Logical and Relational Learning PDF
Logical and Relational Learning PDF
Cognitive Technologies
H. Prendinger, M. Ishizuka (Eds.)
Life-Like Characters
Tools, Affective Functions, and Applications
IX, 477 pages. 2004
H. Helbig
Knowledge Representation and the Semantics of Natural Language
XVIII, 646 pages. 2006
P.M. Nugues
An Introduction to Language Processing with Perl and Prolog
An Outline of Theories, Implementation, and Application with Special Consideration
of English, French, and German
XX, 513 pages. 2006
W. Wahlster (Ed.)
SmartKom: Foundations of Multimodal Dialogue Systems
XVIII, 644 pages. 2006
B. Goertzel, C. Pennachin (Eds.)
Artificial General Intelligence
XVI, 509 pages. 2007
O. Stock, M. Zancanaro (Eds.)
PEACH Intelligent Interfaces for Museum Visits
XVIII, 316 pages. 2007
V. Torra, Y. Narukawa
Modeling Decisions: Information Fusion and Aggregation Operators
XIV, 284 pages. 2007
P. Manoonpong
Neural Preprocessing and Control of Reactive Walking Machines
Towards Versatile Artificial PerceptionAction Systems
XVI, 185 pages. 2007
S. Patnaik
Robot Cognition and Navigation
An Experiment with Mobile Robots
XVI, 290 pages. 2007
M. Cord, P. Cunningham (Eds.)
Machine Learning Techniques for Multimedia
Case Studies on Organization and Retrieval
XVI, 290 pages. 2008
L. De Raedt
Logical and Relational Learning
XVI, 388 pages. 2008
Cognitive Technologies
Managing Editors: D. M. Gabbay J. Siekmann
Editorial Board: A. Bundy J. G. Carbonell
M. Pinkal H. Uszkoreit M. Veloso W. Wahlster
M. J. Wooldridge
Advisory Board:
Luigia Carlucci Aiello
Franz Baader
Wolfgang Bibel
Leonard Bolc
Craig Boutilier
Ron Brachman
Bruce G. Buchanan
Anthony Cohn
Artur dAvila Garcez
Luis Farias del Cerro
Koichi Furukawa
Georg Gottlob
Patrick J. Hayes
James A. Hendler
Anthony Jameson
Nick Jennings
Aravind K. Joshi
Hans Kamp
Martin Kay
Hiroaki Kitano
Robert Kowalski
Sarit Kraus
Maurizio Lenzerini
Hector Levesque
John Lloyd
Alan Mackworth
Mark Maybury
Tom Mitchell
Johanna D. Moore
Stephen H. Muggleton
Bernhard Nebel
Sharon Oviatt
Luis Pereira
Lu Ruqian
Stuart Russell
Erik Sandewall
Luc Steels
Oliviero Stock
Peter Stone
Gerhard Strube
Katia Sycara
Milind Tambe
Hidehiko Tanaka
Sebastian Thrun
Junichi Tsujii
Kurt VanLehn
Andrei Voronkov
Toby Walsh
Bonnie Webber
Luc De Raedt
Logical and
Relational Learning
With 77 Figures and 10 Tables
Author:
Managing Editors:
ISBN: 978-3-540-20040-6
e-ISBN: 978-3-540-68856-3
Preface
I use the term logical and relational learning to refer to the subeld of articial
intelligence, machine learning and data mining that is concerned with learning
in expressive logical or relational representations. It is the union of inductive
logic programming, (statistical) relational learning and multi-relational data
mining, which all have contributed techniques for learning from data in relational form. Even though some early contributions to logical and relational
learning are about forty years old now, it was only with the advent of inductive logic programming in the early 1990s that the eld became popular.
Whereas initial work was often concerned with logical (or logic programming)
issues, the focus has rapidly changed to the discovery of new and interpretable
knowledge from structured data, often in the form of rules, and soon important successes in applications in domains such as bio- and chemo-informatics
and computational linguistics were realized. Today, the challenges and opportunities of dealing with structured data and knowledge have been taken up by
the articial intelligence community at large and form the motivation for a lot
of ongoing research. Indeed, graph, network and multi-relational data mining
are now popular themes in data mining, and statistical relational learning is
receiving a lot of attention in the machine learning and uncertainty in articial intelligence communities. In addition, the range of tasks for which logical
and relational techniques have been developed now covers almost all machine
learning and data mining tasks. On the one hand these developments have resulted in a new role and novel views on logical and relational learning, but on
the other hand have also made it increasingly dicult to obtain an overview
of the eld as a whole.
This book wants to address these needs by providing a new synthesis of
logical and relational learning. It constitutes an attempt to summarize some
of the key results about logical and relational learning, it covers a wide range
of topics and techniques, and it describes them in a uniform and accessible
manner. While the author has tried to select a representative set of topics
and techniques from the eld of logical and relational learning, he also realizes that he is probably biased by his own research interests and views on the
VIII
Preface
eld. Furthermore, rather than providing detailed accounts of the many specic systems and techniques, the book focuses on the underlying principles,
which should enable the reader to easily get access to and understand the
relevant literature on logical and relational learning. Actually, at the end of
each chapter, suggestions for further reading are provided.
The book is intended for graduate students and researchers in articial
intelligence and computer science, especially those in machine learning, data
mining, uncertainty in articial intelligence, and computational logic, with an
interest in learning from relational data. The book is the rst textbook on
logical and relational learning and is suitable for use in graduate courses,
though it can also be used for self-study and as a reference. It contains
many dierent examples and exercises. Teaching material will become available from the authors website. The author would also appreciate receiving
feedback, suggestions for improvement and needed corrections by email to
[email protected].
The book starts with an introductory chapter clarifying the nature, motivations and history of logical and relational learning. Chapter 2 provides
a gentle introduction to logic and logic programming, which will be used
throughout the book as the representation language. Chapter 3 introduces
the idea of learning as search and provides a detailed account of some fundamental machine learning algorithms that will play an important role in later
chapters. In Chapter 4, a detailed study of a hierarchy of dierent representations that are used in machine learning and data mining is given, and two
techniques (propositionalization and aggregation) for transforming expressive
representations into simpler ones are introduced. Chapter 5 is concerned with
the theoretical basis of the eld. It studies the generality relation in logic, the
relation between induction and deduction, and introduces the most important
framework and operators for generality. In Chapter 6, a methodology for developing logical and relational learning systems is presented and illustrated
using a number of well-known case studies that learn relational rules, decision
trees and frequent queries. The methodology starts from existing learning approaches and upgrades them towards the use of rich representations. Whereas
the rst six chapters are concerned with the foundations of logical and relational learning, the chapters that follow introduce more advanced techniques.
Chapter 7 focuses on learning the denition of multiple relations, that is,
on learning theories. This chapter covers abductive reasoning, using integrity
constraints, program synthesis, and the use of an oracle. Chapter 8 covers
statistical relational learning, which combines probabilistic models with logical and relational learning. The chapter starts with a gentle introduction to
graphical models before turning towards probabilistic logics. The use of kernels and distances for logical and relational learning is addressed in Chapter 9,
and in Chapter 10 computational issues such as eciency considerations and
learnability results are discussed. Finally, Chapter 11 summarizes the most
important lessons learned about logical and relational learning. The author
suggests to read it early on, possibly even directly after Chapter 1.
Preface
IX
Luc De Raedt
For Matthew
Young man going east
Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
1.1 What Is Logical and Relational Learning? . . . . . . . . . . . . . . . . . . 1
1.2 Why Is Logical and Relational Learning Important? . . . . . . . . . 2
1.2.1 Structure Activity Relationship Prediction . . . . . . . . . . . . 3
1.2.2 A Web Mining Example . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.2.3 A Language Learning Example . . . . . . . . . . . . . . . . . . . . . . 7
1.3 How Does Relational and Logical Learning Work? . . . . . . . . . . . 8
1.4 A Brief History . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
An
2.1
2.2
2.3
2.4
2.5
2.6
Introduction to Logic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
A Relational Database Example . . . . . . . . . . . . . . . . . . . . . . . . . . .
The Syntax of Clausal Logic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
The Semantics of Clausal Logic Model Theory . . . . . . . . . . . .
Inference with Clausal Logic Proof Theory . . . . . . . . . . . . . . .
Prolog and SLD-resolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Historical and Bibliographic Remarks . . . . . . . . . . . . . . . . . . . . . .
17
17
20
22
28
35
39
41
41
43
44
45
47
48
50
53
56
58
59
60
62
XII
Contents
63
64
64
65
66
68
69
69
Contents
XIII
XIV
Contents
Contents
9.5
9.6
9.7
9.8
XV
1
Introduction
The eld of logical and relational learning, which is introduced in this chapter, is motivated by the limitations of traditional symbolic machine learning
and data mining systems that largely work with propositional representations.
These limitations are claried using three case studies: predicting the activity
of chemical compounds from their structure; link mining, where properties of
websites are discovered; and learning a simple natural language interface for a
database. After sketching how logical and relational learning works, the chapter ends with a short sketch of the history of this subeld of machine learning
and data mining as well as a brief overview of the rest of this book.
1 Introduction
propositional. Propositional representations (based on boolean or propositional logic) cannot elegantly represent domains involving multiple entities
as well as the relationships amongst them. One such domain is that of social networks where the persons are the entities and their social interactions
are characterized by their relationships. The representational limitations of
the early machine learning systems carried over to the resulting learning and
data mining techniques, which were in turn severely limited in their application domain. Various machine learning researchers, such as Ryszard Michalski
[1983] and Gordon Plotkin [1970], soon realized these limitations and started
to employ more expressive knowledge representation frameworks for learning.
Research focused on using frameworks that were able to represent a variable
number of entities as well as the relationships that hold amongst them. Such
representations are called relational. When they are grounded in or derived
from rst-order logic they are called logical representations. The interest in
learning using these expressive representation formalisms soon resulted in the
emergence of a new subeld of articial intelligence that I now describe as
logical and relational learning.
Logical and relational learning is thus viewed in this book as the study of
machine learning and data mining within expressive knowledge representation
formalisms encompassing relational or rst-order logic. It specically targets
learning problems involving multiple entities and the relationships amongst
them. Throughout the book we shall mostly be using logic as a representation
language for describing data and generalizations, because logic is inherently
relational, it is expressive, understandable, and interpretable, and it is well
understood. It provides solid theoretical foundations for many developments
within articial intelligence and knowledge representation. At the same time,
it enables one to specify and employ background knowledge about the domain,
which is often also a key factor determining success in many applications of
articial intelligence.
Active
O=N
CH=N-NH-C-NH
O-
+
N O
O
nitrofurazone
4-nitropenta[cd]pyrene
Structural alert:
Inactive
Y=Z
O
O
N+
NH
N
O-
6-nitro-7,8,9,10-tetrahydrobenzo[a]pyrene
4-nitroindole
Fig. 1.1. Predicting mutagenicity. Reprinted from [Srinivasan et al., 1996], page
c
288, 1996,
with permission from Elsevier
1 Introduction
table specify the value of the attribute for the specic example, for instance,
whether or not a benzene ring is present. We shall call representations that
can easily be mapped into the single-tuple single-table format propositional.
Table 1.1. A table-based representation
Compound Attribute1 Attribute2 Attribute3 Class
1
true
false
true
active
true
true
true
active
2
false
false
true
inactive
3
true
false
true
inactive
4
In this encoding, each entity is given a name and the relationships among
the entities are captured. For instance, in the above example, the compound
is named f1 and its atoms f11 , f12 , .... Furthermore, the relation atom/5 of
arity 5 states properties of the atoms: the molecule they occur in (e.g., f1),
the element (e.g., c denoting a carbon) and the type (e.g., 21) as well as the
charge (e.g., 0.187). The relationships amongst the atoms are then captured
by the relation bond/3, which represents the bindings amongst the atoms.
Finally, there are also overall properties or attributes of the molecule, such
as their logp and lumo values. Further properties of the compounds could be
mentioned, such as the functional groups or ring structures they contain:
ring size 5(f1, [f15 , f11 , f12 , f13 , f14 ])
hetero aromatic 5 ring(f1, [f15 , f11 , f12 , f13 , f14 ])
...
The rst tuple states that there is a ring of size 5 in the compound f1 that
involves the atoms f15 , f11 , f12 , f13 and f14 in molecule f1; the second one states
that this is a heteroaromatic ring.
Using this representation it is possible to describe the structural alert in
the form of a rule
active(M) ring size 5(M, R), element(A1, R), bond(M, A1, A2, 2)
which actually reads as1 :
Molecule M is active IF it contains a ring of size 5 called R and atoms
A1 and A2 that are connected by a double (2) bond such that A1 also
belongs to the ring R.
The previous example illustrates the use of logical representations for data
mining. It is actually based on the well-known mutagenicity application of relational learning due to Srinivasan et al. [1996], where the structural alert
was discovered using the inductive logic programming system Progol [Muggleton, 1995] and the representation employed above. The importance of this
type of application is clear when considering that the results were published
in the scientic literature in the application domain [King and Srinivasan,
1996], that they were obtained using a general-purpose inductive logic programming algorithm and were transparent to the experts in the domain. The
combination of these factors has seldom been achieved in articial intelligence.
1.2.2 A Web Mining Example
While structure activity relationship prediction involves the mining of a (potentially large) set of small graphs, link mining and discovery is concerned
with the analysis of a single large graph or network [Getoor, 2003, Getoor and
Dielh, 2005]. To illustrate link mining, we consider the best known example
of a network, that is, the Internet, even though link mining is applicable in
1
1 Introduction
other contexts as well, for instance, in social networks, protein networks, and
bibliographic databases. The following example is inspired by the inuential
WebKB example of Craven and Slattery [2001].
Example 1.2. Consider the website of a typical university. It contains several
web pages that each describe a wide variety of entities. These entities belong
to a wide variety of classes, such as student, faculty, sta, department, course,
project, and publication. Let us assume that for each such web page, there is
a corresponding tuple in our relational database. Consider, for instance, the
following facts (where the urls denote particular URLs):
faculty(url1, stephen)
course(url3, logic for learning)
department(url5, computer science)
...
faculty(url2, john)
project(url4, april2)
student(url6, hiroaki)
In addition, there are relationships among these entities. For instance, various
pages that refer to one another, such as the link from url6 to url1, denote a particular relationship, in this case the relationship between the student hiroaki
and his adviser stephen. This can again be modeled as facts in a relational
database:
adviser(stephen, hiroaki)
teaches(john, logic for learning)
belongsTo(stephen, computer science)
follows(hiroaki, logic for learning)
...
Again, the structure of the problem can elegantly be represented using a
relational database. This representation can easily be extended with additional
background knowledge in the form of rules:
studentOf(Lect, Stud) teaches(Lect, Course), follows(Stud, Course)
which expresses that
Stud is a studentOf Lect IF Lect teaches a Course and Stud follows the
Course.
Further information could be contained in the data set, such as extracts of the
text appearing on the dierent links or pages. There are several interesting
link mining tasks in this domain. It is for instance possible to learn to predict
the classes of web pages or the nature of the relationships encoded by links
between web pages; cf. [Getoor, 2003, Craven and Slattery, 2001, Chakrabarti,
2002, Baldi et al., 2003]. To address such tasks using logical or relational
learning, one has to start from a set of examples of relations that are known to
hold. For instance, the fact that stephen is the adviser of hiroaki is a (positive)
example stating that the link from hiroaki to stephen belongs to the relation
adviser. If for a given university website, say the University of Freiburg, all
1 Introduction
entities such as countries, cities, states, rivers and places. In addition, it contains facts about the relationships among them, for instance, capital(C, Y),
which species that C is the capital of Y, loc(X, Y), which states that X is located in Y, nextTo(X, Y), which states that X is located next to Y, and many
other relationships.
The task could then be to translate queries formulated in natural language
to database queries that can be executed by the underlying database system.
For instance, the query in natural language
What are the major cities in Kansas?
could be translated to the database query
answer(C, (major(C), city(C), loc(C, S), equal(S, kansas)))
This last query can then be passed on to the database system and executed.
The database system then generates all entities C that are major, a city, and
located in kansas.
Zelle and Mooneys learning system [1996] starts from examples, which
consist of queries in natural language and in database format, from an elementary shift-reduce parser, and from some background knowledge about the
domain. The task is then to learn control knowledge for the parser. Essentially,
the parser has to learn the conditions under which to apply the dierent operators in the shift-reduce parser. The control knowledge is represented using
a set of clauses (IF rules) as in the previous two case studies. The control
rules need to take into account knowledge about the stack used by the parser,
the structure of the database, and the semantics of the language. This is
again hard (if not impossible) to represent under the single-tuple single-table
assumption.
10
1 Introduction
Now that we know what to compute, we can look at how this can be
realized. The computation of the solutions proceeds typically by searching
the space of possible patterns or hypotheses L. One way of realizing this is to
employ a generate-and-test algorithm, though this is too naive to be ecient.
Therefore symbolic machine learning and data mining techniques typically
structure the space L according to generality. One pattern or hypothesis
is more general than another if all examples that are covered by the latter
pattern are also covered by the former.
Example 1.7. For instance, the rule
active(M) ring size 5(M, R), element(A1, R), bond(M, A1, A2, 2)
is more general than the rule
active(M)
ring size 5(M, R), element(A1, R),
bond(M, A1, A2, 2), atom(M, A2, o, 52, C)
which reads as
Molecule M is active IF it contains a ring of size 5 called R and atoms
A1 and A2 that are connected by a double (2) bond such that A1 also
belongs to the ring R and atom A2 is an oxygen of type 52.
The former rule is more general (or, equivalently, the latter one is more
specic) because the latter one requires also that the atom connected to the
ring of size 5 be an oxygen of atom-type 52. Therefore, all molecules satisfying
the latter rule will also satisfy the former one.
The generality relation is quite central during the search for solutions. The
reason is that the generality relation can often be used 1) to prune the search
space, and 2) to guide the search towards the more promising parts of the
space. The generality relation is employed by the large majority of logical
and relational learning systems, which often search the space in a general-tospecic fashion. This type of system starts from the most general rule (the
unconditional rule, which states that all molecules are active in our running
example), and then repeatedly specializes it using a so-called renement operator. Renement operators map rules onto a set of specializations; cf. Chapters
3 and 5.
Example 1.8. Consider the rule
active(Mol) atom(Mol, Atom, c, Type, Charge),
which states that a molecule is active if it contains a carbon atom. Renements
of this rule include:
11
This property holds when learning from entailment. In other settings, such as
learning from interpretations, this property is reversed; cf. Chapter 5. The more
specic hypothesis then entails the more general one.
12
1 Introduction
eral laws. It is commonly applied within the natural sciences, and therefore
has been studied in the philosophy of science by several philosophers since
Aristotle. For instance, Francis Bacon investigated an inductive methodology
for scientic inquiry. The idea is that knowledge can be obtained by careful experimenting, observing, generalizing and testing of hypotheses. This is
also known as empiricism, and various aspects have been studied by many
other philosophers including Hume, Mill, Peirce, Popper and Carnap. Inductive reasoning is fundamentally dierent from deductive reasoning in that the
conclusions of inductive reasoning do not follow logically from their premises
(the observations) but are always cogent; that is, they can only be true with
a certain probability. The reader may notice that this method is actually very
close in spirit to that of logical and relational learning today. The key dierence seems to be that logical and relational learning investigates computational
approaches to inductive reasoning.
Computational models of inductive reasoning and scientic discovery have
been investigated since the very beginning of articial intelligence. Several
cognitive scientists, such as a team involving the Nobel prize winner Herbert A. Simon (see [Langley et al., 1987] for an overview), developed several
models that explain how specic scientic theories could be obtained. Around
the same time, other scientists (including Bruce Buchanan, Nobel prize winner Joshua Lederberg, Ed Feigenbaum, and Tom Mitchell [Buchanan and
Mitchell, 1978]) started to develop learning systems that could assist scientists in discovering new scientic laws. Their system Meta-Dendral produced some new results in chemistry and were amongst the rst scientic
discoveries made by an articial intelligence system that were published in
the scientic literature of the application domain. These two lines of research
have actually motivated many developments in logical and relational learning
albeit there is also a crucial dierence between them. Whereas the mentioned
approaches were domain-specic, the goal of logical and relational learning is
to develop general-purpose inductive reasoning systems that can be applied
across dierent application domains. The example concerning structure activity relationship is a perfect illustration of the results of these developments
in logical and relational learning. An interesting philosophical account of the
relationship between these developments is given by Gillies [1996].
Supporting the scientic discovery process across dierent domains requires a solution to two important computational problems. First, as scientic theories are complex by their very nature, an expressive formalism is
needed to represent them. Second, the inductive reasoning process should be
able to employ the available background knowledge to obtain meaningful hypotheses. These two problems can to a large extent be solved by using logical
representations for learning.
The insight that various types of logical and relational representations can
be useful for inductive reasoning and machine learning can be considered as
an outgrowth of two parallel developments in computer science and articial intelligence. First, and most importantly, since the mid-1960s a number
13
14
1 Introduction
15
works soon afterward. In the past few years, these researchers have gathered in
the statistical relational learning (SRL) workshops [Getoor and Jensen, 2003,
2000, De Raedt et al., 2005, 2007a]. A detailed overview and introduction to
this area is contained in Chapter 8 and two recent volumes in this area include [Getoor and Taskar, 2007, De Raedt et al., 2008]. Statistical relational
learning is one of the most exciting and promising areas for relational and
logical learning today.
To conclude, the eld of logical and relational learning has a long history
and is now being studied under dierent names: inductive logic programming, multi-relational data mining and (statistical) relational learning. The
approach taken in this book is to stress the similarities between these trends
rather than the dierences because the problems studied are essentially the
same even though the formalisms employed may be dierent. The author
hopes that this may contribute to a better understanding of this exciting
eld.
For Matthew
Young man going east
2
An Introduction to Logic
The data mining and machine learning approaches discussed in this book employ relational or logical representations. This chapter introduces relational
database representations and their formalization in logic. Logic is employed
because it is an expressive, well-understood and elegant formalism for representing knowledge. We focus on denite clause logic, which forms the basis of
computational logic and logic programming. The chapter introduces the syntax
as well as the model-theoretic and proof-theoretic semantics of denite clause
logic. Throughout this book an attempt is made to introduce all the necessary
concepts and terminology in an intuitive and yet precise manner, without resorting to unnecessary formal proof or theory. The reader interested in a more
detailed theoretical account of clausal logic may want to consult [Lloyd, 1987,
Genesereth and Nilsson, 1987, Flach, 1994, Hogger, 1990, Kowalski, 1979],
and for a more detailed introduction to the programming language Prolog we
refer him to [Flach, 1994, Bratko, 1990, Sterling and Shapiro, 1986].
18
2 An Introduction to Logic
19
{Pub/foundations of lp}, which state the conditions under which the original query is true. For those readers familiar with SQL, a popular database
language, we also specify the corresponding query in SQL1 :
SELECT Pub FROM authorOf WHERE Author = lloyd
The query
authorOf(Author, logic for learning), authorOf(Author, foundations of lp)
asks whether there is an author who wrote logic for learning as well as
foundations of lp. The single substitution that would be returned for this query
is {Author/lloyd}. In SQL, this query is written as:
SELECT Author
FROM authorOf t1, authorOf t2
WHERE t1.Author = t2.Author AND t1.Pub = logic for learning
and t2.Pub = foundations of lp
So, the , between the two atoms in the query corresponds to and, and two
occurrences of the same variable must be instantiated to the same constant
in the substitution, which corresponds to a join in relational databases.
Suppose now that instead of being interested in knowing which publications refer to which other publications, we are interested in knowing the
authors who cite one another. They can be listed using the following query:
authorOf(A, P), reference(P, Q), authorOf(B, Q)
Many answers would be generated for this query, including:
{A/lloyd, P/logic for learning, Q/foundations of lp, B/lloyd}
{A/lloyd, P/logic for learning, Q/ai a modern appraoch, B/russell}
...
If the query is posed a number of times, it is useful to dene a new predicate
cites/2 using the clause:
cites(A, B) authorOf(A, P), reference(P, Q), authorOf(B, Q)
This clause states that A cites B if A is the authorOf P, P references Q, and B is
the authorOf Q. This clause corresponds to the denition of a view or an intensional relation in relational database terminology, which can be implemented
by the following statement in SQL.
CREATE VIEW cites
AS SELECT a1.Author, a2.Author
FROM authorOf a1, authorOf a2, reference r
WHERE a1.Pub = r.Pub1 AND a2.Pub = r.Pub2
1
The reader unfamiliar with SQL can safely skip the SQL queries.
20
2 An Introduction to Logic
The eect is that the predicate cites can now be queried as if it contained the
following facts:
cites(lloyd, lloyd)
cites(lloyd, russell)
cites(russell, lloyd)
cites(russell, muggleton)
cites(russell, deraedt)
cites(muggleton, quinlan)
cites(muggleton, lloyd)
cites(lloyd, quinlan)
cites(lloyd, norvig)
cites(norvig, lloyd)
cites(norvig, muggleton)
cites(norvig, deraedt)
cites(deraedt, quinlan)
cites(deraedt, lloyd)
Exercise 2.3. Pose a query to identify authors who cite themselves. Use
both the original database (consisting of reference/2 and authorOf/2) and the
one where the cites predicate has been dened. Dene also a new predicate
self citation/1 that succeeds for those authors who cite themselves.
The list functor cons/2 is usually written in Prolog in inx notation. Using this
notation cons(A, B) is written as [A | B], and cons(A, cons(B, C)) as [A | [B | C]] or
[A, B | C] for short.
21
22
2 An Introduction to Logic
The clauses that are most often employed in logical and relational learning are
facts and denite clauses, which we already encountered in the previous section. Denials represent negative information, for instance, human(dracula)
species that dracula is not human, that is, that human(dracula) is false. Denials are used as queries or goals. The reasons for this will become clear soon.
Typically, the database consists of a set of clauses. A set of clauses
{c1 , , cn } species that all clauses in the set are true, that is, the set denotes a conjunction c1 , , cn of the clauses ci . We will sometimes refer to
such sets of clauses as (clausal) theories, databases, or knowledge bases.
A substitution = {V1 /t1 , , Vn /tn } is an assignment of terms t1 , ..., tn to
variables V1 , ..., Vn , for instance, {A/lloyd, Pub/logic for learning}. The instantiated formula F ,where F is a term, atom, or clause and = {V1 /t1 , , Vn /tn }
a substitution, is the formula obtained by simultaneously replacing all variables V1 , ..., Vn in F by the terms t1 , ..., tn . For instance, the formula card(X, Y),
where = { X/j, Y/diamonds}, denotes card(j, diamonds).
23
Herbrand domain as its domain. The Herbrand domain is dened as the set
of all ground terms that can be constructed using the constants and function
symbols that occur in the set of clauses considered.
Example 2.5. The Herbrand universe in the bibliographic database of Ex. 2.1
consists of all constants appearing in the facts, i.e.,
{quinlan, lloyd, muggleton, . . . , logic for learning, . . . , ilp theory and methods}.
Example 2.6. Now consider the clauses dening the natural numbers:
nat(0)
nat(succ(X)) nat(X)
The rst clause states that 0 is a natural number; the second one that succ(X)
is a natural number if X is one. The Herbrand universe in this case is the
innite set {0, succ(0), succ(succ(0)), . . .}.
A Herbrand interpretation now maps each ground term to itself. So each
ground term refers to itself; for instance, john now refers to the object john
instead of to some person such as John Doe. In a similar manner, predicates
are mapped onto relations over the Herbrand universe. The result is that a
Herbrand interpretation can be viewed as the set of ground atoms that are true
in the interpretation. This is the view that we will be employing throughout
this book when talking about interpretations.
Denition 2.7. A Herbrand interpretation of a set of clauses is a set of
ground atoms (over the constant, function and predicate symbols occurring
in the set of clauses).
All ground atoms in the interpretation are assumed to be true, and all others
are assumed to be false.
Example 2.8. One possible Herbrand interpretation I1 over the bibliographic
database of Ex. 2.1 is:
{authorOf(russell, logic for learning), authorOf(russell, quinlan)}
The interpretation I2 consists of all the ground atoms occurring in the bibliographic database.
Example 2.9. Similarly, for the above specied natural numbers, I3 , I4 , and
I5 dened below are Herbrand interpretations.
I3 = {}
I4 = {nat(0), nat(succ(0))}
I5 = {nat(0), nat(succ(0)), nat(succ(succ(0))), . . .}.
24
2 An Introduction to Logic
Some interpretations do not really reect the properties of the clauses that
we have written down. For instance, the rst interpretations in both the bibliographic database and the denition of the natural numbers are intuitively
impossible given the clauses that we have written down. This motivates the
following denition.
Denition 2.10. A Herbrand interpretation I is a Herbrand model for a set
of clauses C if and only if for all clauses h1 ; ; hn b1 , , bm C and
for all ground substitutions : {b1 , , bm } I {h1 , , hn } I = .
So, a Herbrand interpretation I is a model for a clause c if for all substitutions for which body(c) is true in I, head(c) is also true in I. If an
interpretation is a model for a clause (or set of clauses), the interpretation
satises the clause (or set of clauses); otherwise, the interpretation violates
the clause (or set of clauses). Clausal theories that possess a Herbrand model
are called satisifable; those that do not possess one are called unsatisable.
When the context is clear, we will talk about interpretations and models
rather than Herbrand interpretations and Herbrand models.
Example 2.11. Reconsider our bibliographic database and the interpretation
I1 . I1 is not a model for the database because there exists a clause f
authorOf(russell, ai a modern approach)
such that body(f ) = {} I1 but
head(f ) = {authorOf(russell, ai a modern approach))} I1 = .
At the same time, it is easy to see that I2 is a model for the bibliographic
database.
Example 2.12. For the natural numbers, I3 is not a model, because of the fact
nat(0) . Neither is I4 , because of the recursive clause c for which there exists
a substitution ={X/succ(0)} for which body(c) = {nat(succ(0))} I4 but
head(c) ={nat(succ(succ(0)))}I4 = . Finally, I5 is a model for the two
clauses dening nat/1.
Model theory is the basis for reasoning about the declarative semantics
of logical formulae, which relies on the notion of logical entailment. Logical
entailment denes when one formula is a consequence of, or follows from,
another one.
Denition 2.13. Let C be a set of clauses and c be a clause. C logically
entails c, notation C |= c, if and only if all models of C are also models of c.
In this denition, not only the Herbrand interpretations (and models) but all
interpretations and models are considered. The following theorems, however,
allow us to focus our attention on Herbrand interpretations and models to
reason about the satisability of a particular formula.
25
The algorithm starts with the empty model and repeatedly expands it by
non-deterministically adding facts belonging to the head of a violated clause.
26
2 An Introduction to Logic
This process continues until M either becomes a model of the theory, or until
a denial is violated. When a denial is violated, the model cannot be expanded
by adding facts, which explains why the algorithm then backtracks to earlier
choice points. Observe that the algorithm can fail when no model exists, and
also that it can loop innitely while attempting to construct an innite model.
There exists also a very elegant and short implementation of this algorithm in
Prolog. It is called Satchmo and was published by Manthey and Bry [1987];
it is described in detail in [Flach, 1994].
Example 2.18. Consider the following clausal theory:
human(X) male(X)
human(X) female(X)
female(X); male(X) human(X)
human(john)
One possible trace of Algo. 2.1 generates the following sequence of interpretations:
{}
{human(john)} using the last clause.
{human(john), female(john)} using the third clause.
Another model for this example is {human(john), male(john)}.
Example 2.19. Reconsider the bibliographic database together with the clause
dening the predicate cites/2. Algo. 2.1 would generate the interpretation consisting of all ground facts for the predicates reference/2, cites/2 and authorOf/2
that were listed in the earlier examples.
Example 2.20. Reconsider the denition of the natural numbers using the
predicate nat/1. For these clauses, the algorithm does not terminate, because
it attempts to generate the innite model I5 dened above.
Exercise 2.21. Does the following clausal theory have a model? If so, generate one.
student(X), vampire(X)
student(X), professor(X)
female(X), male(X)
being(dracula)
clever(X); student(X) being(X)
female(X); male(X); vampire(X) being(X)
student(X); professor(X); vampire(X) being(X)
Exercise 2.22. Use the theorem prover Satchmo implemented in Prolog
(cf. [Manthey and Bry, 1987] or [Flach, 1994]) to generate more models of the
theory in the previous example. (This exercise requires that you have access
to a Prolog implementation. Some excellent Prolog implementations, such as
SWI-Prolog and YAP-Prolog, are available from the public domain.)
27
28
2 An Introduction to Logic
The key dierence between this algorithm and the previous one is that it
processes all violated clauses in parallel to generate the next model. It can
be optimized by adding {b1 , , bn } (Mi Mi1 ) = as an additional
constraint in the inner for loop. This way the same conclusions h will not be
regenerated in every iteration, which will remove some redundant computations.
Example 2.25. Suppose the denite clause theory is:
ancestor(X, Y) parent(X, Y)
ancestor(X, Y) parent(X, Z), ancestor(Z, Y)
parent(rose, luc)
parent(leo, rose)
The algorithm then computes the following sequence of models:
M0
M1
M2
M3
M4
=
= {parent(rose, luc), parent(leo, rose)}
= M1 {ancestor(rose, luc), ancestor(leo, rose)}
= M2 {ancestor(leo, luc)}
= M3
Exercise 2.26. Specify the least Herbrand model of the following theory:
plus(0, X, X) nat(X)
plus(succ(X), Y, succ(Z)) plus(X, Y, Z)
nat(0)
nat(succ(X)) nat(X)
29
(2.1)
(2.2)
which indicates that if the clauses above the line are presented, the ones below
the line may be inferred. We sometimes use the notation
l b1 , , bn and h c1 , , ci1 , l, ci , , cm
res
h c1 , , ci1 , b1 , , bn , ci , , cm
(2.3)
h c1 , , ci1 , l, ci , , cm
h c1 , , ci1 , b1 , ..., bn , ci , , cm
Fig. 2.1. The propositional resolution operator
Example 2.27.
mammal rabbit
animal mammal
res
animal rabbit
30
2 An Introduction to Logic
foursided rectangle
rectangle square
Example 2.28. A resolution proof of the clause pos square, red (red squares
are positive) is shown in Fig. 2.2. It assumes the following theory T is given:
foursided rectangle
rectangle square
pos foursided, red
A popular technique in mathematics when proving theorems is to assume
that a theorem is false and to prove that this leads to a contradiction. This
technique also applies to logical inference and theorem proving, where it is
known as proving by refutation. The idea of refutation was already formulated
in Theorem 2.15, where it was stated that C |= c if and only if C c |= .
A proof by refutation is now a resolution derivation that ends in the empty
clause or , which is unsatisable.
Resolution is not a complete operator for denite clause logic (even in the
propositional case). Completeness would require that whenever C |= c there
also exists a resolution derivation of c from C.
Example 2.29. Indeed,
mammal rabbit |= mammal rabbit, brown
31
but it is impossible to derive the second clause by resolution from the rst
one.
Fortunately, resolution is refutation complete, as indicated in the following
property.
Property 2.30. (Refutation completeness; cf. Theorem 5.18 of [Nienhuys-Cheng
and de Wolf, 1997]) Let C be a set of clauses. Then C is unsatisable, that is,
C |= , if and only if there exists a resolution derivation of the empty clause
starting from C.
Due to the soundness and refutation completeness of resolution (for propositional Horn clauses) we now have an eective procedure for deciding logical
entailment. Deciding whether a set of Horn clauses logically entails a Horn
clause, that is whether C |= h b1 , , bn , can be realized as follows:
negate the clause h b1 , , bn , which yields the clauses T = { h,
b1 , , bn }
try to derive the empty clause from C T , that is, decide whether
C T .
Example 2.31. Reconsider the clauses in Ex. 2.28. We now prove by refutation
that T |=pos square, red. To this end, we rst negate the clause, which yields
the clauses:
square and red and pos
Figure 2.3 shows how to derive from these clauses and T .
