
20. de la Fuente J, Kocan KM (2006) Strategies
for development of vaccines for control of ixodid tick species. Parasite Immunol 28:
275283
21. Hoa NT, Keene KM, Olson KE et al (2003)
Characterization of RNA interference in an
Anopheles gambiae cell line. Insect Biochem
Mol Biol 33:949957
22. Pal U, Li X, Wang T et al (2004) TROSPA, an
Ixodes scapularis receptor for Borrelia burgdorferi. Cell 119:457468
23. Ramamoorthi N, Narasimhan S, Pal U et al
(2005) The Lyme disease agent exploits a tick
protein to infect the mammalian host. Nature
436:573577
24. Sukumaran B, Narasimhan S, Anderson JF
et al (2006) An Ixodes scapularis protein
required for survival of Anaplasma phagocytophilum in tick salivary glands. J Exp Med
203:15071517
25. Merino O, Almazan C, Canales M et al (2011)
Control of Rhipicephalus (Boophilus) microplus
infestations by the combination of subolesin
26.
27.
28.
29.
vaccination and tick autocidal control after

subolesin gene knockdown in ticks fed on cattle.
Vaccine 29:22482254
Shkap V, Leibovitz B, Krigel Y et al (2005)
Vaccination of older Bos taurus bulls against
bovine babesiosis. Vet Parasitol 129:235242
Livak KJ, Schmittgen TD (2001) Analysis of
relative gene expression data using real-time
quantitative PCR and the 2(T)(-Delta Delta
C) method. Methods 25:402408
Schefe JH, Lehmann KE, Buschmann IR et al
(2006) Quantitative real-time RT-PCR data
analysis: current concepts and the novel gene
expression's C-T difference formula. J Mol
Med 84:901910
de la Fuente J, Almazan C, Blouin EF et al
(2006) Reduction of tick infections with
Anaplasma marginale and A. phagocytophilum
30.
31.
32.
33.
489
by targeting the tick protective antigen subolesin. Parasitol Res 100:8591

Willadsen P, Kemp DH (1988) Vaccination
with concealed antigens for tick control.
Parasitol Today 4:196198
Suarez CE, Palmer GH, Florin-Christensen M
et al (2003) Organization, transcription, and
expression of rhoptry associated protein genes
in the Babesia bigemina rap-1 locus. Mol
Petrigh R, Ruybal P, Thompson C et al (2008)
Improved molecular tools for detection of
Babesia bigemina. Ann N Y Acad Sci 1149:
155157
Bernard P, Gabant P, Bahassi EM, Couturier
M (1994) Positive-selection vectors using
the F plasmid ccdB killer gene. Gene 148:
7174
Chapter 33
Metagenomic Approaches to Disclose Disease-Associated
Pathogens: Detection of Viral Pathogens in Honeybees
Fredrik Granberg, Oskar E. Karlsson, and Sndor Belk
Abstract
Metagenomic approaches have become invaluable for culture-independent and sequence-independent
detection and characterization of disease-associated pathogens. Here, the sequential steps from sampling
to verification of results are described for a metagenomic-based approach to detect potential pathogens in
honeybees. The pre-sequencing steps are given in detail, but due to the rapid development of sequencing
technologies, all platform-specific procedures, as well as subsequent bioinformatics analysis, are more generally described. It should also be noted that this approach could, with minor modifications, be adapted
for other organisms and sample matrices.
Key words Metagenomics, Sequencing, Unknown viruses, Virus detection, Diagnosis, Unknown
etiology
Introduction
Metagenomics based on high-throughput sequencing (HTS)
allows for cell culture-independent and nucleotide sequenceindependent detection of pathogens as well as characterization of
the entire microbial flora in a sample. It thus has the potential to
detect the full spectrum of emerging new pathogens, including
novel viruses and fastidious bacteria, as demonstrated and reviewed
[14]. Viral metagenomics (or metaviromics) focuses on the viral
fraction of a metagenomic sample, and several HTS-based
approaches have been developed for unbiased characterization of
the viral populations in various organisms and environments. These
approaches are usually comprised of several typical steps including
sample homogenization, target enrichment, sequence-independent
amplification, sequencing library construction, HTS, and bioinformatics analysis [5, 6].
The pre-sequencing steps are similar to the method outlined by
Allander et al. [7]. Following homogenization and filtration, nuclease treatment with both DNase and RNase is used to reduce the host
491
492
background and enrich viral nucleic acid by removing unprotected

nucleic acids (i.e., those not in viral capsids), which makes this
approach most suitable for detection of actively replicating viruses
during the infectious period. The nuclease treatment is efficient and
easy to perform, as previously demonstrated [8, 9]. However, the
quantities of recovered viral nucleic acid after extraction from nuclease-treated samples are usually insufficient for generation of sequencing libraries. An amplification step is therefore required, and for this
purpose, we have incorporated random priming and amplification
using the sequence-independent single-primer amplification (SISPA)
method. Even though SISPA, or variants thereof, has been extensively used with great success for pre-amplification in viral discovery
[1013], the method has been demonstrated to introduce an amplification bias. This is not necessarily a problem for virus identification,
but it makes SISPA an unsuitable choice when whole-genome recovery is of central importance [14, 15].
Most existing HTS platforms have their own protocols to convert extracted and amplified material into a sequencing library suitable for subsequent cluster generation and sequencing. These
protocols have differing requirements in terms of the quantity and
quality of the starting material, but they are usually comprised of
four main steps: (1) fragmentation of DNA; (2) end repair, modification, and ligation of adapters, which enable amplification of the
sheared DNA by adapter-specific primers; (3) size selection of
DNA molecules with a certain length optimal for the current application or instrument; and (4) enrichment of adapter-ligated DNA
by PCR [16]. By also adding specific short sequence tags during
the construction of multiple libraries, it is possible to pool them
into a single-indexed library for increased throughput and reduced
costs. The necessary reagents for preparing a sequencing library
can often be purchased as platform-specific commercial kits.
There are currently three major commercial HTS platforms that
we have found suitable for metagenomic-based detection of virus: (1)
Roche 454; (2) Illumina; and (3) Ion Torrent. The Roche 454 platform has been the high-throughput method of choice for discovery
and de novo assembly of novel microorganisms [1719]. In addition
to having the longest read lengths, which simplifies de novo assembly, this was also the first HTS platform on the market. However,
Roche recently announced that the 454 platform will be phased out
in mid-2016, indicating that it has become outdated and cost ineffective. The field has developed rapidly as a result of continuous improvement of existing systems and release of completely new platforms,
and both the Illumina and Ion Torrent platforms have become more
attractive alternatives. What they may lack in terms of read length is
compensated for by throughput, cost, and accuracy. More specifically, while Illumina currently boasts the industrys most accurate
data, Ion Torrent has the shortest run time [20].
A Sequence-Based Metagenomic Approach for Detection of Virus
493
Bioinformatics is employed to analyze obtained sequence data.

It is important and good practice to first perform a quality control
of the dataset, not only to detect deviations but also to aid in the
preprocessing of sequencing data, which include removal of adaptor sequences and low-quality reads [21]. The taxonomical content of a metagenomic dataset is usually determined by comparing
individual reads against databases of known sequences using a
comparison tool such as BLAST. However, for the purpose of
pathogen detection, it is often beneficial to first assemble the reads
into longer continuous sequences (contigs), thereby substantially
decreasing the amount of data to be classified as well as providing
longer stretches of nucleotides to match toward the database.
How and when sampling is conducted might greatly affect the
outcome of pathogen detection schemes. The presence and prevalence of pathogens in a honeybee colony may vary over time and
space and can depend on several factors, such as colony composition regarding age class of bees and brood, physiological status of
bees, and/or the presence of brood [22]. For the investigation of
colony collapse disorder (CCD), which is recognized by a drastic
reduction in adult population despite the presence of abundant
food and breeding resources, hives displaying a lack of vitality of
adult worker honeybees and unusual depopulation might be suitable for sampling.
We here describe a collection of sequential protocols that outline a metagenomic approach aimed at detection of viral pathogens
in honeybees, which successfully has been employed for the detection of viral pathogens in Spanish honeybees [23]. Although variants of the protocols have been described elsewhere, we have
combined and augmented them for this specific aim. While the
pre-sequencing steps are described in detail, more general recommendations are given regarding sequencing procedures and subsequent bioinformatic analysis. This is mainly due to the rapid
development of HTS technologies, which quickly would render
detailed and platform-specific descriptions obsolete. Furthermore,
the generation of sequencing libraries as well as the actual sequencing is commonly performed by engaging a commercial sequencing
provider or an academic sequencing core facility. It should also be
noted that the described approach can be adapted for other organism by simply modifying the sample preparation step.
Materials
If solutions are not obtained from a commercial supplier, they
should be prepared using ultrapure water (prepared by purifying
deionized water to attain a sensitivity of 18 M cm at 25 C) and
analytical grade reagents. Prepare and store reagents according to
494
their individual specifications (room temperature if not specified).

Special care should be taken to keep enzymes at 20 C until use.
Diligently follow all waste disposal regulations when disposing
waste materials.
2.1 Sample
Preparation
1. Hand-operated glass homogenizer (or mortar and pestle),

30 ml capacity.
2. Sterile phosphate-buffered saline (1PBS): 137 mM NaCl,
2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4
(pH 7.4).
3. 0.45 m PVDF syringe filters.
4. 5 ml syringes.
5. 15 ml tubes.
6. 1.5 ml tubes.
2.2 Enrichment by
Nuclease Treatment
and Nucleic Acid
Extraction
1. Desktop mini centrifuge.

2. Refrigerated microcentrifuge.
3. 1.5 ml tubes.
4. DNase I (10 U/l; e.g., Roche Applied Science).
5. DNase buffer (10; supplied with DNase I).
6. RNase A (1 g/l; e.g., Life Technologies, Sigma-Aldrich, or
Thermo Scientific): Dilute to the working concentration using
nuclease-free water (not DEPC treated). Gently mix by pipetting or by flicking the tube a few times. Keep on ice until use.
7. Heat block or water bath (with a rack for 1.5 ml tubes).
8. Column-based DNA extraction kit with proteinase K, e.g.,
QIAamp DNA Mini Kit (Qiagen) or PureLink Genomic DNA
Mini Kit (Life Technologies).
9. TRIzol LS Reagent (Life Technologies) or other acidguanidinium-phenol-based reagents, e.g., TRI Reagent
(Sigma-Aldrich), TriPure (Roche Applied Science), or QIAzol
(Qiagen).
10. Chloroform.
11. Ethanol (70 %).
12. Column-based RNA extraction kit, e.g., RNeasy Mini Kit
(Qiagen) or PureLink RNA Mini Kit (Life Technologies).
13. Fluorescence-based capillary electrophoresis instrument, 2100
Bioanalyzer (Agilent Technologies).
2.3 SequenceIndependent, SinglePrimer Amplification

(SISPA)
1. Desktop mini centrifuge.

2. Thermocycler.
3. 0.2 or 0.5 ml tubes: Should fit the thermocycler.
495
4. 1.5 ml tubes.
5. Nuclease-free water (not DEPC treated).
6. Tag labeling primer FR26RV-N (GCCGGAGCTCTGCAG
ATATCNNNNNN): Dilute to 10 M with nuclease-free
water.
7. Amplification primer FR20RV (GCCGGAGCTCTGCAGAT
ATC): Dilute to 10 M with nuclease-free water.
8. dNTP mix (10 mM each).
9. dNTP mix (2.5 mM each).
10. Exo() Klenow DNA polymerase (5 U/l; e.g., New England
Biolabs or Thermo Fisher Scientific).
11. Exo() Klenow Buffer (10; supplied with Exo() Klenow
DNA polymerase).
12. DTT (0.1 M).
13. RNase inhibitor (40 U/l), e.g., RNaseOUT (Life
Technologies), RiboLock (Thermo Fisher Scientific), or
Protector (Roche Applied Science).
14. Reverse transcriptase (200 U/l), e.g., SuperScript III (Life
Technologies) or Maxima (Thermo Fisher Scientific).
15. Reverse transcriptase (RT) buffer (5; supplied with reverse
transcriptase).
16. MgCl2 (25 mM).
17. DNA polymerase (5 U/l), e.g., AmpliTaq Gold with Buffer
II (Life Technologies).
18. PCR buffer (10; supplied with DNA polymerase).
19. Column-based PCR purification kit, e.g., QIAquick PCR
Purification Kit (Qiagen) or PureLink PCR Purification Kit
(Life Technologies).
20. Elution buffer (EB): 10 mM TrisHCl (pH 8.5).
21. EcoRV (20 U/l; e.g., New England Biolabs).
22. Restriction enzyme buffer (10; supplied with EcoRV).
23. Instrument for quantification of nucleic acids, e.g., Qubit 2.0
Fluorometer with Qubit Assay Kits for DNA and RNA (Life
Technologies) or NanoDrop ND-1000 spectrophotometer
(NanoDrop Technologies).
24. Fluorescence-based capillary electrophoresis instrument, 2100
Bioanalyzer (Agilent Technologies).
25. TBE buffer (0.5): 45 mM TrisHCl (pH 8.3), 45 mM boric
acid, 1 mM EDTA.
496
26. Agarose (type LE) gel (1 %): Prepare using your standard
protocol in 0.5 TBE buffer. Add GelRed or ethidium bromide for visualization.
27. 1 kb Plus DNA Ladder (e.g., Life Technologies or Thermo
Fisher Scientific).
2.4 Library
Preparation
and Sequencing
2.5 Data Handling
and Bioinformatics
See HTS platform-specific protocols, according to manufacturers.
1. Intel-based server: 4 2 Intel Xeon or similar capacity, 256 GB

memory per processor (see Note 1 for bioinformatics and data
management considerations).
2. Linux-based operating system.
3. PrinSeq software package (http://sourceforge.net/projects/
prinseq/files/).
4. MIRA software package (http://sourceforge.net/projects/
mira-assembler).
5. BLAST+ software package
blast/executables/blast+).
(ftp://ftp.ncbi.nlm.nih.gov/
6. Workstation, Intel i7 or similar, 8 GB of memory.