So far, we have introduced resolution for propositional logic, but resolution
becomes more interesting when clauses contain terms. The key dierence is
that unication must be used in this case. Unication is needed to make a
literal in one clause match a literal in the other clause. For instance, when
trying to resolve
father(X, Y) parent(X, Y), male(X)
with
father(luc, maarten)
it is necessary to unify the literals father(X, Y) and father(luc, maarten) using
the substitution {X/luc, Y/maarten} to yield the clause
parent(luc, maarten), male(luc).
Unication was already implicitly used in Algos. 2.1 and 2.2. Formally, a
unier of two expressions f1 and f2 (terms or atoms) is a substitution such
that f1 = f2 .
32
2 An Introduction to Logic
pos
foursided rectangle
foursided, red
rectangle, red
rectangle square
square, red
square
red
red
Fig. 2.3. A proof by refutation
Example 2.32. For instance, to unify father(luc, X) and father(Y, soetkin) one
can use the substitution {Y/luc, X/soetkin}, and to unify the atoms
plus(succ(succ(0)), succ(X), succ(Y)) and plus(A, B, succ(succ(C))) one can use
1 = {A/succ(succ(0)), B/succ(X), Y/succ(C)}, or
2 = {A/succ(succ(0)), B/succ(0), X/0, Y/succ(C)}.
As another example consider the atoms plus(0, X, X) and plus(Y, succ(Y), Z).
One possible unier is {Y/0, X/succ(0), Z/succ(0)}, which illustrates how bindings over one occurrence of a variable are propagated to other occurrences.
33
Notice also that uniers do not always exist; for instance, the atoms
father(john, frank) and father(X, paul) do not unify. In addition, as Ex. 2.32
illustrates, uniers are not necessarily unique. To guarantee the refutation
completeness of resolution when working with denite clauses in rst-order
logic it is necessary to work with a special type of unier, which one calls most
general uniers.
Denition 2.33. The most general unier of two formulae F1 and F2 is a
unier such that for every other unier of F1 and F2 , there exists a nontrivial substitution such that = . A trivial substitution is one that maps
each variable onto itself.
The substitution denotes the substitution that rst applies and then
. The resulting set of equalities can be obtained by rst applying to the
right-hand side terms in and then adding the other equalities in (for
variables not yet occurring in ) to .
Example 2.34. According to this denition, the substitution 2 for the plus
atoms in Ex. 2.32 is not a most general unier as fi 2 can be written as
(fi 1 ) where = {X/0}. Similarly, ={Z/f(h(W)), X/h(W), Y/g(a)} is not
a most general unier of p(f(f(X)), g(Y)) and p(f(Z), g(g(a)) as the Fi can
be written as (Fi ) where = {Z/f(X), Y/g(a)} and = {X/h(W)}. Observe
that = .
Even though the reader by now has probably already obtained an intuitive understanding of how to compute the most general unier, we sketch a
unication algorithm in Algo. 2.3.
Algorithm 2.3 Computing the mgu(t1 , t2 ) of two terms t1 and t2 ; after Lloyd
[1987]
:=
while t1 = t2 do
nd the disagreement set D of t1 and t2
if there exist a variable v and term t in D and v does not occur in t then
:= {v = t}
else
output t1 and t2 are not uniable
end if
end while
34
2 An Introduction to Logic
Example 2.35. Reconsider computing the mgu of the atoms plus(0, X, X) and
plus(Y, succ(Y), Z) using Algo. 2.3. The disagreement sets and substitutions
evolve as follows through the dierent iterations of the algorithm:
1. = and plus(0, X, X), plus(Y, succ(Y), Z). Hence, D = {Y, 0}
2. = {Y/0} and plus(0, X, X), plus(0, succ(0), Z). Hence, D = {X, succ(0)}
3. = {Y/0, X/succ(0)} and plus(0, succ(0), succ(0)), plus(0, succ(0), Z). Hence,
D = {succ(0), Z}
4. = {Y/0, X/succ(0), succ(0)/Z} and t1 = t2 = plus(0, succ(0), succ(0))
implying that is the mgu.
Now we can dene the general resolution rule. Given the clauses l
b1 , , bn and h c1 , , ci1 , l , ci+1 , , cm the resolution operator infers
the resolvent h b1 , , bn , c1 , , cm , where = mgu(l, l ). In formal
form, this yields:
l b1 , , bn and h c1 , , ci1 , l , ci+1 , , cm and = mgu(l, l )
h b1 , , bn , c1 , , cm
(2.4)
Again, this is written as
l b1 , , bn and h c1 , , ci1 , l , ci+1 , , cm
res
h b1 , , bn , c1 , , cm
(2.5)
Example 2.36.
cites(X, Y) authorOf(X, A), authorOf(Y, B), reference(A, B)
authorOf(lloyd, logic for learning)
res
cites(lloyd, Y) authorOf(Y, B), reference(logic for learning, B)
The properties and denitions of resolution proofs, and trees, refutation
proofs, soundness and refutation completeness for propositional logic carry
over to the rst-order case. Only one point changes: the method to prove
C |= h b1 , , bn by refutation. More specically, the step where the
clause is negated needs to take into account the quantiers and the variables
occurring in the clause. As the negation of a universally quantied formula
is an existentially quantied negated formula, the refutation proof uses
h, b1 , ... , bn , where is a so-called skolem substitution. Skolem
substitutions replace all variables in h b1 , ..., bn by distinct constants not
appearing anywhere else in the theory or clause.
Example 2.37. To prove by refutation that
35
36
2 An Introduction to Logic
(2.6)
37
ancestor(rose, luc)
parent(leo, rose)
ancestor(U, V) parent(U, V)
parent(rose, luc)
parent(rose, luc)
Fig. 2.4. A proof by refutation
ancestor(leo, luc)
ancestor(rose, luc)
parent(rose, luc)
Fig. 2.5. An SLD-refutation and derivation.
38
2 An Introduction to Logic
anc(leo, rose)
parent(leo, rose)
anc(rose, rose)
parent(rose, rose)
anc(luc, rose)
parent(luc, rose)
nat(X0)
nat(X1)
nat(X2)
39
For Matthew
Young man going east
3
An Introduction to Learning and Search
In this chapter, we introduce machine learning and data mining problems, and
argue that they can be viewed as search problems. Within this view, the goal is
to nd those hypotheses in the search space that satisfy a given quality criterion
or minimize a loss function. Several quality criteria and loss functions, such as
consistency (as in concept learning) and frequency (in association rule mining)
are presented, and we investigate desirable properties of these criteria, such as
monotonicity and anti-monotonicity. These properties are dened w.r.t. the
is more general than relation and allow one to prune the search for solutions.
We also outline several algorithms that exploit these properties.
42
a language of hypotheses Lh , whose elements describe hypotheses (functions or patterns) about the instances, observations or data.
In many situations, it is helpful to employ background knowledge in the mining and learning process. However, for ease of exposition, we postpone the
discussion of background knowledge to Section 4.9.
The goal of data mining and machine learning is then to discover hypotheses that provide information about the instances. This implies that the
relationship between the language of examples Le and of hypotheses Lh must
be known. This relationship can be modeled elegantly by viewing hypotheses
h Lh as functions h : Le Y to some domain Y. The learning task is then
to approximate an unknown target function f well. This view is illustrated
in Fig. 3.1. Dierent domains are natural for dierent learning and mining
tasks. For instance, in regression, the task is to learn a function from Le to
Y = R, that is, to learn a real-valued function. As an illustration, consider
that we want to learn to assign (real-valued) activities to a set of molecules.
On the other hand, when learning denitions of concepts or mining for local
patterns, Y = {0, 1} or, equivalently, Y = {true, f alse}. In concept learning,
the task could be to learn a description that matches all and only the active
molecules. The resulting description is then the concept description.
h1
h1 (e)
h2
h2 (e)
Le
Fig. 3.1. Hypotheses viewed as functions
When the domain of the hypotheses is binary, that is, when Y = {0, 1}, it
is useful to distinguish the instances that are covered by a hypothesis, that is,
mapped to 1, from those that are not. This motivates the following denition:
Denition 3.1. The covers relation c is a relation over Lh Le , and c(h, e)=
true if and only if h(e) = 1.
Thus the covers relation corresponds to a kind of matching relation. We will
sometimes write c(h) to denote the set of examples in Le covered by the
hypothesis h Lh . Furthermore, the set of examples from D Lh covered
43
c(h)
Lh
Le
Fig. 3.2. The covers relation
44
For boolean data, various types of hypotheses languages have been employed. Perhaps, the most popular one is that of conjunctive expressions of
the form p1 . . . pn where the pi are propositional atoms. In the data mining
literature, these expressions are also called item-sets and usually represented
as {p1 , , pn }; in the literature on computational learning theory [Kearns
and Vazirani, 1994] they are known as monomials. So, in this case: Lh = Le ,
which is sometimes called the single-representation trick. Using clausal logic,
item-sets can be represented by the set of facts {p1 , . . . , pn }, though
this notation is less convenient because it is too lengthy. It will be convenient
to use the notation LI to denote all item-sets or conjunctive expressions over
I, the set of all items. More formally,
LI = {I|I I}
(3.1)
Continuing the basket analysis example above, the hypothesis that someone buys mustard and beer could be represented using mustard and beer ,
or more compactly as {mustard, beer}. It is easily veried that this hypothesis covers the example {sausage, beer, mustard}. The clause mustard
sausage, beer describes an association rule, that is, a particular kind of pattern.
It states than if a client buys beer and sausage she also buys mustard. When
the coverage relation is chosen to coincide with the notion of satisability, the
example is covered by the clause.
When using purely logical descriptions, the function represented by a hypothesis is typically boolean. However, for the domain of item-sets it is also
possible to specify real-valued functions. Consider, for instance, the function
h(e) = sausage + 2 beer + 4 wine + mustard
that computes the price of the basket e.
45
Find the hypothesis h Lh that minimizes the loss function, that is, for
which
h = arg min loss(h, E)
(3.2)
46
Given
a language of examples Le ;
a language of hypotheses (or patterns) Lh ;
a data set D Le ; and
a quality criterion Q(h, D) that species whether the hypothesis h Lh
is acceptable w.r.t. the data set D;
Find the set of hypotheses
T h(Q, D, Lh ) = {h Lh | Q(h, D) is true}
(3.5)
(3.6)
f req(h, D)
|D|
(3.7)
An example of a local quality criterion is now a minimum frequency constraint. Such a constraint states that the frequency of a hypothesis h on
the data set D should exceed a threshold, that is, Q(h, D) is of the form
f req(h, D) > x where x is a natural number or rf req(h, D) > y where y is a
real number between 0 and 1. These criteria are local because one can verify
whether they hold by accessing the hypothesis h and D only. There is no need
to know the frequency of the other hypotheses in Lh .
An example of a global quality criterion is to require that the accuracy of
a hypothesis h w.r.t. a set of positive P and negative example N is maximal.
The accuracy acc(h, P, N ) is then dened as
acc(h, P, N ) =
f req(h, P )
.
f req(h, P ) + f req(h, N )
(3.8)
Q(h, P, N ) = h = arg max acc(h, P, N )
hLh
47
(3.9)
This constraint closely corresponds to minimizing the empirical loss in a function approximation setting.
Because the machine learning and data mining views are quite close to
one another, at least when working with symbolic representations, we shall
in the present chapter largely employ the data mining perspective. When
shifting our attention to take into account more numerical issues, in Chapter
8 on probabilistic logic learning and Chapter 9 on distance and kernel-based
learning, the machine learning perspective will be more natural. The reader
must keep in mind though, that in most cases the same principles apply and
are, to some extent, a matter of background or perspective.
Although the algorithm is naive, it has some interesting properties: whenever a solution exists, the enumeration algorithm will nd it. The algorithm
can only be applied if the hypotheses language Lh is enumerable, which means
that it must be possible to generate all its elements. As the algorithm searches
the whole space, it is inecient. This is a well-known property of generateand-test approaches. Therefore, it is advantageous to structure the search
space in machine learning, which will allow for its pruning. Before discussing
how the search space can be structured, let us illustrate the enumeration algorithm. This illustration, as well as most other illustrations and examples in
this chapter, employs the representations of boolean logic.
Example 3.3. Reconsider the problem of basket analysis sketched in Ex. 3.2. In
basket analysis, there is a set of propositional variables (usually called items)
48
I = {s = sausage, m = mustard, b = beer, c = cheese}. Furthermore, every example is an interpretation (or item-set) and the hypotheses are, as argued in
Ex. 3.2, members of LI . Consider also the data set
D = {{s, m, b, c}, {s, m, b}, {s, m, c}, {s, m}}
and the quality criterion Q(h, D) = (f req(h, D) 3). One way of enumerating
all item-sets in LI for our example is given in Fig. 3.3. Furthermore, the itemsets satisfying the constraint are underlined.
{}
{s}
{s, m}
{s, c}
{s, m, c} {s, m, b}
{m}
{s, b}
{m, c}
{c}
{m, b}
{b}
{c, b}
{s, c, b}
{s, m, c, b}
It would be more precise to state that h2 is at least as general than h1 . Nevertheless, we shall use the standard terminology, and say that h1 is more general
than h2 .
49
g
c(g)
c(s)
Le
Lh
50
When the language Lh does not possess syntactic variants, which will be
assumed throughout the rest of this chapter, the generality relation imposes
a partial order on the search space and can be graphically depicted using a
so called Hasse diagram. This is illustrated in Fig. 3.5.
{}
{s}
{c}
{m}
{s, c}
{s, m}
{s, m, c}
{s, b}
{m, c}
{b}
{m, b}
{s, c, b}
{s, m, b}
{c, b}
{m, c, b}
{s, m, c, b}
3.7 Monotonicity
The generality relation imposes a useful structure on the search space provided
that the quality criterion involves monotonicity or anti-monotonicity.
A quality criterion Q is monotonic if and only if
s, g Lh , D Le : (g s) Q(g, D) Q(s, D)
(3.10)
3.7 Monotonicity
51
(3.11)
In the literature, the denitions of the concepts of monotonicity and antimonotonicity are sometimes reversed.
52
{s}
{s, c}
{s, m}
{c}
{m}
{s, b}
{s, m, c}
{b}
{m, c}
{m, c, b}
{s, c, b}
{s, m, b}
{c, b}
{m, b}
{s, m, c, b}
{s}
{s, m}
{c}
{m}
{s, c}
{s, m, c}
{s, b}
{m, c}
{s, c, b}
{s, m, b}
{b}
{c, b}
{m, b}
{m, c, b}
{s, m, c, b}
3.8 Borders
53
Example 3.12. Reconsider Ex. 3.3 and the monotonic constraint that requires
that the example {m, b, c} not be covered. Because mustard beer cheese
covers this example, all its generalizations can be pruned away as illustrated
in Fig. 3.7.
3.8 Borders
When monotonic and/or anti-monotonic criteria are used, the solution space
has so-called borders. Before introducing borders, let us introduce the max(T )
and min(T ) primitives:
max(T ) = {h T | t T : h t}
(3.12)
min(T ) = {h T | t T : t h}
(3.13)
Intuitively, the maximal elements are the most specic ones. These are also
the largest ones when interpreting the symbol as smaller than or equal to.
Furthermore, more specic hypotheses are typically also longer.
Example 3.13. Let T = {true, s, m, s m}. Then max(T ) = {s m} and
min(T ) = {true}.
Observe that when the hypothesis space Lh is nite, max(T ) and min(T )
always exist. When Lh is innite, this need not be the case. We illustrate this
using string patterns.
Example 3.14. * Many data sets can be conveniently represented using strings
over some alphabet ; cf. also Chapter 4. An alphabet is a nite set of
symbols. A string s1 s2 ...sn is then a sequence of symbols si . For instance,
the string over the alphabet = {a, c, g, t}
atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa
might represent a sequence of DNA. When working with strings to represent
patterns and examples, a natural coverage relation is provided by the notion
of substring. A string S = s1 s2 ...sn is a substring of a string T = t1 t2 ...tk ,
if and only if s1 ...sn occur at consecutive positions in t1 ...tk , that is, there
exists a j for which s1 = tj , s2 = tj+1 , ..., and sn = tj+n . For instance, the
string atgc is a substring of aatgccccc with j = 2. For the language of all
strings over the alphabet , that is, , max( ) does not exist. To avoid
such complications in this chapter, we assume that Lh is nite.
For nite languages and monotonic and anti-monotonic quality criteria Q,
the solution space T h(Q, D, Lh ) has boundary sets that are sometimes called
borders. More formally, the S-border of maximally specic solutions w.r.t. a
constraint Q is
54
S T h(Q, D, Lh ) = max T h(Q, D, Lh )
(3.14)
(3.15)
Example 3.15. Reconsider Ex. 3.13. The set T is the set of solutions to the
mining problem of Ex. 3.3, that is, T = T h((f req(h, D) 3), D, Lm ); S(T ) =
max(T ) = {s m} and G(T ) = min(T ) = {true}.
The S and G sets are called borders because of the following properties.
Property 3.16. If Q is an anti-monotonic predicate, then
T h(Q, D, Lh ) = {h Lh | s S T h(Q, D, Lh ) : h s}
Property 3.17. If Q is a monotonic predicate, then
T h(Q, D, Lh ) = {h Lh | g G T h(Q, D, Lh ) : g h}
Thus the borders of a monotonic or an anti-monotonic predicate completely characterize the set of all solutions. At this point the reader may want
to verify that the S set in the previous example fully characterizes the set
T of solutions to an anti-monotonic query as it contains all monomials more
general than the element s m of S(T ).
Furthermore, when Q is the conjunction of a monotonic and an antimonotonic predicate M A (and the language Lh is nite), then the resulting
solution set is a version space. A set T is a version space if and only if
T = {h Lh | s S(T ), g G(T ) : g h s}
(3.16)
For version spaces, the S and G set together form a condensed representation
for the version space. Indeed, in many (but not all) cases the border sets
will be smaller than the original solution set, while characterizing the same
information (as it is possible to recompute the solution set from the border
sets).
Example 3.18. Consider the constraint Q = (f req(h, D) 2) (f req(h, D)
3) with D dened as in Ex. 3.3:
D = {{s, m, b, c}, {s, m, b}, {s, m, c}, {s, m}}
Then S(T h) ={s m c, s m b}, and G(T h) = {b, c} as shown in Fig. 3.8.
Exercise 3.19. Give an example of a quality criterion Q of the form M A,
with M a monotonic predicate and A an anti-monotonic one, a data set D
and a language Lh , such that T h(Q, D, Lh ) is not a version space.
3.8 Borders
55
{}
{s}
{s, m}
{m}
{s, c}
{s, m, c}
{s, b}
{c}
{m, c}
{b}
{m, b}
{s, c, b}
{s, m, b}
{c, b}
{m, c, b}
{s, m, c, b}
In concept learning, one is given sets of positive and negative examples P and
N . The goal of learning (in an idealized situation where no noise arises), is
then to nd those hypotheses h that cover all positive and none of the negative
examples. Thus concept learning tasks employ the constraint
(rf req(h, P ) 100%) (rf req(h, N ) 0%)
(3.17)
56
Finally, note that the size of the border sets can grow very large. Indeed,
for certain hypothesis languages (such as item-sets), the size of the G set can
grow exponentially large in the number of negative examples for a conceptlearning task. Nevertheless, it should be clear that the size of any positive
border set can never be larger than that of the overall solution set.
(3.20)
(3.21)
Sometimes, the operators will be applied repeatedly. This motivates the introduction of the level n renement operator n :
if n = 1,
(h)
n (h) =
(3.22)
(h ) if n > 1
h n1 (h)
(3.23)
So, an ideal specialization operator returns all children for a node in the Hasse
diagram. Furthermore, these children are proper renements, that is, they are
not a syntactic variant of the original hypothesis. Ideal operators are used in
heuristic search algorithms.
is an optimal operator for Lh if and only if for all h Lh there exists
exactly one sequence of hypotheses = h0 , h1 , ..., hn = h Lh such that
57
with j (I M )
with l M : l j
(3.24)
(3.25)
(3.26)
(3.27)
If the mgg (or mgs) operator always returns a unique generalization (or
specialization), the operator is called the least general generalization lgg or
least upper bound lub (or the greatest lower bound glb). If the lgg and glb
exist for any two hypotheses h1 , h2 Lh , the partially ordered set (Lh , ) is
called a lattice. For instance, the language of item-sets LI is a lattice, as the
following example shows.
Example 3.23. Continuing the previous example, the operators compute
mgg(M1 , M2 ) = M1 M2
mgs(M1 , M2 ) = M1 M2
(3.28)
(3.29)
58
59
the start of this chapter, some algorithms compute all elements, k elements or
an approximation of an element satisfying Q. If all elements are desired, Stop
equals Queue=; when k elements are sought, it is | T h |= k. Finally, some
algorithms Prune candidate hypotheses from the Queue. Two basic types of
pruning exist: heuristic pruning, which prunes away those parts of the search
space that appear to be uninteresting, and sound pruning, which prunes away
those parts of the search space that cannot contain solutions.
As with other search algorithms in articial intelligence, one can distinguish complete algorithms from heuristic ones. Complete algorithms compute
all elements of T h(Q, D, Lh ) in a systematic manner. On the other hand,
heuristic algorithms aim at computing one or a few hypotheses that score
best w.r.t. a given heuristic function. This type of algorithm does not guarantee that the best hypotheses are found.
In the next few subsections, we present a number of instantiations of our
generic algorithm. This includes: a complete general-to-specic algorithm in
Sect. 3.11, a heuristic general-to-specic algorithm in Sect. 3.12, a branchand-bound algorithm for nding the top k hypotheses in Sect. 3.13, and a
specic-to-general algorithm in Sect. 3.14. Afterward, a further (advanced)
section on working with borders is included, before concluding this chapter.
60
2:{s}
6:{s, m}
11:{s, m, c}
7:{s, c}
3:{m}
8:{s, b}
9:{m, c}
4:{c}
5:{b}
10:{m, b}
12:{s, m, b}
61
Example 3.28. Let P = {{s, m, b}, {s, b, c}} and N = {{s, m}, {b, c}} be
the data sets; assume that the heuristic function used is m(h, P, N ) and that
the quality criterion is true if m(h, P, N ) > m(h , P, N ) for all h i (h). The
m(h, P, N ) function is a variant of the accuracy dened in Eq. 3.8:
m(h, P, N ) =
f req(h, P ) + 0.5
f req(h, P ) + f req(h, N ) + 1
(3.30)
The m function is used instead of acc to ensure that when two patterns have
equal accuracy, the one with the higher coverage is preferred. Assume also
that a beam search with k = 1, that is, hill climbing, is used. This results in
the search tree illustrated in Fig. 3.12. The nodes are expanded in the order
indicated.
62
2:{s} (0.625)
6:{s, m}(0.5)
3:{m}(0.5)
4:{c}(0.5)
5:{b}(0.625)
8:{s, b}(0.83)
7:{s, c}(0.5)
9:{s, m, b}(0.75)
10:{s, c, b}(0.75)
(3.32)
Given the current best value (or current k best values) v of the hypotheses
investigated so far, one can safely prune all renements of h provided that
v b(h).
The branch-and-bound algorithm essentially combines the previous two
algorithms: it performs a complete search but selects the hypotheses greedily
(according to their f values) and prunes on the basis of the bounds. Furthermore, it computes a single best hypothesis (or k best hypotheses) as in the
heuristic algorithm.
Example 3.29. Consider the function f (h) = f req(h, P ) f req(h, N ). The
quality criterion aims at nding patterns for which the dierence between
the frequency in P and in N is maximal. For this function f (h), the bound
63
1:{}(2;0)
2:{s} (2;1)
6:{s, m}(1;0)
3:{m}(1;0)
4:{c}(1;0)
5:{b}(2;1)
8:{s, b}(2;2)
7:{s, c}(1;1)
64
instance of the generic algorithm Algo. 3.10 (it is left as an exercise to the
reader to verify this), and also that the eciency of the algorithm can be
improved by, for instance, incrementally processing the examples in D. This
would eliminate our having to test the overall criterion Q over and over again.
Algorithm 3.5 A cautious specic-to-general algorithm
Queue := {};
Th := ;
while Queue = do
Delete a hypothesis h from Queue
if Q(h,D) = true then
add h to T h
else
select a hypothesis d D such that (h d)
Queue := Queue mgg(h, d)
end if
end while
return Th
65
1), note that if a hypothesis is a member of the G set, then all of its (proper)
specializations satisfy Q even though they cannot be maximally general and
therefore do not belong to G. W.r.t. 2), note that it is possible to test whether
a hypothesis h that satises Q is maximally general by computing i (h) and
testing whether elements of i (h) satisfy Q. Only if none of them satises Qcan
one conclude that h G. Here, i denotes an ideal generalization operator,
even though the general direction of the search is from general to specic.
Algorithm 3.6 Computing the G border general-to-specic.
Queue := {
};
Th := ;
while not Queue = do
Delete h from Queue
if Q(h,D) = true and h G then
add h to T h
else if Q(h,D) = false then
Queue := Queue o (h)
end if
end while
return Th
The dual algorithm for computing G from specic to general can be obtained by starting from and by generalizing only those hypotheses h that
satisfy Q (and do not belong to G). Even though the two algorithms compute
the same result, the eciency with which they do so may vary signicantly.
The direction that is to be preferred typically depends on the application.
By exploiting the dualities, one can devise algorithms for computing S as
well as the negative borders.
Exercise 3.33. Compute the S set for the problem of Ex. 3.3 using the
general-to-specic algorithm.
3.15.2 Computing Two Borders
Second, consider computing the borders of a version space as illustrated in Fig.
3.8. This could be the result of a quality criterion Q that is the conjunction of
an anti-monotonic and a monotonic predicate. To compute these borders, we
can proceed in several ways. One of these rst computes one border (say the
S set) using the techniques sketched above and then uses that set to constrain
the computation of the other border (say the G set). When searching from
general to specic for the G set and with the S set already given, hen all
hypotheses h that are not more general than an element in the S set can
safely be pruned in Algo. 3.6. By exploiting the various dualities, further
algorithms can be obtained.
66
The algorithm employs a new operation ms(g, e), the minimal specialization w.r.t. e:
ms(g, e) = min({g Lh | g g e c(g )})
Example 3.35. Applied to item-sets over I, this yields
(3.35)
ms(M1 , M2 ) =
{M1 }
if (M1 M2 )
{M1 {i} | i I (M1 M2 )} otherwise
67
(3.36)
68
Exercise 3.38. * When Lh = Le , the constraint e c(h) can often be rewritten as h e, and the dual one, e c(h), as (h e), where h is the target
hypothesis and e a specic positive or negative example. Consider now the
dual constraints e h and (e h). Are these constraints monotonic or
anti-monotonic? Also, can you illustrate the use of these constraints and compute the corresponding version space? Finally, can you extend the candidate
elimination algorithm to work with these constraints?
Exercise 3.39. Try to learn the father/2 predicate (in a relational learning
setting) in the following context. Let the background theory B be the set of
facts
male(luc)
female(lieve)
female(soetkin)
parent(luc, soetkin)
parent(lieve, soetkin)
69
Property 3.40. Let V S1 and V S2 be two version spaces with border sets S1 , G2
and S2 , G2 , respectively. Then V S = V S1 V S2 has border sets ints (S1 , S2 )
and intg (G1 , G2 ) respectively.
Version space intersection can now be used for learning concepts. To realize
this, compute the version spaces that correspond to each of the single examples
and incrementally intersect them.
Exercise 3.41. Solve the concept learning task in Exer. 3.20 by applying
version space intersection.
3.16 Conclusions
This chapter started by formalizing data mining and machine learning tasks
in a general way. It then focused on mechanisms for computing the set of
solutions T h(Q, D, Lh ). The search space Lh was structured using the important generality relation. Various quality criteria were proposed and their
properties, most notably monotonicity and anti-monotonicity, were discussed.
It was shown that these properties impose borders on the set of solutions
T h(Q, D, Lh ), and the notion of a version space was introduced. To compute
T h(Q, D, Lh ) various algorithms were presented. They employ renement operators which are used to traverse the search space. Ideal operators are especially useful for performing heuristic search and optimal ones for complete
search. Some of the algorithms work from general to specic, other ones from
specic to general. Finally, some algorithms work with the borders and there
are algorithms (such as candidate elimination) that are bidirectional.
70
4
Representations for Mining and Learning
72
learning and data mining. However, there exist dierent possible ways for
choosing Lh , Le and c in logic, and they result in dierent settings for learning. The most popular settings are learning from entailment and learning
from interpretations. Learning from entailment was used in Chapter 1, in
the structure-activity relationship prediction problem, whereas learning from
interpretations was the setting used throughout the previous chapter, when
introducing machine learning and data mining principles. We now introduce
these two settings formally.
In learning from entailment, the languages Le , Lh are logical formulae,
typically subsets of clausal logic, and the covers relation c corresponds to
logical entailment. More formally:
Denition 4.1. When learning from entailment, Le and Le are logical formulae and c(H, e) = true if and only if H |= e.
When working in clausal logic, examples typically correspond to single clauses
and hypotheses to sets of clauses. Hence, Le is a set of clauses, and Lh is a
set of theories, that is, a set of sets of clauses. We write H using uppercase
characters because it corresponds to a set of clauses, and e in lowercase because
it denotes a single clause.
Example 4.2. Let us consider the domain of animals and assume that we have
a blackbird that ies. This bird could be represented using the following clause
e:
ies black, bird, hasFeathers, hasWings, normal, laysEggs
Let H now be the theory:
ies bird, normal
ies insect, hasWings, normal
Because H |= e, the hypothesis H covers the example e.
An alternative inductive logic programming setting that is frequently employed in data mining, and in computational learning theory as well, is that of
learning from interpretations. When learning from interpretations, Lh is a set
of logical formulae, most often subsets of clausal logic, and Le a set of interpretations (or possible worlds). Furthermore, the covers relation corresponds
to satisability. More formally:
Denition 4.3. When learning from interpretations, Le is a set of interpretations, Lh is a set of logical formulae, and c(H, e) = true if and only if e is
a model of H.
For practical reasons, Le is typically restricted to Herbrand interpretations,
which is also what we will assume from now on.
Example 4.4. The previous example can be represented using the interpretation e :
73
74
within data mining, machine learning, neural networks, statistics, etc. Its popularity is to a large extent due to its simplicity and the fact that it can be
represented in tabular form. This implies that data mining tools working with
these representations can elegantly be coupled to other table-based software
such as relational databases and spreadsheets.
Consider Table 4.1, which is due to Quinlan [1986]. It contains information
about situations in which the weather is good (positive), or bad (negative)
for playing tennis. In this table, each row corresponds to an example, and
each column corresponds to an attribute. Furthermore, the examples have
exactly one value specied for each of the attributes. In database terminology,
this means that examples are tuples in a table (or relation). Therefore, the
attribute-value representation makes the single-table single-tuple assumption.
Each attribute A also has a domain d(A), which species the set of values
the attribute can take. In this book, we shall consider the following types of
domains:
nominal : the domain consists of a nite set of discrete values,
ordinal : the values of the domain are enumerable and totally ordered,
continuous: the domain is the set of real numbers.
75
76
(4.1)
(4.2)
The rst constraint states that an example can only have one value for each
attribute Ai ; the second one that this value belongs to the domain d(Ai ). The
reader may want to write down the constraints for the playtennis example.
Boolean and attribute-value representations are collectively referred to as
propositional representations.
Exercise 4.7. How can one represent a boolean learning problem using
attribute-value representations? Can one also represent attribute-value learning problems using boolean representations? If so, are the two representations
equivalent? Or, is there something that is lost?
77
are not. Furthermore, persons belonging to a carrier family may, but need
not necessarily suer from the disease. Being aware of this problem, the data
collectors have collected the data at the family level. There are two classes
of families. The rst is the carrier type family, where the disease has already
occurred in the past, and the second, is the one where the disease has not yet
occurred. For each person of the carrier families there is experimental data.
Thinking about the problem you realize that there is an asymmetry in it.
Indeed, it is safe to assume that none of the persons belonging to non-carrier
families suers from the disease, whereas for the carrier families it is reasonable
to assume that there exists at least one person who suers from the disease.
At this point, you decide it is better to analyze the data at the family level
and to classify a person as being at risk with regard to the genetic disease if
he or she belongs to a family that is classied as a carrier. The representation
you propose describes each person using an attribute-value representation and
each family as a set or bag of such persons, and classies families according
to whether they are carriers or not.
The question now is how to represent this type of problem. The main point
is that the examples now consist of a set of tuples in a table. In Table 4.2,
the examples are families, each of which corresponds to a set of persons, and
each person is described by a feature vector. So, a multi-instance example can
be represented using a single clause. For instance, the rst example would
correspond to the clause
class(neg) person(aa, aa, aa, bb), person(aa, aa, aa, aa)
or, alternatively, using the interpretation,
{person(aa, aa, aa, bb), person(aa, aa, aa, aa)}.
Notice that the number of atoms in the examples for the predicate person
does not have to be equal to 1, and also that it may dier according to the
example. Thus, multi-instance learning examples are essentially sets of tuples.
This corresponds to the single-table multiple-tuple assumption.
To represent hypotheses, various approaches can be taken. The simplest
one is to employ the hypotheses language for attribute-value learning. Continuing Ex. 4.8, a family is classied as carrier if there exists one person (that is,
one tuple) in the family for which the query succeeds. Under this assumption,
all positive and no negative examples (represented as clauses) in Table 4.2 are
covered by
class(pos) person(ab, bb, G3, G4).
This is the traditional multi-instance learning setting, where examples are
classied as positive if one of its instances satises some specied conditions.
This results in clauses having exactly one literal in their condition part.
Alternatively, more expressive hypothesis languages can be employed. Consider clauses involving two conditions
78
Exercise 4.9. Assume that the maximum number of tuples within a multiinstance example is lower than k. Can one then represent a multi-instance
learning problem using attribute-value representation? What are the problems
associated with this? (The solution to this exercise will be discussed in Sect.
4.11.)
79
80
attendsParty(adams)
participant(adams, researcher, scuf),
subscription(adams, erm),
subscription(adams, so2),
...
Observe that in this type of representation the target attribute Party of
participant is projected away as it is now represented by the target predicate attendsParty. Without projecting away the attribute Party, learning the
relation attendsParty would be trivial. So, we are actually using the relations
in Fig. 4.2.
It is not straightforward how to construct clauses of the above type. For
completeness, all facts in the database should be included in the condition
part of the clause. This is usually not done because it is impractical. There
are two possible alternatives. First, syntactic restrictions on the clauses can be
imposed such that only the information relevant to the example is included.
This corresponds to imposing a syntactic bias on the examples. In the summer
school illustration, the following clause for blake could be employed:
attendsParty(blake)
participant(blake, president, jvt),
subscription(blake, erm),
subscription(blake, cso),
course(cso, 2, introductory),
course(erm, 3, introductory),
company(jvt, commercial).
This clause includes only those tuples that are directly concerned with
the participant blake, her company, the subscriptions she takes and the corresponding courses. Secondly, the globally relevant facts (such as those concerning the courses and the companies) could be assembled in the background
knowledge, as will be explained in more detail in Sect. 4.9. One clause covering the example blake is attendsParty(N) participant(N, president, C). So,
typically, examples as well as hypotheses in multi-relational representations
consist of both multiple relations and multiple tuples (or atoms).
Example 4.11. Consider the Bongard problem listed in Fig. 4.4. Bongard problems contain six positive and six negative examples, and the task is to nd
a description of the underlying concept. Can you guess what the concept is
in Fig. 4.4? The dierent scenes in the Bongard problem can be represented
using a relational representation. Indeed, two of the leftmost scenes can be
represented using the following clauses:
pos circle(c), triangle(t), in(t, c)
pos circle(c1), triangle(t1), in(t1, c1), triangle(t2)
So, the idea is to name the objects by constants and to explicitly represent
the relations that hold among them. Furthermore, a hypothesis that covers
all positive examples and no negative example is
Job
Company
researcher
scuf
president
jvt
manager pharmadm
manager
jvt
researcher
scuf
researcher pharmadm
(a) participant
81
Party
no
yes
no
yes
yes
no
Name Course
adams erm
adams so2
adams srw
blake cso
blake erm
king
cso
king erm
king
so2
king
srw
miller so2
scott erm
scott srw
turner so2
turner srw
(b) subscription
Course Length
Type
cso
2
introductory
erm
3
introductory
so2
4
introductory
srw
3
advanced
(c) course
Company
Type
jvt
commercial
scuf
university
pharmadm university
(d) company
Fig. 4.1. The summer school database (adapted from [De Raedt et al., 2001])
82
Job
Company
researcher
scuf
president
jvt
manager pharmadm
manager
jvt
researcher
scuf
researcher pharmadm
(a) person
Name
blake
miller
scott
(b) attendsParty
course
sub m
participant
wf
company
Fig. 4.3. The Entity-Relationship model for the summer school database
Fig. 4.4. A Bongard problem after [Bongard, 1970]. Reprinted with permission from
[Van Laer and De Raedt, 2001]
83
Fig. 4.5. The train problem of Stepp and Michalski [1986]. Reprinted from [Stepp
c
and Michalski, 1986], page 53, 1986,
with permission from Elsevier
84
85
86
Art the
Noun dog
Verb bites
The language that this grammar accepts contains the single string the dog bites.
Note that grammar rules are very similar to clauses. The two dierences are
that the symbol is used instead of and that the order of the symbols
on the righthand side of the rules is important. The similarity between clauses
and grammar rules is also useful for reasoning with grammars. Indeed, deriving
strings (such as the dog bites) from a grammar can be done using a resolutionlike mechanism.
Example 4.15. Starting from the grammar G, one can derive the following
sequence of rules:
S NP VP
S Art Noun VP
S the Noun VP
S the dog VP
S the dog Verb
S the dog bites
Given that S is the starting symbol, one can conclude that the string
the dog bites is accepted by the grammar G. Furthermore, this is the only
string that is accepted by our simple grammar.
The next rule n b1 . . . bi1 a1 . . . an bi+1 . . . bm in the above sequence of rules
is obtained from the rules n b1 . . . bm and bi a1 . . . an where bi is the
rightmost non-terminal symbol in b1 . . . bm . This closely mirrors the resolution
inference rule. Abusing logical notation, we shall write
n b1 . . . bm bi a1 . . . an |= n b1 . . . bi1 a1 . . . an bi+1 . . . bm (4.3)
This analogy between clausal logic and grammars can now be exploited for
data mining purposes. Assume we are given examples such as S the dog bites
and S the cat runs; then the grammar G together with the two rules
Verb runs and Noun cat covers the examples. So, a setting that is very
close to learning from entailment is obtained for working with sequences and
strings. This implies that the principles underlying the mining of sequences
are similar to those of relational data mining.
An alternative for employing grammars to represent formal languages is
to employ relational or logical notations. This is illustrated in the following
example.
87
Example 4.16. Reconsider the grammar G introduced in Ex. 4.14. This grammar can be represented in relational form as follows:
art(P1, P2, the) succ(P2, P1)
noun(P1, P2, dog) succ(P2, P1)
verb(P1, P2, bites) succ(P2, P1)
where the variables starting with a P denote positions, and atoms such as
vp(P1, P2) succeed when the part of the sentence from position P1 to P2 is a
verb phrase (vp). The clause
s(0, 3)
art(0, 1, the), noun(1, 2, dog), verb(2, 3, bites),
succ(1, 0), succ(2, 1), succ(3, 2).
is covered by the grammar and it represents the sentence the dog bites. Instead
of using a relational formalism, the programming language Prolog can be
employed, yielding the following clauses:
art([the|X], X)
noun([dog|X], X)
verb([bites|X], X)
Because of the direct correspondence between this program and the contextfree grammar G of Ex. 4.14, this type of logic program is sometimes called
a denite clause grammar. The example sentence would now be represented
as s([the, dog, bites], []) . At this point, the reader familiar with Prolog may
want to verify that this example is entailed by the program.
To summarize, it is possible to represent sequential data and hypotheses using
relational or rst-order logic. Furthermore, even the more traditional grammar
representations employ rules which are very close to clausal notation. This
implies that techniques and principles for learning relational representations
also apply to mining sequential data.
88
The following hypothesis covers the rst example but does not cover the second one. It is illustrated in Fig. 4.7.
parsetree(s(np(art(A), noun(N1)), vp(verb(V), np(art(A), noun(N2)))
np
art
vp
np
vp
np
noun verb
art
noun
verb
the
cat
bites
art noun
the
dog eats
the rabbit
np
art
vp
noun verb
np
art noun
N1
A N2
The above example clearly shows that tree-structured examples can naturally be represented using logical terms. One of the advantages of using logical
terms for representing trees is that unication can be employed for pattern
4.8 Graphs
89
matching, which allows one to impose restrictions requiring that two subtrees
be identical. For example, the hypothesis in Ex. 4.17 only covers examples in
which the two articles are identical. One disadvantage of the use of standard
logical terms for representing trees is that unication imposes conditions from
the root towards the leaves of the trees, which makes it harder to express conditions such as there exists a subtree noun(dog) in the tree. Because denite
clause logic can be used as a programming language, such hypotheses can still
be represented. Indeed, the clause parsetree(P) occursin(noun(dog), P) together with an appropriate denition of the predicate occursin/2 covers all
parse trees in which noun(dog) occurs. Typically, such additional predicates
have to be dened by the user and are part of the background knowledge; cf.
Sect. 4.9. Obviously, sequences can be represented using terms as well. This
is realized using lists.
Exercise 4.18. Implement the predicate occursin/2 in Prolog.
Exercise 4.19. Represent the example sequences and hypothesis from Ex.
4.14 using terms.
Exercise 4.20. Suppose you have data about sequences of events. How can
you represent a sequence as a logical term? Can you represent, using a query
of the above type, the concept of sequences in which a certain event e occurs?
Exercise 4.21. Can one represent trees using a relational representation, that
is, without using terms? (The solution to this exercise is discussed in Sect.
4.11.)
4.8 Graphs
Another powerful data structure that belongs to the folklore of computer
science is that of graphs. Formally, a graph (V, E) consists of a set V of vertices
and a set E of edges, where E is a relation over V V . Several variants exist
that take into account labels of edges and vertices. Data in the form of graphs
arises in two quite dierent and yet natural settings. The rst setting is where
each data point corresponds to a graph, and this setting is typically known
as graph mining. One quite popular application of graph mining is that of
mining sets of molecules. The second setting is where the data set itself is one
large graph. As an illustration, consider the world wide web. Each document
is a node in the graph and there are links among these nodes. The terms
link analysis and link discovery have recently become popular to describe
(aspects of) the second setting [Getoor, 2003]. Because of the importance of
and current interest in graph data, let us discuss these settings in more detail
and illustrate them using real examples.
90
Example 4.22. Suppose you are a chemist faced with the problem of predicting
which compounds (or molecules) have a certain toxic eect (for instance, carcinogenicity, that is, causing cancer). The structure of the compounds under
consideration is diverse but crucial in causing the eect. The two-dimensional
structure of a simple molecule, named methane (CH4 ), is depicted in Fig. 4.8
on the left. This two-dimensional structure is essentially a graph. If one names
the vertices, that is, the atoms, in the graph, a relational representation can
be used to represent the graph (cf. the right of Fig. 4.8). For our example
molecule, we obtain the following description
atom(a1, c)
atom(a2, h)
atom(a3, h)
atom(a4, h)
atom(a5, h)
bond(a1, a2, s)
bond(a1, a3, s)
bond(a1, a4, s)
bond(a1, a5, s)
for representing the atoms and bonds. The s indicates that there is a single
bond among the atoms. Substructures can easily be represented by clauses.
For instance, the following substructure requires that there be two atoms of
the same type that are bonded to a carbon (c) atom:
substructure
atom(X, c), bond(X, Y, T),
atom(Y, T), bond(X, Z, W),
atom(Z, T), Y = Z.
a2
a3
a1
a5
a4
Fig. 4.8. A molecule as a graph
Once the graphs are represented using relations, they can be treated as
any other multi-relational data set. Nevertheless, for some purposes, it may
still be useful to work with alternative representations for graphs, such as
adjacency matrices, directly. Such alternative representations may allow one
91
92
93
food drink
softdrink coke
...
These clauses can now be used to complete examples. For example, the itemset {hoegaarden, duvel, camembert}, the actual basket containing two famous
Belgian beers and French cheese, can now be completed by
{cheese, drink, alcohol, beer, food, product}
in the minimal Herbrand of the item-set. Using the completed examples enables the discovery of association rules at various levels of abstraction, such as
beer cheese. Note that the taxonomy employed need not be tree-structured.
94
product
nonfood
food
drinks
softdrink
coke
pepsi
cheese
...
...
...
...
camembert
...
cocacola
This example also illustrates one of the main points of the use of expressive representation languages and background knowledge. It becomes possible
to emulate and represent many of the special cases and variants of existing
approaches that have been developed. In this context, the example illustrates
that a general relational association rule miner would be able to emulate the
traditional association rule mining setting with taxonomies. Of course, the
more general learner may pay a (computational) price for this generality; cf.
Chapter 6.
Example 4.30. Reconsider the Bongard problem or Ex. 4.11. There one could
employ clauses such as
1
Some of the early inductive logic programming systems were called extensional
because they were not able to employ intensional clauses.
95
polygon(P) triangle(P)
polygon(P) square(P)
...
inside(O1, O2) in(O1, O2)
inside(O1, O2) in(O1, O3), inside(O3, O2).
Using these clauses, the example
{circle(c1), triangle(t1), in(t1, c1), triangle(t2), in(t2, t1)}
could be completed with the following facts
{inside(t1, c1), inside(t2, t1), inside(t2, c1), polygon(t1), polygon(t2)}.
Example 4.31. In molecular applications, such as the one presented in Ex. 4.22,
researchers have applied complex predicate denitions to dene functional
groups and ring structures. One (slightly simplied) example of such a rule
denes a nitro group used in the mutagenicity application [Srinivasan et al.,
1996]:
nitro(Molecule, Atom0, Atom1, Atom2, Atom3)
atom(Molecule, Atom1, n, 38),
bond(Molecule, Atom0, Atom1, 1),
bond(Molecule, Atom1, Atom2, 2),
atom(Molecule, Atom2, o, 40),
bond(Molecule, Atom1, Atom3, 2),
atom(Molecule, Atom3, o, 40).
The last arguments of the relations bond and atom specify the bond and atom
type, respectively.
96
97
This denition is not only recursive, it is also quite complex, which implies
that it will be hard to generate using an inductive logic programming system.
So, why not employ a slightly dierent representation for sequences and
hypotheses? Let us use the notation
emacs(chapter2, tex) latex(chapter2, tex) bibtex(chapter2, tex)
xdvi(chapter2, dvi) dvips(chapter2, dvi) lpr(chapter2, ps)...
to denote sequences, and
emacs(F, tex) latex(F, tex)
to denote a pattern. Furthermore, a pattern p1 . . . pn covers a sequence
s1 . . . sm if and only if there exists a substitution and a number i
{1, . . . , m} such that p1 = si . . . pn = si+n1 . This setting will be
referred to as that of logical sequences. Note that the above pattern covers
the above sequence of commands with i = 1 and = {F chapter2}. Employing the logical sequence representation is not only much simpler and natural
than the ones previously discussed, it is also much more ecient. It can be
shown that one can decide whether a sequential pattern covers a sequence of
atoms in polynomial time.
Exercise 4.32. * Design the equivalent of clauses to encode background
knowledge in the logical sequence setting. (Hint: use a representation based
on grammar rules.)
(4.4)
98
In boolean representations, it is also typical to allow for negative literals, that is,
negated conditions, in clauses.
99
100
Example 4.35. Reconsider the playtennis example of Table 4.1. Each attribute
Att with its corresponding domain d(Att) can be mapped onto a set of boolean
variables that indicate whether Att = value. For instance, the rst example
in Table 4.1 corresponds to the interpretation
{ outlook = sunny , temp = hot , humid = high , windy = no }.
where outlook = sunny denotes the propositional variable yielding the value
true when the attribute outlook has the value sunny, and false otherwise. All
other propositional variables in this example do not occur in the interpretation, and hence are false. In a similar vein, one can transform rules from
attribute-value format to boolean format.
It is easy to see that the two mappings just introduced form a reduction from AV to BL. When applying the reductions in a practical setting,
one must realize that the constraints shown in Eqs. 4.1 and 4.2 are no
longer automatically satised, and hence are lost in the reduction. These
constraints specied that for each attribute and example there is exactly
one value. When looking at, for instance, the attribute outlook with domain {sunny, rainy, overcast}, the boolean representation no longer guarantees that when the proposition outlook = sunny is true the propositions
outlook = overcast and outlook = rainy must be false.
4.11.2 From M I to AV
Secondly, let us consider how to reduce a multi-instance problem to an
attribute-value representation, that is, how M I AV . A reduction for this
case must map every multi-instance example onto a single tuple in a single
table.
The rst naive approach to reducing M I to AV imposes an upper bound
on the number of possible instances in an example.
Example 4.36. Consider the multi-instance example
{object(red, triangle), object(blue, circle)}
The number of instances for this example is 2 and assume that this is also an
upper bound. At this point, one might map this example onto
{obj2(red, triangle, blue, circle)}
The reduced example has twice the number of attributes as the original one.
There are several problems with this approach. First, the reduced example
is not unique. Indeed, in the above example, it was implicitly assumed that
the red triangle was the rst instance and the blue circle the second one.
Multi-instance examples are, however, unordered, and therefore an equivalent
reduced example would be
101
object(red, triangle)
object(red, circle)
object(blue, triangle)
object(blue, circle)
These can now be employed to describe the original example. Indeed, each
of these attributes has the value true or false. Hence, one can describe the
example using the following propositional interpretation:
{ object(X, Y) , object(red, X) , object(blue, X) ,
object(Y, circle) , object(red, triangle) , object(blue, circle) }
102
Exercise 4.38. In Ex. 4.37, if one only employs the leftmost queries, does
one still have a reduction?
4.11.3 From RL to M I
The next question to address is whether relational learning problems can
be transformed into multi-instance learning problems. The main dierence
between these two types of representations, is that relational representations
allow as their name indicates for multiple relations. So how can one then
reduce these multiple tables to a single table? The theory of databases has
introduced the notion of the universal relation for this purpose. The universal
relation consists of the Cartesian product of the underlying relations. This
concept can directly be applied for obtaining a reduction.
Example 4.39. Let us illustrate this concept on a reduced version of the
summer school database, in which there is only one participant, scott, two
courses, erm and srw, and two companies, scuf and pharmadm. Let us assume that all tuples involving any other course, company or participant have
been deleted from Fig. 4.1. The resulting relations as well as the universal
relation over these relations are shown in Fig. 4.10. The relational example
participant(scott, researcher, scuf) is now turned into 1 2 2 2 = 8 tuples
for a single relation. Also, any clause over the relations in the original database
can be expanded into a clause over the universal relation. For instance, the
clause
attendsParty(P)
participant(P, researcher, C),
subscription(P, C ),
course(C , L, advanced)
corresponds to
attendsParty(P) ur(P, researcher, C, P, C , C , L, advanced).
Reducing clauses involving more than one occurrence of a predicate may require a multi-tuple hypothesis rather than a multi-instance one.
The previous example can easily be generalized from the summer school
database context. It shows that in general it is possible to reduce a relational
learning problem to multi-instance (or multi-tuple) learning one. Nevertheless,
it should also be clear (from database theory as well as the above example)
that this reduction is combinatorially explosive and therefore not to be used
in practice. For instance, for applications in computational chemistry, such
as that illustrated in Ex. 4.22, small molecules have 40 atoms and 80 bonds.
Whereas the original relational representation would involve about 120 tuples,
the Cartesian product would already contain 3,200. This is computationally
prohibitive. Nevertheless, the above reduction is sometimes adapted for propositionalization, as will be explained in the next section.
Notice that because RL M I and M I AV , RL can also be reduced to
AV by applying the two reductions in sequence.
103
Name
Job
Company
scott researcher
scuf
(a) participant
Name Course
scott erm
scott srw
(b) subscription
Course Length
Type
erm
3
introductory
srw
3
advanced
(c) course
Company
Type
scuf
university
pharmadm university
(d) company
Name
scott
scott
scott
scott
scott
scott
scott
scott
4.11.4 From LP to RL
The remaining question concerning our hierarchy is whether LP RL. Upon
a rst investigation, this seems implausible, because LP is a programming
language and RL is not. Nevertheless, there exists a useful transformation
from LP to RL that is, however, not a proper reduction. It is the so-called
attening operation introduced by Rouveirol [1994].
There are basically two important dierences between logic programs and
relational expressions. First, logic programs may contain recursive denitions,
such as the successor, ancestor, member or append relations. As there also
exist extensions of relational databases, such as Datalog, that support recursion, we will not further deal with this aspect of the representation here.
Dealing with recursive clauses in an inductive logic programming setting will
be discussed in Chapter 7. Secondly, logic programs may contain structured
terms that represent the underlying data structures such as lists and trees; cf.
104
Sect. 4.7. The attening transformation takes as input a single clause involving structured terms and generates a attened clause (without functors) and
a number of facts. To atten a clause involving structured terms, introduce
for each functor f of arity n a new predicate pf of arity n + 1. The predicate
pf is then dened by the fact pf (X1 , ..., Xn , f (X1 , ..., Xn )) . This type of
predicate will be called a functor predicate. More formally:
Denition 4.40. Let c be a clause; then f lat(c) =
if c contains a structured term f (t1 , ..., tn ), then return f lat(c ) where c is c
with all occurrences of f (t1 , ..., tn ) replaced by V and with pf (t1 , ..., tn , V )
added to the condition part of c;
return also the fact pf (X1 , ..., Xn , f (X1 , ..., Xn )) ;
otherwise return c.
Example 4.41. Flattening the member program, that is, the two clauses
member(X, cons(X, Y))
member(X, cons(Y, Z)) member(X, Z).
(where we use cons(X, Y) to denote the list [X|Y]) yields
member(X, V) pcons(X, Y, V).
member(X, V) pcons(Y, Z, V), member(X, Z).
pcons(X, Y, cons(X, Y))
The inverse operation is called unattening and is dened as follows:
Denition 4.42. Let c be a clause, then unf lat(c) =
if c contains a literal referring to a functor predicate pf , then return unf lat(c )
where c is the resolvent of the fact pf (X1 , ..., Xn , f (X1 , ..., Xn )) with
the clause c;
otherwise, return c.
Unattening a attened clause yields the original clause again:
Property 4.43. If c is a clause then unf lat(f lat(c)) = c, provided that the
functor predicates are known.
Flattening also preserves entailment:
Property 4.44. When P is a denite clause program, c a clause, and c and P
do not contain any functor predicates, then P |= c if and only if f lat(P ) |=
f lat(c).
Despite these properties, the attening clauses do not yield theories in relational form. The reason is that the attening removes functors from clauses
only to add them back through the denition of the functor predicates. Thus,
attening is only useful to manipulate single clauses; it does not really help
at the program level. In order to be able to transform full programs into relational form, many practitioners of inductive logic programming have often
employed a variant of the attening operation that works on sets of ground
facts or interpretations.
105
Denition 4.45. Let q(t1 , ..., tn ) be a ground fact. The attened interpretation f lati (I) of an interpretation I is
f lati (I) =
({q(ct1 , ..., ctn )}
q(t1 ,...,tn )I
{fp (cu1 , ..., cum , cf (u1 ,...,um ) )|f (u1 , ..., um )is a sub-term of some ti })
where each ct denotes a unique constant.
Example 4.46. Flattening the interpretation I
{append([1], [2], [1, 2]); partition(2, [1], [1], []); sort([], []);
sort([1], [1]); sort([2, 1]), [1, 2])}
yields f lati (I):
{append(c[1] , c[2] , c[1,2] ), partition(c2 , c[1] , c[1] , c[] ), sort(c[] , c[] ),
sort(c[1] , c[1] ), sort(c[2,1] , c[1,2] ) consp(c1 , c[2] , c[1,2] ),
consp(c1 , c[] , c[1] ), consp(c2 , c[1] , c[2,1] ), consp(c2 , c[] , c[2] )}.
This operation has been used in many attempts to synthesize programs
from examples using systems that employ relational representations only.
These systems started by attening the examples, such as sort([2, 3, 1], [1, 2, 3]),
and then adding the resulting interpretation to the relational database. When
applying this transformation, the reader should keep in mind that it is not a
proper reduction and also that the transformation is combinatorially explosive. The reason for this is that the converse of the following property does
not hold, as illustrated in the example below.
Property 4.47. If I is an interpretation that is a model for the clause c a clause,
then f lati (I) is a model of at(c).
Example 4.48. The reader may rst want to verify that the property holds for
the interpretation specied in Ex. 4.46 and the clause
sort([A|B], S)
partition(A, B, C, D), sort(C, E),
sort(D, F), append(E, [B, F], S).
Example 4.49. Consider the clause nat(s(X)) nat(X), stating that the successor of X is a natural number if X is a natural number. Although the interpretation {nat(s(0)), nat(0)} is not a model for the clause, it is easily veried
that the attened interpretation {nat(cs(0) ), nat(c0 ), sp(c0 , cs(0) )} is a model
of the attened clause nat(Y) sp(X, Y), nat(X).
106
4.12 Propositionalization
The previous section introduced a hierarchy of representations and studied the
relationships among the various representational formalisms. It was shown
that some representational formalisms can be reduced to one another. For
instance, RL problems can be reduced to M I form, and M I problems can
be reduced to AV format. On the other hand, it was also argued that these
reductions cannot be applied on real data sets because of the enormous computational costs and combinatorics involved. At this point, the question arises
as to whether it might be possible to control the combinatorial explosion in
some way. When it is impossible to compute the reduced data set, one might
still attempt to approximate it. An approximation to a complete reduction in
AV form is called a propositionalization. It might be an approximation in the
sense that the functions fe and fh are not a reduction in the formal sense, that
is, for some examples e and hypotheses h, c(h, e) = c(fh (h), fe (e)); in other
words, the coverage of h w.r.t. e might be dierent than that for fh (h) and
fe (e), which would imply that some information is lost in the transformation.
If such inconsistencies occur only very rarely, the transformation might still
be useful, because the propositionalized problem might still capture many essential features of the problem, and a traditional propositional learner may
be applied successfully to the propositionalized problem.
One advantage of such propositionalization is that the whole set of traditional learning algorithms, including neural networks, statistics, support
vector machines and so on, can be applied to the propositionalized problem.
The disadvantage is that the propositionalized problem might be incomplete
and that some information might get lost in the propositionalization process.
In the past few years, many approaches to propositionalization have been developed. The majority of these directly transform a relational description into
an attribute-value one, though some also consider the intermediate level of
multi-instance descriptions; cf. [Zucker and Ganascia, 1998]. In line with the
philosophy of the book, we sketch in the remainder of this section two dierent
types of propositionalization and discuss some general issues, rather than provide a detailed survey of the many specic approaches to propositionalization
that have been developed over the past few years.
4.12.1 A Table-Based Approach
The rst approach to propositionalization builds an approximation of the universal relation sketched in Sect. 4.11.3. It typically employs the learning from
entailment setting, and starts from a set of positive and negative examples
(in the form of ground facts) as well as from a clause h b1 , . . . , bm dening the unknown target predicate. It then computes all substitutions that
ground the clause and for which h is an example and all the bi are true.
The resulting substitutions are then listed in a table together with the class
4.12 Propositionalization
107
P
adams
blake
king
miller
scott
turner
J
C
T
Party
researcher
scuf
university no
president
jvt
commercial yes
manager pharmadm university no
manager
jvt
commercial yes
researcher
scuf
university yes
researcher pharmadm university no
108
The table-based approach as sketched so far only works when the obtained
table satises the single-tuple assumption: every example should be mapped
onto a single tuple. In general, this will not be the case. For example, if the
clause
attendsParty(P) participant(P, J, C), company(C, T), subscribes(P, C )
is used, there are multiple tuples for some of the participants in the table. So,
a multi-instance problem would be obtained rather than an attribute-value
one, and therefore, a multi-instance learning algorithm could be applied. As
far as the author knows, the use of multi-instance learners in propositionalization has not yet been investigated systematically. If on the other hand,
an attribute-value representation is targeted, then one should only follow relations of type (n:1) and (1,1) when starting from the target relation. This
concept has been formalized in the inductive logic programming literature under the term determinacy; cf. Muggleton and Feng [1992], which guarantees
that the resulting problem is in attribute-value format (cf. also Sect. 10.2).
Exercise 4.51. Assume that the target relation in the summer school database
is subscription. Specify a feasible clause that results in an attribute-value representation, and specify one that yields a proper multi-instance representation.
4.12.2 A Query-Based Approach
The second approach has already been demonstrated in Ex. 4.37 when discussing the reduction from multi-instance to attribute-value learning. The idea
there can be generalized. Essentially, one starts from a language of queries Lq
which species the set of possible queries. A complete transformation then
employs all queries expressible in this language. Whereas the language in Ex.
4.37 allowed for a single occurrence of the predicate object, in a general relational setting, one will typically employ more complex relational queries
involving multiple literals. For instance, in the Bongard problem illustrated
in Ex. 4.11, one might employ, for instance, the following queries:
triangle(T)
circle(C)
triangle(T), in(T, C)
triangle(T), in(C, T)
The naive approach to query-based propositionalization generates all
queries that are expressible within the language Lq . To keep the number of
such queries within reasonable limits, the user must either carefully engineer
the language Lq or else lter the features so that only the most interesting
ones are retained. Even though there is a wide range of query-based propositionalization techniques available, the underlying principles often remain the
same.
To illustrate engineering the language Lq , consider the choices made in
the rst propositionalization system, Linus, by Lavrac et al. [1991]. If the
4.13 Aggregation
109
goal is to learn a target predicate p/n, Linus learns clauses of the form
p(V1 , . . . , Vn ) b1 , . . . , bm where the variables Vi are the only possible arguments of the atoms bi . The queries in the language Lq then correspond
to all the atoms bi that can be constructed in this way. For instance, when
learning the predicate daughter(X, Y) in terms of parent, male and female, the
language Lq contains queries corresponding to the following atoms (where we
have abbreviated the predicate names):
p(X, X), p(Y, Y), p(X, Y), p(Y, X), m(X), m(Y), f(X), f(Y).
Two approaches exist to ltering the features. One approach imposes hard
constraints on the features of interest. A popular constraint is to require that
the query succeeds for at least x instances, where x is a user-set threshold. This
corresponds to imposing a minimum frequency threshold in frequent pattern
mining; cf. Sects. 3.4 and 6.5. The other approach heuristically searches the
space of possible queries and evaluates each query according to some measure
of interestingness. This search process resembles that of rule learning (cf.
Sect. 6.3) and indeed heuristic query-based approaches are often variants of
rule learners, or they post-process rules generated by a multi-relational rule
learner; cf. [Srinivasan and King, 1999a].
The existing approaches to propositionalization fall into two categories.
The static ones rst propositionalize and then run the attribute-value learner.
The dynamic ones intervene the propositionalization and mining processes.
They incrementally generate a number of features and use these for learning.
If the quality of the learned hypothesis is not satisfactory, new features are generated and this process is repeated until there is no more improvement. Most
of the present propositionalization approaches are static, but see [Landwehr
et al., 2007, Popescul and Ungar, 2007] for two dynamic propositionalization
approaches.
4.13 Aggregation
When querying a database, the specic tuples that belong to a certain table
may be less interesting than the aggregated information over the whole table. Aggregation is related to propositionalization because it also reduces the
available information, and presents it in a more compact form, most often resulting in a loss of information. Aggregated attributes are typically functions
of either all tuples in a table or of a specic attribute in the table. Example
aggregate functions include:
COUNT, which counts the number of tuples in the table, or the number
of values for an attribute,
SUM, which computes the sum of the values for a specic attribute,
AVG, which computes the average of the values for a specic attribute,
MIN and MAX, which compute the minimum and maximum values for a
specic attribute.
110
This convention is similar to the semantics of the well-known bagof/3 and setof/3
predicates in Prolog.
4.13 Aggregation
Course
erm
so2
srw
(a)
111
COUNT
3
(b)
Part C
adams 3
blake 2
king 4
miller 1
scott 2
turner 2
(b) Result.
states that participants will attend the party if they take at most two courses.
Aggregates are popular in relational data mining because they can be used
to reduce a multi-instance learning problem to an attribute-value learning
problem, and in this way form an important tool for propositionalization.
Example 4.54. Consider the table-based propositionalization approach with
regard to the query
attendsParty(P) participant(P, J, C), subscribes(P, C )
This results in the table listed in Fig. 4.13a, which corresponds to a multiinstance learning problem. When using the clause
attendsParty(P) participant(P, J, C), V is COUNT{C |subscription(P, C )}
one obtains the attribute-value learning problem in Fig. 4.13b.
Exercise 4.55. Can you provide an example that illustrates the use of aggregation and that does not involve a reduction to an attribute-value learning
problem?
112
C
erm
so2
srw
cso
erm
cso
erm
so2
srw
so2
erm
srw
so2
srw
P
J
C
adams researcher
scuf
blake president
jvt
king manager pharmadm
miller manager
jvt
scott researcher
scuf
turner researcher pharmadm
(b) Aggregated instances
V
3
3
4
1
2
2
4.14 Conclusions
This chapter started by introducing two alternative logical settings for learning: learning from entailment and learning from interpretations.
We then presented a hierarchy of representations that are used in data
mining and machine learning. The key representations are: boolean, attributevalue, multi-instance, relational and logic program representations. Other representations that are quite popular in data mining and computer science are
sequences, trees and graphs. It was also shown that these traditional data
structures can be elegantly represented using relational representations or
logic programs.
We then investigated the relationship among these dierent representations; more specically we have shown that functors can be eliminated from
logic programs, that (bounded) relational representations can be reduced to
113
114
relational learning [Geibel and Wysotzki, 1997, Knobbe et al., 2001, Perlich and Provost, 2003, Vens et al., 2006] and probabilistic relational models
[Getoor et al., 2001a].
5
Generality and Logical Entailment
(5.1)
116
117
They are also extremely useful because they allow us to directly transfer results from logic to machine learning.
This can be illustrated using traditional deductive inference rules, which
start from a set of formulae and derive a formula that is entailed by the original set. For instance, consider the resolution inference rule for propositional
denite clauses:
h g, a1 , . . . , an and g b1 , . . . , bm
h b1 , . . . , bm , a1 , . . . , an
(5.2)
As discussed in Chapter 2, this inference rule starts from the two rules above
the line and derives the so-called resolvent below the line. This rule can be
used to infer, for instance,
ies blackbird, normal
from
ies bird, normal
blackbird normal
An alternative deductive inference rule adds a condition to a rule:
h a1 , . . . , an
h a, a1 , . . . , an
(5.3)
(5.4)
118
(5.5)
119
are now using the same notation for both clauses, which are disjunctions,
and for item-sets, which are conjunctions. Therefore, this should only be done
when the context is clear. The reason for overloading the set notation will
become clear soon.
Using this notion for two propositional clauses c1 and c2 ,
c1 subsumes c2 if and only if c1 c2
(5.6)
Example 5.4. The clause ies bird, normal subsumes the clause ies
bird, normal, pigeon.
Observe that propositional subsumption is sound, which means that whenever c1 subsumes c2 , it is the case that c1 |= c2 , and complete, which means
that whenever c1 |= c2 , c1 also subsumes c2 .
The resulting search space is shown in Fig. 5.1. At this point, the reader
may observe that this search space coincides with that used for monomials in
Fig. 3.5 of Chapter 3. Whereas this may be surprising at rst sight because
monomials are conjunctions and clauses are literals, there is a simple explanation. When working with clauses, a clause c is said to cover an example when
c |= e, that is, when c e. On the other hand, when working with item-sets
and learning from interpretations, an item-set m covers an interpretation e
when m e. Therefore, when using sets to represent clauses and item-sets,
the generality relation coincides. Therefore, for both item-sets and clauses,
we have that hypothesis h1 is more general than hypothesis h2 if and only
if h1 h2 . This also explains why we employ set notation for both clauses
and monomials. The reader should keep in mind though that, at the logical
level, item-sets and clauses are dual to one another, because conjunction is
complementary to disjunction. Combined with the duality of the generality
relation between learning from entailment (used for clauses) and learning from
interpretations (used for item-sets), the generality relation coincides in both
cases with the subset relation.
Because the generality relation for clauses and item-sets coincides when the
set notation is used, the operators dened for item-sets are the same as those
for clauses. This implies for instance that the lgg of ies blackbird, normal
and ies pigeon, normal is ies normal. Observe also that the space of
propositional clauses forms a lattice and possesses optimal as well as ideal operators, which makes them easy to use. Recall that ideal operators generate
all children (or parents) of a hypothesis in a Hasse diagram, whereas optimal
operators ensure that there is exactly one path from the most general hypothesis to any specic hypothesis through the renement graph; cf. Chapter
3.
120
{f, b}
{f, b, n}
{f, b, h}
{f, b, n, h}
{f, n}
{f, b, l}
{f, h}
{f, n, h}
{f, b, n, l}
{f, l}
{f, n, l}
{f, b, h, l}
{f, h, l}
{f, n, h, l}
{f, b, n, h, l}
Fig. 5.1. The lattice of propositional denite clauses with head atom f. We
use the following abbreviations: f = ies, b = bird, n = normal, h = hasWings and
l = laysEggs
(5.7)
121
= {V1 /W1 , ..., Vn /Wn } and = {W1 /V1 , ..., Wn /Vn } where the Vi and Wi
are dierent variables appearing in e and e , such that e = e and e = e.
It can be shown that the resulting structure on the search space is again a
lattice up to variable renaming (when adding a bottom element).
Let us now introduce the dierent operators for working with atoms.
5.3.1 Specialization Operators
An Ideal Specialization Operator
p(X, Y)
p(X, X)
p(a, Y)
p(a, a)
p(b, Y)
p(a, c)
p(X, c)
p(a, d)
p(b, c)
p(X, d)
p(b, d)
p(X, Y)
p(f(A), Y)
p(f(f(B)), Y)
p(f(f(f(C))), Y)
Fig. 5.3. Part of the lattice on atoms
(5.8)
122
{X/Y }
with X and Y variables occurring in A
(5.9)
The subscript s in the operator stands for specialization, a for atoms, and i for
ideal. It is relatively easy to see that s,a,i is an ideal specialization operator
for atoms.
An Optimal Specialization Operator*
Obtaining an optimal operator for atoms is a little bit harder. The reason for
this is illustrated in Figs. 5.4, 5.5 and 5.6. As one can see, even if one naively
applies one type of elementary substitution there exist many dierent ways of
generating one particular atom. These redundancies can be avoided by further
restricting the elementary substitutions.
The operator s,a,o is an optimal specialization operator for atoms A,
dened as follows:
s,a,o (A) = {A | is an optimal elementary substitution}
(5.10)
variables or constants
{X/c}
with c a constant and no term
=
to the right of the leftmost occurrence of X
containing constants
{X/Y }
with X and Y variables occurring in A
123
This problem disappears when requiring that all optimal elementary substitutions of type {X/f (X1 , ..., Xn )} be applied before those of type {X/c},
which be applied before those of type {X/Y }.