7. MEGAN 4 software (http://ab.inf.uni-tuebingen.de/software/megan/).
8. Bowtie 2 (http://bowtie-bio.sourceforge.net/bowtie2).
9. Integrative Genomics Viewer (http://www.broadinstitute.
org/igv/).
2.6 Confirmation
and Retrieval of NearFull Genome
Sequences
1. Thermocycler.
2. 0.2 or 0.5 ml tubes: Should fit the thermocycler.
3. 1.5 ml tubes.
4. Column-based DNA extraction kit with proteinase K, e.g.,
QIAamp DNA Mini Kit (Qiagen) or PureLink Genomic DNA
Mini Kit (Life Technologies).
5. TRIzol LS Reagent (Life Technologies) or other acidguanidinium-phenol-based reagents, e.g., TRI Reagent (SigmaAldrich), TriPure (Roche Applied Science), or QIAzol (Qiagen).
6. Column-based RNA extraction kit, e.g., RNeasy Mini Kit
(Qiagen) or PureLink RNA Mini Kit (Life Technologies).
7. First-strand cDNA synthesis kit, e.g., SuperScript III FirstStrand Synthesis System (Life Technologies) and RevertAid
First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific)
or Transcriptor First-Strand cDNA Synthesis Kit (Roche
Applied Science).
497
8. DNA polymerase, e.g., AmpliTaq Gold (Life Technologies),

DreamTaq (Thermo Fisher Scientific), or Platinum Taq (Life
Technologies).
9. PCR buffer (10; supplied with DNA polymerase).
10. High-fidelity long-range DNA polymerase, e.g., Phusion Hot
Start II High Fidelity (Thermo Fisher Scientific).
11. Agarose (type LE) gel (1 %): Prepare using your standard protocol in 0.5 TBE buffer.
12. UV transilluminator.
13. Scalpel.
14. Column-based gel extraction kit, e.g., QIAquick Gel
Extraction Kit (Qiagen) or Purelink Quick Gel Extraction Kit
(Life Technologies).
Methods
The sequential steps in the metagenomic-based approach outlined
below are summarized in Fig. 1. Carry out all laboratory procedures at room temperature unless otherwise specified.
3.1 Sample
Preparation
1. For each hive, collect approximately 50 adult worker bees in

total, from both inside and outside the hive to ensure the presence of young and adult bees, in sterile containers. Keep frozen during transport at 18 C or lower.
2. Out of the collected material from a hive, manually homogenize 20 whole bees in a 30 ml glass homogenizer with 6 ml of
1 PBS. If possible, perform the homogenization on ice.
3. Pour the homogenate into a 15 ml tube (or use several 2 ml tubes)
and centrifuge at 1,000 g for 10 min at 4 C to pellet debris.
4. Use a 5 ml syringe and a 0.45 m PVDF syringe filter to remove
any remaining debris. Draw a small amount of air (about 1 ml)
into the syringe before filling with the supernatant. Attach the
syringe filter and pass the supernatant through the filter into
1.5 ml tubes by applying a steady pressure. Use the air in the
syringe to purge the filter. This will minimize fluid retention
within the filter device and maximize sample recovery.
3.2 Enrichment by
Nuclease Treatment
and Nucleic Acid
Extraction
1. Aliquot 168 l of the filtered homogenate into two 1.5 ml

tubes and add 20 l of 10 DNase buffer to each. Mix by vortexing and spin down briefly using a desktop mini centrifuge.
2. To each tube, add 10 l DNase I (10 U/l) and 2 l RNase
(1 g/l). Mix by pipetting.
3. Incubate at 37 C for 2 h using a heat block or water bath.
498

Sampling
Sample preparation
Homogenization
Centrifugation
Enrichment by nuclease
treatment
Extraction of DNA & RNA
Amplification
Generation of platformspecific libraries
Sequencing
Sequence analysis and
assembly
Homology searches
against databases
Verification of results
Fig. 1 Flow graph of the described metagenomic-based approach to detect

potential pathogens
4. Dry the tubes, if necessary, and put them on ice. Store at

80 C or proceed directly.
DNA Extraction
1. Use the QIAamp DNA Mini Kit according to the manufacturers spin protocol for blood and body fluid DNA extraction
(see Note 2).
2. Measure DNA concentration by using a Qubit 2.0 Fluorometer
with the dsDNA HS (High Sensitivity) Assay Kit, or use a
NanoDrop ND-1000 to make an estimate, according to the
manufacturers instructions. Concentrations are expected to
range between 2 and 25 ng/l.
3. Aliquot the DNA and mark the tubes with the sample ID and
date of extraction. Store at 80 C.
RNA Extraction
The following steps should be carried out under a fume
hood due to phenol component.
499
1. Add 600 l of TRIzol LS to each nuclease-treated homogenate

and pipette the homogenate up and down a couple of times.
2. Incubate the tubes at room temperature for 5 min.
3. Add 160 l of chloroform.
4. Cap the tube securely and shake and/or vortex it vigorously
for 15 s, so the contents of the tube get whitish.
5. Incubate the tube for 23 min in room temperature.
6. Centrifuge the tubes at 12,000 g for 15 min at 4 C. The rest
of the centrifugation steps should be carried out at room
temperature.
7. Carefully take the tubes to the fume hood. There will be three
phases after the centrifugation: an upper, colorless, aqueous
phase containing RNA, a white interphase containing DNA,
and a lower, red, organic phase.
8. Carefully transfer the aqueous phase to a fresh 1.5 ml tube.
Transfer it in small volumes without getting any of the other
two phases into the pipette tip.
9. Estimate the volume of the aqueous phase. Add the same volume of 70 % ethanol. Mix thoroughly by vortexing. Do not
centrifuge.
10. Pipet up to 700 l of the sample into an RNeasy Mini Spin
Column, or similar, in a 2 ml collection tube. Mark the lid of
the column with the sample ID.
11. Centrifuge at 8,000 g for 15 s at 1525 C. Discard the
flow-through. If there is still some of the sample left, transfer
it to the Mini Column and centrifuge again.
12. Proceed according to the manufacturers instructions.
13. Measure the concentration of the extracted RNA by using a
Qubit 2.0 Fluorometer with the RNA Assay Kit or control the
RNA quality by using a 2100 Bioanalyzer with a RNA Pico
Chip (Agilent Technologies) according to the instructions of
the manufacturers. Concentrations are expected to range
between 2 and 25 ng/l.
14. Aliquot the RNA and mark the tubes with the sample ID and
date of extraction. Store at 80 C.
3.3 SequenceIndependent, SinglePrimer Amplification
(SISPA)
Tag Labeling DNA

1. Prepare the reagent mixture described in Table 1 in a 0.2 or
0.5 ml tube.
2. Denature at 94 C for 2 min in a thermal cycler and chill on
ice for 2 min.
3. Add 0.5 l (2.5 U) of exo() Klenow DNA polymerase.
500
Table 1
Reagent mixture for tag labeling DNA
Component
Volume (l)
FR26RV-N (10 M)
DNA template
10
dNTP mix (10 mM each)
1.5
Exo() Klenow Buffer (10)
1.5
Total volume
15
Table 2
Reaction mix 1 for tag labeling RNA
Component
Volume (l)
FR26RV-N (10 mM)
RNA template
10
dNTP mix (10 mM each)
1.5
Total volume
13.5
4. Complete a first round of extension by incubating at 37 C for

1 h. Proceed directly with denaturation at 94 C for 2 min and
chill on ice for 2 min.
5. Add 0.5 l (2.5 U) of exo() Klenow DNA polymerase for a
second round of extension.
6. Incubate at 37 C for 1 h and inactivate the enzyme by incubating at 75 C for 10 min.
7. Tagged DNA fragments can be stored at 20 C for several
weeks.
Tag Labeling RNA
1. Prepare the reaction mix 1 (Table 2) and 2 (Table 3) in separate 0.2 or 0.5 ml tubes.
2. Keep reaction mix 2 on ice until step 4.
3. Incubate reaction mix 1 at 65 C for 5 min in a thermal cycler
to denature the RNA.
4. Chill on ice for 1 min and add reaction mix 2.
5. Perform the reverse transcription by incubating at 25 C for
5 min, 50 C for 1 h, and 85 C for 5 min. Place on ice.
6. Add 0.5 l (2.5 U) of exo() Klenow DNA polymerase for
second-strand synthesis and incubate at 37 C for 1 h. A final
incubation at 75 C for 10 min inactivates the enzyme.
501
Table 3
Reaction mix 2 for tag labeling RNA
Component
Volume (l)
Reaction mix 1 (see Table 2)
13.5
RT buffer (5)
DTT (0,1 M)
RNase inhibitor (40 U/l)
Reverse transcriptase (200 U/l) 1

Total volume
20.5
Table 4
Reaction mix for PCR amplification
Component
Volume (l)
PCR buffer (10)
dNTP Mix (2.5 mM each)
MgCl2 (25 mM)
FR20RV (10 mM)
DNA polymerase (5 U/l)
0.5
Nucleic acid template
2.5
Nuclease-free H2O
29
Total volume
50
7. Tagged cDNA fragments can be stored at 20 C for several

weeks.
Amplification
1. Perform the PCR amplification by using the complementary
primer FR20RV. For each reaction, prepare the reaction mix
described in Table 4 in a 0.2 or 0.5 ml tube.
2. Mix gently and, if necessary, spin down briefly using a desktop
mini centrifuge.
3. Perform the PCR in a thermal cycler with the conditions
described in Table 5.
4. PCR products can be stored at 20 C for several weeks.
Exonuclease Removal of Amplification Tag Sequences
1. Purify the PCR products with the QIAquick PCR Purification
Kit, according to the manufacturers instructions, or use a
similar column-based purification system. Elute in 50 l of EB
buffer or water (pH 7.08.5).
502
Table 5
Thermal cycling conditions
Cycle step
Temperature (C)
Duration
Number of cycles
Initial denaturation
95
10 min
Denaturation
95
60 s
Annealing
58
60 s
Extension
72
60 s
Final extension
72
10 min
40
Table 6
Restriction reaction mixture
Component
Volume (l)
Purified PCR product
26
Restriction enzyme buffer (10)
EcoRV (20 U/l)
0.5
Total volume
29.5
2. Use the restriction enzyme EcoRV to remove the amplification

tag. Add purified PCR product, buffer, and restriction enzyme
to a 1.5 ml microfuge tube as described in Table 6.
3. Incubate at 37 C for 1 h using a heat block or water bath.
4. Purify again using the QIAquick PCR Purification Kit or a
similar column-based purification system. Elute in 50 l of EB
buffer or water (pH 7.08.5).
5. To assess the compositions and concentrations of the final
samples, use either a 2100 Bioanalyzer or run the samples on
an agarose gel (1 % agarose in 0.5 TBE buffer) and measure
the concentration using a Qubit 2.0 Fluorometer. Figure 2a,
b illustrates successfully amplified random products when analyzed with the two abovementioned methods, respectively.
3.4 Library
Preparation
and Sequencing
The generation of sequencing libraries as well as the actual sequencing is commonly performed by engaging a commercial provider or
an academic core facility. This paragraph will therefore be kept
brief and not outline a detailed protocol.
1. Since the preparation of sequencing libraries are platform specific, it is first necessary to select a sequencing platform. It has
been demonstrated that HTS data in the range of 1050 Mbp
is enough to identify viruses with the described approach [24].
Most current platforms have a capacity in this range or higher.
There are therefore other factors that might influence the
503
Fig. 2 Successfully amplified random products analyzed using (a) the 2100 Bioanalyzer DNA 1000 Assay and
(b) separation on a 0.8 % agarose gel. The Bioanalyzer produces a graph where the y-axis represents fluorescence units [FU] and the x-axis is time, which translates to fragment size in base pair (bp). This information is
also used to create a gel-like densitometry plot. On the agarose gel, sizes were determined using a 1 kb Plus
DNA Ladder. A smear is expected due to the randomness of the amplification procedure and the DNA size typical range from 200 to 1,000 bp, with the mean size ~375 bp
choice, such as read length, cost (both per run and per Mb of
DNA sequence), and ease of availability. For comparison,
major commercial HTS platforms suitable for metagenomicbased detection and their characteristics are summarized in
Table 7. A comprehensive review about HTS platforms has
also been made by Glenn et al. [25].
2. The necessary reagents for sequencing library generation can
be obtained as platform-specific commercial kits. It should
therefore be straightforward to prepare a sequencing library
according to the kit manufacturers protocol. In addition, the
use of specific short sequence tags (indexes) is supported by
most platforms. They can be added during the construction of
multiple libraries to allow multiplexing for increased throughput and reduced costs (for other considerations regarding
preparation of sequencing libraries, see Note 3).
3. Perform sequencing according to the platform manufacturers
protocol.
3.5 Data Handling
and Bioinformatics
We here describe a general approach based on publicly available

software on a Unix/Linux system.
1. Sequence data is usually received in compressed format, for
example, as a .tar.gz file. The software application gzip is preinstalled on most Unix/Linux systems and can be invoked as
gunzip from the command line to uncompress files (on the
command line type: gunzip h for help using gunzip).
~24 h
MiSeq
90 min
11 days
27 h
10 h
23 h
Run
timea
HiSeq 2500 (max) 35 h
HiSeq 2500
(rapid)
35 h
26 h
GS Junior
Illumina
26 h
Library
preparation time
GS FLX Titanium
XL+
Roche/454c
Platforms
2 250
2 100
2 100
~400
~700
Average read length

(bp)
7.58.5 Gb
600 Gb
180 Gb
3550 Mb
700 Mb
Throughput
per run
~$1 K
~$23 k
~$6 k
~$1 k
~$6 k
Reagent
cost/run
~$0.13
~$0.04
~$0.04
~$20
~$8.6
Reagent
cost/Mb
A/Bgood; shorter reads than 454

but much greater throughput; low
cost per Mb; fastest Illumina run
times
B/Aaverage; limited by short reads

(assembly more challenging);
highest throughput per run; low
cost per Mb
B/Caverage; suitable for single

samples; long read length; low cost
per run but high cost per Mb
Baverage; long read length; high

cost per Mb
Utility gradeb
Table 7
Characteristics and utility grades of HTS platforms suitable for metagenomic-based detection of potential pathogens
504
24 h
24 h
Chip I
Chip II
~200
~200
~400
~400
~400
~100 Gb
~10 Gb
~1 Gb
400 Mb
1040 Mb
~$1 k
~$1 k
$750
$550
$350
~$0,01
~$0,1
~$0,75
~$1.38
~$8.5
A/Bgood, longer reads than HiSeq;

lowest cost per Mb
B/Aaverage; longer reads than

HiSeq; low cost per Mb
A/Bgood; similar to the 316 chip

but higher throughput
A/Bgood; similar to the 314 chip

but higher throughput
B/Caverage; long read length;

lowest experimental cost but high
cost per Mb; short run time (but
long library prep.)
Instrument time for maximum read length

Initial letter indicates the authors opinion of the overall utility (grade) for a platform for metagenomic-based detection. Utility grades combine data characteristics, cost of data,
and ease of assembling the data into the final desired product. Major considerations for utility grades are noted
c
Roche recently announced that the 454 sequencers will be phased out in mid-2016
23 h
318 Chip
46 h
23 h
316 Chip
Ion Proton
23 h
46 h
314 Chip
Ion Torrent PGM

505
506
2. If necessary, convert the data into a file format, such as FASTQ or

FASTA with a corresponding quality file, that is compatible with
most sequence analysis software and applications (see Note 4).
3. Perform a quality control on the data (investigate read length,
quality score, and sequence complexity distributions, as well as
sequence duplication and number of ambiguous bases) and preprocess the data accordingly. The PrinSeq software can be used
both for the quality control and the preprocessing (see Note 5).
4. Assemble the reads into longer continuous sequences (contigs). The MIRA assembler can be used for data from most
available platforms and is publicly available [33] (see Note 6).
There also exist alternative assemblers (see Note 7).
5. Complete BLASTN, BLASTX, and tBLASTx searches against
local copies of NCBIs nucleotide and protein databases using
an updated version of NCBIs blast program to enable taxonomic classification (see Note 8). This can be performed for
both reads and contigs. For parsing of blast results, we would
recommend using either a custom-made script (see Note 9) or
a ready software solution, such as MEGAN (MEtaGenome
ANalyzer) [26].
6. For potential pathogens identified during the evaluation of
BLAST results, retrieve candidate reference genomes from
GenBank in FASTA format. Map reads and/or contigs against
the reference genomes to allow analysis and visualization of
similarities and coverage distribution (see Note 10).
3.6 Verification
and Retrieval of NearFull Genome
Sequences
1. Based on the results from the alignments, use the Primer3

program [27] (or similar software) to design PCR primers to
confirm the presence of virus in the original material and to
close gaps.
2. Extract RNA and DNA from the original material as above,
but without nuclease treatment.
3. Generate cDNA by using a first-strand cDNA synthesis kit
with random hexamers according to the manufacturers
instructions.
4. PCR products with an expected length shorter than 1,500 bp
can be obtained by using a standard DNA polymerase assay.
For longer fragments, it is recommended to use a high-fidelity
long-range DNA polymerase system, such as the Phusion Hot
Start II High-Fidelity system. Optimize reaction conditions,
such as annealing temperature, if necessary.
5. Separate the amplified products on an agarose gel and visualize and extract the DNA bands of interest by using a UV transilluminator and a scalpel (for an alternative procedure without
potentially damaging UV illumination, see Note 11).
507
6. Purify the PCR products by using a column-based gel extraction kit.