Exercise 5.7. * If one orders the optimal elementary substitutions dierently,
is the resulting operator still optimal?
a(U, V)
{U/f(X)}
{V/g(Y, Z)}
a(f(X), V))
{V/g(Y, Z)}
a(f(X), g(Y, Z))
Fig. 5.4. Example of duplicate avoidance
{X/f (X1 , . . . , Xn )} (adapted from [Lee, 2006])
for
substitutions
of
type
f(A, B, C)
f(a, B, C)
f(A, b, C)
f(A, B, c)
f(a, b, C)
f(a, B, c)
f(A, b, c)
f(a, b, c)
Fig. 5.5. Example of duplicate avoidance for substitutions of type {X/c} from [Lee,
2006]
124
f(X, X , X, Y )
f(X, X, Y, Y )
f(X, X , Y, X)
f(X, X, Y, X)
f(X, X, X, Y )
f(X, X , X , Y )
f(X, X , Y, X )
f(X, Y, X, X)
f(X, X, Y, Y)
f(X, X , Y, Y)
f(X, X , X, X )
f(X, X , X , X )
f(X, X , X , X)
f(X, X, X, X)
Fig. 5.6. Example of duplicate avoidance for substitutions of type {X/Y } (adapted
from [Lee, 2006])
(5.12)
Whereas regular substitutions substitute terms for variables, inverse substitutions substitute variables for terms. However, because a term can occur more
than once in an atom (or a logical expression), we need to distinguish the different occurrences of a term. To this end, one employs positions (sometimes
also called places). With each occurrence of a term t in an atom p(t1 , ..., tn ),
a position is associated as follows:
<i>
if t = ti
< i, i1 , ..., im > if t is a sub-term of ti at position < i1 , ..., im >
(5.13)
Example 5.8. Consider p(f(a), a, a). The term a occurs at positions < 1, 1 >,
< 2 > and < 3 > in the atom.
An inverse substitution 1 now substitutes terms at specied positions
with variables. Thus, formally speaking, an inverse substitution is of the form
{p1 /V1 , ....pk /Vk } with positions pi and variables Vi
Example 5.9. Let A =p(f(a), a, a). Applying inverse substitution
1 = {< 1, 1 > /X, < 3 > / Y}
to A yields A1 =p(f(X), a, Y).
(5.14)
125
(5.15)
X
where X is variable occurring at least n + 1 times in A;
(5.16)
Example 5.10. Applying the elementary inverse substitutions to p(a, f(b))
yields p(X, f(b)) with {< 1 > /X} and p(a, f(X)) with {< 2, 1 > /X}.
Exercise 5.11. * Assume you are given an atom A and a substitution . How
can one, in general, obtain the inverse substitutions A1 ?
The operators g,a,i and s,a,i are ideal for the class of atoms (up to variable
renaming). The dual of the operator s,a,o , that is, the operator g,a,o , is not
presented because such operators are not commonly applied.
5.3.3 Computing the lgg and the glb
We claimed above that subsumption at the level of atoms induces a complete
lattice (up to variable renaming) on the search space. By denition, a complete
lattice has a unique least upper bound and a unique greatest lower bound for
any two elements. The greatest lower bound glb(a1 , a2 ) of two atoms a1 and
a2 starting with the same predicate symbol p is
glb(a1 , a2 ) = a1 = a2 where = mgu(a1 , a2 )
(5.17)
So, the glb corresponds to unication, the operation introduced in Sect. 2.4
The dual operation is the least general generalization (lgg) operation. It
is sometimes referred to as anti-unication. The least general generalization
lgg(a1 , a2 ) of two atoms a1 and a2 starting with the same predicate symbol p
is a generalization a of a1 and a2 such that for all other generalizations b of
a1 and a2 there exists a substitution such that b = a and b and a are not
variable renamings.
It is well known that the set of all atoms, partially ordered by the subsumption relation (and extended by special and elements), forms a complete
lattice as the lgg and the glb exist and are unique for all pairs of atoms. The
special elements and are used for those cases where the glb or lgg of two
126
atoms are not dened, that is, is the result of the glb operator when the
two atoms are not uniable, and is the result of the lgg operator when the
two atoms do not start with the same predicate symbol.
Example 5.12. Consider the atoms p(a, b, f(a)) and p(c, b, f(c)). The atom
p(X, b, f(X)) is the least general generalization of these two terms, as it is
a generalization of the rst atom (with substitution {X/b}) and of the second
atom (with substitution {X/c}), and furthermore, for all other generalizations, for instance, p(U, b, f(W)), there exists a substitution = {U/X, W/X}
for which p(U, b, f(W)) = p(X, b, f(X)).
The computation of the least general generalization bears some similarities with the unication algorithm shown in Algo. 2.3. The anti-unication
algorithm is depicted in Algo. 5.1.
Algorithm 5.1 Computing the lgg(a1 , a2 ) of two atoms a1 and a2 following
[Nienhuys-Cheng and de Wolf, 1997]
1 := ; 2 := ;
while a1 = a2 do
nd the leftmost position p where a1 and a2 dier
let s and t be the terms at position p in a1 and a2
if {V /s} occurs in 1 and {V /t} occurs in 2 then
replace the terms s and t at position p in a1 and a2 by V
else
replace the terms s and t at position p in a1 and a2 by a new variable W
1 := 1 {W/s}; 2 := 2 {W/t}
end if
end while
return a1
The algorithm repeatedly nds the position p where the two atoms a1 and
a2 disagree, and replaces the terms s and t at the corresponding positions by
a variable. If the terms s and t were already encountered before and replaced
by a variable V , the same variable is used; otherwise a new variable W not
yet occurring in the atoms is used.
Example 5.13. To illustrate the operation of the algorithm, consider the terms
p(a, b, f(a), c) and p(c, b, f(c), d). Then the variables at the end of each iteration
obtain the following values:
1. 1 = , 2 = , a1 = p(a, b, f(a), c), and a2 = p(c, b, f(c), d);
2. p =
< 1 >, s = a, t = b, and hence a1 = p(V, b, f(a), c), a2 =
p(V, b, f(c), d), 1 = {V/a} and 2 = {V/b};
3. p =
< 1, 3 >, s = a, t = b, and hence a1 = p(V, b, f(V), c), a2 =
p(V, b, f(V), d), 1 = {V/a} and 2 = {V/b};
5.4 -Subsumption
127
4. p =
< 4 >, s = c, t = d, and hence a1 = p(V, b, f(V), W), a2 =
p(V, b, f(V), W), 1 = {V/a, W/c} and 2 = {V/b, W/d};
5. at this point a1 = a2 , and hence the algorithm terminates and outputs
p(V, b, f(V), W).
5.4 -Subsumption
-subsumption is the most important framework for generalization and specialization in inductive logic programming. Almost all inductive logic programming systems use it in one form or another.
-subsumption combines propositional subsumption with subsumption at
the level of logical atoms. It is dened as follows. Clause c1 -subsumes clause
c2 if and only if
(5.18)
substitution : c1 c2
Example 5.14. The clause
father(X, john) male(X), male(john), parent(X, john)
is -subsumed (with substitution {Y/X, Z/john}) by
father(Y, Z) male(Y), parent(Y, Z))
The clause
nat(s(X)) nat(X)
-subsumes (with substitution) {X/s(0)}
nat(s(s(0))) nat(s(0))
and
p(X, Y, X) q(Y)
-subsumes (with substitution {X/U, Y/U})
p(U, U, U) q(U), r(a)
Finally, the clause
q(X) p(X, Y), p(Y, X)
-subsumes (with substitution {X/A, Y/A})
q(A) p(A, A).
The last example is surprising in that the clause q(X) p(X, Y), p(Y, X) is
both more general and longer than the clause q(A) p(A, A). In machine
learning, it is typical that longer clauses are more specic. When working
with -subsumption, this is not always the case.
There are various interesting properties of -subsumption, which we will
now discuss.
128
(5.19)
The reverse property, that is, completeness, does not hold. Indeed, as shown
in the example below, -subsumption is incomplete. Fortunately, it is only
incomplete for self-recursive clauses. These are clauses which resolve with
themselves.
Example 5.15. Consider c1 : nat(s(Y)) nat(Y) and c2 : nat(s(s(X))) nat(X).
Then c1 |= c2 but c1 does not -subsume c2 . Indeed, c1 |= c2 can be proved
by resolution; cf. Fig. 5.7. Furthermore, there is no substitution that makes c1
-subsume c2 . The rst literal indicates that Y should be substituted by s(X)
but the second literal requires Y to be substituted by X. These constraints are
unsatisable.
nat(s(Y)) nat(Y)
nat(s(X)) nat(X)
nat(s(s(X)) nat(X)
Fig. 5.7. Proving c1 |= c2 using resolution with substitution {Y/s(X)}
Algo. 5.2 has a short, though tricky implementation in Prolog, where the clauses
are represented as lists.
5.4 -Subsumption
129
130
triangle(e1, t2)
square(e1, s1)
...
The example pos(e1) is covered by the clause if and only if the clause
pos(e1) triangle(e1, T), circle(e1, C), in(e1, T, C)
-subsumes
pos(e1)
triangle(e1, t1), triangle(e1, t2), circle(e1, c1),
square(e1, s1), in(e1, t2, c1), . . .
Vice versa, testing whether
pos(E) triangle(E, T), circle(E, C), in(E, T, C)
-subsumes
pos(E) triangle(E, t1), circle(E, C), in(E, t1, C), square(E, S)
can be realized by testing whether the example pos(ske) is covered by the
clause
pos(E) triangle(E, T), circle(E, C), in(E, T, C)
5.4 -Subsumption
131
circle(ske, skc)
square(ske, sks)
The above discussion shows that -subsumption and extensional coverage testing are intimately related and belong to the same complexity class.
Because -subsumption is NP-complete, so is extensional coverage testing.2
Because the two problems are closely related, the number of such tests carried out by a logical or relational learning system can be used as a measure
of the eciency of the learning system. It should be clear that the number of
such tests should be as small as possible. At the same time, it is important
that the implementations of such tests be optimized where possible. Various
techniques for realizing this are presented in Chapter 10.
5.4.3 Equivalence Classes
When analyzing the properties of -subsumption, it is quite easy to see that
-subsumption is both reexive (take the empty substitution) and transitive
(compose the substitutions). Unfortunately, it is not anti-symmetric because
there exist syntactic variants, which are not restricted to variable renamings.
Example 5.18. The following clauses, syntactically dierent, are equivalent under -subsumption, and are therefore syntactic variants.
parent(X, Y) mother(X, Y)
parent(X, Y) mother(X, Y), mother(X, Z1 )
parent(X, Y) mother(X, Y), mother(X, Z1 ), mother(X, Z2 )
All these clauses are equivalent under -subsumption and therefore (due
to the soundness of -subsumption) also logically equivalent. This can be
quite problematic when dening operators. Some of the early inductive logic
programming systems get into innite loops because of this problem. They
start from the rst clause, rene it into the second, the third, and so on, and
might never recover.
Because -subsumption is reexive and transitive, but not anti-symmetric,
it is a quasi-order. The standard mathematical approach to turn a quasi-order
into a partial one is to dene equivalence classes and study the quotient set.
This is also what Gordon Plotkin did for -subsumption. Let us denote by
[c] the set of clauses equivalent to c under -subsumption. The quotient set
is then the set of all equivalence classes [c]. The -subsumption relation
induced a relation on the quotient set, and this quotient relation has various
interesting properties. The rst such property concerns the existence of a
2
Furthermore, given that the typical size of the relations in a database is much
larger than that of the typical clause, testing coverage is typically more expensive
than testing generality under -subsumption.
132
(5.20)
For instance,
c2 = p(X1 , X2 ), p(X2 , X1 )
c3 = p(X1 , X2 ), p(X2 , X1 ), p(X1 , X3 ), p(X3 , X1 ), p(X2 , X3 ), p(X3 , X2 )
...
One can prove that ci ci+1 (that is, ci -subsumes ci+1 and ci+1 does not
-subsume ci ) for all i 2; cf. [Nienhuys-Cheng and de Wolf, 1997]. This
means that the ci belong to dierent equivalence classes. Furthermore, each
ci -subsumes c = p(X, X). So, we have an innite ascending chain in the
partial order because c2 c3 . . . c c.
5.4 -Subsumption
133
There also exist innite descending chains in the partial order though
the corresponding series are even more complicated. For this direction, one
can construct, for instance, an innite descending chain starting at d =
p(X1 , X2 ), p(X2 , X1 ); cf. [Nienhuys-Cheng and de Wolf, 1997].
The third property is a consequence of the second. Due to the existence of
these innite ascending and descending chains which are bounded from below
or from above, there exist neither ideal nor optimal renement operators for
-subsumption. The problem is due to clauses such as c and d above. For
example, consider that one wants to minimally generalize c. Given the innite
chain, one of the minimal generalizations of c would be c . Now, c is not a
clause because it has an innite number of literals. Even if it were a clause, it
could not be computed by an algorithm. As a consequence there exist neither
computable ideal nor optimal renement operators for -subsumption.
In order to deal with this problem, one somehow has to relax the conditions
imposed on ideal and optimal renement operators. One can either work with
a nite hypothesis language (as this excludes the existence of such innite
chains) or relax the condition that the renements (c) of a clause c must be
proper, minimal or complete.
Most logical and relational learning systems address this problem in a more
pragmatic manner (see also Sect. 5.5.1 on object identity). Simple renement
operators are then used, for example:
c
with an elementary substitution
(5.21)
s,i, (c) =
c {l} with l an elementary literal
A literal l is elementary w.r.t. c if and only if it is of the form
p(X1 , ..., Xn ) with the Xi dierent variables not occurring in c
(5.22)
There exist many variants of such operators. Most of them take into account
certain syntactic restrictions, that is, a syntactic bias, on the form of the
clauses to be obtained. Syntactic biases are discussed in depth in Sect. 6.6. In
Fig. 5.8, we show part of the renement graph obtained using a renement
operator that only considers linked clauses (these are clauses where each literal
in the clause contains at least one variable already introduced earlier in the
clause).
One can now also invert the operator s,i, , in order to obtain a generalization operator. We leave this as an exercise to the reader.
Exercise 5.21. Invert the pragmatic specialization operator.
The fourth property of the quotient relation is that it forms a complete
lattice. Its structure is summarized in Fig. 5.9. Because the quotient set is a
lattice, there exist for any two equivalence classes [c1 ] and [c2 ] a unique lgg
and glb in the quotient set. A representative of lgg([c1 ], [c2 ]) and glb([c1 ], [c2 ])
can be computed starting from the clauses c1 and c2 themselves. These operations are the notions of lgg and glb typically found in the inductive logic
programming literature.
134
d(X, Y)
d(X, X)
d(X, Y) f(X)
d(a, a)
d(X, Y) p(X, Y)
(5.23)
This denition implicitly assumes that if two terms s and t are to be replaced
by a variable V at position p in literals l1 and l2 , and if they occur at position
p in literals l1 and l2 , then they will be replaced by the same variable V
throughout; cf. Algo. 5.1.
Example 5.22. Let c1 and c2 be
father(jef, ann) parent(jef, ann), female(ann), male(jef)
father(jef, tom) parent(jef, tom), male(jef), male(tom)
Then lgg(c1 , c2 ) is
father(jef, AT) parent(jef, AT), male(jef), male(JT)
This clause can be further reduced to yield
father(jef, AT) parent(jef, AT), male(jef)
From the denition of the lgg it follows that, in the worst case, the number
of literals in the lgg can be O(nm) where n and m are the size of the original
clauses. When computing the lgg with regard to k examples of size n the lgg
can be of size O(nk ), which is exponential in the number of examples, and
therefore problematic from a computational point of view. Another problem
is that the lgg of two clauses, as computed above, is itself a clause, which
may not be reduced. Therefore, after each computation of the lgg, one may
want to reduce the result with regard to -subsumption. However, as we have
mentioned earlier, this is again computationally expensive due to the need to
carry out a number of -subsumption tests.
The operation that is dual to the lgg is the glb. The glb of two clauses c1
and c2 (which do not share any variables) is dened as:
glb(c1 , c2 ) = c1 c2
(5.24)
It is mainly important for theoretical reasons and not so much used in practice. One of the reasons for not using it in practice is that the glb of two
135
m(X, Y)
m(X, Y), m(X, Z)
m(X, Y), m(X, Z), m(W, Y)
lgg([c1 ], [c2 ])
m(X, Y), r(X)
[c1 ]
[c2 ]
m(X, Y), s(X), r(X)
m(X, Y), m(X, Z), r(X), s(Y)
glb([c1 ], [c2 ])
Fig. 5.9. The -subsumption lattice on clauses.
denite clauses (these are clauses with exactly one literal in the head) may be
non-Horn (with more than one literal in the head), even after reduction.
Given the importance of the -subsumption framework, it is no surprise
that several variants have been introduced. We study two such variants in the
next section, which can be skipped without loss of continuity. These variants
address particular shortcomings of -subsumption. First, OI-subsumption
eliminates syntactic variants from the search space and possesses optimal and
ideal renement operators. Second, the framework of (inverse) implication addresses the incompleteness of -subsumption with regard to logical entailment.
136
(5.25)
(5.27)
c
with a substitution of the form {X/a},
X a variable in c, and
(5.28)
s,i,OI (c) =
a a constant not occurring in c
137
So, the only operators allowed substitute a variable with a constant or add an
atom to the body of the clause. Unifying two variables is not allowed as this
violates the object identity the assumption. From this operator, various other
operators under OI-subsumption can be derived, including an optimal one.
Whereas the key advantage of OI-subsumption is that the structure on the
search space is simpler, there are also some complications that arise. First,
OI-subsumption is weaker than -subsumption, and is therefore also a weaker
approximation of logical implication. Second, evaluating whether a certain
hypothesis covers an example will typically be more expensive because the
process of computing the completion com(c) of a clause c introduces further
constraints that must be satised. As the eciency of coverage tests depends
on the length of the clauses, working with OI-subsumption may lead to less
ecient covers tests. For example, consider the clause p(X) q(X), r(Y).
Under -subsumption, the literals q(X) and r(Y) can be handled independently
of one another, whereas under OI-subsumption, the clause not only becomes
longer, but also introduces the extra dependency Y = X. Finally, the lgg of
two clauses may no longer be unique, as shown in the next example.
Example 5.25. Consider the two clauses
pos circle(a), blue(a), small(a)
pos circle(b), blue(b), large(a), circle(c), green(c), small(c)
The lgg under -subsumption is
pos circle(X), blue(X), circle(Y), small(Y)
but this clause does not OI-subsume the rst clause. Instead, there are now
two minimal general generalizations of the two clauses:
pos circle(X), blue(X)
pos circle(X), small(X)
This situation is akin to the older work on structural matching [Ganascia and
Kodrato, 1986, Hayes-Roth and McDermott, 1978, De Raedt et al., 1997].
5.5.2 Inverse Implication*
The incompleteness of -subsumption with respect to logical entailment has
been addressed under the framework of inverse implication. Rather than inverting -subsumption this framework attempts to invert the implication relation among clauses. A clause c1 implies a clause c2 if c1 |= c2 . The implication
framework diers from -subsumption only for recursive clauses. The computational properties of the framework are worse than those of -subsumption
because testing whether one Horn clause logically implies another one is only
semi-decidable [Marcinkowski and Pacholski, 1992].
Research within inverse implication has focused around the lgg operation.
We illustrate this operation on an example.
138
(5.30)
139
140
More formally, the bottom clause (c) with regard to a clause c and a
background theory B is the most specic clause such that
B (c) o c
(5.31)
The bottom clause is of interest because it bounds the search for a clause
covering the example c as any single clause hypothesis h covering c with regard
to B must be more general than (c).
Example 5.28. Let B consist of
polygon(X) rectangle(X)
rectangle(X) square(X)
and let c be as follows:
pos(X) red(X), square(X)
Then
(c) : pos(X) red(X), square(X), rectangle(X), polygon(X)
Any clause that is not more general than the bottom clause cannot cover the
example c and can therefore be safely pruned away, for instance, pos(X)
green(X). Bottom clauses are thus similar to the S set in version spaces as
the (positive) example c determines the set S = {(c)}. Thus the bottom
clause captures all information that is relevant to the example and the background theory. In the example, even though the predicates green and circle
might appear in the background theory, they are irrelevant to the specic
example, and hence do not appear in the bottom clause. Given the bottom
clause with regard to a positive example, inductive logic programming systems only consider the elements in the corresponding version space. This can
be realized by searching the space from general to specic starting from
using a renement operator that considers only generalizations of the bottom
clause (c). Although renement operators working under relative generality
could, in principle, be used, it is more convenient to employ the standard subsumption operators. This is the strategy in the well-known inductive logic
programming system Progol of Muggleton [1995].
So far we have not given any details as to how bottom clauses are computed. In general this will depend on the notion of relative generality considered. Below, we present the computation in its most general form, that is, for
inverse entailment, the semantic notion of relative generality.
We are looking for the most specic clause (c) such that
B (c) |= c
(5.32)
B c |= (c)
(5.33)
141
(5.34)
(5.35)
(5.36)
The dierent steps in computing the bottom clause are summarized in Algo.
5.4.
Algorithm 5.4 Computing the bottom clause (c)
Find a skolemization substitution for c (w.r.t. B and c)
Compute the least Herbrand model M of B body(c)
Deskolemize the clause head(c) M and return the result.
142
Let us illustrate this notion using two examples. The rst concerns a special
case of the rlggB , already studied by Plotkin, where B {c1 , c2 } are all ground
facts. The rlggB of two such examples is illustrated in the example below and
forms the basis of the inductive logic programming system Golem [Muggleton
and Feng, 1992].
Example 5.29. Let
B = {p(t, a), m(t), f(a), p(j, p), m(j), m(p)}
c1 = fa(t, a) and c2 = fa(j, p)
where p stands for parent, f for female, m for male, and fa for father. Then
fa(t, a) p(t, a), m(t), f(a), p(j, p), m(j), m(p)
rlggB (c1 , c2 ) = lgg
fa(j, p) p(t, a), m(t), f(a), p(j, p), m(j), m(p)
fa(Vtj, Vap) p(t, a), m(t), f(a), p(j, p), m(j), m(p),
p(Vtj, Vap), m(Vtj), m(Vtp), p(Vjt, Vpa),
=
143
144
5.7 Aggregation*
145
on these predicates rather than dening them. It is typically also much simpler, shorter, and therefore more ecient to use than the typical background
theories found in applications of inductive logic programming.4
5.7 Aggregation*
Several studies have shown that the ability to use aggregation inside logical
and relational learning can be essential for the success of an application, cf.
[Perlich and Provost, 2003, Vens et al., 2006, Knobbe et al., 2001, Krogel and
Wrobel, 2001]. The question thus arises as to how aggregated literals can be
used in the learning process. In this section, we focus on aggregated conditions
of the type introduced in Sect. 4.13. Until recently, it was unclear how such
aggregated literals could be could be rened. We shall employ the general
framework of Vens et al. [2006], who study renement of literals involving
aggregation along three dimensions. We illustrate this using the clause
passes(Student) AVG{Mark|markFor(Student, Course, Mark)} 10
which states that a student passes if the average mark she gets is at least 10.
We employ the same notation as in Sect. 4.13. There are three elements in
this condition:
1. the aggregation function (here: AVG),
2. the membership interval (here: [10, [) used in the condition, and
3. the set used as the argument of the aggregation function (here: the set of
Marks for the Student); for convenience, we shall not explicitly distinguish
the query from the set of substitutions for which it succeeds.
The observation made by Vens et al. [2006] is that one can rene along three
dimensions, which correspond to the three elements indicated above.
Example 5.33. The following two operations will generalize the clause:
generalize AVG to MAX, or
generalize 10 to 8.
On the other hand, neither generalizing nor specializing the query
markFor(Student, Course, Mark)
is guaranteed to yield generalizations or specializations. The reason, as we
shall see soon, is that the aggregate function AVG is neither monotonic nor
anti-monotonic. On the other hand, if we would have started from the clause
4
146
(5.38)
The notion of anti-monotonicity is dened dually. For instance, the condition MIN(Q) 5 is monotonic, whereas MAX(Q) 5 is anti-monotonic, and
AVG(Q) 5 is neither monotonic nor anti-monotonic no matter what query
Q is used.
Conditions of the form A(Q) t can now be generalized by:
generalizing A, that is, replacing A by a function G such that A a G,
yielding G(Q) t;
generalizing the interval, that is, replacing the threshold t by a threshold
g such that g t, yielding A(Q) g.
These two operations will produce generalizations regardless of whether the
condition is monotonic or anti-monotonic. However, if the condition A(Q)
t being rened is monotonic, one can also apply a third operation, which
generalizes Q, that is, replaces Q by a query G for which G Q, yielding
A(G) t. The monotonicity requirement is only necessary to guarantee that
the result of applying the nal operation is a generalization. If on the other
hand the condition A(Q) t being rened is anti-monotonic, this operation
realizes a specialization.
Finally, let us remark that the following dualities hold.
147
Applying the inverse of the rst two operations realizes specialization for
conditions of the form A(Q) t.
Applying the rst two operations on conditions of the form A(Q) < t
realizes specialization.
Applying the inverse of the third operation on a monotonic condition
A(Q) t realizes specialization.
Exercise 5.34. Show some generalizations and specializations of the clause
fails(Student) MIN{Mark|markFor(Student, logic, Mark)} 10
along all possible dimensions.
(5.39)
148
c1 = {l1 , ..., lk , l}
c2 = {l1 , ..., lm
, l}
c = {l1 , ..., lk , l1 , ..., lm
}
(5.40)
In this scheme, the leftmost clause below the line is the resolvent of the two
clauses above the line and the rightmost clause below is a copy of the rightmost clause above the line. Thus the specialization operator deductively infers
the clauses below the line from those above the line, whereas the absorption
operator inductively infers the clauses above the line from those below it.
Similarly, by changing the position of the copied clause, we obtain the
identication operator:
p q, k1 , . . . , km and q l1 , . . . , ln
p l1 , . . . , ln , k1 , . . . , km and p q, k1 , . . . , km
(5.41)
149
foursided rectangle
rectangle square
150
parent(jef, paul)
parent(jef, paul)
p k1 , ..., kn , q
p k1 , ..., kn , l1 , ..., lk
q l1 , ..., lm
p k1 , ..., kn , l1 , ..., lm
The W -operators link two V -operators in such a way that one of the clauses
is shared. In Figs. 5.14 and 5.15, the two clauses at the bottom of the gure
are derived by resolution; and vice versa, the three clauses at the top of the
p r, l1 , ..., lk
151
q r, l1 , ..., lm
r k1 , ..., kn
q k1 , ..., kn , l1 , ..., lm
p k1 , ..., kn , l1 , ..., lk
foursided rectangle
rectangle square
gure are derived by inverse resolution from the two clauses at the bottom.
Using the notation for inference operators, we obtain the following schemes
for intra-construction and inter-construction, respectively.
q l1 , . . . , lk and p k1 , . . . , kn , q and q l1 , . . . , lm
p k1 , . . . , kn , l1 , . . . , lk and p k1 , . . . , kn , l1 , . . . , lm
(5.42)
p r, l1 , . . . , lk and r k1 , . . . , kn and q r, l1 , . . . , lm
p k1 , . . . , kn , l1 , . . . , lk and q k1 , . . . , kn , l1 , . . . , lm
(5.43)
152
153
154
5.10 Conclusions
This chapter has discussed the generality relation within logic, and it has
been shown that the generality relation coincides with logical entailment. This
important property has allowed us to devise inductive inference operators by
inverting deductive ones. By imposing dierent restrictions on the form of
the hypotheses and on the allowed deductive inference operators, dierent
frameworks for generality were obtained. The most important frameworks
include - and OI-subsumption, and various forms of subsumption relative
to a background theory and inverse resolution. For these frameworks, the
most important operators, that is, inductive inference rules, were derived and
their properties studied. Towards the end of the chapter, we discussed several
advanced topics, such as semantic renement, aggregation and the application
of these logical frameworks for generality to graphs, trees and sequences.
155
logic programming. This includes the framework of inverse resolution [Muggleton, 1987, Muggleton and Buntine, 1988], inverse entailment [Muggleton,
1995] and inverse implication [Muggleton, 1992a] (see also [Idestam-Almquist,
1993]). The idea of induction as the inverted deduction goes back to [Michalski, 1983] and of inverse resolution to [Wirth, 1988] and [Sammut and Banerji,
1986]. The concept of bottom clauses goes back to Buntine [1987] and was also
studied under the names of starting clauses [Ade et al., 1995] and saturation
[Rouveirol, 1994].
Many current results were formalized by Akihiro Yamamoto [1999a,b].
OI-subsumption was introduced and studied more recently by Esposito et al.
[1996]. Semantic renement was studied by De Raedt and Ramon [2004],
renement at the theory level by Badea [2001], and renement involving aggregation by Vens et al. [2006] and Knobbe et al. [2001, 2002].
For Matthew
Young man going east
6
The Upgrading Story
158
identify the mining task from the many available ones, such as classication,
regression, probabilistic modeling, clustering, and association rules discovery.
At the same time, he must determine a suitable representation, and, for reasons outlined in Chapter 4, the chosen representation may well need to be a
relational one. The task and nature of the representation then determine the
choice of the data mining algorithm or system to be employed.
Unfortunately, when dealing with relational problems, there may not be a
readily available system that is suitable for the problem at hand. In such situations, the analyst may want to consider devising a novel logical or relational
learning system. Furthermore, if the mining task has already been identied
and an eective propositional learner exists for tackling a propositional version of the problem, it is a good idea to upgrade the propositional learner,
which means to adapt the existing learner so that it can cope with more expressive representations. This adaptation has to be performed by the machine
learning or data mining expert, and typically involves the implementation of a
new upgraded system. Upgrading the propositional learner typically consists
of the following steps:
Whereas the rst few steps are more concerned with the design of the algorithm, the last few are concerned with its implementation. During the upgrading process, one should take care that the propositional system remains
a special case of its upgrade so that the propositional system can still be
emulated.
This upgrading methodology is an eective means for obtaining novel logical and relational learning systems. Evidence for this claim will be presented by showing in the next sections that three well-known systems, Foil
[Quinlan, 1990], Tilde [Blockeel and De Raedt, 1998] and Warmr [Dehaspe
and Toivonen, 2001], were designed using this methodology. Even though not
all developers of these systems may have explicitly followed this methodology,
the discussion still provides insight and case studies into how to develop novel
logical and relational learning tools. At the same time, three popular such
systems will be encountered.
There are many reasons why following the methodology is advantageous.
First, as argued above, the need to develop an upgrade of a particular propositional learner may occur naturally when tackling a specic application.
Second, by upgrading a learner that is already eective for propositional representations, one can benet from the experiences and results obtained in the
159
propositional setting. In many cases, such as, for instance, decision trees, this
implies that one can rely on well-established methods and ndings, which are
the outcomes of several decades of machine learning research. It will be hard
to do better starting from scratch. Third, upgrading an existing learner is
also easier than starting from scratch as many of the components (such as
heuristics, search strategy, etc.) can be recycled. It is therefore also economical in terms of person power. Fourth, the upgraded system will be able to
simulate the propositional one, which provides guarantees that the output hypotheses will perform well on propositional problems even though it is likely
that the upgraded system will be computationally more expensive to use than
its propositional counterpart. Finally, it may be possible to incorporate new
features in the learner by following the methodology. One feature, which is
often absent from propositional learners and may be easy to incorporate, is
the use of a background theory. Finally, the author wishes to stress that the
methodology like any other methodology has limitations and does not
always apply. Indeed, an obvious limitation occurs when there does not exist
a propositional learner for a given task.
160
161
and there may be good reasons for introducing new relational representations
that upgrade some procedural propositional hypothesis language. Of course,
this should be exercised with care and only when the traditional logical concepts cannot easily capture the propositional representation.
6.2.3 Adapting the Algorithm
A propositional learner that searches the space of possible hypotheses can
often be upgraded by only modifying the operators to traverse the search space
to cope with the upgraded hypotheses space; and of course, the coverage test
will need to be upgraded too. As the vast majority of propositional operators
are a special case of -subsumption or OI-subsumption, it will often suce to
consider these two frameworks for generalization. The particular choice will
then depend on the properties of the operators that the propositional learning
system relies on.
For instance, when the search space is searched completely and an optimal renement operator (cf. Chapter 3) is needed, one should consider OIsubsumption. On the other hand, if the propositional system relies on the
existence of a least general generalization, -subsumption is to be preferred.
Apart from upgrading the operators and the covers test, one should make
as few changes to the original algorithm as possible (especially w.r.t. heuristics and search strategy). This will allow one to maximally prot from the
knowledge the propositional learner is based on and at the same time avoid
having to go through the same tuning that the designers of the original system
had to go through. It also guarantees that the upgraded system can emulate
the original one.
6.2.4 Adding Features
Finally, it may be desirable to add some new and typical relational learning
features. One feature to incorporate that immediately comes to mind and that
is worth considering is background knowledge in the problem setting. Indeed,
it is often useful to allow the user to specify new predicates and relations in
the background theory, which can then be employed to complete the example
descriptions, as extensively discussed in Chapter 4. This extension is often
easy to realize as one, in principle, only needs to change the coverage test.
Now that we have introduced the methodology, we discuss three case studies in the next few sections.
162
examples are ground facts; positive examples are true, and negative ones
are false;
a hypothesis corresponds to a set of denite clauses, and a denite clause
represents a rule.
In addition, given the limited form of examples employed, it is useful to
employ a background theory that contains further predicates and information
about the examples. This background theory can again be represented as a
set of denite clauses.
This leads to the following problem specication, which forms the basis of
the inductive logic programming system Foil [Quinlan, 1990] and many of
its variants (such as mFoil [Lavrac and Dzeroski, 1994]):
Given
a set of true ground facts P , the set of positive examples,
a set of false ground facts N , the set of negative examples,
a background theory B, consisting of a set of denite clauses
Find: a set of denite clauses H such that p P : B H |= p and
n N : B H |= n.
One illustration of this setting was given in Ex. 4.6 where the background
theory B was empty. Nevertheless, we provide another illustration.
Example 6.1. Assume that the background theory consists of the relations
subscription, course, company and person in the summerschool database of
Sect. 4.4 (cf. Figs. 4.1 and 4.2). If the positive examples are
attendsParty(blake)
attendsParty(miller)
163
At the same time, rather using an intensional coverage test, which would
merely test whether a hypothesis h covers an example e by checking whether
B h |= e, it employs an extensional coverage test. Deciding whether a
hypothesis h extensionally covers an example e with regard to an extensional
background theory B involves identifying a clause c b1 , ..., bn that belongs
to the hypothesis h such that there exists a substitution for which c = e
and the bi B.
Example 6.2. Applying the extensional coverage test to attendsParty(blake)
and the clause mentioned in the previous illustration amounts to verifying
whether there exists a substitution such that
{person(blake, J, C), company(blake, commercial)} B
The eect of the choices made in Foil is that a simple setting (avoiding
many complications such as functors) is obtained, which allows for a very fast
implementation of some essential components of the learning algorithm. Foil
is still one of the most ecient relational learners that exists today, despite
the facts that it was developed around 1990. On the other hand, the use of an
extensional background theory and coverage testing is more restricted than
the full learning from entailment setting.
Because these restrictions are not essential to the problem setting itself,
and are not imposed by some of Foils variants, we will largely ignore them
throughout the remainder of the section. A more detailed discussion of extensional coverage testing and its eciency is contained in Sect. 10.1.
Exercise 6.3. Discuss why the extensional coverage test can be implemented
eciently and also sketch situations in which the extensional coverage test
causes problems (that is, where extensional and intensional coverage testing
may produce dierent results).
164
165
n(c , P )
n(c , P )
n(c, P )
log2
log2
n(c, P )
n(c , P N )
n(c, P N )
(6.1)
166
The weighted information gain from the rst clause to the second one is
2
2
2
log2 log2
= 0 bits
3
3
3
and from the second one to the third is:
2
2
2
log2 log2
= 0.58 bits
2
2
3
Exercise 6.5. Provide a concrete illustration that shows that counting substitutions may yield dierent results than counting examples.