7. Perform Sanger sequencing (either in-house or by using a
commercial sequencing service). Longer distances can be covered by iterative primer walking and repeated sequencing (see
Note 12).
8. Obtained sequences should be incorporated into the alignment against the reference genome.
Notes
1. On the use of bioinformatics, centers, and in-house solutions.
One of the major obstacles to using HTS methodologies for
detection of viruses is the need for server solutions for bioinformatics analysis as well as for storage of data. Most sequencing centers provide basic bioinformatics as part of their
services, but for more in-depth analysis, the baseline service
might not be sufficient. The best cost/benefit solution is to
attach a bioinformatician to the group and access either a
national high-performance center for computing or a local-/
university-based solution. The second best alternative is to
build the capacity yourself by expanding the group with bioinformaticians and server solutions for handling the data; there,
our recommendations are the minimum recommendations.
The third option is to outsource the analysis to a commercial
partner and/or another group with the needed expertise. This
is the least favored option due to the loss of control over a
major part of the project.
2. Kits from other manufacturers can be used, but it is preferable
to use nucleic acid extraction systems incorporating a spin or
vacuum column. This allows for efficient removal of inhibitors
since nucleic acid trapped in a silica gel membrane can be very
effectively washed before elution [28].
3. For each sample, the SISPA products (from DNA and cDNA,
respectively) can be pooled (unless there is a specific reason not
to). Additionally, when sequencing SISPA material on HTS platforms that permit longer read lengths (300600 bp), an alternative to fragmentation is to perform direct size selection since the
majority of the SISPA products already are within this size range,
as illustrated in Fig. 2. This can be performed by traditional gel
electrophoresis or by an automated preparative gel electrophoresis system, such as the Pippin Prep (Sage Science).
4. Most sequencing platforms can deliver the data in a variety of
output formats, including FASTQ or FASTA with a corresponding
quality (QUAL) file. One noticeable exception is the Roche/454
508
platform that generates a binary standard flowgram format (SFF)

file. However, the Roche/454 software usually comes bundled
with off-instrument applications that allow conversion from
SFF to FASTA and QUAL files. An alternative solution is to use
the seq_crumbs package (http://bioinf.comav.upv.es/seq_
crumbs/). For the use with certain assemblers, it is also useful to
extract the trace.info file in XML format.
5. The PrinSeq software for quality control and preprocessing of
metagenomic datasets is a powerful tool for assessing the validity of a dataset [21]. Except for the normal quality measures,
such as sequence length and base qualities, PrinSeq also
enables the user to overview several statistics valuable for
assessing metagenomic datasets. Among these are tag sequence
contamination, complexity, and a measurement of possible
sequence contamination. PrinSeq can also be used to trim
adaptor regions, filter low-quality and low-complexity reads,
as well as remove platform-specific duplicates, an artifact of the
sequencing technology.
6. The MIRA (Mimicking Intelligent Read Assembly) software is
one of the more accomplished stand-alone noncommercial assemblers. For assembly aimed at metagenomes, standard settings for
de novo assembly should be sufficient. Consult the MIRA manual
for suggested settings and required preprocessing of data.
7. There are several assemblers suitable for assembly of metagenomic datasets. Except for MIRA, the Newbler assembler can
be used with good result for 454 and Ion Torrent data. Both
MetaVelvet and Ray Meta can produce assemblies taking mixed
genomic material into account. For increased quality, several
assemblies should be compared, resulting in a master list of verified contigs (sequences that are found in more than one assembly), thereby removing assembly artifacts as an error source.
8. The BLAST software suite released by NCBI can perform a
number of different types of homology searches of nucleotide
query sequences against databases of nucleotide and amino
acid sequences. Updated and preformatted nucleotide and
protein databases can be obtained from NCBI as compressed
archives (ftp://ftp.ncbi.nih.gov/blast/db/). When performing a BLAST search, it is possible to configure parameters or
settings to specify BLAST algorithm, database(s) to be searched,
output format, cutoff levels, etc. For example, to compare
nucleotide sequence(s) against a nucleotide database with
BLASTn and receive the result in XML format, the command
would be: blastn query your_query_file.fasta db your_
database out your_result outfmt 5. For more information,
see the manual at http://www.ncbi.nlm.nih.gov/books/
NBK1763/. In addition to BLASTn, it is preferable to also
509
perform homology searches with BLASTx, using a nucleotide

query toward a protein database, and tBLASTx, querying a
translated nucleotide toward a translated nucleotide database.
Together, these three search strategies allow an increasingly
wider homology search to be performed, enabling direct mapping toward known organisms, indirect mapping toward similar proteins, and finally mapping toward protein families.
9. Tools for computational molecular biology and bioinformatics
have been developed using both Perl and Python, two generalpurpose scripting languages, and are now being distributed in
the modules BioPerl [29] and Biopython [30]. Both have useful tools for parsing BLAST result files in XML format and can
be used to create custom-made scripts. More information and
installation instructions can be found at http://www.bioperl.
org/ and http://biopython.org/.
10. This can be performed by using combinations of sequence
aligners and visualization software. The results from aligners
such as Bowtie2 [31] and bwa [32] can be inspected using the
Integrative Genomics Viewer (IGV) [33]. Another possibility
is to use MUMmer and DisplayMUMs [34], or the commercial software CodonCode Aligner (CodonCode Corporation).
11. As an alternative to UV illumination, it is recommended to use
SYBR Gold staining and a blue-light transilluminator, such as
Safe Imager 2.0 (Invitrogen) or Dark Reader (Clare Chemical).
12. Primer walking can be used to sequence PCR fragments that
are too long to be sequenced in a single round of Sanger
sequencing. First use the PCR primers that generated the fragment to perform Sanger sequencing from both ends of the
fragment. New PCR primers are then designed at the end of
the obtained sequences, close to the region not yet covered.
Perform another round of Sanger sequencing with the new
primers and repeat the procedure if necessary until the whole
fragment has been sequenced.
Acknowledgments
The authors would especially like to thank Professor Jos Manuel
Snchez-Vizcano (Animal Health Department, Complutense
University of Madrid, Madrid, Spain) and his research group for
their contribution to the original paper on which this chapter was
based. This work was supported by Epi-SEQ, a research project
supported under the 2nd joint call for transnational research projects by EMIDA ERA-NET (FP7 project nr 219235); by the Award
of Excellence (Excellensbidrag), provided to SB by the Swedish
University of Agricultural Sciences (SLU); and by/executed in the
510
framework of the EU project AniBioThreat (Grant Agreement:

Home/2009/ISEC/AG/191) with the financial support from the
Prevention of and Fight against Crime Programme of the European
Union, European CommissionDirectorate General Home
Affairs. This publication reflects the views only of the authors, and
the European Commission cannot be held responsible for any use,
which may be made of the information contained therein. The
funders had no role in the study design, data collection and analysis,
decision to publish, or preparation of the manuscript.
References
1. Cheval J, Sauvage V, Frangeul L et al (2011)
Evaluation of high-throughput sequencing for
identifying known and unknown viruses in biological
samples.
J
Clin
Microbiol
49:32683275
2. Lipkin WI (2010) Microbe hunting. Microbiol
Mol Biol Rev 74:363377
3. Nakamura S, Nakaya T, Iida T (2011)
Metagenomic analysis of bacterial infections by
means of high-throughput DNA sequencing.
Exp Biol Med (Maywood) 236:968971
4. Tang P, Chiu C (2010) Metagenomics for the
discovery of novel human viruses. Future
Microbiol 5:177189
5. Daly GM, Bexfield N, Heaney J et al (2011) A
viral discovery methodology for clinical biopsy
samples utilising massively parallel next generation sequencing. PLoS One 6:e28879
6. Delwart EL (2007) Viral metagenomics. Rev
Med Virol 17:115131
7. Allander T, Tammi MT, Eriksson M et al
(2005) Cloning of a human parvovirus by
molecular screening of respiratory tract samples. Proc Natl Acad Sci U S A
102:1289112896
8. Allander T, Emerson SU, Engle RE, Purcell
RH, Bukh J (2001) A virus discovery method
incorporating DNase treatment and its application to the identification of two bovine parvovirus species. Proc Natl Acad Sci U S A
98:1160911614
9. Victoria JG, Kapoor A, Dupuis K, Schnurr DP,
Delwart EL (2008) Rapid identification of
known and new RNA viruses from animal tissues. PLoS Pathog 4:e1000163
10. Djikeng A, Halpin R, Kuzmickas R et al (2008)
Viral genome sequencing by random priming
methods. BMC Genomics 9:5
11. Reyes GR, Kim JP (1991) Sequenceindependent,
single-primer
amplification
(SISPA) of complex DNA populations. Mol
Cell Probes 5:473481
12. Rosseel T, Scheuch M, Hper D (2012) DNase

SISPA-next generation sequencing confirms
Schmallenberg virus in Belgian field samples
and identifies genetic variation in Europe.
PLoS One 7:e41967
13. Ambrose HE, Clewley JP (2006) Virus discovery by sequence-independent genome amplification. Rev Med Virol 16:365383
14. Karlsson OE, Belk S, Granberg F (2013) The
effect of preprocessing by sequenceindependent,
single-primer
amplification
(SISPA) on metagenomic detection of viruses.
Biosecur Bioterror 11(S1):S227S234
15. Rosseel T, Van Borm S, Vandenbussche F et al
(2013) The origin of biased sequence depth in
sequence-independent nucleic acid amplification and optimization for efficient massive parallel sequencing. PLoS One 8:e76144
16. Linnarsson S (2010) Recent advances in DNA
sequencing methodsgeneral principles of
sample
preparation.
Exp
Cell
Res
316:13391343
17. Palacios G, Druce J, Du L et al (2008) A new
arenavirus in a cluster of fatal transplantassociated diseases. N Engl J Med
358:991998
18. Briese T, Paweska JT, McMullan LK et al
(2009) Genetic detection and characterization
of Lujo virus, a new hemorrhagic feverassociated arenavirus from southern Africa.
19. Cox-Foster DL, Conlan S, Holmes EC et al
(2007) A metagenomic survey of microbes in
honey bee colony collapse disorder. Science
318:283287
20. Loman NJ, Misra RV, Dallman TJ et al (2012)
Performance comparison of benchtop highthroughput sequencing platforms. Nat
21. Schmieder R, Edwards R (2011) Quality control and preprocessing of metagenomic datasets. Bioinformatics 27:863864

22. Pirk CWW, Miranda JR, Kramer M, et al.
(2013) Statistical guidelines for Apis mellifera
research. J Apic Res 52 (doi: 10.3896/
IBRA.1.52.4.13)
23. Granberg F, Vicente-Rubiano M, Rubio-Guerri
C et al (2013) Metagenomic detection of viral
pathogens in Spanish honeybees: co-infection
by Aphid lethal paralysis, Israel acute paralysis
and Lake Sinai viruses. PLoS One 8:e57459
24. Belk S, Karlsson OE, Leijon M, Granberg F
(2013) High-throughput sequencing in veterinary infection biology and diagnostics. Rev Sci
Tech 32:893915
25. Glenn TC (2011) Field guide to nextgeneration DNA sequencers. Mol Ecol Resour
11:759769
26. Huson DH, Mitra S, Ruscheweyh HJ, Weber
N, Schuster SC (2011) Integrative analysis of
environmental sequences using MEGAN4.
Genome Res 21:15521560
27. Rozen S, Skaletsky H (2000) Primer3 on the
WWW for general users and for biologist programmers. Methods Mol Biol 132:365386
511
28. Ratcliff RM, Chang G, Kok T, Sloots TP

(2007) Molecular diagnosis of medical viruses.
Curr Issues Mol Biol 9:87102
29. Cock PJ, Antao T, Chang JT et al (2009)
Biopython: freely available Python tools for
computational molecular biology and bioinformatics. Bioinformatics 25:14221423
30. Stajich JE, Block D, Boulez K et al (2002) The
Bioperl toolkit: Perl modules for the life sciences. Genome Res 12:16111618
31. Langmead B, Salzberg SL (2012) Fast gappedread alignment with Bowtie 2. Nat Methods
9:357359
32. Li H, Durbin R (2009) Fast and accurate short
read alignment with Burrows-Wheeler transform. Bioinformatics 25:17541760
33. Thorvaldsdottir H, Robinson JT, Mesirov JP
(2013) Integrative Genomics Viewer (IGV):
high-performance genomics data visualization
and exploration. Brief Bioinform 14:178192
34. Kurtz S, Phillippy A, Delcher AL et al (2004)
Versatile and open software for comparing
large genomes. Genome Biol 5:R12
Chapter 34
Proteomics Characterization of Tick-Host-Pathogen
Interactions
Marina Popara, Margarita Villar, and Jos de la Fuente
Abstract
Ticks are blood-feeding arthropod ectoparasites of wild and domestic animals that transmit disease-causing
pathogens to humans and animals worldwide and a good model for the characterization of tick-host-pathogen
interactions. Tick-host-pathogen interactions consist of dynamic processes involving genetic traits of hosts,
pathogens, and ticks that mediate their development and survival. Proteomics provides information on the
protein content of cells and tissues that may differ from results at the transcriptomics level and may be
relevant for basic biological studies and vaccine antigen discovery. In this chapter, we describe various
methods for protein extraction and for proteomics analysis in ticks based on one-dimensional gel electrophoresis to characterize tick-host-pathogen interactions. Particularly relevant for this characterization is
the use of blood-fed ticks. Therefore, we put special emphasis on working with replete ticks collected after
feeding on vertebrate hosts.
Key words Tick-host-pathogen interactions, Proteomics, Protein extraction, Mass spectrometry,
LC-MS/MS, Electrophoresis
Introduction
Ticks are blood-feeding arthropod ectoparasites of wild and domestic animals that transmit disease-causing pathogens to humans and
animals worldwide [13]. Tick-host-pathogen interactions consist
of dynamic processes involving genetic traits of hosts, pathogens,
and ticks that mediate their development and survival [24]. In the
early 1990s, a cost-effective alternative for tick control became
commercially available with the development of vaccines reducing
the use of acaricides and the problems associated with them such as
selection of acaricide-resistant ticks and the contamination of the
environment and animal products with pesticide residues [5].
However, new vaccines are needed for efficient control of vector
infestations and pathogen infection and transmission [6].
513
514
Marina Popara et al.
In the post-genomics era, proteomics has emerged as a

powerful new tool that includes strategies for the characterization
of dynamic interactions that cannot be analyzed by genomics or
transcriptomics approaches alone. This technique provides information on the protein content of cells and tissues that may differ
from results at the transcriptomics level and may be relevant for
basic biological studies and vaccine antigen discovery [2, 3, 69].
Regarding proteomics of blood-sucking arthropods, a significant
number of studies were done primarily on mosquitoes, sandflies,
and tsetse flies [10]. The sequence databases of tick species of agricultural and medical importance are constantly increasing, which
enabled the expansion of research into the field of proteomics
[11]. However, the application of proteomics research on ticks is
still at its infancy [2]. The only tick genome close to completion is
that of the black-legged deer tick, Ixodes scapularis [12, 13], with
26,066 proteins currently in the UniProt database (data from
January 2014). However, for other tick species of medical importance such as Rhipicephalus, Dermacentor, and Amblyomma species, protein information in the databases is very limited, thus
making proteomics research in this area very difficult.
Few studies have covered proteomics research in ticks [2, 9
11, 1417]. Furthermore, some of these studies were done using
tick cells lines, but work with ticks is more complex because, in
most cases, proteins from the vector, the vector-borne symbionts
or pathogenic microorganisms, and the vertebrate hosts are identified [2, 7]. Therefore, proteomics techniques need to be refined to
adequately address these challenges. In this chapter, we describe
various methods for protein extraction and for proteomics analysis
in ticks based on one-dimensional gel electrophoresis to characterize tick-host-pathogen interactions. Particularly relevant for this
characterization is the use of blood-fed ticks. Therefore, we put
special emphasis on working with replete ticks collected after feeding on vertebrate hosts.
Materials
All reagents used for buffer preparations need to be of analytical
grade. The solutions are prepared with ultrapure water and stored
at 4 C, except for the solutions containing SDS that are stored at
20 C to avoid detergent precipitation. Reagents for protein digestions and mass spectrometry analysis need to be of liquid
chromatography-mass spectrometry (LC-MS) grade.
2.1
Tick Samples
Ticks are collected after feeding on vertebrate hosts, including

both domestic and wild animals. After repletion, ticks are collected
and stored in 70 % ethanol at 4 C until processed (see Note 1).
Tick Proteomics
2.2 Protein
Extraction Buffers
515
1. Buffer 1: 10 mM phosphate-buffered saline (PBS), pH 7.4

(0.26 g of KH2PO4, 2.17 g of Na2HPO4.7H2O, 8.71 g of
NaCl) supplemented with 1 % sodium dodecyl sulfate (SDS).
For preparation of buffer 1, add 1 ml of 10 % stock solution of
SDS to 9 ml of 10 mM PBS pH 7.4 and mix (see Note 2). The
buffer is also supplemented with 1 tablet of complete mini protease inhibitor cocktail (Roche, Basel, Switzerland) per 10 ml
of solution.
2. Buffer 2: 10 mM PBS, pH 7.4, supplemented with 1 % octyl
phenol ethoxylate (Triton X-100). For preparation of buffer 2,
add 1 ml of 10 % stock solution of Triton X-100 to 9 ml of
10 mM PBS pH 7.4 and mix (see Note 2). The buffer is also
supplemented with 1 tablet of complete mini protease inhibitor cocktail per 10 ml of solution.
3. Buffer 3: 10 mM PBS, pH 7.4, supplemented with 1 % polyethylene glycol sorbitan monolaurate (Tween 20). For preparation of buffer 3, add 1 ml of 10 % stock solution of Tween 20
to 9 ml of 10 mM PBS pH 7.4 and mix (see Note 2). The
buffer is also supplemented with 1 tablet of complete mini protease inhibitor cocktail per 10 ml of solution.
4. Buffer 4: 7 M urea, 2 M thiourea, 4 % CHAPS, 20 % glycerol,
200 mM KCl and 100 mM sodium hydrogen phosphate dihydrate, pH 7.4. Weigh 4.2 g of urea, 1.52 g of thiourea, 0.4 g
of CHAPS, 0.015 g of KCl, and 0.36 g of Na2HPO4.2H2O. Add
9 ml of water, mix, and make up to 10 ml with water. The buffer is also supplemented with 1 tablet of complete mini protease inhibitor cocktail per 10 ml of solution.
2.3 Laemmli
Sample Buffer
2.4 SDS-PAGE Gel

Components
0.125 M TrisHCl, pH 6.8, 4 % SDS, 20 % glycerol, 0.004 % bromophenol blue, and 10 % -mercaptoethanol. Mix 1.51 g of Tris
HCl, 4 g of SDS, 20 ml of glycerol, and 0.004 g of bromophenol
blue and bring up the volume to 100 ml with water. Make aliquots
of 1 ml and store at 20 C. Supplement the buffer with 10 % final
of -mercaptoethanol before use.
1. Resolving gel buffer: 1.5 M TrisHCl, pH 8.8. Weigh 181.7 g
of Tris, add water to a volume of 900 ml, adjust to pH 8.8 with
HCl, and make up to 1 L.
2. Stacking gel buffer: 1.5 M TrisHCl, pH 6.5. Weigh 181.7 g
of Tris, add water to a volume of 900 ml, adjust to pH 6.5 with
HCl, and make up to 1 L.
3. Resolving gel: Mix 2.5 ml of resolving gel buffer, 4 ml of 30 %
acrylamide/bis-acrylamide solution (Bio-Rad, Hercules, CA,
USA), 100 l of 10 % SDS, and 4 ml of water and mix well.
Add 100 l of 10 % ammonium persulfate and 5 l of TEMED
and cast gel.
516
4. Stacking gel: Mix 0.84 ml of stacking gel buffer, 0.84 ml of

30 % acrylamide/bis-acrylamide solution, 50 l of 10 % SDS,
and 3 ml of water and mix well. Add 50 l of 10 % ammonium
persulfate and 5 l of TEMED and cast gel.
5. Make 1.5 mm-thick gels with wells of 5 mm wide for conventional one-dimensional gels and 1.2 cm wide for proteome
band concentration.
2.5 SDS-PAGE
Running Buffer
2.6 Protein In-Gel

Digestion Buffers
Tris-glycine SDS-PAGE buffer (10): 0.25 M TrisHCl, pH 8.3,

1.92 M glycine, and 1 % SDS. This buffer is diluted 10 times with
water before use.
1. 50 mM ammonium bicarbonate, pH 8.8: Add 0.04 g of ammonium bicarbonate to 9 ml of LC-MS grade water, mix, and
adjust pH to 8.8 with 5 N ammonium hydroxide. Complete to
10 ml with water to obtain a 50 mM final solution.
2. 10 mM dithiothreitol (DTT): Add 1.54 mg of DTT to 1 ml of
50 mM ammonium bicarbonate, pH 8.8.
3. 55 mM iodoacetamide: Add 10.2 mg to 1 ml of 50 mM
ammonium bicarbonate, pH 8.8.
4. Sequencing grade trypsin (Promega, Madison, WI, USA) is
dissolved in 50 mM ammonium bicarbonate, pH 8.8, to a final
concentration of 60 ng/l.
2.7 Other Reagents,

Consumables,
Equipments,
and Software
1. Ice-cold acetone.
2. Trifluoroacetic acid.
3. 0.1 % formic acid.
4. 10 % (v/v) acetonitrile.
5. Methanol.
6. Chloroform.
7. GelCode Blue Stain Reagent (Thermo Scientific, San Jose,
CA, USA).
8. BCA Protein Assay (Thermo Scientific, San Jose, CA, USA).
9. Liquid nitrogen.
10. Sterilized mortar and pestle.
11. Syringe equipped with a 21 gauge needle.
12. OMIX pipette tips C18 (Agilent Technologies, Santa Clara,
CA, USA).
13. Ultrasonic cooled bath.
14. SDS-PAGE apparatus.
15. Centrifuge.
16. Freezer (20 C).
17. Vertical rotating shaker.
18. Confocal microscope.
Tick Proteomics
517
19. Reverse-phase liquid chromatography-mass spectrometer (we

use Easy-nLC II system coupled to an ion trap LCQ Fleet mass
spectrometer, Thermo Scientific, San Jose, CA, USA).
20. SEQUEST algorithm (Proteome Discoverer 1.3, Thermo
Scientific, San Jose, CA, USA).
21. PEAKS Studio v 6.0 software (Bioinformatics Solutions Inc.,
Waterloo, Ontario, Canada).
Methods
3.1 General
Considerations
Up to date, tick proteome characterization has not been widely

developed, and the methodologies used are based on the analysis
of either unfed ticks or the specific tick tissue of interest. Herein,
we focus on establishing standardized conditions to work with
replete ticks after feeding on vertebrate hosts and with onedimensional gel electrophoresis. One important consideration,
especially for quantitative proteomics analysis, is to perform protein extraction as simple as possible reducing the number of steps
to minimum in order to avoid protein losses during the extraction
procedure. The application of detergents for protein solubilization
in a sample is widely used for routine protein extraction as for the
enrichment of membrane proteins that are involved in the first
contact between pathogen, vector, and the host. However, to date,
there is no universal detergent or detergent mixtures that allow the
complete solubilization of all proteins in the sample. For proteomics analysis, buffers based on the use of chaotropic reagents
such as urea and thiourea, combined with detergents and salts are
also widely used for protein solubilization in one single step.
Therefore, the optimal method always needs to be determined
empirically depending on the sample type.
3.2 Tick Protein

Extraction
Carry out all the procedures at 4 C until the SDS-containing buffer is used, requiring 20 C to avoid detergent precipitation:
1. Remove the ticks from the ethanol storage and leave for
12 min in a fume hood to evaporate excess of ethanol.
2. Remove the cuticle by dissecting the ticks using a confocal
microscope and add 10 mM PBS for constant hydration of the
tissues during dissection (see Note 3).
3. Homogenize the tick internal organs by quick-freezing in liquid
nitrogen and pulverizing with a sterilized mortar and pestle.
4. Add at least 2 ml of protein extraction buffer 1, 2, 3, or 4 per
100 g of tissue. Homogenize in a glass homogenizer with a
minimum of 10 strokes of a glass rod.
5. Sonicate the sample for 1 min in an ultrasonic cooled bath
followed by 10 s vortex and leave to rest on ice for 1 min.
Repeat these cycles 23 times or until the sample becomes
518
completely solubilized. Moderately shake the crude extracts

for 20 min at 4 C and then additionally pass the extract
through a syringe equipped with a 21 gauge needle to assist
breakdown of remaining nucleic acids.
6. Centrifuge the samples for 5 min at 200 g at 20 C to remove
the cell debris.
7. Collect the supernatant, quantify the protein content of the
crude extracts with the BCA Protein Assay (Table 1), and analyze
by SDS-PAGE (Fig. 1), according to standard procedures.
Table 1
Identification of proteins extracted using different
extraction buffersa
Database search
Buffer 1
Buffer 2
Buffer 3
Buffer 4
Ixodida
62.9 %
48.2 %
44.4 %
82.0 %
Pecora
72.4 %
44.2 %
40.2 %
72.7 %
a
The efficacy of different detergents on tick protein extraction is compared by using
protein extraction buffers 14. We have observed that extraction with buffer 4 gives the
highest yield for both tick and host proteins identification, compared to the detergentbased buffers 13. Of the three detergent-based buffers, SDS-containing buffer 1 shows
the best efficiency in proteins extraction, whereas the nonionic detergents in buffers 2
and 3, Triton X-100 and Tween 20, show similar values for protein extraction. Proteins
are expressed as percentages of the total proteins identified
Fig. 1 Representative one-dimensional SDS-PAGE gel showing protein band patterns in extracts prepared using different protein extraction buffers. (1) Proteins
extracted with buffer 1. (2) Proteins extracted with buffer 2. (3) Proteins extracted
with buffer 3. (4) Proteins extracted with buffer 4. MW: molecular weight markers
(PageRuler Plus Prestained Protein Ladder, Scientific, San Jose, CA, USA). Twenty
micrograms of soluble fractions are run on a 5 mm wide conventional 12 % SDSPAGE gel performing electrophoresis at 180 V of constant voltage. Bands are visualized by staining with GelCode Blue Stain Reagent by manufacturers protocol
Tick Proteomics
3.3 Protein
Fractionation Method
519
In this extraction method, an additional step is introduced for

sample processing, thus resulting in the fractionation of the crude
extract into cytosolic (supernatant) and plasma membraneassociated (pellet) protein fractions:
1. Extract the tick proteins following the same steps as in the
previous method (Subheading 3.2, steps 16).
2. After the centrifugation at 200 g, additionally centrifuge the
obtained supernatant at 12,000 g for 20 min obtaining two
fractions: cytosolic-enriched protein supernatant and crude
plasma membrane-enriched protein pellet.
3. Collect the supernatant and quantify the protein content with
the BCA Protein Assay (Fig. 2a) (see Note 4).
4. Resuspend the pellet containing the crude plasma membrane
fraction directly in 100 l of Laemmli sample buffer and leave
on a vertical rotating shaker for 30 min to 1 h at 20 C with
vigorous shaking to enable solubilization.
5. Centrifuge the sample for 30 s on a benchtop centrifuge to
remove insoluble fragments and collect the supernatant
(Fig. 2b) (see Note 5).
3.4 Proteome
In-Gel Digestion
1. Precipitate 200 g of protein extracts to be analyzed by adding

four volumes of ice-cold acetone to one volume of sample.
Vortex the mixture, incubate at 20 C for at least 4 h, and
centrifuge at 12,000 g for 15 min at 4 C. Discard the supernatant, air-dry the pellet, and resuspend in 100 l of Laemmli
sample buffer supplemented with 5 % -mercaptoethanol.
2. Apply the samples onto 1.2 cm wide wells in a 12 % SDSPAGE gel.
3. Stop the electrophoretic run as soon as the front enters 3 mm
into the resolving gel, so that the whole proteome becomes concentrated in the stacking/resolving gel interface (see Note 6).
4. Stain with GelCode Blue Stain Reagent for visualization of the
unseparated protein bands, excise the gel-containing bands,
cut into 2 2 mm cubes, and transfer into a microcentrifuge
tube.
5. Destain gel pieces, alternating 50 mM ammonium bicarbonate/acetonitrile (1:1, v/v) with neat acetonitrile, incubating
for 10 min at room temperature with occasional vortexing
until the gel pieces become white and shrink; remove acetonitrile; and dry gel pieces.
6. Cover gel pieces with 60 ng/l of sequencing grade trypsin at
5:1 protein/trypsin (w/w) ratio in 50 mM ammonium bicarbonate, pH 8.8, containing 10 % (v/v) acetonitrile and leave it
in an ice bucket for 2 h to saturate them with trypsin. If all
solution was absorbed, add 2030 l of 50 mM ammonium
bicarbonate and digest overnight at 37 C.
520
Buffer 1
Buffer 4
b
300
Supernatant proteins
250
Plasma membrane enriched proteins