Foil also employs a criterion, based on the minimal description length
principle, to decide when to stop rening a rule. According to this criterion,
Foil will stop rening the current hypothesis, when the encoding length of the
clause will become longer than the encoding length of the covered examples.
It should be stressed that other heuristics than those presented here could
be (and actually have been) employed in relational learners such as Foil.
As in Foil, two types of heuristic can be distinguished: one that guides the
search towards the more promising clauses, for instance, information gain,
and one that is meant to cope with noisy data and to avoid over-tting, for
instance, minimum description length. More details on the particular heuristics employed in Foil can be found in [Quinlan, 1990] and an overview of
alternatives can be found in [Lavrac and Dzeroski, 1994].
Rather than discussing the use of dierent heuristics, which are quite similar to those in the propositional setting, we now focus on some new problems
that arise in a relational context.
First, as extensively discussed in Chapter 5, there are some serious problems with specialization operators under -subsumption, in particular, the
non-existence of ideal operators, which implies that one has to resort to the
use of a pragmatic operator. Such pragmatic operators proceed by adding
literals to clauses. As a consequence, care must be taken that the generated
clauses are proper specializations and do not belong to the same equivalence
class. For example, the sequence of clauses
p(X) m(X, Y1 )
p(X) m(X, Y1 ), m(X, Y2 )
p(X) m(X, Y1 ), m(X, Y2 ), m(X, Y3 )
...
can be generated by a pragmatic operator, even though all clauses in this
sequence are equivalent under -subsumption. This problem can be alleviated
by resorting to another type of subsumption (such as OI-subsumption); see
Chapter 5 for more details.
Secondly, and somewhat related, there is the problem of determinate literals. These are literals that when added to a clause, change neither the covered
examples nor the covered substitutions. More formally, a literal l is determinate with regard to a clause h b1 , ..., bn and background theory B if
167
and only if for all substitutions that ground the clause such that the query
b1 , ..., bn succeeds in B there is exactly one substitution such that
(h b1 , ..., bn , l) is ground and the query b1 , ..., bn , l succeeds in
B.
Example 6.6. Continuing the attendsParty illustration, the literal person(P, C, J)
is determinate with regard to the clauses
attendsParty(P)
attendsParty(P) subscribes(P, erm)
but the literal person(P, president, J) is not.
Determinate literals cause problems for heuristic methods because they do
not result in any improvement of the score; cf. Ex. 6.4. Yet, they are often
essential because they introduce new variables in the clauses on which further
conditions can be specied (such as the job type and the company name when
learning attendsParty). Therefore, determinate literals often receive a special
treatment. In the literature on inductive logic programming, the following
solutions have been considered:
168
Traditional decision trees also allow for non-boolean tests with multiple outcomes.
For simplicity, we will not deal with such tests explicitly in this book, though this
is, of course, possible.
169
Job
Seniority Company Party
researcher junior
scuf
no
president junior
jvt
yes
manager junior pharmadm no
manager senior
jvt
yes
researcher senior
scuf
yes
researcher junior pharmadm no
seniority = senior
yes
company = jvt
yes
no
Fig. 6.1. A decision tree for the party attribute (adapted from [De Raedt et al.,
2001])
Fig. 6.2. A larger Bongard problem. Reprinted with permission from [De Raedt
et al., 2001]
170
There are several possible answers to the rst question. On the one hand,
for the Bongard problems, it is quite natural to employ interpretations that
completely describe a particular scene. The interpretations are then also labeled with the class value. For instance, the rightmost top example can be
represented as
{square(s1), square(s2), in(s1, s2)}
Another possibility is to employ one relational database to model the examples
as sketched in Ex. 4.27. In both cases, a background theory can be used to
complete the interpretations (as discussed in Chapter 4).
The next design decision to make concerns the denition of a relational
decision tree. To design a proper denition in relational logic, it is helpful to
carefully analyze the propositional decision tree, and to draw some correspondences. Formulated in logic, a test corresponds to an atom or a query. So,
what happens if we replace the nodes by queries? To classify an example, one
runs the query on the example and takes the corresponding branch in the tree.
This seems like a reasonable choice although there is one complication related
to the use of variables. If multiple nodes refer to the same logical variables,
should they be considered as the same variable or not? For instance, in the
example relational decision tree shown in Fig. 6.3, when querying in(T1, T2)
should T1 be restricted to triangles because the root query requires T1 to be
a triangle?
Because classifying an example in a relational setting often requires one
to employ long chains of literals connected through variables, it seems best
to dene the semantics of relational decision trees so that multiple occurrences of a variable, along a succeeding branch of the decision tree, denote the
same variable. Using this view, an equivalent representation of the relational
decision tree in Fig. 6.3 reads as follows:
IF triangle(T1), in(T1, T2), triangle(T2) THEN Class = yes
ELSIF triangle(T1), in(T1, T2) THEN Class = no
ELSIF triangle(T1) THEN Class = no
ELSIF circle(C) THEN Class = no
ELSE Class = yes
Thus, the decision tree corresponds to a decision list, where the leaves of the
decision tree are traversed from left to right and where each leaf contributes
one rule to the list. Furthermore, whereas the variable bindings and atoms
are propagated along the succeeding branches of the decision tree, this is not
done for the failing branches. For example, the literals (and bindings) for the
leftmost leaf produces the condition triangle(T1), in(T1, T2), triangle(T2) but
for the left leaf under circle(C), the parent literal triangle(T1) does not occur
171
in the condition of the rule for this leaf because it is already known to have
failed (if triangle(T1) would have succeeded, one of the rst three rules must
have succeeded as well).
Let us also mention that this particular use of an if-then-else construct
would be modeled using Prologs cut (!). So, the above decision list or logical
decision tree can be represented by the following Prolog program. The eect
of ! in this program is that the rst rule for class that succeeds determines
the class.
class(yes) triangle(T1), in(T1, T2), triangle(T2), !.
class(no) triangle(T1), in(T1, T2), !.
class(no) triangle(T1), !.
class(no) circle(C), !.
class(yes)
Using this representation, it is easy to check how an example e is classied
by a logical decision tree t. One merely needs to compute the Prolog program
pt corresponding to the tree t, assert both pt and e in a Prolog database and
pose the query class(C). If a background theory B is employed, B should
be asserted in the database as well before posing the query.
triangle(T1)
in(T1, T2)
triangle(T2)
yes
no
circle(C)
no
yes
no
172
n(P ) n(N )
n(N )
n(P )
log2
log2
n(E)
n(E)
n(E)
n(E)
(6.2)
173
where P and N are the sets of positive and negative examples, respectively,
and n(X) denotes the number of examples in the set X. Furthermore, if we
split the sets of examples E = P N into the sets El = Pl Nl and
Er = Pr Nr with regard to the test t then the information gain can be
expressed as
IG(E, El , Er ) = I(P, N )
n(El )
n(Er )
I(Pl , Nl )
I(Pr , Nr ) (6.3)
n(E)
n(E)
5
9
5
9
log2
log2
= .940 bits
14
14 14
14
Assume furthermore that there is a test t that splits the examples into El
with three positive and four negative examples, and into Er with six positive
and one negative examples, then
IG(E, El , Er ) = .940
7
7
.985
.592 = .151 bits
14
14
These calculations inform us that if we know the outcome of the test t then
we have gained .151 bits of information.
Typical decision tree learners also include heuristics to decide when to stop
rening a certain node. A simple heuristic that can still be very eective is to
stop expanding nodes when the number of examples in the nodes falls below
a certain (user-dened) threshold.
174
Further heuristics and optimizations may be targeted at avoiding overtting the data and dealing with noise. This includes algorithms for postpruning decision trees and turning them into rules. There exist also decision
tree learners that predict real valued attributes rather than discrete classes.
They are known under the name of regression trees. A full discussion of these
techniques is outside the scope of this book but can be found in [Breiman
et al., 1984, Quinlan, 1993a, 1986, Mitchell, 1997].
175
Therefore, there is also an alternative formulation of relational frequent pattern mining that circumvents the partitioning process. It is this formulation
that will be used throughout this section.
To focus our attention, we shall use the summerschool database of Fig.
4.1 as a typical relational database. When mining for local patterns in the
summerschool database, one must rst determine the entity of interest. Are
we looking for patterns about participants, job types, companies, courses, or a
combination of these entities? The entity of interest determines what is being
counted, and will determine the type of pattern searched for. As patterns can
be represented as denite clauses, the entity of interest also determines the
type of clause searched for.
Example 6.10. The following clauses serve as patterns about dierent entities
of interest.
key(P) participant(P, J, C, Pa), company(C, commercial)
key(J) participant(P, J, C, Pa), company(C, commercial)
key(C) participant(P, J, C, Pa), company(C, commercial)
key(Co) course(Co, L, T), subscription(adams, Co)
key(C, J) participant(P, J, C, Pa), company(C, commercial)
The rst three patterns make statements about participants, job types, and
companies, respectively. In the fourth query the entity of interest is the course,
and in the last query, it is the relationship between companies and job types.
The rst clause is a statement about participants. It covers all participants
who work for a commercial company, that is, blake and miller. Thus the frequency of the rst clause is 2.
We can now formalize the frequent query mining task in relational databases
as follows:
Given
a relational database D
the entity of interest determining the key
a frequency threshold t
a language L of logical clauses of the form key b1 , ..., bn dening key.
(6.4)
Notice that the substitutions only substitute variables that appear in the
conclusion part of the clause. For instance, the frequency of the pattern about
companies is 1 as jvt is the only commercial company.
In addition to frequent item-sets, the data mining community also employs
association rules. Simple association rules in the boolean case are rules of the
form
176
(6.5)
(6.6)
Association rule mining is then concerned with nding all association rules
that have a minimum support and a minimum condence in a given database.
As we will see soon, frequent pattern mining is often an intermediate step in
nding all association rules of interest.
Thus a further question about local pattern mining is what a relational
association rule is. Because local patterns are now clauses of the form key
query, it is tempting to dene association rules as
IF query THEN literal
However, it is unclear how to interpret this expression as it is not a clause.
Example 6.11. Consider the relational rule
IF participant(K, J, C, P) THEN subscription(K, C)
This rule denotes that participants typically subscribe to some course because
when the clause
key(K) participant(K, J, C, P)
covers some participant , the clause
key(K) participant(K, J, C, P), subscription(K, C)
typically also covers . Thus the meaning is dierent from the clause
subscription(K, C) participant(K, J, P, C)
which denotes that participants take all courses as all variables are universally
quantied. So, new variables introduced in the conclusion part of a relational
association rule are existentially quantied, which explains also why we stick
to the IF THEN notation. Also, the support and condence of this rule are
both 100%.
By now it is easy to dene the problem of relational association rule mining:
Given
a relational database D,
177
(6.7)
Therefore, one can directly apply Algo. 3.3 which nds all hypotheses that
satisfy an anti-monotonic constraint using general-to-specic search. Most instantiations of this algorithm for frequent pattern mining, however, perform
some optimizations. An important optimization, introduced in Apriori by
Agrawal and Srikant [1994], is shown in Algo. 6.4. Because the database may
be very large, it is desirable to minimize the number of passes through the
database. Therefore, Algo. 6.4 computes the frequent patterns level-wise, that
is, at each level i, it rst computes the candidate clauses Cani and then computes the frequencies of all clauses in Cani by scanning the database once.
Thus Algo. 6.4 is an instantiation of Algo. 3.3, where the two for loops have
been inverted and where the search proceeds in a level-wise fashion.
This algorithm applies directly to the relational case though there are a
number of subtleties. First, the level-wise scanning of the database works only
178
if one can load the examples one by one. Although this is easy when working
with interpretations, it is harder using the full database approach that we
have adopted. One might of course load all possible entities of interest (say all
participants) as atoms for the key, but using standard database techniques
there may be more ecient ways to compute the number of covered entities of
interest. Second, Algo. 6.4 employs an optimal specialization operator. When
working under -subsumption such operators do not exist. Therefore, it is
better to work under OI-subsumption. However, when working under OIsubsumption, the implementation of an optimal renement operator is also
both complex and computationally expensive; cf. [Nijssen and Kok, 2003].
Early versions of relational pattern mining systems, such as Dehaspes
Warmr system [1997, 2001], introduced the problem of relational association rule discovery, and employed -subsumption and non-optimal renement
operators generating many duplicate queries that had to be ltered using expensive -subsumption tests, which explains why these early versions were
rather inecient. One improvement studied in the item-set mining case concerns the use of the Apriori join to generate the candidate set at the next
level. This join operation basically computes
Cani+1 {l k | l, k Cani and | l k |= i 1}
(6.8)
179
Example 6.12. Reconsider the Bongard problem illustrated in Fig. 4.4. Assume the entities of interest are the dierent scenes, and that the available
predicates are in(K, O1, O2), stating that in scene K, object O1 is inside O2,
circle(K, C) and triangle(K, T), and assume that the language L species that
no constants be used. Assuming the frequency threshold on the positive scenes
is 6, the algorithm may start as follows (under OI-subsumption):
T h0 contains key(K)
Can1 contains
key(K) triangle(K, T) which is frequent
key(K) circle(K, C) which is frequent
key(K) in(K, O1, O2) which is frequent
Can2 contains
key(K) triangle(K, T1), triangle(K, T2) which is frequent
key(K) circle(K, C), triangle(K, T) which is frequent
key(K) circle(K, C1), circle(K, C2) which is not frequent as not all
scenes contain two circles
key(K) in(K, O1, O2), circle(K, O1) which is not frequent (as there is
no circle inside another object)
key(K) in(K, O1, O2), circle(K, O2) which is frequent
key(K) in(K, O1, O2), triangle(K, O1) which is frequent
key(K) in(K, O1, O2), triangle(K, O2) which is infrequent as there is
no triangle containing another object
...
Exercise 6.13. * Dene the problem of frequent tree or graph mining and
outline an algorithm for solving it. Discuss the key challenges from an algorithmic point of view
180
yet received much attention in the literature. At a general level, two forms of
declarative language bias can be distinguished: syntactic and semantic bias.
Syntactic bias, as the name indicates, merely restricts the syntax of the allowed
hypotheses. Semantic bias, on the other hand, restricts the behavior of the
hypotheses with regard to the examples and possibly the background theory.
Both forms of bias restrict the hypotheses spaces Lh .
6.6.1 Syntactic Bias
Formally speaking, syntactic bias is concerned with dening the syntax of the
hypotheses in Lh . From a general computer science perspective, one can regard
syntactic bias as dening the well-formed elements in the formal language Lh ,
a task for which one typically employs some type of grammar. A great variety
of mechanisms and formalisms to specify such grammars has been developed
in the inductive logic programming literature; see Nedellec et al. [1996] for an
overview. Even though these formalisms often reect the personal preferences
or needs of their developers, there exist a few principles that underlie virtually
all syntactic biases employed. These include the use of predicate, type and mode
declarations.
Types and Modes
The predicate declarations specify the predicates to be used, and the type
declarations the corresponding types of the predicates. Such declarations are
often written as type(pred(type1 , ..., typen )), where pred denotes the name of
the predicate and the typei denote the names of the types. In addition, there
can (but need not) be type denitions, which contain a specication of the
domain of the dierent types. For instance, if the type corresponds to an attribute, one might specify the domain of the attribute using a declaration of
the form type = [v1 , ..., vn ], where the vi are the dierent values the attribute
or type can take, or, if it is continuous, one might specify the range. Furthermore, if the type allows for structured terms, the allowed function symbols
can be specied. For example, to specify a type allowing for the set of terms
F = {f(g(f(g(...f(0)...))))} the following declarations
nul = 0; G = g(F); F = f(G) or f(nul)
recursively dene the set of terms F. Type declarations are important because
they allow the renement operators to generate only hypotheses that are typeconform. A hypothesis is type-conform if it satises the type restrictions.
Example 6.14. For instance, given the type declarations
type(p(F))
type(lives(person, location))
type(in(location, city))
181
the clauses
p(f(f(f(0))))
lives(X, Y), in(X, C)
are not type-conform, but the clauses
p(f(g(f(0))))
lives(X, Y), in(Y, C)
are.
In addition to types, there are also modes, which specify restrictions on the
order of literals in clauses. The way that literals are ordered in a clauses may
determine whether the clause is potentially relevant (and may contribute to
distinguishing positive from negative examples), the eciency of testing the
clause, and, when working with functors (as in program synthesis), whether
calls to the corresponding predicate terminate. A mode declaration is an
expression of the form mode(pred(m1 , ..., mn )), where the mi are dierent
modes. Typically, three modes are distinguished: input (denoted by +),
output (denoted by -) and ground (denoted by #). The input mode species that at the time of calling the predicate the corresponding argument must
be instantiated, the output mode species that the argument will be instantiated after a successful call to the predicate, and the constant mode species
that the argument must be ground (and possibly belong to a specied type).
A clause h b1 , ..., bn is now mode-conform if and only if
1. any input variable in a literal bi appears as an output variable in a literal
bj (with j < i) or as an input variable in the literal h,
2. any output variable in h appears as an output variable in some bi ,
3. any arguments of predicates required to be ground are ground.
Example 6.15. Consider the following declarations:
mode(molecule()). mode(atom(+, , #, #)). mode(bond(+, +, , #)).
type(molecule(m)). type(atom(m, a, at, r)). type(bond(m, a, a, bt)).
Then the clauses
molecule(M) atom(B, A, c, 3)
molecule(M) atom(M, A, D, 3), bond(M, B, A, C)
are not mode-conform because the variable B does not satisfy the input mode
and C is not ground. The following clauses, however, satisfy the modes:
molecule(M) atom(M, A, c, 3)
molecule(M) atom(M, A, c, 3), bond(M, A, B, double)
Very often, inductive logic programming systems integrate the notation for
modes and types, summarizing the above declarations as
mode(molecule(m)).
mode(atom(+m a, #at, #r)).
mode(bond(+m, +a, a, #bt)).
182
183
illegal(A, B, C, D, E, F) A = B
is not.
Regardless of the formalism employed, the designer of the logical or relational
learning system must ensure that the bias mechanism can be incorporated in
the search strategy. Often this is realized by dening a special-purpose renement operator that only generates clauses within the language of hypotheses.
Exercise 6.17. Dene a generality relationship for rule schemata and discuss
its properties. How would you use it for structuring the search space? (The
solution to this exercise forms the basis for the system Mobal [Morik et al.,
1993].)
Exercise 6.18. Outline a specialization operator employing the denite clause
grammar bias. (Hint: a sequence of derivation steps in the grammar corresponds to a specialization under -subsumption.)
6.6.2 Semantic Bias
In addition to syntactic restrictions, it can be desirable to constrain the behavior of the target predicate by imposing semantic restrictions on the clauses
in the hypotheses.
At least two such restrictions have been employed in the literature. The
rst restriction is that to determinate clauses, which we encountered in Sect.
4.12.1 when talking about propositionalization. A clause h b1 , ..., bn is
determinate if and only if for all substitutions that ground h, and all i,
there exists at most one substitution such that
b1 , ..., bn succeeds in B
(6.9)
Example 6.19. Under the usual semantics of family relationships, the clause
isafather(F) parent(F, C), male(F)
is not determinate, because F may have multiple children C. However, the
clause
father(F, C) parent(F, C), male(F)
is determinate.
Another form of semantic bias is concerned with learning functional predicates. A predicate p/n is functional if and only if if satises the constraint
X = Y p(X1 , ..., Xn , X), p(X1 , ..., Xn , Y )
(6.10)
where we have, for convenience, written the functional argument as the last
one.
184
6.7 Conclusions
This chapter introduced a methodology for developing logical and relational
learning algorithms and systems. The methodology starts by identifying a
propositional learning or mining system of interest, and then rst upgrades the
problem setting by changing the representation language of hypotheses and
examples and the covers relation, and then upgrades the propositional learning
algorithm in a systematic manner by modifying its operators. The methodology is eective and it was shown at work on three case studies from the
literature of inductive logic programming: the Foil system for rule-learning,
the Tilde system for logical decision tree induction, and Warmr for relational
association rule induction. The resulting systems also have the desirable properties that the original propositional system is a special case of the upgraded
one. Finally, we also discussed various ways to restrict the search space of
logical and relational learning systems by means of a declarative language
bias. This is often necessary to make the search more tractable even though
it imposes an additional burden on the user.
185
developments include: mFoil [Lavrac and Dzeroski, 1994], which aims at handling noise and whose Prolog source code is available in the public domain,
FFoil [Quinlan, 1996], which learns a functional predicate p(t1 , ..., tn ) implementing the function pf (t1 , ..., tn1 ) = tn , Focl [Pazzani and Kibler, 1992],
which employs resolution steps to obtain additional renements, and Foidl
[Mooney and Cali, 1995], which learns decision lists rather than unordered
rule sets. Other systems, such as Muggletons prominent Progol system
[Muggleton, 1995] and Srinivasans Aleph system [Srinivasan, 2007], possess
some similarities with Foil, even though Aleph and Progol were developed
from a richer logical perspective. Aleph and Progol apply inverse entailment (cf. Sect. 5.6.1) on a positive example and then heuristically search
the -subsumption lattice more generally than the resulting bottom clause.
Furthermore, rather than employing a beam search, Progol is based on an
A -like search mechanism. Another early inductive logic programming system
is Golem [Muggleton and Feng, 1992]. It combines the cautious specic-togeneral Algo. 3.5 with the covering algorithm. It provides an answer to Ex.
6.7.
Several relational or logical decision tree learners have been developed.
These include the early work of Watanabe and Rendell [1991], the regression
tree learner S-Cart [Kramer, 1996], the system Tilde by [Blockeel and De
Raedt, 1998], who also studied the expressive power of logical decision trees
as compared to relational learners that induce rules or decision lists, and the
more recent relational probability trees by Neville et al. [2003], which contain
probability estimates in the leaves of the tree. A related approach by Bostr
om
and Idestam-Almquist [1999] discusses a divide-and-conquer approach based
on performing resolution steps (that is, unfolding) on an overly general logic
program. A more recent approach computes aggregates of relational decision
trees in the form of relational random forests [Van Assche et al., 2006].
Frequent queries and relational association rules were introduced by Dehaspe and De Raedt [1997], Weber [1997], but became popular in data mining
with an application in predictive toxicology [Dehaspe et al., 1998, Dehaspe
and Toivonen, 2001]. Since then they have received quite some attention;
especially their ecient computation was studied by Nijssen and Kok [2001,
2003]. Recently, condensed representations (such as closed queries; cf. Ex. 3.8)
for relational queries have been developed [De Raedt and Ramon, 2004, Garriga et al., 2007]. Furthermore, the work on relational frequent query mining
and its applications has inspired much of the work on frequent graph mining,
which has been very popular over the past few years [Inokuchi et al., 2003,
Kuramochi and Karypis, 2001, Yan and Han, 2002, Nijssen and Kok, 2004].
Many dierent forms of declarative bias have been studied in the literature.
Modes and types were already introduced in the Model Inference System
of Shapiro [1983] and they have become standard since their incorporation in
the Progol system by Muggleton [1995]. Parametrized language restrictions
were employed by the Clint system of De Raedt [1992], who also studied ways
to shift the bias when the language was too restricted. Clause schemata were
186
introduced in Blip [Emde et al., 1983] and used in Mobal [Morik et al., 1993].
The denite clause grammar bias was rst used in Grendel [Cohen, 1994a].
Determinacy restrictions were employed in Linus [Lavrac and Dzeroski, 1994]
and Golem [Muggleton and Feng, 1992]. An overview of declarative bias is
contained in [Nedellec et al., 1996].
7
Inducing Theories
188
7 Inducing Theories
but can also synthesize programs from examples. Because theory revision in
rst-order logic as incorporated in the Model Inference System is quite
involved, it is worthwhile to study also some simpler settings that illustrate
alternative views on theory revision. Therefore, Sect. 7.4 introduces two famous propositional theory revision systems, the Horn algorithm by Angluin
et al. [1992] and the Duce system by Muggleton [1987]. Finally, we end this
chapter by investigating in Sect. 7.5 how a set of integrity constraints can be
induced from a theory. This complements the use sketched above of integrity
constraints to constrain the search space, and it is quite useful in a database
setting.
189
rank(8)
rank(10)
rank(k)
rank(b)
red(d)
black(c)
190
7 Inducing Theories
191
whenever it does not cover a positive example. The key dierence with the
techniques seen so far is that a renement operator at the theory level is
now employed.
Operators at the theory level start from theories, that is, sets of clauses,
and have to specialize or generalize these. In Chapter 5, we have already seen
operators that work on sets of clauses when dealing with (inverse) resolution.
However, one can also rene a theory by rening one of its clauses. These theory renement operators typically employ an underlying clausal renement
operator . Two typical theory renement operators work as follows.
The theory generalization operator ,g employing the clausal generalization renement operator g is dened as
,g (T ) = {T {c} {c } | c g (c) with c T } {T {c} | c Lh } (7.1)
The theory specialization operator ,s employing the clausal specialization
renement operator s is dened as follows:
,s (T ) = {T {c} {c } | c s (c) with c T } {T {c} | c T } (7.2)
The generalization operator ,g either generalizes one of the clauses in the
theory or adds a new clause. The specialization operator ,s either specializes
one of the clauses or deletes an entire clause.
Example 7.4. Consider the theory consisting of the following clauses:
ies(X) bird(X)
bird(X) ostrich(X)
normal(X) blackbird(X)
ostrich(oliver)
bird(X) blackbird(X)
and the negative example ies(oliver) that is covered by this theory. Various
renements correctly account for this example, for instance:
1. retract ies(X) bird(X)
2. retract bird(X) ostrich(X)
3. retract ostrich(oliver)
4. specialize ies(X) bird(X) into ies(X) bird(X), normal(X)
Assume that we select the fourth option, and then encounter an uncovered
positive example ies(tweety) . To deal with this example, there are again
various options, such as:
1. assert ies(tweety)
2. assert bird(tweety) and normal(tweety)
3. assert blackbird(tweety)
The last operation appears to be the most desirable one from a user perspective.
192
7 Inducing Theories
193
Finally, in Sect. 7.5, we shall show how integrity constraints in the form of
full clausal theories can be inferred from data. This is, as we shall argue, a
kind of inverse theory revision problem.
(7.3)
That is, abduction starts from a clause p q1 ... qn and a fact p and
infers that q1 ... qn must be true. This also implies that, abduction like
induction, can be regarded as a form of inverted deduction; cf. Sect. 5.1.
Example 7.6. Consider the clause ies(X) bird(X), normal(X) and the fact
ies(tweety). Abduction infers that bird(tweety) and normal(tweety) are both
true.
When the clause used by the abductive operator has variables in its body
that do not appear in its head, the abduced facts may not be ground. In
such situations, one typically applies a skolem substitution (which replaces
the variables in body(c) with new constants) or consults the user.
The abductive operator can be used to address the dependency problem
in theory revision. Indeed, examples for one predicate can be reduced to those
for other predicates. By revising the theory to correctly handle these other
examples, the original theory revision problem can be solved. The following
scheme based on the abductive operator dened in Eq. 7.3 can be used for
this purpose.
If p is a positive example and the clause p q1 , ..., qn belongs to the
theory, then infer that the q1 and ... and qn are positive examples.
If p is a negative example and the clause p q1 , ..., qn belongs to the
theory, then infer that q1 or ... or qn must be a negative example.
194
7 Inducing Theories
The rst case is a direct application of the abductive inference operator. The
second case corresponds to its contra-position. It is especially useful when the
clause is used in a proof of p from the theory. Indeed, the proof will no longer
hold if one of the qi no longer follows from the theory.
Example 7.7. Reconsider Ex. 7.4. If ies(tweety) is a positive example, it will
be covered if the two examples bird(tweety) and normal(tweety) are covered. If
on the other hand it is a negative example that is covered and the clause for
ies/1 is needed to prove normal(tweety), then ies(tweety) will no longer be
covered when either bird(tweety) or normal(tweety) is no longer covered.
One way of incorporating the abductive operators into a theory revision
algorithm, is to work with a procedure tr(E) that takes the current set of
examples E as a parameter. When the abductive operator is applied on a positive example, the procedure is called recursively using tr(E {q1 , ..., qn });
when it is applied on a negative example, one can use the following calls:
tr(E {q1 }), ..., tr(E {qn }). If one of these calls succeeds, then return
success.
7.2.2 Integrity Constraints
The use of integrity constraints in theory revision has been motivated by
its use in abductive logic programming and belief revision, where integrity
constraints provide a powerful means to constrain the abduced theories in a
declarative manner. Integrity constraints play an important role as in traditional databases, where they impose restrictions on the state (or extension) the
database can be in. In a theory revision context, they constrain the theories
that can be generated. In this chapter, we shall view an integrity constraint
as a (general) clause that is true in the intended interpretation. Furthermore,
a theory satises an integrity constraint if and only if the constraint is true
in the least Herbrand model of the theory. If a theory does not satisfy a
constraint, it violates the constraint.
The theory revision problem can now be modied to allow the user to
specify integrity constraints and to require that the generated theory satisfy
all constraints.
Example 7.8. Consider the theory shown in Ex. 7.4. The constraint
vampire(X); normal(X) ies(X),
which states that only normal animals and vampires y, is violated for
X = oliver.
Observe that facts that are true or false in the intended interpretation,
that is, positive and negative examples, can be represented as integrity constraints. Indeed, a positive example p corresponds to a constraint of the form
195
either the denition of one of the predicates pi in the body of the constraint
is too general (that is, T covers pi but should not), or
the denition of one of the predicates qj in the head of the constraint is
too specic (that is, T does not cover qj but should).
196
7 Inducing Theories
current theory, one cannot expect the constraints mentioning the predicate
p to be satised. Also, the predicates (and the constraints) that depend on
the predicate p may be aected. A predicate p depends on a predicate q with
regard to a given theory if and only if there is a clause in the denition of
p that mentions q, or there is a clause in the denition of p that mentions a
predicate r that depends on q. Therefore, one should postpone checking constraints that depend on predicates for which there are still incorrectly handled
examples.
Example 7.9. Reconsider the constraint
vampire(X); normal(X) ies(X).
If there are still incorrectly handled examples for vampire say vampire(dracula)
is a positive but uncovered example one cannot expect the constraint to
be satised and should therefore postpone the verication of the constraint
until the positive example is satised.
Exercise 7.10. Can you relax the conditions for postponing the examples in
situations where a predicate has either only uncovered positive examples or
only covered negative examples?
7.2.3 Abductive Logic Programming
The special case of theory revision that employs integrity constraints but only
allows us to add or delete missing facts is known as abductive logic programming. It has received a lot of attention in the computational logic community
and can be dened as follows:
Given
a
a
a
a
The computational logic community has also devoted a lot of attention to dealing
in a more sound manner with normal programs, which employ negation as failure
[Kakas et al., 1992, Denecker and De Schreye, 1992, Flach, 1994].
197
problem. Throughout this section, it will be assumed, for reasons of simplicity, that the integrity constraints are denials, that is, clauses of the form
q1 , ..., qn . This simplies the credit assignment problem in that theories
that violate a denial must be overly general.
Example 7.11. Consider the theory
bird(X) ostrich(X)
bird(X) blackbird(X)
198
7 Inducing Theories
ies(tweety)
bird(tweety), normal(tweety)
ostrich(tweety), normal(tweety)
normal(tweety)
blackbird(tweety), normal(tweety)
normal(tweety)
199
Algo. 7.2 can be adapted to nd a minimal set of facts by using a breadthrst strategy (where the depth would be dened in terms of the size of F )
instead of a depth-rst one. In Chapter 8, we shall extend the algorithm
to work in a probabilistic context, which allows one to associate probabilities
with the dierent solutions, and to prefer the one with the highest probability.
Abductive logic programming is a rich research eld that has successfully
addressed such problems under many dierent settings (including the use of
negation). A detailed overview of these is outside the scope of this book, but
can be found in [Kakas et al., 1992].
Abductive logic programming also has interesting applications, including:
Finally, let us still stress that the abductive logic programming setting
dealt with in this section forms a special type of theory revision problem.
Furthermore, Algo. 7.2 is closely related to the Model Inference System,
in which the only generalization operator is the one that adds specic facts,
and in which the oracle always answers positively (and the Model Inference
Systems eager strategy is used); cf. Sect. 7.3 below.
200
7 Inducing Theories
membership queries, which query the oracle for the truth-value of a specic
ground fact in the intended interpretation,
existential queries, which query the oracle for all substitutions that make
an atom a ground and a true in the intended interpretation; e.g. when
presented with the query father(X, soetkin), the oracle may answer X = luc;
subset queries, which query the oracle about whether a certain clause is
true in the intended interpretation;
equivalence queries, which ask the oracle whether a particular hypothesis
is equivalent to the target theory; the oracle answers yes if that is the case,
and presents a counter-example otherwise.
The Model Inference System relies on an oracle for two dierent tasks.
First, its key specialization operation is to remove an incorrect clause from the
current theory. This is accomplished by the backtracing algorithm sketched in
the next subsection. Second, it uses an oracle to decide whether a candidate
clause to be added to the theory covers a positive example.
The Backtracing Algorithm
The rst way that the Model Inference System employs an oracle is by
identifying incorrect clauses in the current theory, where a clause is incorrect
if and only if it is false in the intended interpretation.
In Shapiros Model Inference System, this property is used in the
backtracing algorithm, Algo. 7.3, which starts from a covered negative example
n and identies an incorrect clause in the present theory. The algorithm rst
computes the SLD-tree and then analyzes the successful branches of the tree.
Each such branch is then analyzed in a bottom-up manner. The algorithm
starts by considering the deepest literal that was resolved and consults the
oracle to decide whether the literal is true in the interpretation or not. If it
is, the search continues with the parent literals. Otherwise, the clause used to
resolve q is incorrect and output.
Example 7.15. Consider the theory
normal(X) ostrich(X)
bird(X) ostrich(X)
and the false negative ies(oliver). The SLD-tree is shown in Fig. 7.2. Assuming that the rst clause is incorrect, the backtracing algorithm would ask the
oracle for the truth-values of ostrich(oliver) (true) and normal(oliver) (false)
and return the incorrect clause normal(X) ostrich(X) which was used to
resolve normal(oliver).
201
Exercise 7.16. The backtracing algorithm will in the worst case query the
oracle for the truth-value of all literals employed in a successful branch. This
corresponds to a linear search through the proof. Can you sketch the outline of
Shapiros divide-and-conquer approach? Rather than selecting the next atom
on the path from the bottom to the top of the proof, the divide-and-conquer
approach focuses on the atom in the middle of the tree.
ies(oliver)
bird(oliver), normal(oliver)
ostrich(oliver), normal(oliver)
normal(oliver)
ostrich(oliver)
Fig. 7.2. Illustrating backtracing.
The backtracing algorithm, to some extent, employs a form of abductive reasoning. Indeed, in the above example, from the negative example
202
7 Inducing Theories
ies(oliver) the system abduces that some of the atoms used in the proof may
be negative as well, and therefore queries the oracle for their truth-values.
This process is continued until enough evidence is accumulated to identify an
incorrect clause.
Discovering Missing Clauses
A second reason for employing an oracle in a theory revision system is to guide
the search when processing an uncovered positive example. When processing
such an example, one must decide whether there are missing clauses for the
predicate in the example or whether perhaps some of the underlying predicates
are incomplete. To this end, Shapiros Model Inference System employs
three dierent strategies, one of which heavily relies on the use of an oracle.
To explain the dierences, we need to dene when a clause covers an example
with regard to a model.
More formally, a clause p q1 , ..., qn covers an example q in the model M
if and only if
mgu(p, q) = and : (q1 , ..., qn ) is true in M
(7.4)
While learning, the system cannot directly access the intended interpretation, but can consult it indirectly by posing queries to the oracle and using the
examples it already knows. This is why covers testing is performed not with
regard to the intended intepretation but rather through the use of a dierent
model M . Shapiro distinguishes three dierent possibilities:
In the lazy strategy, the model M contains only the example set E, and
an atom is considered true if it is a known positive example, false if it is a
known negative example, and unknown otherwise.