200
150
100
50
Tick (Cyt)Tick (Cyt + PM)
Host (Cyt)Host (Cyt + PM)
Fig. 2 The subcellular distribution of the extracted proteins depends on the buffer used. (a) Subcellular distribution of identified tick proteins after extraction with buffer 1 and buffer 4. We observed that buffer 4, a more
astringent buffer, allows the extraction of a greater number of internal organelle and membrane proteins. (b)
Number of identified tick and host proteins in the different fractions obtained using the buffer 1. An average of
41 % increase in the number of tick proteins and up to 72 % for host proteins is detected when crude plasma
membrane fraction is included in the analysis compared to the supernatant fraction only. Therefore, it is necessary to process both fractions, cytoplasmatic soluble, and plasma membrane pellet, obtained after detergent
extraction and separated by ultracentrifugation, in order to characterize the entire proteome. Identification is
performed using the SEQUEST algorithm of Proteome Discoverer 1.3 against Ixodida and Ruminantia databases for tick and host proteins identification, respectively. An FDR<0.05 for tick and an FDR<0.01 for host
proteins identification are considered as cutoff. Abbreviations: Cyt, cytoplasmic soluble protein fraction; PM,
plasma membrane protein fraction
Tick Proteomics
521
7. Add trifluoroacetic acid to a final concentration of 1 % to stop

the digestion.
8. Desalt the samples using OMIX pipette tips C18 following the
manufacturer instructions, vacuum dry, and store at 20 C
until the mass spectrometry analysis.
3.5 Reverse-Phase
Liquid Chromatography (RP-LC)-MS/
MS Analysis
1. Resuspend the protein digests in 0.1 % formic acid and analyze

by RP-LC-MS/MS in an Easy-nLC II system coupled to an
ion trap LCQ Fleet mass spectrometer (Thermo Scientific, San
Jose, CA, USA).
2. The peptides are concentrated (online) by reverse-phase chromatography using a 0.1 mm 20 mm C18 RP precolumn (Thermo
Scientific) and then separated using a 0.075 mm 100 mm C18
RP column (Thermo Scientific) operating at 0.3 l/min.
3. Elution of peptides is done using a 180 min gradient from 5 to
35 % solvent B (solvent A, 0.1 % formic acid in water; solvent
B, 0.1 % formic acid in acetonitrile). ESI ionization is done
with nano-bore emitters stainless steel ID 30 m (Thermo
Scientific) interface (see Note 7).
4. Peptides are detected in survey scans from 400 to 1,600 amu
(1 scan), followed by three data-dependent MS/MS scans
(Top 3), using an isolation width of 2 in mass-to-charge ratio
units, normalized collision energy of 35 %, and dynamic exclusion applied during 30 s periods (see Note 8).
3.6 Proteomics
Data Analysis
Peptide identification from raw data is carried out using the

SEQUEST algorithm (Proteome Discoverer 1.3, Thermo Scientific):
1. Database search is performed against Uniprot-Ixodida.fasta
(57,021 entries in January 2014), Uniprot-Pecora.fasta (67,200
entries in January 2014), and Uniprot-Alphaproteobacteria.
fasta (2,480,730 entries in January 2014) (http://www.
uniprot.org) for tick, host, and pathogen proteins identification, respectively.
2. The following constraints may be used for the searches: tryptic
cleavage after Arg and Lys, up to two missed cleavage sites, and
tolerances of 1 Da for precursor ions and 0.8 Da for MS/MS
fragment ions and the searches were performed allowing
optional Met oxidation and Cys carbamidomethylation. Search
against decoy database (integrated decoy approach) is done
using false discovery rate (FDR) <0.01.
3.7 Hemoglobin
Removal
In ticks collected after feeding on a host, the major constrain for

the successful protein identification is the large amount of the host
proteins, predominantly blood. These proteins, such as hemoglobin, serum albumin, and immunoglobulins, are very abundant and
mask the detection of vector and pathogen proteins. In engorged
tick samples, a high abundance of host hemoglobin is detected
522
RI: 2.51E7
55.16
100
Number of proteins
90
Relative Abundance
80
70
60
Hemoglobins
55.40
50
99.51
54.62
40
45.37
30
20
52.90
67.66
59.47
74.18 77.25
51.98
60.51
10
6.05 11.60
0
100
12.40
18.01
67.32
40.67 41.65
24.66 27.82
90.07
92.77
93.31
93.82
Tick
proteins
101.30
86.64
68.75
72.45
79.34 83.95
101.81
104.01 109.38 114.33 121.22
97.63
Host
proteins
128.23
54.00 57.18
90
80
70
RI: 1.66E7
100.74
60
50
40
99.52
73.62
30
49.45
43.57
35.12 41.34 46.11
39.88
20
10
9.94
7.83 9.41 11.60 17.74 20.91
10
20
59.12
30.04 34.31
30
40
50
60
68.27
74.57 81.99
67.72
87.91 91.79 94.45
67.07 73.14 75.10
71.45
96.34
75.83
70
Time (min)
80
90
101.33
100
102.37 109.68
110
116.54 120.27
120
125.28
130
Number
of proteins
51.98
Hemoglobins
after acetone
precipitation
Hemoglobins
after
chloroform
precipitation
Fig. 3 Removal of host hemoglobin from tick protein samples. (a) Representative protein distribution in
engorged tick samples. (b) Mass spectra comparing the MS/MS fragment peptides of two precipitation methods: acetone- (above) and chloroform-based method (below). The same profile is observed with a slight
increase in the intensity of the spectra using the acetone precipitation method. (c) Presence of hemoglobins in
the sample before and after treatment. Chloroform-methanol precipitation decreases the number of detected
hemoglobins in a total sample where hemoglobins represented 14 % of total of proteins identified compared
to 23 % of hemoglobins present after acetone precipitation. Additionally, the hemoglobins that remain in the
sample are identified with a lower number of peptides. This method is therefore very helpful in treating the
engorged tick samples, but it does not completely eliminate host hemoglobins
within an average of 20 % of the total number of identified proteins

(Fig. 3a) (see Note 9). We next describe the comparison of the
efficacy of two methods for removal of these hosts proteins from
tick samples: a method reported to remove hemoglobin from
blood samples [18] with minor modifications and a conventional
precipitation method with ice-cold acetone that was used as a
control:
1. Process two samples of 200 g each of a tick protein extract.
2. One sample is directly precipitated following a conventional
acetone precipitation method.
3. To the other sample, slowly add a mixture of methanol and
chloroform under homogenization to a final concentration of
19 % of methanol and 0.6 % chloroform. Keep the mixture at
4 C and homogenize for an additional 20 min to obtain
Tick Proteomics
523
Fig. 4 Identification of tick, host, and pathogen proteins in a single sample with a high level of confidence.
Protein extract of engorged ticks was obtained by total protein extraction method with buffer 4. (a) Database
search is performed against a database composed of Uniprot-Ruminantia.fasta, Uniprot-Ixodida.fasta, and
Uniprot-Alphaproteobacteria.fasta. Data is analyzed using the SEQUEST algorithm of Proteome Discoverer 1.3
software applying a 1 % FDR as criteria for assignations. (b) The application of de novo sequencing software
PEAKS Studio 6.0 significantly increases the number of identified proteins, primarily tick and pathogen proteins that are usually masked by host proteins in engorged ticks
hemoglobin elimination. Centrifuge the sample at 2,500 g

for 10 min at 4 C and discard the resulting hemoglobin containing precipitate.
4. Precipitate the resulting supernatant with acetone (see Note 10).
5. Both pellets resulting from the two methods may be dissolved
in Laemmli buffer, concentrated on conventional SDS-PAGE
gel and compared by LC-MS/MS analysis (Fig. 3b, c).
3.8 Pathogen
Identification
Proteomics is one of the most powerful technologies that allow

simultaneous detection of proteins originating from different
organisms in the same sample. Pathogen proteins present in ticks
can be successfully detected with a high level of confidence in the
same protein extract where tick and host proteins are identified if
the search is performed against a database containing pathogen
proteins built by combination of Ixodida and Alphaproteobacteria
UniProt databases (www.uniprot.org) (Fig. 4a).
3.9 De Novo
Sequencing and
Homology Analyses
PEAKS Studio v 6.0 software (Bioinformatics Solutions Inc.) permit protein identification by generating de novo peptide sequences,
which is especially useful when working with organisms such as
ticks with limited sequence information available. These analyses
may be done with the same general parameters as for the routinely
applied software Proteome Discoverer 1.3 (as described in
Subheading 3.6). Additionally, in PEAKS a special algorithm is
used to generate de novo sequences of the input spectrum, and the
SPIDER module is used to identify variations from sequences
using a homology match query. The filtering of the scores for all
identified peptides is done by assigning a 10lg P value of 30 that
524
was established after manual analyses of the obtained peptide

matches to assure quality of the identifications. The application of
PEAKS software using the above listed parameters gives 10 % to
20 % average increase in the number of detected proteins by applying homology search and generating de novo peptide sequences
(Fig. 4b). This approach enables the identification of every peptide
in the dataset, whether it is in a database or not, modified or
mutated.
3.10 Quantitative
Proteomics Analyses
Proteomics analyses are intended not only to obtain the identification of as many proteins as possible in a given sample but also to
allow focusing on the differences between several samples of interest, which is possible through the application of quantitative proteomics techniques. Quantitative proteomics approaches can be
divided into label-based or label-free methodologies depending
on the use or not of stable isotopic or isobaric labeling reagents to
mark the proteins or peptides under comparison before mass
spectrometry analysis. Additionally, gel-based and gel-free
approaches using multidimensional chromatography can be developed for quantitative proteomics analyses (a good review of these
quantitative methodologies can be found in [19]). The combination of more than one technique is the best way to obtain greater
proteome coverage and to identify a bigger number of differentially represented proteins between samples due to the complementarity of the quantitative approaches. The application of
quantitative proteomics to the characterization of the tickpathogen interface is still in its infancy [2], but its development is
crucial for the identification of proteins involved in pathogen
infection, multiplication, and transmission, as well as possible
antigens for vaccine development.
Notes
1. When working in field experiments such as epidemiology
studies or vaccine trials, collected ticks are generally stored in
ethanol and not deep-frozen because it is easier under field
conditions and makes their shipment from one lab to another
cheaper. Therefore, this work focused on optimizations on this
kind of samples.
2. Triton X-100 and Tween 20 detergents are diluted to a 10 %
stock solution to reduce their viscosity and facilitate pipetting.
SDS is also prepared in a 10 % stock solution in order to work
in a similar manner.
3. Removing the cuticle from a tick enables a better detection of
low-abundance tick proteins. Our previous studies showed
that processing the entire tick results in the detection of over
Tick Proteomics
525
50 % of abundant cuticle proteins masking other minority tick

proteins that might be a key for understanding ticks metabolical processes. The removal of the cuticle of completely
engorged ticks is relatively easy to perform. Care should be
taken to completely remove the tissues around the mouthparts. However, if not working with freshly collected ticks, differentiating tick tissues is very difficult due to a large presence
of coagulated host blood.
4. When using a urea-containing buffer such as buffer 4, the
obtained pellet containing the protein fraction is less abundant
than when using buffers 13 in which the solubility of the proteins is higher. However, it has to be taken into consideration
that the obtained pellet protein fraction cannot be processed
further since a dense and insoluble viscous pellet is formed,
probably due to the accumulation of nucleic acids or coagulation of abundant host blood proteins. However, the obtained
protein extracts in the soluble fraction remain stable through
time and do not show signs of degradation after long-term
storage. Samples of the soluble fraction, if very diluted, can be
successfully concentrated using columns for protein concentration. Millipore (Billerica, MA, USA) columns give a good
result, and four times concentration is accomplished by centrifuging a 1 ml sample for 10 min at 4,800 g.
5. Due to the impossibility of direct quantification of insoluble
pellet fraction, equal amount of micrograms of dried pellet is
measured, and the protein concentration is determined by
running the same amount of the sample on a one-dimensional
gel and comparing to an albumin standard. Pellet is very difficult to dissolve and needs to be left on a shaker for at least
30 min. It is best to store dry pellets at 20 C and directly
solubilize them in Laemmli buffer prior to the analysis.
6. The concentration of proteins in one single band is the only
gel-based approach that allows quantitative comparisons
between samples without using protein-labeling approaches
because all proteins from the samples under comparison are
located in the same band avoiding the gel-cutting effect [20].
7. The development of long gradients promotes peptide separation and increases the number of identified proteins. When a
HPLC working on microliters instead of nanoliters is used, it
is recommended to increase the duration of the gradient time.
8. In the case of using a mass spectrometer with scan speed and
mass resolution higher than LCQ Fleet (e.g., a LTQ), it is recommended to increase the numbers of dependent MS/MS
scans to 15 or more, allowing the detection of low-abundant
proteins.
526
9. Even in unfed ticks, host blood proteins can persist months

after feeding and molting. Vertebrate actins are found in Ixodes
ricinus nymphs and Rhipicephalus microplus larvae even weeks
after molting [14, 16, 17].
10. When precipitating with acetone, a special care needs to be
taken to allow it to evaporate from the obtained pellet before
further processing. Otherwise, the efficiency of protein detection after this method decreases significantly [21, 22].
Acknowledgments
We thank the CMBSO proteomics facility (Centro de Biologa
Molecular Severo Ochoa, Madrid, Spain) for technical assistance.
This research was supported by grants BFU2011-23896 and the
EU FP7 ANTIGONE project number 278976. M. Popara is an
early-stage researcher supported by the POSTICK ITN (postgraduate training network for capacity building to control ticks and
tick-borne diseases) within the FP7-PEOPLEITN program
(EU Grant No. 238511).
References
1. de la Fuente J, Estrada-Pea A, Venzal JM et al
(2008) Overview: Ticks as vectors of pathogens that cause disease in humans and animals.
Front Biosci 13:69386946
2. Villar M, Popara M, Bonzn-Kulichenko E
et al (2012) Characterization of the tickpathogen interface by quantitative proteomics.
Ticks Tick Borne Dis 3:154158
3. de la Fuente J, Kocan KM, Blouin EF et al
(2010) Functional genomics and evolution of
tick-Anaplasma interactions and vaccine development. Vet Parasitol 167:175186
4. Galindo RC, de la Fuente J (2012)
Transcriptomics Data integration reveals JakSTAT as a common pathway affected by pathogenic intracellular bacteria in natural reservoir
hosts. J Proteomics Bioinform 5:108115
5. de la Fuente J, Almazn C, Canales M et al
(2007) A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Anim Health Res Rev 8:
2328
6. de la Fuente J (2012) Vaccines for vector control: exciting possibilities for the future. Vet J
194:139140
7. Villar M, Torina A, Nuez Y et al (2010)
Application of highly sensitive saturation labeling to the analysis of differential protein
8.
9.
10.
11.
12.
13.
expression in infected ticks from limited

samples. Proteome Sci 8:43
Sebatjane SI, Pretorius A, Liebenberg J et al
(2010) In vitro and in vivo evaluation of five
low molecular weight proteins of Ehrlichia
ruminantium as potential vaccine components. Vet Immunol Immunopathol 137:
217225
Marcelino I, de Almeida AM, Ventosa M et al
(2012) Tick-borne diseases in cattle: applications of proteomics to develop new generation
vaccines. J Proteomics 75:42324250
Patramool S, Choumet V, Surasombatpattana
P et al (2012) Update on the proteomics of
major arthropod vectors of human and animal
pathogens. Proteomics 12:35103523
Rachinsky A, Guerrero FD, Scoles G et al
(2007) Differential protein expression in ovaries of uninfected and Babesia-infected southern cattle ticks, Rhipicephalus (Boophilus)
microplus. Insect Biochem Mol Biol 37:
12911308
Hill CA, Wikel SK (2005) The Ixodes scapularis genome project: an opportunity for
advancing tick research. Trends Parasitol 21:
151153
Meyer JM, Kurtti TJ, Van Zee JP, Hill CA
(2010) Genome organization of major tandem
Tick Proteomics
14.
15.
16.
17.
repeats in the hard tick, Ixodes scapularis.

Chromosome Res 18:357370
Villar M, Aylln N, Busby AT et al (2010)
Expression of heat shock and other stress
response proteins in ticks and cultured tick
cells in response to Anaplasma spp infection
and heat shock. Int J Proteomics 2010:657261
Untalan PM, Guerrero FD, Haines LR,
Pearson TW (2005) Proteome analysis of
abundantly expressed proteins from unfed larvae of the cattle tick, Boophilus microplus.
Insect Biochem Mol Biol 35:141151
Vennestrm J, Jensen PM (2007) Ixodes ricinus:
the potential of two-dimensional gel electrophoresis as a tool for studying host-vectorpathogen interactions. Exp Parasitol 115:
5358
Wickramasekara S, Bunikis J, Wysocki V,
Barbour AG (2008) Identification of residual
blood proteins in ticks by mass spectrometry
proteomics. Emerg Infect Dis 14:12731275
527
18. Tanaka K, Sawatani E, Shigueoka EM et al

(2001) Isolation of bovine plasma albumin by
liquid chromatography and its polymerization
for use in immunohematology. Braz J Med
Biol Res 34:977983
19. Megger DA, Bracht T, Meyer HE, Sitek B (2013)
Label-free quantification in clinical proteomics.
Biochim Biophys Acta 1834:15811590
20. Bonzon-Kulichenko E, Prez-Hernndez D,
Nez E et al. (2011) A robust method for
quantitative high-throughput analysis of proteomes by 18O labeling. Mol Cell Proteomics
10(1):M110.003335
21. Fic E, Kedracka-Krok S, Jankowska U et al
(2010) Comparison of protein precipitation
methods for various rat brain structures prior
to proteomic analysis. Electrophoresis
31:35733579
22. Simpson DM, Beynon RJ (2010) Acetone precipitation of proteins and the modification of
peptides. J Proteome Res 9:444450
INDEX
A
Accreditation ........................................................ 80, 81, 119
Accuracy .............................................................. 4, 8, 13, 20,
27, 28, 31, 40, 49, 50, 56, 58, 61, 62, 84, 86, 90,
91, 9597, 110, 134, 145, 147, 151, 165, 207, 237,
246, 257259, 270, 288, 295, 296, 298, 313, 357,
362, 369, 398, 429, 448, 459, 492
Actinobacillus
A. equuli subsp. haemolyticus ................................ 235, 242
A. pleuropneumoniae .................................... 235, 236, 242
A. seminis ....................................................................... 22
Aerial animals .......................................................................3
AFLP-PCR......................................................................292
African swine fever virus (ASFV) .................... 209217, 255
Agglutination test .................................................................4
Alkaline phosphatase .......................................... 24, 211, 215
Allantoic fluid.....................................................................71
Alternating electrical field ........................................ 236, 323
Amblyomma ....................................................................... 514
Amplified fragment length polymorphism .......................292
Analytical accuracy .............................................................96
Analytical sensitivity ....................................... 11, 9193, 261
Analytical specificity...........................................................93
Ancylostoma
A. caninum ....................440, 442, 443, 445, 446, 453455
A. duodenale ..........................................437, 439, 442, 446
Animal health ...................................................... 3, 7, 15, 35,
37, 55, 56, 78, 110, 126, 153, 193, 254, 279
Animal welfare ........................................3, 15, 254, 255, 486
Anthelmintics .................... 145, 422, 429, 437, 441, 442, 458
Anthrax .................................................................... 109, 361
Anthropic ...........................................................................28
Antibiotic ........................................................ 115, 195, 250,
299, 300, 425, 427, 429, 478, 482, 487
Antifading mounting media ............................. 226, 227, 231
Antimicrobial resistance ..........................4, 15, 301, 424, 427
Antimicrobial therapy......................................... 4, 7, 10, 256
Aptamers ..................................................................275276
Aquatic animals ................................................................258
Ascaris
A. suum ................................................................ 448, 452
Assay performance................................................. 12, 21, 24,
77, 8385, 87, 94, 99102, 104, 151, 274
Asymmetric PCR .............................................................133
Aujeszkys disease ................................................................. 6

Autofluorescence ...................................................... 222, 233
Avian chlamydiosis ................................................... 194, 195
Avian influenza...............................................3, 40, 113, 114,
117, 255256, 258, 261, 271
Avian mycoplasmosis........................................................194
Avibacterium paragallinarum ............................................. 235
B
Babesia
B. bigemina .......................................................... 475487
B. bovis ........................................................................ 475
Babesiosis ......................................................... 475, 480, 481
Bacillus anthracis .........................118, 298, 361371, 401411
Backward inner primer (BIP) .......................... 165, 170172,
176178, 180
Barbers pole worm ...........................................................439
Basic local alignment software tool (BLAST) ......... 449, 483,
487, 493, 496, 506, 508, 509
Beta-actin gene ...................................................................26
Biobanking ...................................................................4359
Biochip .............................................................................117
Biocontainment .......................................33, 3740, 365, 404
Biodiversity...................................................................15, 56
Biohazard ............................................................... 27, 36, 45
Bioinformatics ................................................23, 27, 56, 318,
420, 438, 448453, 457, 459461, 479, 491, 493,
496, 503507, 509, 517, 523
Biological resources .................................... 4446, 48, 5457
Biosafety ...................................................28, 3141, 72, 135,
260, 268, 269, 365, 383, 404
Biosecurity .................................................................. 38, 257
Biosensors....................................14, 256, 266268, 273, 274
Bioterrorism .....................................................................255
BLASTn .................................................. 449, 506, 508509
BLASTp...........................................................................449
BLASTx ........................................................... 449, 506, 509
Blocking solution.............................................. 211, 213, 217
Blood samples.............................. 6, 7, 50, 175181, 264, 522
Bluetongue .......................................... 3, 7, 25, 125131, 425
Borrelia burgdorferi ............................................................ 296
Bos
B. indicus ...................................................................... 175
B. taurus ....................................................................... 175
Methods in Molecular Biology, vol. 1247, DOI 10.1007/978-1-4939-2004-4, Springer Science+Business Media New York 2015
529
VETERINARY INFECTION BIOLOGY: MOLECULAR DIAGNOSTICS AND HIGH-THROUGHPUT STRATEGIES,

530 Index
Bovine mastitis ................................................. 323334, 429
Bovine tuberculosis (bTB) ........................ 109, 153, 155, 294
Bridge-PCR .....................................................................447
Brucella
B. abortus ..................................................................... 335
B. canis ......................................................................... 335
B. melitensis..................................... 21, 335, 339, 343, 344
B. neotomae .................................................................. 335
B. ovis .................................................................... 22, 335
B. suis ..................................................................... 22, 335
Brucellosis ........................................................................335
Bst DNA polymerase ................................114, 164, 167, 168,
177, 178, 181
Bubalus bubalis ................................................................... 175
C
Caenorhabditis elegans ........................................ 438, 451452
C6 amino linker.................................183184, 186, 187, 190
Campylobacter
C. coli ............................................297, 300, 311320, 424
C. fetus ......................................................................... 292
C. jejuni ........................ 291, 297, 300, 311320, 375, 427
Campylobacteriosis...........................................................311
Canonical SNPs (canSNPs) .................................... 362368,
401, 402, 404, 410, 411
Capillary electrophoresis.......................................... 292, 293,
335347, 363, 494, 495
Carbon nanotube (CNTs) ................................................ 275
Cas genes .................................................................. 373, 374
cDNA library cloning ....................................... 479, 482483
cDNA microarray technology ..........................................445
Cell cultures......................................................20, 26, 46, 48,
5051, 53, 194, 197, 204, 205, 251, 425, 482, 491
Chabertia ovina .................................................. 146, 148, 149
Chemiluminescence...................184, 186, 189191, 267, 376
Chlamydia
C. abortus ..............................................194, 195, 204, 297
C. avium .............................................................. 195, 204
C. gallinacea ......................................................... 195, 204
C. pecorum ............................................................ 195, 204
C. pneumoniae .............................................. 194, 195, 204
C. psittaci .............................................194, 195, 202, 204,
206, 291, 296, 297, 391393, 395399
C. suis................................................................... 195, 204
C. trachomatis.................... 5, 194, 195, 204, 392, 394398
Chlamydiaceae ................................. 46, 51, 194, 204, 206, 391
Chlamydophila ........................................... 194, 203204, 206
Classical diagnostic methods ................................ 8, 111, 426
Classical swine fever ............................ 25, 114, 255, 258, 425
Clinical accuracy ..................................................... 49, 96, 97
Clonorchis sinensis............................................................... 448
Clostridium difficile ........................................................ 5, 114
Clustered regularly interspaced short
palindromic repeats (CRISPR) ............... 373388
Colony collapse disorder (CCD) .............................. 426, 493

Complementary DNA (cDNA) .................................. 24, 25,
205, 402, 410, 444, 445, 447449, 477,
479483, 485, 487, 496, 501, 506, 507
Connector inversion probe (CIPer) .................................. 116
Contagious agalactia .........................................................194
Contagious bovine pleuropneumonia (CBPP) .................193
Contagious caprine pleuropneumonia (CCPP) ........193194
Contigs ..............................................448, 449, 493, 506, 508
Coproscopic examination .................................................151
Coxiella burnetii ................................................... 22, 293, 298
CRISPR spacers ...............................................................375
Cross agglutinin absorption test (CAAT) ........................350
Cross contamination...............................8, 25, 112, 131, 141,
264, 357, 387
Cryopreservation .....................................44, 50, 58, 313, 481
Cryptosporidium parvum .................................................... 422
Culling..............................................................................257
Cyprinid herpesvirus-3 (CyHV-3) ........................... 165, 166
D
Data recording ........................................................ 45, 46, 58
de Bruijn graph......................................................... 448, 449
Deparaffinization.............................................. 225229, 232
Dephasing ........................................................................420
Dermacentor ....................................................................... 514
Diagnosis ........................................ 4, 19, 31, 44, 61, 77, 110,
125, 134, 145, 153, 163, 176, 184, 193, 209, 236,
245, 254, 298, 335, 350, 362, 393, 402, 416, 438
sensitivity ..................................................... 8, 12, 15, 26,
90, 9394, 110, 151, 268, 275
specificity ................................................8, 12, 15, 26, 90,
9394, 110, 151, 275
4,6-Diamidino-2-phenylindole (DAPI) ......... 226, 231, 232
Dice coefficient......................................................... 331, 332
Digoxigenin ......................................................................210
Direct repeats (DRs) .........................295, 374376, 383, 387
Direct variable repeat polymerase
chain reaction (DVR-PCR) ............................375
DNA arrays ................................................ 25, 115116, 196
DNA Data Bank of Japan (DDBJ) ..................................450
Domestic animals ................ 15, 109, 133, 255, 426, 513, 514
DR region......................................................... 374376, 383
Dual-labeled probe ........................................... 113, 133142
Dual priming oligonucleotide system (DPO) .......... 140, 402
E
Echinococcus multilocularis .................................................. 456
Eimeria .............................................................................. 422
Electrophoresis .................................................14, 22, 24, 39,
112, 118, 125, 141, 156, 158, 177179, 181, 188,
194, 199, 202, 206, 288, 291293, 312, 314319,
326, 336, 339, 345, 347, 354, 355, 357, 363, 381,
383, 394397, 481, 482, 487, 507, 514, 517, 518