In the eager strategy, the model M corresponds to the intended interpretation. To decide on the truth-value of an atom, the eager strategy
rst veries whether it already knows the truth-value of the atom in the
example set E, and if it does not, it queries the oracle for the truth-value.
In the adaptive strategy, the model M corresponds to the least Herbrand
model of P {c} T , where P is the set of positive examples, T is the
current theory and c is the clause whose coverage is evaluated.
At this point, one can also imagine a fourth possibility, a variant of the adaptive strategy, which employs the least Herbrand model of P T .
Example 7.17. Suppose one has to decide whether the clause
ies(X) normal(X), bird(X)
covers the example ies(tweety). Using the lazy strategy, the example is not
covered by the clause unless the facts normal(tweety) and bird(tweety) have
already been provided as positive examples. Using the eager strategy, the
203
At this point, one can easily imagine more ecient ways of realizing this than
marking all clauses.
204
7 Inducing Theories
c
and adapted from [Shapiro, 1983], excerpt from pages 104109, 1983
Massachusetts Institute of Technology, by permission of The MIT Press);3 the
eager strategy is employed and the language bias species that the rst argument of member is an element and the second is a list.
?-mis.
Next fact? member(a, [b, a]) is true.
Checking facts . . . member(a, [b, a]) is not entailed.
MIS discovers that the reason for this is that there is no clause covering the
example (according to Eq. 7.4) and decides to search for one.
Searching for a clause that covers member(a, [b, a]) . . .
Checking member(X, [Y|Z])
Found clause member(X, [Y|Z])
Checking facts . . . no error found
Next fact? member(a, [b, c]) is false.
Fact member(a, [b, c]) is entailed . . . locating an incorrect clause
Clause member(X, [Y|Z]) is incorrect and retracted
Checking facts . . . member(a, [b, a]) is not entailed.
Searching for a clause that covers member(a, [b, a]) . . .
Checking member(X, [Y|Z]) . . . refuted
Checking member(X, [Y, Z|U]) . . . refuted
Checking member(X, [Y|Z]) member(Y, Z)
Query: is member(b, [a]) true? no.
If the answer were yes, the original example would be covered by the clause.
Checking member(X, [Y|Z]) member(X, Z)
3
For understandability, the order of the queries and candidate clauses has been
slightly modied.
205
206
7 Inducing Theories
function of the input arguments, which implies that for each input argument,
there is exactly one output argument for which the predicate succeeds; cf. also
Sect. 6.6.2), and that isort/2 employs the (unknown) predicate insert/3, which
in turn employs .
?-mis.
Next fact? isort([2, 3, 1], [1, 2, 3]) is true.
Checking facts . . . isort([2, 3, 1], [1, 2, 3]) is not entailed.
MIS discovers that the reason for this is that there is no clause covering the
example (according to Eq. 7.4) and decides to search for one.
Searching for a clause that covers isort([2, 3, 1], [1, 2, 3]) . . .
Query: is isort([3, 1], [1, 2, 3]) true? no.
Query: is insert(2, [3, 1], [1, 2, 3]) true? no.
Query: is isort([1], [1, 2, 3]) true? no.
Query: is insert(2, [1], [1, 2, 3]) true? no.
Query: is insert(3, [1], [1, 2, 3]) true? no.
Query: for which values of X is isort([3, 1], X) true? X = [1,3].
Query: is insert(2, [1, 3], [1, 2, 3]) true? yes.
Found clause isort([X|Y], Z) isort(Y, V), insert(X, V, Z)
Checking facts . . . isort([2, 3, 1], [1, 2, 3]) is not entailed.
Query: for which values of X is isort([1], X) true? X =[1].
Query: for which values of X is isort([], X) true? X =[].
Searching for a clause that covers isort([], []). . .
Found clause isort([], []) . . .
Current hypothesis for isort/2:
isort([], [])
isort([X|Y], Z) isort(Y, V), insert(X, V, Z)
Checking facts . . . isort([2, 3, 1], [1, 2, 3]) is not entailed.
Query: is insert(1, [], [1]) true? yes.
Searching for a clause that covers insert(1, [], [1]) . . .
Found clause insert(X, Y, [X|Y]) (an incorrect clause consistent with the
current facts)
Checking facts . . . isort([2, 3, 1], [1, 2, 3]) is not entailed.
Query: is insert(3, [1], [1, 3]) true? yes.
Searching for a clause that covers insert(3, [1], [1, 3]). . .
Query: is insert(3, [], [1, 3]) true? no.
Query: is insert(1, [], [1, 3]) true? no.
Found clause insert(X, [Y|Z], [Y, X|Z])
Current hypothesis for insert/3:
insert(X, Y, [X|Y])
insert(X, [Y|Z], [Y, X|Z])
Checking facts . . . no error found
At this point, all examples known to MIS are handled correctly. The user,
however, discovers a mistake and enters it.
Next fact? isort([2, 3, 1], [2, 3, 1]) is false.
207
208
7 Inducing Theories
More precisely, let m be the number of clauses in the target theory, and n be the
number of predicates. Then Algo. 7.5 learns a Horn theory that is logically equiva-
209
The algorithm is summarized in Algo. 7.5. One observation that is exploited by Horn is that a negative example x must violate one of the clauses
in clauses(s).
Example 7.21. Assume that the theory involves the propositional predicates
ies, bird and normal, and that {bird, normal} is a negative example. Then the
example violates at least one of the clauses({bird, normal}), that is,
ies bird, normal
false bird, normal
lent to the unknown target theory in polynomial time using O(m2 n2 ) equivalence
queries and O(m2 n) membership queries.
210
7 Inducing Theories
or their generalizations.
Given that Horn searches from specic to general, it starts to search this
space of possibilities at the most specic of these, that is, at clauses(s). During
the learning process, Horn keeps track of an ordered sequence of negative
examples S. Each new negative example x is used to rene the theory. There
are two ways of realizing this. First, Horn attempts to generalize a negative
example using one of the examples s already in S. For each such generalization
x s, Horn queries the user to nd out whether the generalized example is
negative or not. If it is negative, the example can safely be generalized (and
replaced in S). If it is positive, generalization is not allowed as otherwise
a positive example (x s) would become violated. Second, if the previous
attempts to generalize x fail, the new example is added to the end of S. Finally,
after processing a negative example, the clauses on H must be recomputed
from S. Positive examples are only used to elmininate clauses from H that are
incorrect. These are clauses that violate one of the positive examples already
encountered.
Observe that the idea of generalization by intersection corresponds to computing a kind of least general generalization of two negative examples. This
idea in combination with the removal of clauses (and candidates) that violate
the dual examples (the positives) resembles the inductive logic programming
system Golem [Muggleton and Feng, 1992]. However, whereas Golem computes the least general generalization of positives and removes the clauses
covering negatives, Horn takes the converse approach.
Exercise 7.22. Explain why Golem and Horn perform dual operations.
A session with Horn is shown in the next example.
Example 7.23. Let the target theory be
ies bird, normal
normal bird, strongwings
?-Horn.
Query: is equivalent to the target theory?
No. Counter-example: {bird, strongwings, normal} (negative).
This is a negative example, covered by the current theory H = , but violated
by the rst clause of the target theory.
At this point becomes S = [{bird, strongwings, normal}]
Query: is
false bird, strongwings, normal
ies bird, strongwings, normal
equivalent to the target theory?
No. Counter-example: {bird, strongwings, normal, ies} (positive).
Retracting false bird, strongwings, normal
Query: is
211
212
7 Inducing Theories
213
214
7 Inducing Theories
arises in this context is whether one can also induce such integrity constraints?
This question has received quite some attention in the data mining literature,
and various algorithms have been developed for inducing a rich variety of
integrity constraints from databases. In this section, we show how integrity
constraints in the form of general clauses can be induced from a database (in
the form of an interpretation). Furthermore, it will be shown how this general
framework can be instantiated to infer other forms of integrity constraints
such as functional, inclusion and multi-valued dependencies.
7.5.1 Problem Specication
The problem of inducing integrity constraints can be specied as follows.
Given:
(7.5)
Thus integrity constraints are clauses, and the database satises a clause
if the interpretation (representing the database) is a model for the clause;
otherwise, the databases violates the clause. Furthermore, one is looking for
a complete set of clauses, that is, all clauses that cover the database must be
either in I or entailed by I.
Example 7.31. Let the language L contain all clauses containing one variable
and no constants over the predicates human/1, male1/1 and female/1, and let
the database D be the interpretation
{male(luc), female(lieve), human(lieve), human(luc)}.
Then the following set of clauses constitutes a complete solution to the integrity constraint induction problem:
female(X), male(X)
female(X); male(X) human(X)
human(X) male(X)
human(X) female(X)
Even though other clauses in L are satised by the database, the theory is
complete because all other clauses (such as female(X), male(X), human(X))
are entailed by the theory.
215
(7.6)
Minimal theories are often desired because they do not contain redundant
clauses. Observe also that it is important that L be nite. Otherwise, the
induced theory might be innite as well.
7.5.2 An Algorithm for Inducing Integrity Constraints
The key insight that leads to an algorithm is that when a clause p1 ; ...; pm
q1 , ..., qn is violated by a database there must be a substitution for which
q1 , ..., qn holds in D but p1 ; ...; pm does not hold. Such a substitution can
be computed by answering the query q1 , ..., qn , not(p1 ; ...; pm ) using Prolog
on the database D. (This procedure is only sound for range-restricted clauses.)
Example 7.32. Consider the database
{human(luc), human(lieve), bat(dracula),
male(luc), male(dracula), female(lieve)}.
Then the clause
human(X) male(X)
is violated for the substitution = {X/dracula}.
If a clause c violates a database for a substitution , one can rene it by
either modifying body(c) so that it no longer succeeds for or by modifying
head(c) so that it no longer fails for . Thus the clause can be rened by either
specializing the body or generalizing the head, for instance, by adding literals
to the head or the body. Instead of realizing this using two dierent operations,
it is convenient to merely apply a renement operator under -subsumption
to the clause c.
Example 7.33. Some of the renements of the violated clause
male(X)
include
human(X) male(X)
female(X) male(X)
male(X), bat(X)
bat(X) male(X)
male(X), female(X)
male(X), human(X).
216
7 Inducing Theories
generalizes the clause. This is also what is needed because the clause is overly
specic as it does not cover the positive interpretation and, hence, must be
generalized.
Given that our aim is to nd a complete theory, we can easily adapt the
generic algorithm (Algo. 3.10) presented earlier. This algorithm closely corresponds to the clausal discovery engine presented by De Raedt and Bruynooghe
[1993].
Algorithm 7.6 Discovering integrity constraints
Queue := {};
I := ;
while Queue = do
Delete c from Queue;
if c covers D then
add c to I
else
Queue := Queue o (c)
end if
end while
return I
The algorithm starts from the most specic element (the empty clause
when learning from interpretations) and repeatedly generalizes it using an
optimal renement operator under -subsumption for the language L. Whenever it encounters a clause that is satised by the database, it is added to the
integrity theory I. Those clauses that are not satised are further rened.
Observe also that various search strategies are possible in the clausal discovery algorithm presented. Two natural ones include breadth-rst and iterative deepening [De Raedt and Bruynooghe, 1993].
It is easy to see that the clausal discovery algorithm nds a complete integrity theory. However, it is not necessarily a minimal one. Some redundant
clauses can be eliminated by verifying whether I |= c before adding the clause
c to the integrity theory. This requires however the use of a rst-order theorem prover (such as Satchmo [Manthey and Bry, 1988] or PTTP [Stickel,
1988]). Furthermore, this by itself does not suce to guarantee that a minimal
integrity theory is found.
Exercise 7.34. Can you provide an example that shows that non-minimal
theories may be found even when using the above procedure to eliminate
redundant clauses ? (Hint: this depends on the order in which the clauses are
considered by the algorithm).
To guarantee a minimal theory, one must include a post-processing phase
in which the clauses have to be processed in the order in which they were
found. For each such clause, one can then check whether it is redundant with
217
regard to the discovered theory. If it is, it can be deleted before going to the
next clause.
A further optimization is possible when the language L is anti-monotonic
[De Raedt and Bruynooghe, 1993]. A language is anti-monotonic if and only
if
c L : (s -subsumes c) s L
(7.7)
Anti-monotonicity in this context requires that all generalizations of all clauses
in L also belong to L. For anti-monotonic languages, one can safely prune
away renements that are not reduced w.r.t. the data while still retaining a
complete solution.
A renement c {l} of a clause c is not reduced with regard to the data D
if and only if vars(l) vars(c) and
: c is violated if and only if c {l} is violated in D
(7.8)
218
7 Inducing Theories
(we abbreviate atoms such as male(X) to m), which in turn cover the example
and are therefore rened as well. Of the resulting clauses, the clauses
m, f
hm
hf
f, h
mf
fm
are not reduced. The only clauses that remain for renement are
fh
m h.
Given that we work with an optimal renement operator, the only remaining
renement is
m; f h
which forms a solution as well.
m, f
m, h
fm
hm
hf
f, h
mf
fh mh
m; f h
Fig. 7.3. Illustrating clausal discovery
(7.9)
219
Example 7.37. Consider the database for the relation train(From, Hour, Min, To)
that denotes that there is a train from From to To at time Hour, Min:
train(utrecht, 8, 8, denbosch)
train(maastricht, 8, 10, weert)
train(utrecht, 9, 8, denbosch)
train(maastricht, 9, 10, weert)
train(utrecht, 8, 13, eindhoven)
train(utrecht, 8, 43, eindhoven)
train(utrecht, 9, 13, eindhoven)
train(utrecht, 9, 43, eindhoven)
(7.10)
where r denotes a relation and we again work with vectors of variables. Again,
one can simplify the notation and write this as X Y where X and Y represent
the attributes used in the relation.
Inclusion dependencies are clauses of the form r.X s.Y where r.X and
s.Y represent the attributes used in the relations r and s. They basically state
that every value that appears in r.X must also appear in s.Y.
220
7 Inducing Theories
7.6 Conclusions
In this chapter we have investigated the complications that arise when learning
or revising theories. Dierent types of theories and settings have been considered. First, we have looked into abductive logic programming, where possible
revisions are restricted to the addition of facts. We have also seen that integrity constraints in the form of general clauses provide us with a powerful
and declarative means to incorporate additional background knowledge into
the induction process and to restrict the space of possible solutions. Second,
we have considered the problem of inferring a theory or model by interacting with an oracle. The same types of techniques are applicable to program
synthesis from examples. Third, we have also used two propositional learners,
that is, Horn [Angluin et al., 1992] and Duce [Muggleton, 1987], to illustrate
computational complexity issues in both theory revision and heuristic search.
Finally, we have concluded the chapter by investigating how integrity theories
can be induced from data.
Throughout the chapter, several new principles for logical and relational
learning have been introduced. These include the use of abductive reasoning
for inferring missing facts that explain particular examples, the use of operators at the level of theories, the use of an oracle to support interaction, and
the use and the induction of integrity constraints.
221
equivalence and subset queries. A detailed account of the use of queries for
learning is given in [Angluin, 1987]. Various researchers have also tried to
upgrade Horn to a proper inductive logic programming setting with interesting theoretical and practical results; cf. [Arias and Khardon, 2002, Khardon,
1999, Reddy and Tadepalli, 1998] and Sect. 10.2. The combination of learning
and reasoning was studied by Khardon and Roth [1997].
The introduction of integrity constraints in theory revision systems is due
to De Raedt and Bruynooghe [1992b]. It was motivated by an analogy between
the view-updating problem in deductive databases (briey sketched at the end
of Sect. 7.2.3).
Abduction has fascinated researchers since the introduction of the term
by the philosopher Charles S. Peirce [Hartshorne and Weiss, 1965]. In a computational logic context, early works include [Poole, 1988, Shanahan, 1989]
and overviews are given by [Kakas et al., 1992, 1998]. The relationship among
induction and abduction is discussed in [Flach and Kakas, 2000], and a useful view in an inductive logic programming context is presented in [Ade and
Denecker, 1995].
The induction of integrity constraints in various forms has been studied
by various researchers in the data mining community, for instance [Mannila
and Raiha, 1992, Flach and Savnik, 1999]. Within an inductive logic programming setting it was studied by Helft [1989], De Raedt and Bruynooghe [1993],
De Raedt and Dehaspe [1997] and Flach and Lachiche [2001].
For Matthew
Young man going east
8
Probabilistic Logic Learning
So far, this book has focused on logical aspects of learning and on learning
in logic. Logic has, however, severe limitations for representing and reasoning
about uncertainty. Therefore, this chapter adds another dimension to logic and
learning: probability. Probability theory provides us with an elegant and formal
basis for reasoning about uncertainty. In the past few decades, several probabilistic knowledge representation formalisms have been developed to cope with
uncertainty, and many of these formalisms can be learned from data. Unfortunately, most such formalisms are propositional, and hence they suer from
the same limitations as traditional propositional learning systems. This chapter studies how to alleviate these problems by introducing probabilistic logic
learning, sometimes also called probabilistic inductive logic programming or
statistical relational learning. This is a newly emerging area in articial intelligence lying at the intersection of reasoning about uncertainty, machine
learning and knowledge representation. Our presentation of probabilistic logic
learning starts from an inductive logic programming perspective and extends
logical learning with probabilistic methods. In this regard, it follows the upgrading approach of Chapter 6. The chapter will also show how the frameworks of learning from interpretations and learning from entailment can be
upgraded to a probabilistic context, yielding representational formalisms such
as stochastic logic programs (SLPs) [Eisele, 1994, Muggleton, 1996, Cussens,
2000], PRISM [Sato, 1995] and ICL [Poole, 1993b], Markov logic networks
[Richardson and Domingos, 2006], and Bayesian logic programs [Kersting and
De Raedt, 2007].
While the chapter provides a brief review of probabilistic models, it does not
contain an elaborate overview of probabilistic methods in articial intelligence,
as this by itself is an important topic of study. Such overviews can be found,
for instance, in [Russell and Norvig, 2004, Jensen, 2001, Cowell et al., 1999,
Baldi et al., 2003]. At the same time, the chapter is not intended as a complete
survey of statistical relational learning (see [De Raedt and Kersting, 2003,
Getoor and Taskar, 2007, De Raedt et al., 2008]), but rather focuses on the
principles that underlie this new and exciting subeld of articial intelligence.
224
P(X, Y )
P(Y )
(8.1)
(8.2)
(8.3)
(8.4)
(8.5)
Observe that, due to the division, it is required that P(Y ) = 0, that is,
y dom(Y ) : P (y) = 0.
225
n
P(Xi |Xi1 , , X1 )
(8.6)
i=2
(8.7)
Marginalization:
P(X) =
P(X, y)
(8.8)
ydom(Y )
Conditional independence: the (sets of) variables X and Y are conditionally independendent given Z (assuming P(Y ) = 0) if and only if
P(X, Y |Z) = P(X|Z) P(Y |Z)
(8.10)
(8.11)
This is sometimes denoted as (XY |Z). Intuitively, Eq. 8.11 states that
when X and Y are conditionally independent given Z, knowing the value
of Y does not inuence (that is provide any information about) the value
of X, provided one already knows the value of Z.
If the conditional independency property holds without needing to condition on Z, we say that X and Y are marginally independent, notation
(XY ). Obviously, when X and Y are conditionally independent given
Z, then Y and X are also conditionally independent given Z, more formally (XY |Z) (Y X|Z). Thus the conditional independence relation
is symmetric.
226
rushHour
227
badWeather
tracJam
annLate
jeLate
Fig. 8.1. A Bayesian network
P(badWeather)
(0.10, 0.90)
P(rushHour)
(0.25, 0.75)
tracJam P(annLate)
true
(0.70, 0.30)
f alse (0.01, 0.99)
Table 8.1. The conditional probability distributions associated with the nodes in
the trac network; cf. Figure 8.1. The distributions are specied over {true, f alse}
Example 8.1. Consider the Bayesian network in Fig. 8.1. It contains the random variables rushHour, badWeather, annLate, jeLate and tracJam. The
CPDs associated with each of the nodes are specied in Table 8.1. They include the CPDs P(tracJam | badWeather, rushHour), P(badWeather), etc.
The Bayesian network thus has two components: a qualitative one, the directed acyclic graph, and a quantitative one, the conditional probability distributions. Together they specify the joint probability distribution P(X1 , ..., Xn )
over a xed and nite set of random variables {X1 , . . . , Xn }. For simplicity,
228
we assume that all random variables have the domain {true, f alse}; this actually amounts to specifying a probability distribution on the set of all possible
interpretations. Indeed, in our trac example, the Bayesian network denes
a probability distribution over truth assignments to {tracJam, rushHour,
annLate, jeLate, badWeather}.
Intuitively, an arc from node X to node Y in the directed acyclic graph
indicates that X inuences Y . In the trac example, having bad weather or
during rush hour the probability that there is a trac jam increases. Also,
if there is a trac jam, Je and Ann are likely to be late. More formally,
the qualitative component of a Bayesian network species the following set
of conditional independence assumptions (sometimes called the local Markov
assumptions):
Assumption 1 (cf. Russell and Norvig [2004]) Each node Xi in the graph is
conditionally independent of any subset A of nodes that are non-descendants
of Xi given a joint state of Pa(Xi ), that is, P(Xi | A, Pa(Xi )) =P(Xi | Pa(Xi )).
For example, annLate is conditionally independent of badWeather given
its parent tracJam, notation (annLatebadWeather|tracJam). Intuitively,
it states that knowledge of the value of badWeather is not inuencing, that
is, not providing more information about the value of annLate if one already
knows the value of tracJam. Because of the local Markov assumptions, we
can write down the joint probability density as
P(X1 , . . . , Xn ) =
n
P(Xi | Pa(Xi ))
(8.12)
i=1
by applying the independency assumption and the chain rule to the joint
probability distribution. Let us illustrate this derivation on our example:
P(B, R, T, J, A) = P(A|B, R, T, J) P(B, R, T, J)
= P(A|T ) P(B, R, T, J) (Assumption 1)
= P(A|T )
= P(A|T )
= P(A|T )
= P(A|T )
P(J|B, R, T ) P(B, R, T )
P(J|T ) P(T |B, R) P(B, R)
P(J|T ) P(T |B, R) P(B|R) P(R)
P(J|T ) P(T |B, R) P(B) P(R)
(8.13)
229
These ndings are also valid when taking into account intermediate nodes.
For instance, replacing X Z Y with X U1 ... Uk Z V1
... Vm Y still yields a serial connection with the same properties. In the
literature on Bayesian networks, these notions are used in the denition of dseparation. Two sets of nodes X and Y are d-separated given evidence nodes
Z provided that there is no connection from a node in X to one in Y along
which information can ow. So, all connections from nodes in X to nodes in
Y should be blocked by nodes in Z. The notion of d-separation coincides with
that of conditional independence.
Bayesian networks are a popular knowledge representation formalism because they allow one to explicitly encode conditional independency assumptions, which result in a compact representation of the joint probability distri-
230
bution. This is much more ecient than directly encoding the joint probability
distribution in a table, as the trac network example illustrates.
Exercise 8.3. How many probability values are required to explicitly list the
probability of each interpretation for the trac problem? How many are required when the Bayesian network is used?
So, Bayesian networks dene a probability distribution on the possible
worlds, that is, the interpretations. To compute the probability of the interpretation {t, a, b}, observe that r and j hold. Therefore, the probability of
this interpretation is
P (b, r, t, j, a) = P (a|t)P (j|t)P (t|b, r)P (b)P (r)
= 0.7 0.4 0.7 0.1 0.75
= 0.0147
(8.14)
(8.15)
(8.16)
P (B, R, t, J, a)
(8.19)
231
232
P(X1 , , Xn ) =
1
Z
fc (Xc1 , , Xckc )
(8.20)
c:clique
where Z is a normalization constant needed to obtain a probability distribution (summing to 1). It is dened by
Z=
fc (Xc1 = xc1 , , Xckc = xckc )
(8.21)
x1 , ,xn c:clique
1
fT,R,B (T, R, B) fJ,T (J, T ) fA,T (A, T )
Z
(8.22)
(8.23)
where the Fi denote features of the state of the Xc1 , , Xckc and the wi
are weights. This results in a so-called log-linear model because taking the
logarithm of Eq. 8.20 then yields a weighted sum of features, which is easier
to handle than a product.
The graphs of Bayesian and Markov nets encode a set of (conditional)
independency assumptions. A natural question that arises in this context is
whether Markov and Bayesian nets can encode the same set of conditional
independency assumptions. The answer to this question is, however, negative.
Indeed, the assumptions encoded by the Bayesian net depicted in Fig. 8.2c,
the converging connection, cannot be encoded using a Markov net.
We now turn our attention to probabilistic representations that dene
probability distributions on sequences; they are often used in the natural
language processing community [Manning and Sch
utze, 1999].
8.2.2 Probabilities on Proofs
In this section, we rst introduce probabilistic context-free grammars, and
then study a closely related framework: Markov models.
Probabilistic Context-Free Grammars
Probabilistic grammars, which have been employed successfully in bioinformatics [Durbin et al., 1998] and natural language processing [Manning and
rushHour
233
badWeather
tracJam
annLate
jeLate
Fig. 8.3. A Markov network
Sch
utze, 1999], dene a probability distribution on proofs. Because there is
a close correspondence between derivations in a (context-free) grammar and
resolution proofs (cf. Sect. 4.6), probabilistic grammars can provide ideas for
probabilistic resolution proofs.
Probabilistic context-free grammars are context-free grammars (cf. Sect.
4.6) where the rules possess a probability label. More formally, whereas the
usual rules in a context-free grammar have the form n s (where n is a nonterminal symbol in N and s is a string over N ), the rules in a probabilistic
context-free grammars are of the form p : n s, where p is a probability value.
Furthermore, it is required that
p=1
(8.24)
n N :
p:nsi
that is, the sum of the probabilities associated with rules for each non-terminal
symbol n must be equal to 1.
Example 8.7. Consider the following probabilistic context-free grammar,
adapted from Allen [1987], where N = {S, NP, VP, N, PP, V, P} and {rice, ies,
like, sand, ...} , and where we have omitted many of the terminal symbols
for brevity.
234
1.0 :
0.2 :
0.8 :
0.6 :
0.4 :
1.0 :
S NP, VP.
NP N, N.
NP N.
VP V, NP.
VP V, PP.
PP P, NP.
0.01 :
0.01 :
...
0.02 :
0.02 :
...
0.05 :
...
N rice.
N ies.
V like.
V ies.
P like.
Observe, for instance, that the sum of the probabilities for the non-terminal
VP = 0.4 + 0.6 = 1.
We can now employ the rules to dene the probability of a derivation (or
proof) and the probability of a sentence. The probability P (d) of a derivation
d, in which the rules r1 , ..., rn with associated probability labels p1 , ..., pn are
used m1 , ..., mn times, is
i
P (d) =
pm
(8.25)
i
i
Example 8.8. Consider the following derivation of the sentence Rice ies like
sand with the above-mentioned stochastic grammar. The associated probabilities are listed on the right.
S NP VP.
1.0
S N N VP.
S Rice N VP.
0.2
0.2 0.01
S Rice
S Rice
S Rice
S Rice
S Rice
ies
ies
ies
ies
ies
VP.
V NP.
like NP.
like N.
like sand.
Each time a rule is applied in a proof, the probability of the rule is multiplied
with the overall probability. This induces a probability distribution over all
derivations for the same non-terminal symbol.1 The probabilities on derivations can be aggregated to obtain a probability distribution over all sentences
s that can be derived from a non-terminal symbol n. More formally,
P (n s) =
P (d(n s))
(8.26)
d(ns)
1
There exist some context-free grammars for which the sum of the probabilities
over all the derivations is not equal to 1; see [Prescher, 2003] for more details and
a way to repair this.
235
(8.27)
The most likely derivation is useful for disambiguation. For instance, the
sentence Rice ies like sand possesses two parse trees. A natural language understanding system must choose among these dierent parse trees,
and the natural choice is the most likely one.
Sampling: generating a representative sample of sentences at random from
the grammar. Sample sentences can be generated by generating derivations
at random. Sampling a derivation proceeds by probabilistically selecting
at each choice point during the derivation the derivation step according to
the probabilities of the rules in the grammar.
Learning the structure or the parameters of the probabilistic-context free
grammar, cf. Sect. 8.3.
Exercise 8.9. Formalize the algorithm for sampling derivations from a stochastic context-free grammar and show how it works on an example.
Exercise 8.10. Design an algorithm to nd the most likely parse tree of a
sentence. Finding a naive algorithm is not so hard (and the purpose of the
exercise). However, there exists also a polynomial time algorithm based on
dynamic programming; cf. [Manning and Sch
utze, 1999].
For stochastic context-free grammars there exist ecient (polynomial) algorithms for the key problems (decoding, most likely parse tree, and learning
the parameters); cf. [Manning and Sch
utze, 1999]. However, their key limitation is their expressive power. On the one hand, they only deal with at
sequences, that is, sequences of unstructured symbols. On the other hand,
context-free grammars (and therefore stochastic context-free grammars) are
not Turing equivalent, that is, they cannot be used as a programming language
as denite clause logic can, as in Prolog. Therefore, it is useful to upgrade the
underlying grammar representation to that of a (denite) logic program, a
Turing-equivalent language; cf. [Muggleton, 1996].
236
Markov Models*
Markov models have numerous applications, most notably in speech recognition [Rabiner, 1989] and bioinformatics [Baldi and Brunak, 1998], where
(hidden) Markov models are used, for instance, to determine how likely it is
that a given protein belongs to some fold [Durbin et al., 1998]. Markov models
can be regarded as a kind of stochastic regular grammar. A stochastic regular grammar is a special case of a stochastic context-free grammar in which
all rules have exactly one symbol on the right-hand side. A key dierence
between Markov models and stochastic regular grammars, however, is that
hidden Markov models dene a probability distribution over sentences of the
same length, whereas in stochastic grammars the distribution is over sentences
of variable length. Markov models are also a special type of Bayesian network,
which is convenient for introducing them. In a visible Markov model, there is
a sequence of n variables X0 , , Xn , where the domain of each variable Xi
is the same, that is, the set of values they can take are identical. Furthermore,
it is assumed that
i, j 1 : P(Xi |Xi1 ) = P(Xj |Xj1 )
i, j 1 : P(Xi |Xi1 , Xi2 , , X0 ) = P(Xi |Xi1 ).
(8.28)
(8.29)
These assumptions imply that one only needs two sets of parameters, one that
models the prior P(X0 ) and one that models the state-transition probabilities
P(Xi |Xi1 ). Because the transition probababilities are the same for all i,
Markov models employ parameter tying (see below). A Markov model thus
corresponds to the type of Bayesian network shown in Fig. 8.4 and the Markov
model factorizes as
P(Xi |Xi1 )
P(X0 , , Xn ) = P(X0 )
i>0
(8.30)
X0
X1
...
Xn1
Xn
(8.31)
and that the model has the structure indicated in Fig. 8.5. Thus the hidden
Markov model factorizes as
n
237
i>0
(8.32)
In hidden Markov models, the Xi denote the hidden states and are typically
not observed, the Yi correspond to the observations.
X0
X1
Y0
Y1
...
Xn1
Xn
Yn1
Yn
Hidden Markov models are extremely popular in many application domains such as bioinformatics and natural language processing. One of the
reasons is that ecient inference procedures (based on dynamic programming)
exist for the following central tasks:
Decoding: computing the probability P(Y0 = y0 , , Yn = yn ) of a particular observation sequence.
Most likely state sequence: computing the most likely hidden state sequence corresponding to a particular observation sequence, that is,
This is realized using the well-known Viterbi algorithm; cf. Rabiner [1989].
State prediction: computing the most likely state based on a particular
observation sequence, that is,
arg max P (Xt = xt , , Xn = xn |Y0 = yo , , Yn = yn )
xt
(8.34)
238
(8.35)
P (E|H) P (H)
P (E)
(8.36)
239
(8.37)
The likelihood function shown in Eq. 8.37 will be employed throughout the rest
of the chapter. The reason is that the maximum aposteriori approach is more
complicated as a prior on the hypotheses must be specied and be taken into
account during the learning. This corresponds to the bayesian approach where
the prior is viewed as a kind of background knowledge. For an introduction
to this type of approach, the reader may want to consult [Russell and Norvig,
2004, Bishop, 2006].
It is typically assumed that the examples are independently and identically
distributed (i.i.d.), which allows one to rewrite the expression in the following
form (where the ei correspond to the dierent examples):
P (ei |H)
(8.38)
HM L = arg max
H
ei E
Notice that at this point, the probabilistic coverage relation P (e|H) is employed. It indicates the likelihood of observing e given the hypothesis H.
Typically, the goal is to learn a generative model, that is, a model that
could have generated the data. As an example of such a model, consider a
stochastic context-free grammar. To learn such a grammar, one employs possible examples e, for which P (e|H) > 0, that is, sentences with non-zero
probability. Examples that are impossible, that is, for which P (e|H) = 0, are
typically not used. This contrasts with the traditional inductive logic programming setting, which is discriminative. The positive examples in the traditional
inductive logic programming setting have a strictly positive probabilistic coverage, the negative ones have a 0 probabilistic coverage. This observation
implies that
P (e|H) > 0 if and only if c(e, H) = 1
(8.39)
ei E
where the examples ei are split up into the class of interest class(ei ) and the
description of the example des(ei ). Throughout the rest of this chapter, we
will concentrate on the generative case.
240
tracJam
annLate
Fig. 8.6. A simple Bayesian network. P (t) = 0 ; P (a|t) = 1 ; P (a|t) = 2
P(tracJam)
(0 , 1 0 )
tracJam P(annLate)
true
(1 , 1 1 )
f alse (2 , 1 2 )
Table 8.2. The conditional probability distributions associated with the nodes
in the simple trac network; cf. Figure 8.6. The distributions are specied over
{true, f alse}
Notice that the likelihood for one example satisfying tracJam = true and
annLate = f alse is
P (t, a) = 0 (1 1 )
e1
e2
e3
e4
...
241
tracJam annLate
true
true
true
true
false
false
false
true
Therefore, under the i.i.d. assumption, for n examples, the likelihood of the
data can be written as (where we use |x| to denote the number of examples
satisfying the logical condition x)
P (E|M ) =
=
n
i
|t|
0
P (ei |M )
|ta|
(1 0 )|t| 1
|ta|
(1 1 )|ta| 2
(1 2 )|ta|
(8.41)
0
0
1 0
|t a| |t a|
L
=
1
1
1 1
|t a| |t a|
L
=
2
2
1 2
(8.42)
(8.43)
(8.44)
(8.45)
(8.46)
(8.47)
242
e1
e2
e3
e4
tracJam annLate
true
true
true
?
false
false
?
true
Expectation Maximization
The Expectation Maximisation (EM) algorithm deals with the case where the
data are not fully observable, but only partially observable. To continue our
illustration, this corresponds to the type of example illustrated in Table 8.4. If
values for some variables are occasionally unobserved, there is missing data.
If values for some variables are always unobserved, the variables are called
latent.