531
Index
ELISA .................................................................... 4, 35, 117
Emulsion PCR (emPCR).................................................447
Endonuclease................................................... 291, 292, 313,
317318, 323, 332, 350
Enzootic abortion of ewes ........................................ 194, 195
Eosin ....................................................................................4
Epidemiology .................................................... 4, 13, 15, 20,
23, 26, 28, 29, 45, 5557, 110, 125, 146, 151, 183,
195, 257, 259, 261, 263, 288, 291, 293, 295301,
311, 312, 323, 324, 336, 347, 350, 375, 416, 419,
421429, 524
Epizootic .................................................................. 250, 425
Eradication ................................................15, 26, 35, 78, 120
Escherichia coli (E. coli) ..................................... 150, 196, 239,
293, 296, 299, 300, 424, 429, 451, 482, 487
Ethidium bromide ............................................. 39, 112, 158,
177, 178, 181, 199, 314, 318319, 326, 331, 354,
355, 392, 395, 496
European Molecular Biology
Laboratory (EMBL) ............................... 229, 450
Expressed sequence tags (EST) ................................ 444, 445
Extended MLST (eMLST) .............................................299
External control .......................................................... 91, 396
External quality assessment (EQA) .......... 80, 81, 8384, 101
F
False negative .................................................. 1113, 20, 25,
26, 72, 90, 91, 98, 101, 154, 161, 250, 259, 262
False positive ................................................8, 24, 25, 72, 90,
98, 101, 112, 130, 164, 250, 258, 259, 265
Farm .......................14, 27, 145, 256, 257, 324, 332, 424, 426
Farmed animals ................... 3, 51, 56, 61, 235, 254, 255, 324
Fasciola
F. gigantica ................................................................... 448
F. hepatica .................................................................... 448
Fast Green solution .................................................. 211, 213
Fecal flotation ...................................................................147
Feces samples....................................................................399
Feline immunodeficiency virus (FIV)...........................11, 12
Field tests ......................................................... 256, 260, 264
Fish infectious diseases .....................................................163
Fit-for-purpose...................................................... 13, 22, 77,
78, 80, 84, 85, 90, 99, 100, 104
Fixation of tissue ......................................................225228
flaA-RFLP.........................................312, 313, 315, 317318
Flagellin genes ..................................................................291
Flotation of nematode eggs ...................................... 147, 149
Fluorescein isothiocyanate (FITC).................. 167, 170172,
231, 232
Fluorescence in situ hybridization (FISH) ................ 25, 115,
219, 222, 223, 225, 228, 229, 232
Fluorescence resonance energy transfer (FRET) ..............276
Fluorescent detection reagent (FDR) ............... 165, 167169
Fluorescent reporter .........................................................126
Food security ........................................................................ 3

Foot and mouth disease (FMD) .....................3, 7, 14, 23, 25,
27, 62, 109, 114, 255257, 259, 265, 266, 424,
429
Forward inner primer (FIP) .................................... 165, 167,
170172, 176178, 180
FTA card ...................................................... 63, 64, 6673
G
Gel-based PCR ........................................................ 112, 113
GenBank ......................................................... 229, 248, 358,
392, 450, 459, 506
Genomics .............................................23, 56, 263, 278, 288,
296, 416, 421, 427, 429, 444, 450, 452455,
475487, 514
partitioning ......................................................... 115, 116
wide typing .........................................................298301
Genomotyping ......................................................... 298, 299
Gold nanoparticles (AuNPs) ............................ 245251, 273
Gold standard ...................................................12, 20, 25, 26,
8788, 90, 94, 96, 134, 292293, 312
Good laboratory practices (GLPs) ................. 25, 47, 58, 210
H
Haemonchosis ..................................................................439
Haemonchus
H. contortus ..................................................146, 149, 151,
439, 440, 442445, 452454, 456, 458460
Hazard identification and assessment...........................3234
Hazard prevention and control .....................................3234
Helicase-dependent amplification ....................................114
HelmDB...........................................................................451
Hematoxylin .........................................................................4
Herd ............................................................ 74, 78, 257259,
266, 291, 324, 419, 423, 424
Highly pathogenic avian influenza (HPAI) ......................261
High resolution melting (HRM) ...................... 194, 361371
High throughput sequencing (HTS) ................. 27, 288, 299,
417, 446448, 450, 452454, 458, 461, 491493,
496, 502504, 507
Histophilus somni ......................................................... 22, 242
Hookworm ................................437441, 443, 446, 453, 455
Hot-start Taq DNA polymerase....................... 369, 404, 408
Housekeeping gene ........................................... 26, 238, 288,
296298, 312, 356, 359, 480
Humic acids.............................................................. 151, 271
Hybridization buffer .................................178, 199, 202, 210,
213, 226, 227, 230233, 248, 249, 395, 397, 404
Hybridoma ...................................................................46, 52
Hydrolysis probes .............................................................126
I
Immunofluorescence ....................................................4, 111
Immunomagnetic separation (IMS) .........................153161

532 Index
IMS-culture...................................................... 156, 157, 159
IMS-PCR ........................................................ 155, 156, 158
Infectious pancreatic necrosis virus (IPNV) .....................165
Inhibitors .............................................. 11, 21, 26, 73, 74, 87,
90, 91, 112, 117, 131, 139, 141, 149, 151, 176,
271, 275, 363, 369, 404, 428, 453458, 460, 461,
495, 507, 515
In situ hybridization (ISH) ....................... 209217, 222, 225
Integrative omics ...................................................... 421, 427
Intermediate precision ........................................................95
Internal control ...........................................26, 40, 74, 82, 91,
200204, 206, 265
Internal quality assessment (IQA) ................................8184
Internal quality control (IQC) ......................................8084
International standard ................. 12, 80, 93, 94, 99, 120, 312
Intervention ............................................... 27, 349350, 426,
429, 437461, 476
In-the-field use .................................................... 28, 45, 125,
256, 259261, 270
In vitro diagnostics market ....................................... 5, 77, 98
IS6110, 134, 137142, 155, 158, 159,
291, 295, 374376
IS6110-like .......................................................................141
Isothermal amplification..............27, 111, 114115, 175181
Ixodes scapularis .................................................................. 514
K
k-mers...............................................................................449
L
Lab-on-a-chip (LOC)................................ 14, 117, 270272
Large sequence polymorphisms (LSPs)..............................23
Lateral flow strips ....................................... 14, 167, 170, 172
Leptospira
L. alexanderi ........................................................ 351, 356
L. biflexa ...................................................................... 349
L. borgpetersenii ........................................... 351, 356358
L. interrogans ....................................... 349, 351, 356359
L. noguchii............................................................ 351, 356
L. santarosai ......................................................... 351, 356
L. weilii ....................................................... 351, 356, 358
Leptospirosis ....................................................................349
Levey Jennings charts .........................................................82
LightUp probes ................................................................113
Limit of detection (LOD) ...............82, 9193, 118, 275, 410
Linearity ..........................................82, 94, 95, 276, 370, 447
Liner-after-the-exponential
PCR (LATE-PCR) ................................ 113, 265
Liposome ..........................................................................275
Listeria monocytogenes ........................................................ 293
Livestock ..................................................5, 25, 56, 134, 139,
145, 183, 254261, 279, 335, 361, 416, 421, 427,
429, 437, 439, 442
Loading buffer.......................................................... 326, 330
Loop-mediated isothermal
amplification (LAMP)....................7, 14, 27, 111,
114, 163172, 176181, 265, 266, 271
Loop primers .....................................114, 164, 165, 170172
Louping ill virus ...............................................................425
Low melting temperature agarose ............................ 326, 328
LSPs. See Large sequence polymorphisms (LSPs)
Luminex array .................................................. 185, 401411
LUX primers ....................................................................113
Lysozyme ................................................................. 232, 325
M
Macroarray ............................................................... 115, 184
Magnetic beads................................................ 118, 154, 155,
159, 274, 275, 277, 278, 409
Magnetic nanobeads .........................................................274
Magnetic particles ............................................ 274, 275, 278
MALDI-TOF MS ...................................................235243
Management ..............................................15, 3234, 36, 37,
4359, 80, 81, 85, 86, 97, 101, 256, 260, 265, 268,
301, 324, 336, 415429, 450, 459, 496
Mannheimia haemolytica .................................................... 235
Manual grinder .............................................................64, 69
Mareks disease .................................................................428
Massive parallel sequencing ......................................417421
Mass spectrometry (MS) ..........................235243, 274, 429,
514, 516, 521525
Mastitis..................................................6, 194, 323334, 429
Matrix-assisted laser desorption/ionization
time-of-flight (MALDI-TOF)...............235243
Measurement range ......................................................89, 95
Mechanical grinder..................................... 6465, 69, 72, 73
Melt curve analysis ........................................... 363, 366367
Melting temperature (Tm)............................... 113, 126, 148,
180, 181, 206, 232, 236, 357, 362, 365, 367, 368,
370, 371, 394, 404
Melt profile .......................................362, 365, 367, 369371
Metabolomics ...................................................................444
Metagenomics ........................................8, 23, 420, 425427,
429, 446, 491510
Metaviromics ....................................................................491
Microarrays...............................................7, 25, 52, 115116,
193207, 263, 268, 269, 273, 289, 290, 295299,
391399, 402, 445, 446, 452, 477
Microbiome ...................................................... 426, 427, 429
Microfluidics ............................................... 10, 14, 117118,
268272, 276, 279, 299
microRNA (miRNA) ....................................... 263, 427, 428
MIQE ........................................................................ 87, 102
Mismatch amplification
mutation assays (MAMA) ..............................363
Molecular beacons (MBs)................................. 113, 276278
Molecular epidemiology .................................... 23, 297, 312,
324, 375, 416, 424, 425, 429

533
Index
Molecular inversion probe (MIP) .....................................116
Mollicutes ............................................193, 196, 203, 205207
Multilocus variable-number tandem repeat
analysis (MLVA) .............................. 22, 289, 290,
293, 294, 298, 335347, 362
Multilocus sequence typing (MLST) .................. 8, 196, 289,
290, 296301, 312, 349359
Multiplex oligonucleotide ligation
PCR (MOL-PCR) .................................402404
Multiplex PCR .................................268, 289, 319, 335347,
394, 396
Multiplex real time PCR ..........................................133142
Mycobacterial interspersed
repetitive units (MIRU) ......................... 288, 290,
293295, 378379
Mycobacterial interspersed repetitive unit-variable number
tandem repeat (MIRU-VNTR) .....................288,
290, 293295, 378379
Mycobacterium
M. africanum ........................................133, 139, 295, 378
M. avium ...................................... 278, 290, 291, 293, 295
M. bovis .....................................................7, 21, 133, 135,
139, 141, 142, 153161, 197, 201, 203, 291, 294,
375, 376, 378, 381, 383, 424
M. caprae......................................................133, 139, 141,
142, 290, 291, 294, 295, 378, 379
M. microti .............................................133, 139, 294, 295
M. pinnipedii ........................................133, 139, 294, 295
M. smegmatis ............................................................... 141
M. tuberculosis .............................................. 7, 11, 23, 114,
133142, 160, 264, 278, 290, 291, 295, 300,
373388
Mycoplasma
M. agalactiae ................................................ 194, 197, 203
M. bovis ............................................... 194, 278, 290292
M. capricolum subsp. capripneumoniae ................. 194, 197
M. conjunctivae .................................................... 194, 197
M. gallisepticum ........................................... 194, 197, 203
M. hyopneumoniae ........................................ 194, 197, 221
M. hyorhinis ................................................. 194, 197, 221
M. mycoides subsp. mycoides ..................193, 197, 290, 425
M. ovipneumoniae ................................................ 194, 197
M. suis.................................................................. 194, 197
M. synoviae .......................................................... 194, 197
Mycoplasmoses .................................................................193
N
Nanoarrays........................................................................263
Nanobiotechnology ..........................................................273
Nanomagnetic beads ........................................................274
Nanomagnets....................................................................274
Nanomaterials .................................................. 118, 119, 273
Nanoscale sensors ............................................. 118, 119, 245
Nanospheres .....................................................................274
Nanotechnology ................................. 14, 117119, 253279

NBT/BCIP solution......................................... 211, 213, 217
Necator americanus ..................................... 437, 439, 442, 443,
446, 448, 452453, 459
Negative diagnostic likelihood ratio ...................................90
Negative predictive value (NPV) ..................................12, 90
Nematodes............................................... 145151, 437443,
445, 446, 450458, 460
Neospora caninum ................................................................. 22
Nested PCR .................................................21, 24, 112, 113,
133142, 482, 486487
Newcastle disease ............................................. 113114, 255
Next generation sequencing (NGS) .............................. 8, 40,
415429, 446, 461
NGS platforms ..................................416, 417, 420, 421, 446
Normal range......................................................................96
Notifiable animal diseases..................................... 7, 110, 193
Nucleic acid lateral flow assay...........................................165
Nucleic acid sequence-based
amplification (NASBA) ................ 7, 27, 118, 264
O
Oesophagostomum
O. dentatum ..................................440, 445, 452455, 458
O. venulosum ........................................................ 146, 149
OIE listed diseases ......................................... 8, 19, 110, 193
ompA gene .................................291, 296, 391395, 398, 399
Open reading frames (ORFs) ...........................................449
Opisthorchis viverrini ......................................................... 448
Optofluidic devices ...........................................................267
Orientobilharzia turkestanicum........................................... 428
Ornithosis.........................................................................195
Ostertagia ................................................................... 437, 444
Overlap-layout-consensus ................................................448
Ovine chlamydiosis ..........................................................195
P
Padlock probe (PLP) ........................................ 115, 116, 120
Pandemic H5N1 avian influenza ......................................258
Paraffin-embedded tissues .....................4, 213, 226228, 232
Parasitic nematodes ...................437452, 455, 456, 458461
Pasteurellaceae ............................................................ 235243
Pasteurella multocida................................................... 235, 242
PCR. See Polymerase chain reaction (PCR)
PDB. See Protein Data Bank (PDB)
Pen side testing ...................................................................27
Peptide binders .................................................................154
Peptide nucleic acid (PNA) ...................................... 224, 276
PFGE. See Pulsed-field gel electrophoresis (PFGE)
Photodiode detectors ........................................................267
Piroplasm.................................................. 175, 180, 183191
Piroplasmosis ....................................................................183
PLA. See Proximity ligation assay (PLA)
Plexor primers ..................................................................113