We would like to maximize the (log-)likelihood of the data. The loglikelihood is, as before, a function of the parameters of the model. Let
us call this function Q(). The diculty now is that the function Q() depends on the unobserved values. A natural way of dealing with these values
is to compute the expected likelihood function Q(), where the expectation is
taken over the missing values of the examples. Let the examples ei = xi yi
be composed of an observed part xi and an unobserved part yi . In the expectation step, the expected values of the yi will be computed. To do this,
we need a model. Therefore, the expectation maximization algorithm assumes
that there is a current model M (j ) and uses it to compute the expected values of the yi , which are then used to compute Q(). More formally, this yields
(where E stands for the expectation taken with regard to the current model
M (j ) and the missing data yi , and L() for the likelihood as a function of
the parameters as indicated in Eq. 8.41):
243
Q() = E[L()]
= E[log P (E|M ()]
log P (ei |M ())
=E
ei E
log P (xi , yi |M ())]
=E
ei E
(8.48)
ei E
To compute the expected likelihood Q(), one rst needs to compute the
P (yi |xi , M (j )). These values are typically computed using the normal inference procedures of the underlying probabilistic model. Doing so corresponds
to estimating the likelihood that the examples xi are completed with the yi
given the current model M (j ) the estimation step. Once these estimates
are known, the expected likelihood of the data, Q() can be computed. Q()
is then used, in the maximization step, to determine the maximum likelihood
estimators. This step is analogous to that for fully observable data discussed
earlier. Thus, the general expectation maximization (EM) algorithm can be
summarized as follows:
E-Step: On the basis of the observed data and the present parameters of
the model, compute a distribution over all possible completions of each
partially observed data case.
M-Step: Using each completion as a fully observed data case weighted by
its probability, compute the updated parameter values using (weighted)
frequency counting.
The frequencies over the completions are called the expected counts. The algorithm is sketched more formally in Algo. 8.1.
Algorithm 8.1 The EM algorithm
j := 0
initialize j
repeat
Compute the P (yi |xi , M (j )) for all
i
j+1 := arg max Q() = arg max i P (yi |xi , M (j )).log P (xi |M ())
j := j + 1
until convergence
It can be shown that an EM re-estimation step never decreases the likelihood function, and hence that the EM algorithm must converge to a stationary
point of the likelihood function. If this function has a single maximum, the
EM algorithm will converge to a global maximum; otherwise it will converge
to a local maximum or a saddle point.
244
Example 8.11. On the example data set shown in Table 8.2, the EM algorithm
rst completes the data set. The result is that the example e2 (or e4 ) is split
into two fractional examples e2,1 and e2,2 . The rst has the value true for
a and receives a probability (weight) of P (a|t) and the second has the value
false and probability P (a|t). These fractional examples can then be used to
compute the expected counts and perform the maximization step. For instance,
the parameter 0 can be re-estimated as
0 =
ec(t)
ec(t) + ec(t)
(8.49)
where ec (t), the expected count of the number of occurrences of t given the
current set of parameters = (0 , 1 , 2 ), now replaces |t| in Eq. 8.45; that is
P (t|ei ) = 2 + P (t|e4 )
(8.50)
ec (t) =
i{1,...,4}
(8.51)
|ta|
P (E|M ) = 0 (1 0 )|t| 1
|tj|
|ta|
(1 1 )|ta| 2
|tj|
(1 3 )|tj| 4
(1 4 )|tj|
(1 2 )|ta|
245
|ta|+|tj|
P (E|M ) = 0 (1 0 )|t| 1
|ta|+|tj|
(1 1 )|ta|+|tj|
(1 2 )|ta|+|tj|
tracJam
annLate
jeLate
Exercise 8.13. Show that computing the maximum likelihood estimators for
the Bayesian network involving Je and Ann essentially corresponds to frequency counting.
Other methods to reduce the number of parameters of a probabilistic
model exist as well. One of them involves representing large conditional probability tables in a more compact manner. This can, for instance, be realized
by employing a decision tree to encode conditional probability distributions.
246
(8.52)
247
P (E|H)P (H)
P (E)
= arg max P (E|H)P (H)
= arg max
H
H
(8.53)
If the prior probability is higher for simpler models, then the term log P (H)
actually penalizes more complex models.
The state-of-the-art structure learning algorithm is the structural EM
(SEM) algorithm [Friedman, 1998]. It adapts the standard EM algorithm for
structure learning. The key idea is that the expected counts are not computed
anew for every structure that is proposed, but only after several iterations,
which yields only an approximation but improves the eciency.
For completeness, let us mention that there are also other structure learning techniques for graphical models; they often rely on conditional independency tests between the random variables. These tests are then used to constrain the structure of the model.
248
father(henry, bill)
father(alan, benny)
father(bill, carl)
father(carl, dennis)
mother(ann, betsy)
mother(alice, benny)
mother(bonnie, cecily)
founder(henry)
founder(an)
founder(alice).
249
father(alan, betsy)
father(brian, bonnie)
father(benny, cecily)
mother(ann, bill)
mother(ann, bonnie)
mother(betsy, carl)
mother(cecily, dennis)
founder(alan)
founder(brian)
Observe that logical atoms, such as mother(M, X), do not aect the distribution of Bayesian atoms, such as carrier(X), and are therefore not considered
in the conditional probability distribution. They only provide variable bindings, for instance, between carrier(X) and carrier(M).
The semantics (and hence, the covers relations) of Bayesian logic programs
are dened through a process called knowledge-based model construction. In
this process, a propositional Bayesian net is constructed by grounding the
Bayesian clauses. The resulting net then denes the probability distribution.
Often, the knowledge-based model construction process takes into account a
particular query to the network, and generates only that grounded part that
is needed to answer the query, though we shall ignore such optimizations in
the exposition below. For Bayesian logic programs, the random variables A
of the constructed Bayesian network are Bayesian ground atoms in the least
Herbrand model I of the annotated logic program. A Bayesian ground atom
b, say carrier(alan), directly inuences another Bayesian ground atom h, say
carrier(betsy), if and only if there exists a Bayesian clause c such that
b body(c) I and h = head(c) I
(8.54)
The Bayesian network constructed from the Baysian logic program for the
stud farm problem is depicted in Fig. 8.8. The nodes are the ground Bayesian
atoms in the least Herbrand model of the program, and the direct inuence is
derived using Eq. 8.54. For instance, in the example, carrier(alan) is a parent
node of carrier(betsy) in the constructed model, as it is an instance of the
second clause in Ex. 8.14.
250
Example 8.16. As another example to illustrate Eq. 8.54, consider the carrier
Bayesian logic program from Ex. 8.14 together with background theory
founder(adam) . According to the Eq. 8.54, the least Herbrand model is
{founder(adam), carrier(adam), suers(adam)}
and hence founder(adam) is the only parent of carrier(adam), which in turn
the only parent of suers(adam).
Note that in Bayesian logic programs it is required that the induced network
be acyclic and have a nite branching factor. The reason is that Bayesian
networks must be directed acyclic graphs.
c(henry)
s(henry)
c(bill)
s(bill)
c(ann)
c(brian)
c(alan)
s(ann)
c(betsy)
c(bonnie)
s(brian)
c(carl)
s(betsy)
s(bonnie)
c(cecily)
s(carl)
c(dennis)
s(alan)
c(alice)
c(benny)
s(alice)
s(benny)
s(cecily)
s(dennis)
Fig. 8.8. The Bayesian network induced by the stud farm. Reprinted with permission from [De Raedt and Kersting, 2004]
To complete the network, we still need to associate conditional probability distributions with the nodes of the network. Nodes head(c) constructed
using Eq. 8.54 are assigned cpd(c) as their associated conditional probability
distribution. However, when there exist multiple ground instances in I with
the same head, a complication arises with these assignments.
Example 8.17. Consider the Bayesian logic program (adapted from [De Raedt
and Kersting, 2003]), dening fever:
fever | cold
fever | u
fever | malaria
cold.
u.
malaria.
All three clauses apply, and hence we obtain three conditional probability distributions: P(fever|cold), P(fever|u) and P(fever|malaria). However, as cold,
u and malaria are parents of fever we need to have a conditional probability distribution dening P(fever|cold, u, malaria). Notice that the problem
also occurs when there is only one Bayesian clause (with multiple ground
instances in I satisfying the conditions of Eq. 8.54 for a particular ground
Bayesian atom).
251
There are two approaches to dealing with this problem. The rst solution is
adopted in Bayesian logic programs and employs combining rules. The second
one, aggregation, is used in Probablistic Relational Models [Getoor et al.,
2001a], which we briey discuss below.
A combining rule is a function that maps nite sets of conditional probability distributions onto one (combined) conditional probability distribution.
Examples of combining rules are noisy-or and noisy-and; cf. [Jensen, 2001].
Noisy-or is used in graphical models to reduce the number of parameters.
To introduce noisy-or, let us assume that there is a node X in a Bayesian
network with a large number (say k) of parents Yi . As the node has many
parents, the CPD associated with the node X becomes very large, and hence
hard to specify or learn. If the parents are independent causes for the variable X, the noisy-or rule applies. The noisy-or rule denes the conditional
probability distribution as
(1 P (X = true|Yi = true)) (8.55)
P (X = true|Y1 , ..., Yk ) = 1
Yi =true
The advantage is that one only needs to specify the probability values
P (X = true|Yi = true). This is linear in k instead of exponential. The noisy-or
combining rule can also be understood as a more complex network, involving
a logical or.
Example 8.18. The fever example can be rewritten as a Bayesian network involving a logical or :
fever cold
fever u
fever malaria
cold.
malaria
cold |cold
u |u
malaria |malaria
u.
So, fever is dened in a logical manner, and the intermediate Bayesian predicates cold , u , and malaria are introduced.
Exercise 8.19. Verify that Ex. 8.18 correctly represents the noisy-or combining rule as applied to the earlier fever network.
The noisy-or rule can directly be applied to solve the problem with
Bayesian logic programs sketched in Ex. 8.17. That network consists of
Bayesian clauses of the form X|Yi . There are then k clauses with body literals
Yi that inuence X. Using noisy-or, the conditional probability distribution
of X can be dened.
An alternative to combining rules is to employ aggregate functions as in
probabilistic relational models [Koller, 1999, Pfeer, 2000]. Aggregate functions are well-known from the database literature, and were already discussed
in Sect. 4.13. Example aggregate functions include MIN, MAX, SUM, AVG, etc.
To illustrate their use in the present context, consider the Bayesian clause
252
(8.56)
To compute this probability in this example, the complete model need not
be constructed, as long as one knows the number of possible authors and the
independency assumptions hold.
The probability distribution induced by the Bayesian logic program on the
possible world is:
P(A|Pa(A))
(8.57)
P(I|H) =
Bayesian atom AI
where the Pa(A) are constructed using Eq. 8.54 and, where necessary, the
P(A|Pa(A)) are constructed using combining rules or aggregation functions.
Example 8.21. For instance, in the stud farm, using the above denition, the
probability of the interpretation
{carrier(henry) = f alse,
suers(ann) = f alse,
carrier(alan) = f alse,
suers(alice) = f alse,
253
254
essentially dene via single clauses probabilistic dependencies between the attributes of various entities. There exists also an appealing graphical notation
for probabilistic relational models.
Probabilistic relational models are closely related to the Clp(bn) formalism of Costa et al. [2003a], which employs the same ideas in the context of a
(constraint) logic programming language.
Markov Logic*
Markov logic combines rst-order logic with Markov networks. The idea is to
view logical formulae as soft constraints on the set of possible worlds, that
is, on the interpretations. If an interpretation does not satisfy a logical formula, it becomes less probable, but not necessarily impossible as in traditional
logic. Hence, the more formulae an interpretation satises, the more likely it
becomes. In a Markov logic network, this is realized by associating a weight
with each formula that reects how strong the constraint is. More precisely, a
Markov logic network consists of a set of weighted clauses H = {c1 , , cn }.2
The weights wi of the clauses then specify the strength of the clausal constraint.
Example 8.22. Consider the following example (adopted from [Richardson and
Domingos, 2006]). Friends & Smokers is a small Markov logic network that
computes the probability of a person having lung cancer on the basis of her
friends smoking. This can be encoded using the following weighted clauses:
1.5 : cancer(P) smoking(P)
1.1 : smoking(X) friends(X, Y), smoking(Y)
1.1 : smoking(Y) friends(X, Y), smoking(X)
The rst clause states the soft constraint that smoking causes cancer. So,
interpretations in which persons that smoke have cancer are more likely than
those where they do not (under the assumptions that other properties remain
constant). The second and third clauses state that the friends of smokers are
also smokers.
A Markov logic network together with a Herbrand domain (in the form of a set
of constants {d1 , , dk }) then induces a grounded Markov network, which
denes a probability distribution over the possible Herbrand interpretations.
The nodes, that is, the random variables in the grounded network, are
the atoms in the Herbrand base. Furthermore, for every substitution that
grounds a clause ci in H, there will be an edge between any pair of atoms
a, b that occurs in ci . The Markov network obtained for the constants
anna and bob is shown in Fig. 8.9. To obtain a probability distribution over the
Herbrand intepretations, we still need to dene the potentials. The probability
distribution over intepretations I is
2
Markov logic networks, in principle, also allow one to use arbitrary logical formulae, not just clauses. However, for reasons of simplicity, we will only employ
clauses throughout this section, and make some further simplications.
255
fr(a, b)
fr(a, a)
smok(a)
can(a)
smok(b)
fr(b, b)
can(b)
fr(b, a)
Fig. 8.9. The Markov network for the constants ann and bob. Adapted from
[Richardson and Domingos, 2006]
P(I) =
1
Z
fc (I)
(8.58)
c:clause
(8.59)
256
1995], Probabilistic Horn Abduction [Poole, 1993b] and the more recent Independent Choice Logic (ICL) [Poole, 1997] specify probabilities on facts from
which further knowledge can be deduced. We discuss these two types of framework in turn.
Stochastic Logic Programs
Stochastic logic programs combine principles from computational logic with
those of stochastic or probabilistic context-free grammars. A stochastic logic
program is a denite clause program, where each of the clauses is labeled with
a probability value. Furthermore, as in context-free grammars, it is required
that the sum of the probability values for all clauses dening a particular
predicate be equal to 1 (though less restricted versions have been considered
as well).
Example 8.24. The stochastic logic program below denes a probability distribution on a card deck with 32 cards. The suits are d(iamonds), h(earts),
s(pades), and c(lubs). The ranks are a(ce), 7, 8, 9, 10, and f(armer), q(ueen),
and k(ing).
1 : card(X, Y) rank(X), suit(Y)
0.25 : suit(d)
0.25 : suit(h)
0.125 : rank(a)
0.125 : rank(7)
0.125 : rank(8)
0.125 : rank(9)
0.25 : suit(c)
0.25 : suit(s)
0.125 : rank(10)
0.125 : rank(k)
0.125 : rank(q)
0.125 : rank(f)
257
258
Observe that the probability distribution PD also assigns a non-zero probability to failed derivations. Usually, we are interested in successful derivations,
that is, refutations ending in . The probability distribution PR (r(a)), dened
on refutations r(a) for an atom a and induced by PD and the logic program,
can be obtained by normalizing PD :
PR (r(a)) =
PD (r(a))
r(g) PD (r(g))
(8.61)
where the sum ranges over all SLD-refutations r(g) of the goal g.
Example 8.27. Continuing the poker example shows that all derivations d for
the sameSuit(X, Y) predicate have probability PD (d) = 0.25 0.25. Because
only four of them are also refutations, the probability of a refutation r is
PR (r) =
0.25 0.25
= 0.25
4 0.25 0.25
(8.62)
where ri ranges over all possible refutations for a. This is the equivalent of
the statement that the probability of a sentence in a stochastic grammar is
the sum of the probabilities of its parse trees.
Example 8.28. The value PD of the proof tree u in Fig. 8.10 is vu = 13 12 12 =
1
12 . The only other ground proofs s1 , s2 of atoms over the predicate sentence
are those of sentence([a, turtle, sleeps], []) and sentence([the, turtle, sleeps], []).
1
. Because there is only one proof for each of the sentences,
Both get value = 12
PA (sentence([the, turtles, sleep], [])) = 13 , and this is also the probability PR of
the corresponding refutations.
Like Markov models and stochastic context-free grammars, stochastic logic
programs can be employed for:
259
0.7 : edge(c, b)
0.9 : edge(d, b)
which specify that with probability 0.9 there is an edge from a to c. Consider
also the following (simplied) denition of path/2.
path(X, Y) edge(X, Y)
path(X, Y) edge(X, Z), path(Z, Y)
One can now dene a probability distribution on (ground) proofs. The probability of a ground proof is then the product of the probabilities of the (ground)
clauses (here, facts) used in the proof. For instance, the only proof for the
goal path(a, b) employs the facts edge(a, c) and edge(c, b); these facts are
marginally independent, and hence the probability of the proof is 0.90.7. The
260
(8.64)
which shows that computing the probability of a derived ground fact reduces
to computing the probability of a boolean formula in disjunctive normal form
(DNF), where all random variables are marginally independent of one another. Computing the probability of such formulae is an NP-hard problem,
the disjoint-sum problem. The naive approach for realizing it employs the
inclusion-exclusion principle from set theory. This principle, applied to our
problem, states:
P (X1 ... Xn ) =
n
i=1
P (Xi )
P (Xi1 Xi2 )
(8.65)
1i1 <i2 n
(8.66)
(8.67)
(8.68)
(8.69)
261
1986] are employed to represent the DNF formula. The ProbLog system has
also been applied to link mining problems in large biological networks.
The above example has shown how the probability of a specic fact is
dened and can be computed. The distribution at the level of individual facts
(or goals) can easily be generalized to a possible world semantics, specifying a
probability distribution on interpretations. It is formalized in the distribution
semantics of Sato [1995], which is dened by starting from the set of all
probabilistic ground facts F for the given program. For simplicity, we shall
assume that this set is nite, though Satos results also hold for the innite
case. The distribution semantics then starts from a probability distribution
PF (S) dened on subsets S F :
PF (S) =
P (f )
(1 P (f ))
(8.72)
f S
f S
Each subset S is now interpreted as a set of logical facts and combined with
the denite clause program R that species the logical part of the probabilistic logic program. Any such combination S R possesses a unique least
Herbrand model M (C) (cf. Sect. 2.3), which corresponds to a possible world.
The probability of such a possible world is then the sum of the probabilities
of the subsets S yielding that possible world, that is:
PF (S)
(8.73)
PW (M ) =
SF :M (SR)=M
For instance, in the path example, there are 16 possible worlds, which can
be obtained from the 16 dierent truth assignments to the facts, and whose
probabilities can be computed using Eq. 8.73. As we have seen when discussing
Bayesian networks (cf. Eq. 8.17), the probability of any logical formulae can
be computed from a possible world semantics (specied here by PW ).
Prism, PHA and ICL
Because computing the probability of a fact or goal under the distribution
semantics is hard, researchers such as Taisuke Sato and David Poole have introduced the probabilistic logics Prism [Sato, 1995, Sato and Kameya, 1997,
2001], Probabilistic Horn Abduction (PHA) [Poole, 1993b] and the Independent Choice Logic (ICL) [Poole, 1997] that impose additional restrictions that
can be used to improve the eciency of the inference procedure.
The key assumption is that the explanations for a goal are mutually exclusive, which overcomes the disjoint-sum problem. If the dierent explanations
of a fact do not overlap, then its probability is simply the sum of the probabilities of its explanations. This directly follows from the inclusion-exclusion
formulae as under the exclusive-explanation assumption the conjunctions (or
intersections) are empty.
262
In addition, PHA, ICL and Prism employ disjoint statements of the form
disjoint(p1 : a1 ; ...; pn : an ) , where the a
i are atoms for a particular predicate, and the pi probability values satisfy i pi = 1. For instance, the statement
disjoint(0.3 : gene(P, a); 0.15 : gene(P, b); 0.55 : gene(P, o))
states that 1) the probabilities that (an instance) of the corresponding fact
for gene is true, and 2) an atom of the form gene(P, X) instantiates to exactly
one of these options. This corresponds to enforcing the constraints:
false gene(P, a), gene(P, b)
false gene(P, a), gene(P, c)
false gene(P, b), gene(P, c)
The advantage of using disjoint statements is that it becomes much easier to
model random variables over domains other than {true, false}.
Example 8.32. Consider the previous disjoint statement together with the following denite clause program (adapted from Sato and Kameya [1997]). It
states the well-known rules for determining the bloodtype of a person depending on the genes she inherits from her parents. To have bloodtype a, the
genes of both parents should be a, or else a combined with o; the rules are
similar for b, and then bloodtype ab corresponds to a combined with a, and
o corresponds to both genes being o. The clauses dening dominates, pgtype,
gtype and btype dene deductive knowledge. The predicate gene, dened in
the above disjoint statement, is a probabilistic predicate. It states the probabilities of the genes a, b and o.
btype(Btype) gtype(Gf, Gm), pgtype(Btype, Gf, Gm)
gtype(Gf, Gm) gene(mother, Gf), gene(father, Gm)
pgtype(X, X, X)
pgtype(X, X, Y) dominates(X, Y)
pgtype(X, Y, X) dominates(X, Y)
pgtype(ab, a, b)
pgtype(ab, b, a)
dominates(a, o)
dominates(b, o)
A labeled atom in a disjoint statement states the probability with which
(an instance of) the fact is true. This induces a probability distribution
at the level of the proofs. Indeed, using the disjoint statement, the facts
gene(mother, a) and gene(father, b) are true with probability 0.3 and 0.15 respectively. Therefore, the probability of the proof of bloodtype(ab) that involves these two facts is 0.3 0.15 = 0.045.
Using the distribution semantics, the probability distribution for proofs
induces a probability distribution for the atoms of predicates in R, and
hence for possible worlds, or interpretations. Indeed, because there is only
263
one possible proof for btype(o), the probability of this atom being true is
0.55 0.55 = 0.3025. If there are more proofs, then one has to sum the probabilities of the corresponding explanations. This is safe under the exclusiveexplanation assumption.
Example 8.33. For instance, for bloodtype(a), there are three proofs, relying
on
gene(m, a), gene(f, a) with probability 0.3 0.3 = 0.09
gene(m, a), gene(f, o) with probability 0.3 0.55 = 0.165
gene(m, o), gene(f, a) with probability 0.55 0.3 = 0.165
So, the probability of the atom bloodtype(a) = 0.09 + 0.165 + 0.165 = 0.42.
Example 8.34. The probability of the least Herbrand interpretation of the deductive part of the PRISM program with {gene(m, a), gene(f, a)} is 0.09. It
constitutes one possible world and includes the fact btype(a).
Probabilistic Abduction
The representations of PHA, ICL and Prism were originally motivated as a
kind of probabilistic abduction. It is therefore interesting to link these representations to the abductive logic programming framework introduced in Sect.
7.2.3. The procedure for generating an abductive explanation of a ground atom
sketched in Algo. 7.2 can be adapted to the representations of PHA, ICL and
Prism, which work with disjoint statements under the exclusive-explanation
assumption. The resulting algorithm is shown in Algo. 8.2; it generates also
the probabilities of the explanations. The theory T is the deductive part of
the program. The integrity constraints I are obtained from the disjoint statements, as indicated above. The function is called with the parameters g,
{} and 1.
As the function abduce of Sect. 7.2.3 could be modied to yield only the
minimal explanations (using a breadth-rst strategy), prob-abduce can be
extended into a best-rst search strategy that will generate the most likely
explanations rst; cf. [Poole, 1993a]. This involves selecting the (goal, explanation, probability) tuple with maximal probability rst from the queue of
candidates instead of following a last-in-rst-out strategy. In addition, one
must verify whether the explanations are minimal.
Notice that their key dierence with the Bayesian network approaches is
that the ICL and Prism approaches rely on logical inference methods, whereas
Bayesian networks rely more on probabilistic inference mechanisms.
Exercise 8.35. Simulate prob-abduce on the fact bloodtype(a).
Exercise 8.36. * Represent the Bayesian trac network as an ICL or a
Prism program?
Exercise 8.37. ** Can a stochastic logic program be represented as an ICL
or a Prism program? Is this always possible?
264
Algorithm 8.2 The function prob-abduce( q1 , ..., qn ; F ; P ) for probabilistic abduction in a theory T
if n = 0 then
return F , P
else if the predicate in q1 is probabilistic then
compute a ground substitution such that q1 unies
with a fact f with probability p in a disjoint statement
if F T {q1 } satises I then
call prob-abduce( q2 , ..., qn ; I; F {q1 }, p P )
else
fail
end if
else if possible then
select the next clause q r1 , ..., rm in T for which mgu(q, q1 ) =
call prob-abduce( r1 , ..., rm , q2 , ..., qn ; F ; P )
else
fail
end if
265
0.3
0.1
course
0.7
0.1
0.3
department
0.3
0.2
0.1
lecturer
0.8
Fig. 8.11. The graph structure of a Markov model for web navigation (from [De
Raedt and Kersting, 2003])
266
(0.7)
(0.2)
(0.3)
(0.3)
(0.3)
(0.1)
Now, starting from any ground state, for instance, dept(cs), one can determine the possible transitions as well as their probabilities. The above logical
Markov model species, however, only the probability of a transition to an
abstract state; these are non-ground states, states that contain variables such
as course(cs, C) and lecturer(cs, L) in our example. To determine the corresponding real states, one also needs to know 1) the domains of the various
arguments (in our examples, the set of all lecturers and the set of all courses,
say dom(L) and dom(C)), and 2) a probability distribution on these domains
(that is, PL and PC ) that species the probability of selecting a particular
instance from these domains; for instance, the probability of selecting pedro
as a lecturer would be given by PL (pedro). Given these domains and their
corresponding distributions, the abstract transitions can be instantiated. For
instance, starting from dept(cs) there is a probability of 0.7PL (pedro) of going
to lecturer(cs, pedro). This illustrates the key ideas underlying these representations: proof steps correspond to time steps.
The resulting model can be conveniently represented as the stochastic logic
program sketched in the following example.
Example 8.39. The logical Markov model specied as a stochastic logic program:
0.7 : dept(D) domcourse(C), course(D, C)
0.2 : dept(D) domlect(L), course(D, L)
...
0.3 : course(D, C) domlect(L), lecturer(D, L)
0.3 : course(D, C) dept(D)
0.3 : course(D, C) domcourse(C1), domdept(D1), course(D1, C1)
...
0.1 : lecturer(X, L) domcourse(C), course(X, C).
...
0.1 : domlect(pedro)
...
The probability of the proofs in the stochastic logic program then corresponds
to the probability of the trace through the Markov model. The domain predicates are introduced only to bind those variables that appear in the body of
267
clauses but not in the head. In the example, we ignored the starting and the
terminal states of the Markov model. This is left as an exercise to the reader.
Exercise 8.40. Discuss how to deal with starting and terminal states of the
Markov model within the stochastic logic program.
Exercise 8.41. Can you model the Markov model as a Prism or ICL program?
268
{carrier(henry) = f alse,
suers(ann) = f alse,
carrier(alan) =?,
suers(alice) = f alse,
269
eE
:hebe
eE
:hebe
P (h = v b = w|e)
(8.74)
P (b = w|e)
(8.75)
ec (h = b = w)
ec (b = w)
(8.76)
The rst summation ranges over all possible examples. The second one captures the parameter tying within a single example. It ranges over all relevant
instantiations of the clause in the example. The relevant probabilities can be
computed using the standard Bayesian logic program inference engine.
Structure Learning*
To learn the structure of a Bayesian or Markov network (cf. Sect. 8.3), one
typically performs a heuristic search through a space of possible structures
constructed using a kind of propositional renement operator which adds,
deletes or changes arcs in the network. Thus it seems natural to adapt these
algorithms by employing a rst-order renement operator that works at the
theory level, as discussed extensively in Chapter 5. There are, however, two
complications that may arise when learning probabilistic logics.
First, the sets of random variables in each of the example interpretations
should correspond to those of the probabilistic logic. For probabilistic relational models, it is typically assumed that the domain of discourse, that is,
the relevant constants and deterministic relations, are known. For Bayesian
logic programs, it is required that example interpretations are also a model
for the Bayesian logic program in the logical sense.
Example 8.43. Reconsider the Bayesian logic program dening the stud farm
and the logical facts dening mother, father and founder. Assume that there is
a (logical) fact specifying that founder(jef) is true. Then, because of the (least
Herbrand model) semantics of Bayesian logic programs, there must also be
a random variable carrier(jef). If this random variable is not included in the
example interpretation, the interpretation does not contain all random variables in the grounded Bayesian network, and hence contains latent variables,
which are extremely dicult to deal with.
Therefore, when learning Bayesian logic programs, it is required that the
ground facts in the interpretation also constitute a model in the logical sense
of the Bayesian logic program. This can be enforced using the techniques seen
in Sect. 7.5.
270
271
and failures), truncated to yield refutations only, and nally grouped to produce the set of observed atoms. As shown by [Cussens, 2001], this yields the
following formula for computing the expected counts of a clause Ci given E,
the set of examples, for the E-Step:
ec (Ci |e) + (Z 1 1)ec (Ci |fail)
ec (Ci |E) =
(8.77)
eE
Here, ec (Ci |e) (or ec (Ci |fail)) denotes the expected number of times clause
Ci has been used to derive atom e (or to derive a failure), and Z is the
normalization constant
PD (r(h))
Z=
r(h)
where the sum ranges over all proof-trees r(h) of the variabilized head h of
clauses Ci . In the M-Step, FAM computes the improved probability label pi
for each clause Ci as
ec (Ci |E)
pi =
C ec (C |E)
where the sum ranges over all clauses C with the same predicate in the head
as Ci .
Structure Learning
Learning both the structure and the parameters of a rst-order probabilistic
logic from entailment from scratch is extremely hard, if not impossible. The
reason is that this requires a combined solution to the structure learning problem in both probabilistic models as well as in inductive logic programming.
Both subproblems are very hard and largely unsolved today. For instance, from
an inductive logic programming perspective, a solution to hard problems such
as multiple predicate learning and theory revision would be required. Therefore, there seems little hope of solving the full problem of structure learning
from entailment in the near future. Nevertheless, for some special cases, one
may still be able to develop some interesting techniques. For instance, Muggleton [2003] has extended the single-predicate learning setting of the Progol
system to induce stochastic logic programs.
Because structure learning is so hard when learning from entailment, one
may want to incorporate more information into the learning process. This can
be realized using the learning from proofs setting, as proofs carry much more
information about the target models than facts.
8.5.3 Learning from Proof Trees and Traces
Examples
When learning from proofs, the examples are proof trees or traces. For instance, for the stochastic logic program denoting the grammar, the proof tree
272
of Fig. 8.10 could be a valid example. Similarly, when working with Web logs,
as in the logical Markov model, one may actually observe a trace, which can
easily be mapped onto a proof, as argued earlier.
One question that naturally arises with this setting, is to what extent it is
reasonable to require examples in the form of proof trees. Although it seems
clear that in most applications this is unrealistic, it should be emphasized
that there exist specic situations in which proof trees occur quite naturally
or in which the examples can be reformulated as such trees or traces, for
instance, when dealing with logs of users traversing a web-site, logs of smart
phones, or traces of a GPS device or robot. Also, in a bioinformatics setting,
such structured sequences often occur naturally. Finally, within the natural
language processing community, many large and annotated corpora exist that
provide parse trees for a set of sentences, which correspond to proof trees in
a logical setting.
Parameter Estimation
In order to address the parameter estimation problem in the learning from
proofs setting it is again adequate to start with the simpler case of probabilistic context-free grammars. When learning probabilistic context-free grammars
from parse trees, everything is fully observable and, hence, it is straightforward to estimate the parameters of the probabilistic grammar by frequency
counting.
On the other hand, when considering stochastic logic or PRISM programs,
this need not be the case. There are two cases to consider. First, if one observes derivations (both successful, that is, refutations, as well as failed), then
all variables are observed and frequency counting will yield a maximum likelihood hypothesis. Second, if one only observes refutations, that is, succesful
derivations, then the failed ones are unobserved. Thus, a form of failure adjusted maximisation needs to be employed. Actually, it turns out that Eq. 8.77
given for the FAM algorithm can easily be simplied to this case. The key
simplication is that the (successful) proofs are now observed and hence one
can replace the expected counts ec (Ci |e) of the number of times the clause
Ci is used in the proof of example e with the actual counts c(Ci |e). This is the
only modication needed to adapt the FAM algorithm to the learning from
proofs setting.
Structure Learning
We can get some inspiration from the work on probabilistic context-free grammars for structure learning. In particular, in natural language processing probabilistic context-free grammars have been successfully learned from large corpora of parse trees. This work is known under the name of tree-bank grammars
[Charniak, 1996]. It turns out that learning the structure of a probabilistic
273
context-free grammar is easy. The learner only needs to collect all the rules
used in the given parse trees.
Example 8.44. Reconsider the parse trees shown in Fig. 4.6. The rules employed in the rightmost parse tree are:
S NP VP
VP Verb
NP Art Noun
Art the
Noun cat
Verb bites
274
If the rst condition is violated, then there are literals in ci that do not occur
in lgg(c1 , c2 )i . These literals would be lost from the corresponding proofs
(as sketched in the example), and so the proofs would not be preserved. If
the second condition is violated, a standard theorem prover would derive different proofs (containing more children), and again the proofs would not be
preserved. Furthermore, as is common in inductive logic programming, one
can assume that all clauses in the target (and intermediate) logic programs
are reduced w.r.t. -subsumption. The above conditions allow one to verify
whether the proofs are preserved after computing the lgg. However, one needs
to compute and consider only the lgg of two clauses if the multi-set of predicates occurring in these two clauses are identical.
The operation whereby two clauses are replaced by their least general
generalization can now be used to heuristically search through a space of
possible candidate models. They can be scored using, for instance, a maximum
likelihood score penalized for model complexity.
Even though the techniques introduced for learning from proofs were
largely illustrated using stochastic logic programs, it is, in principle, also possible to apply these ideas to the learning for Prism programs and logical or
relational Markov models. At the time of this writing, structure learning for
Prism programs has not yet been considered.
275
and
b
a
and
b,
where the order of the stacks does not matter. In the blocks world, one can
move a block if it is clear from one position to another. This means that we
have the following possible actions for the states
A
a
= {move a to oor}
b
A
A a
b
= {move b to oor}
a
b = {move a to b; move b to a}.
Assume that the actions succeed with probability 0.9 and fail with probability
0.1, where failure implies that executing the state is left unchanged, and that
the reward function yields 10 only when the action leads to the next state
a
and 0 otherwise. This reward function implicitly encodes that the goal is
b
to enter this state as often as possible. Because encoding the reward function in terms of the state resulting from the action is quite convenient and
understandable, we shall from now on encode rewards functions in this way.
The goal of the agent is to maximize the expected return, that is, the
expected discounted sum of rewards over time:
276
t rt ,
(8.78)
t=0
t rt |s0 = s ,
(8.79)
t=0
that is, the expected return when starting in s and selecting actions according
to . Similarly, the action-value function Q : S A R species for each
state action pair (s, a) the expected return Q (s, a) the agent will receive
when starting in state s, executing action a and then following the policy .
The two value functions of a policy are related by the equation
V (s) = max Q (s, a),
(8.80)
which species that the state-value function yields the value of the best action
in that state.
The task of the agent is then to compute an optimal policy . A policy
is optimal if and only if for all other policies and for all states s S:
V (s) V (s).
(8.81)
Following the optimal policy yields the highest expected returns. The Bellman
optimality equations characterize the state-value function V of an optimal
policy :
T (s, a, s )V (s ) .
(8.82)
V (s) = max R(s, a) +
a
s
s
(8.83)
From the optimal value functions, the optimal policy can be derived because
(s) = arg max Q (s, a)
a
= arg max R(s, a) +
T (s, a, s )V (s ) .
a
(8.84)
(8.85)
s
This equation shows a clear advantage of the Q function: the transition and
reward functions need not be known to compute the optimal policy.
277
Example 8.47. Continuing the blocks world example, the Bellman optimality
equation for the state
a
states
V ( a b ) = max
a
10 + 0.9V ( ) + 0.1V ( a b ) ;
b
b
0 + 0.9V ( ) + 0.1V ( a b ) .
a
It is possible to improve upon a non-optimal policy using policy improvement, which computes an improved policy s:
(s) = maxa Q (s, a).
(8.86)
Because the policy greedily selects actions, it improves upon , that is, for
all states s S : V (s) V (s); see [Sutton and Barto, 1998] Sect. 4.2 for
a proof. If the policy was already optimal, then = and the Bellman
optimality equations hold. Policy improvement is typically used in a process
called generalized policy iteration, in which one starts from a given policy,
computes its value function, uses the value function to improve the policy,
and iterates; see Sutton and Barto [1998].