534 Index
Point-of-care (POC) .......................... 27, 256262, 266272
Point-of-decision ......................................................253279
Polymerase chain reaction (PCR) .................................. 5, 19,
35, 48, 61, 81, 111, 125, 134, 146, 155, 164, 176,
183, 194, 242, 248, 260, 288, 313, 336, 350, 362,
374, 392, 402, 416, 445, 477, 492
Polynucleotide probes .......................................................224
Porcine reproductive and
respiratory syndrome virus ...................... 425, 428
Portable devices ................................................ 256, 260, 269
Positive diagnostic likelihood ratio .....................................90
Positive predictive value (PPV) ....................................12, 90
Post transcriptional gene silencing....................................477
Post weaning multisystemic wasting syndrome ................426
Precision ....................................81, 84, 9596, 262263, 362
Primer walking ......................................................... 507, 509
Project leader .......................................................... 8587, 99
Project manager ............................................................85, 99
Proteinase K .................................................... 210, 216, 313,
315, 325, 328330, 494, 496
Protein data bank (PDB) ..................................................450
Protein fractionation.........................................................519
Proteome in-gel digestion ........................................519521
Proteomics ........................................................... 50, 56, 278,
429, 444, 461, 513526
Proximity ligation assay (PLA)......................... 115117, 120
Psittacosis ................................................................. 195, 391
Public health................................................. 3, 15, 31, 34, 36,
56, 59, 110, 254, 258, 279, 335, 349
Pulsed-field gel electrophoresis (PFGE) ........... 22, 292293,
299, 312, 323334, 350
PulseNet database..................................................... 293, 312
Pyrophosphate sequencing reaction ..................................447
Pyrosequencing.................................................................417
Q
Quality assurance (QA) ............ 26, 40, 47, 48, 57, 58, 7273,
77104, 261, 369
Quality control (QC)........................................12, 20, 25, 40,
4548, 51, 58, 74, 77, 7984, 98, 99, 101, 261,
379, 427, 493, 506, 508
Quality management system (QMS)...................... 4551, 81
Quantification of target sequences (qPCR) ................ 25, 198
Quantitative assay .........................................................81, 94
Quantitative proteomics analyses ............................. 517, 524
Quantum dots (QDs) ....................................... 119, 273, 274
Quartz crystal microbalance (QCM)................................266
Quasispecies .............................................................420425
Quencher ...........................................113, 126, 127, 136, 276
R
Rabies ................................................................. 93, 109, 428
Random amplified polymorphic
DNA (RAPD) ................................ 288292, 301
Rapid tests ................................................................ 117, 256

Real time PCR (rPCR) ..................................5, 7, 13, 21, 24,
40, 48, 5153, 9697, 112114, 125129, 131,
133142, 145151, 176178, 180, 200, 201, 242,
260, 266, 296, 365366, 370, 392, 477, 483
Real time reverse transcription
PCR (rRT-PCR) .............................. 25, 125131
Reference interval .........................................................9697
Reference laboratory .....................................14, 93, 256, 257,
259261, 387
Reference limits ..................................................................96
Reference range ..................................................................96
Regions of difference (RD) ........................................ 23, 134
Repeatability ................................................. 9596, 296, 299
Reproducibility .................................................49, 51, 74, 81,
90, 9596, 261, 291293, 312, 313, 320, 350, 402
Resistome .........................................................................300
Restriction enzyme .......................................... 181, 210, 212,
214, 215, 291, 296, 299, 313, 315, 318, 320, 326,
333, 350, 392, 482, 495, 502
Restriction fragment length
polymorphism (RFLP) ...................... 22, 51, 288,
291292, 295, 296, 311320, 391394, 398
Reverse hybridization ............................................. 7, 24, 376
Reverse line blotting (RLB) .................................... 176, 179,
183191, 375376
Reverse phase-liquid
chromatography (RP-LC) ...................... 517, 521
Reverse transcriptase PCR ................................... 6, 125131
Reverse transcription loop-mediated isothermal
amplification (RT-LAMP) ............. 114, 164, 168
Reverse transcription
PCR (RT-PCR) .................................. 22, 24, 25,
115, 117, 127, 128, 130, 263, 265, 271, 274, 480,
483486
Reverse transcription-qPCR (RT-qPCR) ..........................25
Review team .................................................................8486
Rhipicephalus annulatus ......................476481, 483, 484, 486
Ribotyping........................................................ 291, 295296
Rift Valley fever ................................................................255
Rinderpest ........................................................................255
Risk assessment ....................... 3337, 39, 41, 87, 88, 98, 101
RLB hybridization ................................... 184, 185, 188189
RNA interference (RNAi) ........................451, 460, 477, 478,
480, 481, 484487
RNA sequences (RNA-Seq).................................... 209, 219,
237, 422, 425, 428, 477
Robustness..................................................96, 112, 205, 263,
264, 275, 363, 370
Rolling circle amplification...............................................114
Roundworms ............................................................ 145, 437
rPCR. See Real time PCR (rPCR)
rRT-PCR. See Real time reverse transcription PCR
(rRT-PCR)

535
Index
S
Salmonella
S. enterica .............................. 196, 290, 293, 297, 311, 427
Sample census...............................................................4546
Sampling bias ...................................................................419
Schistosoma
S. haematobium ............................................................ 448
S. mansoni .................................................................... 456
Schmallenberg virus................................................ 8, 23, 427
Scorpion primers ..............................................................113
SDS-PAGE .............................................. 515516, 518, 523
Sensitivity .........................................................6, 8, 9, 11, 12,
15, 21, 22, 24, 26, 51, 53, 74, 79, 81, 8694, 96,
97, 99, 110112, 115, 117, 118, 134, 139, 151,
159, 163, 164, 172, 175, 181, 191, 206, 216, 257,
261, 264268, 271279, 292, 362, 367, 369, 371,
392, 394, 404, 419, 493, 498
Sequence annotation ........................................................459
Sequence assembly.................................... 420, 448, 449, 459
Sequence-independent
single-primer amplification (SISPA) .............492,
494496, 499502, 507
Sequence read archive (SRA) ................................... 421, 450
Sequence type (ST) ........... 296, 297, 300, 351, 356, 358, 359
Serial analysis of gene expression (SAGE) .......................444
Severe acute respiratory syndrome (SARS) ............. 114, 255,
265, 272
Shared type (ST) ...............................296, 358, 359, 378, 379
Shelf-life .......................................................................97, 98
Shewhart charts ..................................................................82
Short sequence repeats (SSR) typing....................... 294295,
299, 449, 492, 503
Sialome .............................................................................476
Signal-to-noise ratio (S/N) .............................. 273275, 408
Signal transduction ................................... 119, 266268, 428
Single locus sequence typing ....................................295296
Single molecule sequencing ..............................................418
Single nucleotide polymorphism (SNPs) .................. 23, 196,
289, 290, 300, 361371, 401, 402, 404407, 410,
411, 447, 448, 451, 458
Singleton ..........................................................................449
SISPA. See Sequence-independent single-primer
amplification (SISPA)
Slaughter ...............................................10, 14, 153, 257, 260
Small interfering RNAs (siRNAs) ...................................477
Southern hybridization ............................................. 291, 295
Spacer oligonucleotide typing................................... 295, 375
Specificity ...................................................6, 8, 9, 12, 15, 24,
26, 49, 51, 79, 8890, 9394, 97, 99, 110114,
117, 134, 149, 151, 163, 164, 171, 175, 176, 181,
205, 206, 210, 229, 232, 236, 248, 250, 261, 275,
294, 296, 350, 362, 369, 370, 392, 394, 398, 402,
410, 486
Spoligotype bovis (SB) ............................. 121, 378, 379, 509
Spoligotyping ...............................................7, 159, 290, 295,

374376, 378, 379
Spring viraemia of carp virus (SVCV)......................247250
SRA. See Sequence read archive (SRA)
Standard deviation (SD) ................................... 82, 84, 9496
Standard operating procedures (SOP) ..................... 9, 46, 47,
81, 85, 97100
STARD initiative ...............................................................87
Strand displacement activity ..................................... 114, 164
Streptococcus
S. agalactiae .................................................................. 324
S. dysgalactiae subsp. dysgalactiae ......................... 324, 332
S. pyogenes .................................................................... 375
S. uberis ........................................................................ 324
Strongylid nematodes ...................................... 146, 148, 151,
441, 445, 453456, 460
Subtractive suppression
hybridization (SSH) .............................. 445, 446,
476, 477, 479484, 487
Surface plasmon resonance ............................... 246, 254, 267
Surveillance .................................................... 3, 9, 19, 21, 27,
28, 35, 40, 61, 62, 87, 101103, 151, 256260,
301, 424
Suspension microarray ......................................................402
SWISS-PROT database .......................................... 450, 459
SWOT analysis .............................................................. 814
SYBR green ....................................................... 24, 113, 165,
167170, 181, 198, 480, 483, 485, 509
Synchronicity....................................................................420
Systems biology ................................................ 421, 427, 444
SYTO-9 ................................................................... 146, 149
T
Taenia ................................................................................ 422
Tams1-encoding gene .......................................................176
TaqMan .............................................................113, 126, 134,
135, 137, 138, 140, 363
Taq polymerase .................. 126, 130, 185, 186, 190, 198, 408
Teladorsagia circumcincta ............................................ 146, 445
Telemedicine ............................................................ 260, 267
Terrestrial animals ............................................................258
Texas red........................................................... 136, 231, 232
Theileria
T. annulata ............................................... 7, 175181, 187
T. lestoquardi ........................................................ 180, 187
T. parva ....................................................................... 180
T. taurotragi ................................................................. 180
Theileriosis .......................................................................175
Threshold cycle (Ct) ............ 25, 126, 129131, 146, 206, 369
Tick-borne disease ...........................................................476
Time-of-flight (TOF) mass spectra .................................236
Tissue samples ....................................................... 5253, 62,
6973, 134, 135, 137138, 141, 153, 160, 198,
220, 224, 225, 227, 233, 391399

536 Index
Tissue scrapings...................................................... 62, 7071
Touch-down PCR ............................................ 155, 158, 160
Toxome .............................................................................300
Trade ................................................ 3, 15, 19, 28, 35, 5758,
78, 109, 153, 254, 258
Transboundary animal diseases.........................................109
Transcription-mediated amplification (TMA) .................114
Transcriptomics ............................................... 298, 416, 422,
427429, 438, 444455, 458461, 476, 477, 514
Trichina ............................................................................452
Trichinella spiralis .............................................................. 452
Trichostrongylosis ............................................................439
Trichostrongylus
T. colubriformis ......................................148, 439, 453, 454
Trichuris trichiura .............................................................. 437
Tropical theileriosis ..........................................................175
Tuberculosis (TB) .................................................... 7, 11, 23,
109, 114, 133142, 153, 160, 264, 278, 288, 290,
291, 293295, 300, 373388
Turkey viral hepatitis ........................................................426
Two-base-calling ..............................................................448
Variable number tandem repeat (VNTR)........................293,

301, 336, 343345, 347
Viral hemorrhagic septicaemia virus (VHS)....................165,
166, 250
Viral load .............................................................. 7, 112, 271
Viral metagenome ............................................ 425426, 491
Virulome ..........................................................................300
Virus-encoded microRNA (vmiRNA) .............................428
VNTR/MLVA ................................. 293295, 298, 335347
UniGene ...........................................................................450
Unweighted pair group method using arithmetic
averages (UPGMA) ........................ 331, 332, 347
Uracil-DNA glycosylase (UNG) ......................................369
Urine samples ........................................................... 4, 48, 74
Usutu virus .......................................................................425
xMAP technology ............................................ 185, 401411
Zoonotic diseases..................................... 3, 5, 29, 34, 40, 349
Validation ...................................................12, 21, 26, 40, 51,

74, 77104, 119, 120, 196, 203, 260, 261, 263,
299, 418, 451, 460, 477, 480
W
Westgard rules ..............................................................82, 94
West Nile virus (WNV) ........................................... 255, 425
Whipworm .......................................................................437
Whole genome sequencing (WGS) .......................... 23, 264,
298, 300, 301, 416, 424
Wild animals ....................................................... 3, 133, 254,
255, 426, 514
World Organisation for
Animal Health ................. 7, 37, 78, 110, 126, 193
WormBase ........................................................ 450, 451, 460
Y
Yersinia pestis ............................................................. 374375

(Mónica V. Cunha, João Inácio) Veterinary Infec PDF

Uploaded by

Copyright:

Available Formats

(Mónica V. Cunha, João Inácio) Veterinary Infec PDF

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

(Mónica V. Cunha, João Inácio) Veterinary Infec PDF

Uploaded by

Copyright:

Available Formats

What is the book about?

What is the book about?

What are some of the major animal diseases discussed?

What are some of the major animal diseases discussed?

Methods in

Molecular Biology 1247

For further volumes:

Veterinary Infection Biology:

Centro de Biologia Ambiental

School of Pharmacy and Biomolecular Sciences

INTRODUCING NUCLEIC ACID TESTING

1 Overview and Challenges of Molecular Technologies in the Veterinary

MOLECULAR DETECTION AND IDENTIFICATION OF ANIMAL

7 Molecular Approaches to Recognize Relevant and Emerging Infectious

10 A Real-Time PCR Assay for the Diagnosis of Gastrointestinal Nematode

MOLECULAR PROFILING OF VETERINARY RELEVANT

21 Molecular Typing Tools: From Pattern Recognition to Genome-Based

24 Multiple-Locus Variable-Number Tandem Repeat (VNTR)

INTEGRATIVE OMICS AND HIGH-THROUGHPUT PLATFORMS

30 Next-Generation Sequencing in Veterinary Medicine: How Can the Massive

LLIA CHAMBEL Centro de Biodiversidade, Genmica Integrativa e Funcional,

Public Health (BVF), Swedish University of Agricultural Sciences (SLU),

SIMON THIERRY Bacterial Zoonosis Unit, Animal Health Laboratory, University

Mnica V. Cunha and Joo Incio

diseases require a rapid and accurate detection of the etiological

Challenges of Molecular Technologies in Veterinary Diagnosis

Molecular Diagnostics Market

Brief Overview of Molecular Technologies in the Veterinary Microbiology

Mnica V. Cunha and Joo Incio

genotype the microorganisms following their culture and isolation

Challenges of Molecular Technologies in Veterinary Diagnosis

greatly contributed to the accumulation and popularity of molecular

Mnica V. Cunha and Joo Incio

of associated costs. The sequencing of certain genes or other

SWOT Analysis of Molecular Diagnostics Technologies

Overall higher analytical and diagnostic

Higher costs for establishing a molecular biology

Mnica V. Cunha and Joo Incio

molecular diagnostics is one of the highest

Pressure to keep a low cost per analysis in the

clinical laboratories. With the currently available technology, it is

Challenges of Molecular Technologies in Veterinary Diagnosis

may generate substantial savings, making these technologies more

Mnica V. Cunha and Joo Incio

implementation of molecular diagnostics methods varies greatly

Challenges of Molecular Technologies in Veterinary Diagnosis

between colonization and active infection. Veterinary doctors and

Mnica V. Cunha and Joo Incio

Challenges of Molecular Technologies in Veterinary Diagnosis

change, among others, have cumulatively and irreversibly affected

Mnica V. Cunha and Joo Incio

13. Heid CA, Stevens J, Livak KJ et al (1996)

Challenges of Molecular Technologies in Veterinary Diagnosis

susceptibility of Egyptian mongoose to Feline

result and accuracy; however, laboratories also face several challenges

Basic Approaches in the Laboratory

Significance and Integration of Molecular Diagnostics in the Framework

(which can mean saving up to several months) and the possibility

of designing own primers allows to focus diagnosis on local needs