8.6.2 Solving Markov Decision Processes
Numerous approaches exist for solving Markov Decision Processes. They are
primarily distinguished by whether they are model-based, that is, whether
they use a model or not. A model, in this context, refers to the transition and
reward functions T and R.
Model-based solution techniques for Markov Decision Processes are typically based on dynamic programming. As one example of this popular class
of techniques, we consider the value iteration algorithm sketched in Algo. 8.3.
This algorithm initializes the Q-function arbitrarily (here, by setting all the
values to 0), and then repeatedly updates the Q-function for all state action
pairs. The update rule that is employed is essentially the Bellman optimality
equation of Eq. 8.83. This process continues until the values converge and
the updates become suciently small. The value function Q computed by the
value iteration algorithm will converge in the limit towards the optimal value
function Q . Therefore, the Q-function computed by the algorithm can be
used as an encoding of the optimal policy .
In model-free approaches to reinforcement learning, the functions T and
R are unknown to the agent, but the task essentially remains the same: computing (an approximation of) the optimal policy. However, in this case the
278
agent will gather evidence about these functions through interaction with its
environment, which means that the agent will perform actions and learn from
their outcomes. One line of model-free approaches learns a model, that is, an
approximation of the transition and reward functions T and R, from these
interactions. To this end, it keeps track of statistics for each possible transition T (s, a, t) and reward R(s, a). If all possible state-action pairs are visited
a sucient number of times, the estimated model will approximate the true
model. Model-based techniques, such as value iteration, can then be applied
to compute the optimal policy.
Another type of model-free approach is based on Monte Carlo methods.
This type of method estimates the value functions directly. This is only possible when the environment is episodic, that is, sequences of actions are guaranteed to reach a terminal state. Episodic environments naturally occur, for instance, in game playing. In other cases, the environment can be made episodic.
For instance, in the blocks world example, if the goal is to reach a particular
state, say a b , this state could be made absorbing, which means that no matter what action is executed in that state, the agent remains in the state. In
episodic environments, Monte Carlo methods for learning a Q function for a
given policy compute Q (s, a) as the average of all returns received when
executing action a in state s and following the policy afterward.
The nal and most interesting class of model-free approaches from a machine learning perspective is that of temporal dierence learning. Characteristic for temporal dierence learning is that it reestimates its current value
function for a particular state (or state-action) using estimates for other states.
This realizes a kind of bootstrapping. One of the most prominent examples
in this category is Q-learning. Q-learning employs the following update rule
to reestimate Q(s, a) after executing action a in state s, receiving the reward
r and observing the next state s :
Q(s , a ) Q(s, a) ,
(8.87)
Q(s, a) := Q(s, a) + r + max
a
279
where 0 < < 1 is the learning rate. The higher the learning rate, the
more important the new experience is. Therefore, the value of is gradually
decreased over time. This leads to the famous Q learning algorithm; see Algo.
8.4. This algorithm will, under certain conditions, converge to the optimal
Q function. While learning, the agent has to select and execute actions.
After each action, it performs an update of the Q-function according to the
above formula. The formulation of Q-learning in Algo. 8.4 assumes an episodic
setting.
Recall that the agents goal is to learn how to maximize the expected
future return, and that, while learning, the agent has to take action in its
environement. The strategy for selecting the next action is important in this
regard. There is a typical trade-o between exploration and exploitation in
reinforcement learning. To maximize the expected return, it is tempting to
select the actions greedily, according to the current value functions. This is
called exploitation. However, if the approximations of the value functiions are
still imperfect, greedy action selection might lead to suboptimal behavior.
Therefore, the agent should also explore its environment, that is, ensure that
it visits all parts of the search-space a sucient number of times so that
good approximations can be learned. Because exploration and exploitation
are conicting goals, one has to nd the right balance between these two ways
of selecting actions. One way of realizing this employs an -greedy method to
select the next action to execute. For a given Q-function, this method selects
with probability 1 the best action according to Q, that is, arg maxa Q(s, a),
and with probability a random action a A(s).
Algorithm 8.4 Q-learning
initialize Q(s, a) := 0 for all s S, a A(s)
for each episode do
let s be the starting state
repeat
choose an action a A(s) and execute it
observe the
new state s and reward r
Q(s, a) := r + maxa Q(s , a ) Q(s, a)
s := s
until s is a terminal state
end for
280
for the value function, for instance, using the languages of the representation hierarchy sketched in Chapter 4. The simplest of these is a propositional
logic or attribute-value representation. States then correspond to item-sets or
propositional interpretations. This enables us, in turn, to represent the value
function by a model, such as a decision tree, a linear equation, or a neural
network. To illustrate this idea, consider the Q-learning procedure sketched
in Algo. 8.4 and assume that we are using a neural network to represent the
Q-function. The value of Q(s, a) for state s and action a is then the value
obtained by using the example consisting of the interpretation describing the
state s together with the action a as input for the neural network. The output
of the network is the predicted Q-value. To work with this representation the
Q-learning algorithm needs to be adapted at the point where the Q-function
is updated. Rather than computing the new value for Q(s, a) and storing it
in the table for Q, the algorithm will now generate an example for the neural
network learning algorithm. This example consists of the description (s, a)
together with the desired target value Q(s, a). The neural network will then
update its weights to accommodate this change. Neural networks are often
employed as function approximators because they are incremental although
other paradigms can be used as well. Because the function learned by the
function approximator is only an approximation of the Q-function in tabular
form, the algorithm will be ecient. However, depending on the approximator
used, it may also lose its convergence properties. In practice, it often works
well, as shown by, for instance, the famous TD-gammon player by Tesauro
[1995]. Rather than illustrating this technique using propositional representations, we will use relational representations. Before doing so, we introduce
the concept of a relational Markov Decision Process.
8.6.3 Relational Markov Decision Processes
Relational Markov Decision Processes are an upgrade aimed at using relational representations in which states correspond to Herbrand interpretations
like in planning [Russell and Norvig, 2004]. The advantage of relational representations is, as usual, that they enable one to work with a variable number
of entities and the relationships amongst them. For instance, while the simple blocks world example shown above consisted of only two blocks, articial
intelligence typically studies such worlds with an arbitrary number of blocks
and relations. Our goal is now to adapt relational reinforcement learning to
work with such worlds. This goal is in line with the probabilistic logic learning
approach pursued in this chapter. The key question then is how to represent
such Relational Markov Decision Processes? To address this question, it is
useful to start from existing formalisms employed within the domain of planning, and to investigate how they can be upgraded using the methodology of
Chapter 6.
To upgrade the denition of Markov Decision Processes to cope with relational states and actions, we need to make the denitions of the transition
281
and reward functions relational. It is convenient to start from one of the popular planning formalisms, Strips by Fikes and Nilsson [1971], to realize this.
In Strips, each action is dened using a precondition and a set of eects,
where the precondition is specied using a conjunction of atoms and the effects specify which atoms to add and which ones to delete from the state.
More formally, an action is a nite set of actions rules of the form
pi : A :: Hi B,
(8.88)
282
and
b
a
and
are not directly representable using the relational Markov Decision Process
just dened. The reason is that we do not explicitly take into account the oor
of the blocks. Taking into account a unique oor requires the adaptation of the
transition rules, and the introduction of new transition rules. We use simpler
state descriptions, in which it is assumed that there are a xed number of
places (like f1 and f2) where blocks can be placed. This is the view where f1
and f2 are treated as oor blocks. It leads to the following possible states for
the blocks a and b and places f1 and f2
{on(a, b), on(b, f1), cl(f2), cl(a)}
{on(b, a), on(a, f1), cl(f2), cl(b)}
{cl(a), cl(b), on(a, f1), on(b, f2)}
Exercise 8.49. Can you adapt the transition rules for the case where there
is a unique oor on which one can place an arbitrary number of stacks? The
transition should support the representation of the blocks world that we introduced rst.
8.6.4 Solving Relational Markov Decision Processes
Now that Relational Markov Decision Processes have been dened, we look
into possible approaches for solving them. More specically, we investigate how
both the value iteration and the Q-learning approaches can be adapted. We
start with the simplest of these two, that is, Q-learning. Then we present one
of its variants, abstract Q-learning, before discussing relational value iteration.
Q-Learning
To adapt Q-learning to work with relational representations, all that is needed
is a relational function approximator to learn the Q-function. This can be
realized by using, for instance, a logical regression tree for representing the Qfunction. The decision list resulting from the tree might, for the blocks world,
look like
283
qvalue(10) cl(a), !.
qvalue(9.0) on(X, a), cl(X), cl(F1), move(X, F1, a), !.
qvalue(8.1) on(X, Y), on(Y, a), cl(X), cl(F1), cl(F2), move(X, F1, Y), !.
qvalue(7.2)
This denition of the Q-function can be applied to a state and an action
represented as a set of ground facts. It then returns the Q-value.
Although the induction of such regression trees proceeds essentially along
the same lines as for other decision trees, there are some subtle diculties that
occur in a reinforcement learning setting. First, the algorithm should learn
online, that is, it should process the examples as they occur and incrementally
adapt the current hypothesis. Second, the examples provided to the regression
algorithm might change over time. As the policy improves over time the values
associated to a state action pair may change as well, which implies that later
examples might invalidate former ones, and hence some way of forgetting
is necessary. Further subtleties arise in the relational case. Even though the
logical regression tree will predict a value for each state, the predicted value
will be independent of the number of objects in the state, and this causes
problems. The reason is that Q-values implicitly encode the distance to the
goal. Let us illustrate this using an example.
Example 8.50. Assume the reward function returns 10 when entering a state
where on(a, b) and 0 otherwise, that such states are absorbing, that we have
n blocks, and more than four places. Thus, the goal is to stack a onto b, and,
due to the absorbing states, the task is episodic. The optimal policy for this
case rst clears a and b, that is, it repeatedly removes the top blocks from
the stacks to which a and b belong, and then moves a onto b. The state-value
function for this policy is graphically depicted in Fig. 8.12 (for = 0.9). The
gure shows clearly that the higher the number of needed actions, the lower
the utility, and hence that the utility is a function of the distance to the goal.
Nevertheless, the optimal strategy can be dened independent of the distance
to the goal. It simply removes the next block from the stack above a or b until
a and b are clear, after which a is moved on top of b.
The example indicates that policies are often easier to encode than value
functions, which explains why some approaches try to learn and represent
policies directly rather than through their value functions [Fern et al., 2007].
It is also possible to learn an explicit policy starting from the Q-function
[Dzeroski et al., 2001]. This can be realized by using the Q-function to generate
examples consisting of state-action pairs. Positive examples are those for which
the action associated with the state is optimal; the negative examples contain
the non-optimal actions.
Abstract Q-Learning**
In the Q-learning approach just presented the learner generates the denition
of the Q-function from a set of examples in the form of state-action-value
284
Fig. 8.12. Parts of the value function for on(a, b). Reproduced from [Kersting et al.,
2004]. Uppercase characters denote logical variables, and the Fi can bind to blocks
or to positions
tuples, and dynamically partitions the set of possible states. For instance,
the above denition of the qvalue/1 predicate employs four partitions. These
partitions are described by a kind of abstract state, that is, a logical condition,
which matches several real states. For instance, the rst rule matches all states
in which cl(a) is true, the second one all states in which cl(a) is not true, but
on(X, a), cl(X) is true, etc. The relational Q-learning approach sketched above
thus needs to solve two tasks: nding the right partition and learning the right
values for the corresponding abstract state-pairs. This is a hard task, and the
question arises as to whether it can be simplied, for instance, by providing
additional knowledge in the form of the partition to the learner. The answer
to this question is armative. It is actually easy to devise a variant of the
relational Q-learning approach that learns at an abstract level; cf. [van Otterlo,
2008, Kersting and De Raedt, 2003]. The abstract Q-learning algorithm starts
from a partition of the state space in the form of a decision list of abstract
state-action pairs ((S1 , A1 ), , (Sn , An )), where we assume that all possible
abstract actions are listed for all abstract states. Each abstract state Si is a
conjunctive query, and each abstract action Ai contains a possibly variablized
action. As one example of such an abstract state-action pair consider the
condition of the third rule for qvalue/1 above, that is,
on(X, Y), on(Y, a), cl(X), cl(F1), cl(F2) move(X, F1, Y)
The abstract state matches any real state where there is a block X on a, X is
clear and so are F1 and F2, and the action moves X from Y to F1.
285
The abstract Q-learning algorithm now turns the decision list into the
denition of the qvalue/1 predicate, and then applies Q-learning using the
qvalue/1 predicate as its table of state-action pairs. This means that every
time a concrete state-action pair (s, a) is encountered, a Q-value q is computed
using the current denition of qvalue/1, and then the abstract Q-function,
that is, the denition of qvalue/1 is updated for the abstract state-action pair
to which (s, a) belongs. It can be shown that this algorithm will converge
to the optimal policy at the abstract level. However, the optimal policy at
the abstract level does not necessarily coincide with the optimal policy of
the underlying Relational Markov Decision Process as the following example
shows.
Example 8.51. ** (Due to Robert Givan, closely following [Kersting and De
Raedt, 2003].) Consider the following transition rules
1.0 : a :: q p, q
1.0 : a :: p
1.0 : a :: p
The resulting Markov Decision process has the states {}, {p}, {q}, and {p, q}
and as only possible action, a, which is deterministic. Let us also assume that
the reward is 1.0 if the action a is executed in state {p} and 0 otherwise.
Let the abstraction level now consist of the decision list
(p, a), (q, a), (true, a)
This abstraction level results in the following partition of the states
{{p}, {p, q}} and {{q}} and {{}}
The abstract Markov Decision Process will now assign the same probabilities
and rewards to the transitions from the second partition to the rst one and
from the third to the rst one. Thus the abstract Markov Decision Process
seems to have a non-Markovian nature. As a consequence the values for the
second and third partition in the abstract Markov Decision Process are the
same as the next state is the same, that is, the rst partition. This is not the
case for the (grounded) Relational Markov Decision Process, as the reader
may want to verify.
The example shows that learning at the abstract level may result in losing
information about the original problem, resulting in a kind of partially observable Markov Decision Process, which requires more advanced solution techniques. This shows that relational reinforcement learning is a hard problem,
as it is important to get the abstraction level right. The relational Q-learning
approach oers no guarantees in this respect.
286
Value Iteration**
Value iteration is a model-based technique, and therefore the model is available. The model of the Relational Markov Decision Process consists of the
denitions of the transition and rewards functions. We now want to adapt
the value iteration algorithm for use with relational representations. The key
diculty lies in the upgrading of the the update rule, based on the Bellman
optimality equation Eq. 8.83. The update rule works backwards, that is, to
update the value of a state it employs the values of the possible predecessor states. While the predecessors are explicitly encoded in a normal Markov
Decision Process, they are now only implicitly available.
Example 8.52. For illustration, consider that we are in the goal state where
on(a, b) is true, and assume that we want to update the value function. Then
we need to update the abstract state, where on(a, b) is true, to identify all
states in which executing the action move(X, Y, Z) leads to on(a, b) being true.
In other words, we need to nd the weakest preconditions under which executing the action move(X, Y, Z) leads to on(a, b). This is needed because the
Bellman optimality equation denes the value of a state in terms of those of
its predecessors. The problem of computing the weakest preconditions of an
(abstract) state is known as regression in the planning literature; cf. [Russell
and Norvig, 2004]. There are two cases to consider for computing the weakest
preconditions for our example. First, assuming that the move(X, Y, Z) action
caused on(a, b) to be true, implies that in the predecessor state the condition
cl(a), cl(b), on(a, Z) must have been true X = a and Y = b. Second, assuming
that the move action did not cause on(a, b) to become true, the predecessor
state must have satised cl(X), cl(Y), on(X, Z), on(a, b). Please note that we
are still using OI-subsumption, which implies that X = Y, X = a, etc.
The example shows that a complex logical operation is needed to compute the abstract predecessors of an abstract state, and this makes adapting
the value iteration algorithm quite involved, which explains why we refer to
[Boutilier et al., 2001, Kersting et al., 2004, Wang et al., 2008] for more details.
The idea, however, is that the value iteration algorithm takes as initial value
function the reward function, and then propagates the conditions occurring in
the rules dening the reward function backwards using regression. This process is then repeated on the resulting value function. Additional complications
arise because the conditions of the rules dening the value function may be
overlapping, and some rules might be redundant, which explains why some
approaches [Kersting et al., 2004] employ further operations on these rules
sets to compress and simplify the denition of the value function. Figure 8.12
shows the state value function that is the result of performing a 10-step relational value iteration algorithm. The reader should also realize that, when the
potential number of blocks is unbounded, value iteration will never terminate
as an innite number of abstract states would be required.
287
To summarize, relational reinforcement learning aims at upgrading reinforcement learning techniques and principles to use logical and relational
representations. Two main approaches exist: model-based and model-free reinforcement learning. The model-based approach is closely related to decisiontheoretic planning, and borrows regression techniques to compute value functions. The model-free approach uses relational function approximators to learn
value functions, or assume that an abstraction level in the form of a partition
of the state space is given. We have also seen that many challenges in relational reinforcement learning remain open, which explains why it is an active
eld of research; see [Driessens et al., 2004, 2005] for two collections of recent
papers on this topic.
8.7 Conclusions
We have provided an overview of the new and exciting area of probabilistic
logic learning in this chapter. It combines principles of probabilistic reasoning,
logical representation and statistical learning into a coherent whole. The techniques of probabilistic logic learning were analyzed starting from a logical and
relational learning perspective. This turned out to be useful for obtaining an
appreciation of the dierences and similarities among the various frameworks
and formalisms that have been contributed to date. In particular, the distinction between a model- and a proof-theoretic view was used for clarifying the
relation among the logical upgrades of Bayesian networks (such as probabilistic relational models, Bayesian logic programs, etc.) and grammars (such as
stochastic logic programs and Prism). This distinction is not only relevant
from a knowledge representation perspective but also from a machine learning
perspective, because one typically learns from interpretations in the modeltheoretic approaches, from entailment in the proof-theoretic ones, and from
traces in the intermediate ones (such as Rmms and Lohmms). Furthermore,
principles of both statistical learning and logical and relational learning can
be employed for learning the parameters and the structure of probabilistic
logics. We have then also shown how important ideas such as knowledgebased model construction can be applied in a reinforcement learning setting,
and how various techniques from reinforcement learning can be upgraded to
relational representations.
288
statistical relational learning and probabilistic logic learning provide a detailed account of the state-of-the-art in the eld; cf. [Getoor and Taskar, 2007,
De Raedt et al., 2008]. Background material on graphical and probabilistic
models can be found in [Russell and Norvig, 2004, Jensen, 2001].
Probabilistic logics were originally mostly studied from a knowledge representation and reasoning perspective. Many dierent representations and inference algorithms were developed from this perspective in the late 1980s and
1990s; see, for instance, [Nilsson, 1986, Bacchus, 1990, Poole, 1993b, Dantsin,
1992, Haddawy, 1994, Ngo and Haddawy, 1995, Muggleton, 1996, Jaeger, 1997,
Koller and Pfeer, 1997, Lakshmanan et al., 1997]. The interest in learning
such logics started soon afterwards with work on Prism [Sato, 1995, Sato and
Kameya, 1997] and on probabilistic relational models [Friedman et al., 1999,
Getoor et al., 2001a,b]. Especially the probabilistic relational models received
a lot of attention in the articial intelligence community, and soon afterwards
the rst workshops on statistical relational learning were organized [Getoor
and Jensen, 2003, 2000]. Around that time, many further representations were
conceived, including Bayesian Logic Programs [Kersting and De Raedt, 2007],
CLP(BN) [Costa et al., 2003a], iBAL [Pfeer, 2007], Markov logic [Richardson and Domingos, 2006], and CP-logic [Vennekens et al., 2006], and several
learning techniques were developed, such as [Cussens, 2001, Kok and Domingos, 2005, Jaeger, 2007, Singla and Domingos, 2005, Taskar et al., 2001].
Furthermore, theoretical issues such as expressiveness of the representation
languages Jaeger [2008] and lifted inference were being investigated [Poole,
2003, de Salvo Braz et al., 2007]. Also, some exciting applications of probabilistic logic learning have been contributed; see for instance [Getoor et al.,
2004, Anderson et al., 2002, Bhattacharya et al., 2006, Fern et al., 2002, Liao
et al., 2005, King et al., 2004, Limketkai et al., 2005].
Introductions to reinforcement learning can be found in [Russell and
Norvig, 2004, Sutton and Barto, 1998]. The use of relational representations
was introduced in reinforcement learning by Dzeroski et al. [2001], and investigated from a decision theoretic perspective (value iteration) by Boutilier et al.
[2001]. Since then several works have been devoted to these topics, including
[G
artner et al., 2003, Driessens et al., 2001, Wang et al., 2008, Kersting et al.,
2004, Sanner and Boutilier, 2005]; an extensive overview of these developments
can be found in [van Otterlo, 2008].
9
Kernels and Distances for Structured Data
290
(9.2)
The norm x of a vector x denotes its size. It can be computed from the
inner product as follows:
(9.3)
x = < x, x >
Furthermore, the inner product < x, y > of two vectors in Rd can be written
as
< x, y >= x ycos()
(9.4)
where is the angle between the two vectors x and y, which allows us to
interpret the inner product in geometric terms. The equation states that when
the two vectors are normalized (that is, have length 1), the inner product
computes the cosine of the angle between the two vectors. It then follows that
when = 0, < x, y > = 1, and when the two vectors are orthogonal, the inner
product yields the value 0. This indicates that the inner product measures a
kind of similarity.
Even though we will formally introduce kernels and distance measures
later an interesting relationship amongst them can already be stated. Any
(positive denite) kernel K induces a distance metric dK as follows:
(9.5)
dK (x, y) = K(x, x) 2K(x, y) + K(y, y)
It is instructive to verify this statement using the kernel K(x, y) =< x, y >.
Exercise 9.1. Show that the distance de can be obtained from Eq. 9.5 using
the inner product as a kernel, that is:
(9.6)
de (x, y) = < x, x > 2 < x, y > + < y, y >.
A key dierence between a kernel and a distance measure is that kernels measure the similarity between instances whereas distances measure the
dissimilarity.
291
Example 9.2. Assume that the instances are vectors over {1, +1}d and that
we are using, as before, the inner product kernel. The maximum value of the
inner product over all possible pairs of instances will be d, and this value will
be obtained only when the two instances are identical. The minimum value will
be d, which will be obtained when the two vectors contain opposite values
at all positions. So, the maximum is reached when the vectors are identical
and the minimum is reached when they are opposite. It is easy to see that
using a distance measure this is just the other way around. The minimum of
0 will always be reached when the objects are identical.
(9.7)
where w is the weight vector and b is a constant. The hyperplane then consists
of all vectors x that are a solution to this equation. Such a hyperplane h can
then be used to classify an example e as positive or negative by computing
h(e) = sgn(< w, e > +b) where
+1 if val > 0
sgn(val) =
1 if val 0
(9.8)
(9.9)
The idea is not just to compute any hyperplane h that separates the two
classes, but the optimal one, which maximizes the margin. The margin of a
hyperplane h = (w, b) w.r.t. a set of examples E is given by
margin(h, E) = min{x ei | ei E, < w, x > + b = 0}
(9.10)
292
margin approach computes the optimal hyperplane, that is, the hyperplane
h that maximizes the margin:
h = arg max margin(h, E)
h
(9.11)
(9.13)
(9.14)
1
w
(9.15)
(see [Scholkopf and Smola, 2002] for the proof). Therefore, minimizing w
corresponds to maximizing the margin(h, E). This is illustrated in Fig. 9.1.
The optimization problem is usually not solved in the form listed above.
It is rather turned into the dual problem using the theory of Karush, Kuhn
and Tucker and the Langragian; cf. [Cristianini and Shawe-Taylor, 2000]. This
dual formulation is typically an easier optimization problem to solve:
max(1 , ,n )
subject to
1
f (ei )f (ej )i j < ei , ej >
2 i,j
i
i : i 0 and
f (ei )i = 0
i
(9.16)
Several public domain quadratic programming solvers exist that solve this
optimization problem. Using this formulation, the weight vector w is a linear
combination of the data vectors:
293
+
+
+
+
o
w o
1/||w||
Fig. 9.1. The max margin approach and the support vectors. The positive examples
are marked with a + and the negative ones with an o. The maximum margin
hyperplane is the middle line. The support vectors lying on the dotted lines, and
the vector normal to the margin is indicated by w
w=
i f (ei ) ei
(9.17)
Typically, many i will have the value 0. Those vectors ei with non-zero i
are the so-called support vectors. These are also the vectors that lie on the
margin, that is, those for which
(9.18)
f (ei ) < w, ei > + b = 1
These are the only ones that inuence the position of the optimal hyperplane.
The constant b can be obtained by substituting two support vectors, one for
each class, in Eq. 9.18 and solving for b. The value h(e) of a new data point
e can then be computed as:
i f (ei ) < ei , e > + b
(9.19)
h(e) = sgn
i
Given that the i are non-zero only for the support-vectors, only those need
to be taken into account in the above sum.
A central property of the formulation of the dual problem in Eq. 9.16 as
well as the use of the resulting hyperplane for prediction in Eq. 9.19 is that
they are entirely formulated in terms of inner products. To formulate the dual
problem, one only needs access to the data points and to the so-called Gram
matrix, which is the matrix containing the pairwise inner products < ei , ej >
of the examples.
294
There are numerous extensions to the basic support vector machine setting. The most important ones include an extension to cope with data sets
that are not linearly separable (by introducing slack variables i for each of
the instances) and several loss functions designed for regression.
9.2.3 The Kernel Trick
The support vector machine approach introduced above worked within the
space Rd , used the inner product as the kernel function and worked under
the assumption that the examples were linearly separable. In this subsection,
we will lift these restrictions and introduce a more formal denition of kernel
functions and some of its properties.
Consider the classication problem sketched in Fig. 9.2. Using the max
margin approach with the inner product kernel, there is clearly no solution to
the learning task. One natural and elegant solution to this problem is to rst
transform the instances e to some vector (e) in some other feature space
and to then apply the inner product.
Example 9.3. Using the function
: R2 R3 : (x1 , y1 ) (x21 ,
2x1 x2 , x22 )
(9.20)
instead of the inner product in R2 . The interesting point about this kernel K
is that does not have to be computed explicitly at the vectors, because
K(x, y) =< x, y >2
(9.21)
This is called the kernel trick. It often results in enormous computational savings as the dimension of the transformed space can be much larger than that
of the input space Le . The example also illustrates that kernels are essentially
inner products in some feature space that does not necessarily coincide with
the input space Le .
Formally, functions have to satisfy some conditions for being a kernel and
for the optimization approaches sketched above to work. In particular, one
typically uses so-called Mercer kernels, which are symmetric functions that
are positive denite.1 For convenience, we will continue to talk about kernels
instead of Mercer or positive denite kernels.
1
A symmetric function
is positive denite if and only if m N : x1 , , xm
Le : a1 , , am R : m
i,j=1 ai aj K(xi , xj ) 0, or, equivalently, if the eigenvalues of the possible Gram matrices are non-negative.
295
(9.22)
are also kernels,2 where s stands for sum, p for product, d for polynomial, g
for Gaussian and n for normalized.
Exercise 9.4. Show how the kernel Eq. 9.21 can be formulated as a polynomial kernel. Show also that this kernel corresponds to < (x), (y) > with
dened as in Eq. 9.20.
In Sect. 9.4, we shall expand these results to obtain kernels for structured
data. Before doing so, we turn our attention to distance-based learning.
o
o
+
+
+
+ +
+
o
Fig. 9.2. A circular concept. The examples are marked with a + and the negative
ones with an o. Whereas there is no hyperplane in the original space that separates
the positives from the negatives, there is one in the feature space. Mapping that
hyperplane back to the original space yields the circular concept indicated
For the normalized kernel, it is assumed that K(x, x) > 0 for all x.
296
(9.23)
(9.24)
(9.25)
(9.26)
(9.27)
(9.28)
(9.29)
297
In this algorithm, the function avg computes the average of the values
of the function f in Ek . In a classication settting, avg corresponds to the
mode, which is the most frequently occurring class in Ek , while in a regression
setting, avg corresponds to the arithmetic average. The k-nearest neighbor
algorithm is very simple to implement; it often also performs well in practice
provided that the dierent attributes or dimensions are normalized, and that
the attributes are independent of one another and relevant to the prediction
task at hand; cf. standard textbooks on machine learning such as [Mitchell,
1997, Langley, 1996].
Exercise 9.7. Argue why violating one of these assumptions can give problems with the k-nearest neighbor algorithm.
Many variants of the basic k-nearest neighbor algorithm exist. One involves
using all the available examples x in E but then weighting their inuence
in h(e) using the inverse distance 1/d(e, x) to the example e to be classied.
Other approaches compute weights that reect the importance of the dierent
dimensions or attributes. Further approaches devise schemes to forget some
of the examples in E [Aha et al., 1991].
9.3.3 The k-Means Algorithm
Clustering is a machine learning task that has, so far, not been discussed
in this book. When clustering, the learner is given a set of unclassied examples E, and the goal is to partition them into meaningful subsets called
clusters. Examples falling into the same cluster should be similar to one another, whereas those falling into dierent classes should be dissimilar. This
requirement is sometimes stated using the terms high intra-cluster similarity and low inter-cluster similarity. There are many approaches to clustering,
298
but given that this chapter focuses on distances, we only present a simple
clustering algorithm using distance measures.
The k-means algorithm generates k clusters in an iterative way. It starts
initializing these clusters by selecting k examples at random, the initial centroids, and then computing the distance between each example and the k
centroids. The examples are then assigned to that cluster for which the distance between the example and its centroid is minimal. In the next phase, for
each cluster, the example with minimum distance to the other examples in
the same cluster is taken as the new centroid, and the process iterates until
it converges to a stable assignment, or the number of iterations exceeds a
threshold. The algorithm is summarized in Algo. 9.2.
Algorithm 9.2 The k-means algorithm
Select k centroids ck from E at random
repeat
Initialize all clusters Ck to their centroids {ck }
for all examples e E {c1 , ..., ck } do
Let j := arg minj d(e, cj )
Add e to Cj
end for
for all clusters Cj do
Let i := arg mini eCj d(e, ei )
cj := ei
end for
until convergence, or, max number of iterations reached
Several variants of the k-means algorithm exist. Analogously to the cnearest neighbor algorithm there is the c-means algorithm for soft clustering.
In soft clustering, all examples belong to all the clusters to a certain degree.
The degree is, as in the c-nearest neighbor algorithm, inversely related to the
distance to the centroid of the cluster. There is also the k-medoid algorithm,
where the centroids are replaced by medoids, which correspond to the average
of the instances in the cluster.
299
(9.30)
So, the Ei denote spaces of parts of objects. We shall also write (e1 , , eD )
R1 (e).
The type of decomposition relation depends very much on the nature of
the structured instances in Le . For instance, when dealing with sets, it is
natural to dene R(e, x) = x e; when dealing with strings, one can dene
R(e, x1 , x2 ) as concatenation, that is, R(e, x1 , x2 ) is true if and only if e is x1
concatened with x2 ; and when dealing with vectors in Rn , R(e, x1 , , xn ) is
true if e denotes the vector (x1 , , xn ). Observe that there may be multiple
ways to decompose an object. For instance, when working with strings of
length n, they can be decomposed in n dierent ways using the concatenation
relation.
The basic result by Haussler employs kernels Kd : Ed Ed R dened at
the part level to obtain kernels at the level of the instances Le using a nite
decomposition relation R. More formally, under the assumption that the Kd
are kernels, Haussler shows that
KR, (x, z) =
D
Kd (xd , zd )
(9.31)
Kd (xd , zd )
(9.32)
KR, (x, z) =
D
300
Let us rst reinvestigate the inner product over Rd . Viewing the product
in R as a kernel K , the inner product in Rd can be viewed as a decomposition
kernel (using Eq. 9.32):
K (xi , yi )
(9.33)
< x, y >=
i
This denition can easily be adapted to dene kernels over tuples in attributevalue form. The key dierence is that, generally speaking, not all attributes
will be numeric. To accomodate this dierence, one only needs to dene a
kernel over a discrete attribute. This could be, for instance,
1 if x = y
(x, y) =
(9.34)
0 otherwise
Example 9.8. Reconsider the playtennis example of Table 4.1. Using in combination with the dot product yields:
< (sunny, hot, high, no), (sunny, hot, high, yes)>= 3
9.4.3 Sets and Multi-sets
When using sets, and membership as the decomposition relation, and a kernel
Kel dened on elements, we obtain the convolution kernel KSet :
KSet (X, Y ) =
Kel (xi , yj )
(9.35)
xi X yj Y
(9.36)
Of course, other kernels at the element level can be choosen as well. For sets,
it is also convenient to normalize the kernel. This can be realized using Eq.
9.22, which yields
KSetN orm (X, Y ) =
KSet (X, Y )
KSet (X, X)KSet (Y, Y )
(9.37)
(9.38)
301
9.4.4 Strings
Let us now apply convolution kernels to strings. There are two natural ways
of decomposing a string into smaller strings. The rst employs the substring
relation, the second the subsequence relation.
A string S : s0 sn is a substring of T : t0 tk if and only if
j : s0 = tj sn = tj+n
(9.39)
that is, all symbols in the string S occur in consecutive positions in the string
T.
On the other hand, a string S : s0 sn is a subsequence of T : t0 tk if
and only if
j0 < j1 < < jn : s0 = tj0 sn = tjn
(9.40)
that is all symbols in the string S occur in positions in the string T in the
same order, though not necessarily consecutively. jn j0 + 1 is called the
occurring length of the subsequence. For instance, the string achi is a substring
of machine and a subsequence of Tai-chi of length 5.
These two notions result in alternative relationships R. Let us rst consider
the substring case, where the string can be decomposed into its substrings. It
is convenient to consider only substrings from n , the set of all strings over
containing exactly n symbols, yielding:
1
(s) = {t n |t is a substring of s}
Rsubstring
(9.41)
1
returns a multi-set. In combination
Note that it is assumed that Rsubstring
with a kernel such as , it is easy to obtain a substring kernel.
Example 9.10. Consider the strings john and jon. When choosing n = 2:
1
(john) = {jo, oh, hn}
Rsubstring
1
Rsubstring
(jon) = {jo, on}
(9.42)
which corresponds to the inner product using the feature mapping substring (s)=
(u1 (s), , uk (s)) with n = {u1 , , uk } and ui (s) = number of occurrences of ui as a substring in s. This kernel is sometimes called the n-gram
kernel.
302
(9.44)
Kpen (s/l, t/k) =
0
otherwise
where 0 < < 1 is a decay factor that determines the inuence of occurring
length. The larger , the less the inuence of gaps in the subsequences.
Example 9.11. Reconsider the strings john and jon. When choosing n = 2:
1
(john) = {jo/2, jh/3, jn/4, oh/2, on/3, hn/2}
Rsubseq
1
Rsubseq
(jon) = {jo/2, jn/3, on/2}
Hence, Ksubseq,pen (john, jon) = 2+2 + 3+2 + 4+3 for the subsequences
jo, on and jn.
This kernel correspondsto the feature mapping subseq (s) = (u1 (s), ,
uk (s)) where ui (s) = ui /lR1 (s) l .
subseq
Exercise 9.12. If one takes into account all strings of length less than or
equal n instead of only those of length n, does one still obtain valid substring
and subsequence kernels? Why? If so, repeat the two previous exercises for
this case.
The two kernels Ksubseq and Ksubstring can be computed eciently, that
is, in time O(n|s||t|), where |s| denotes the length of the string s; cf. G
artner
[2003].
9.4.5 Trees and Atoms
As this book is largely concerned with logical representations, which are centered around terms and atoms, this subsection concentrates on dening kernels
and distances for these structures, in particular, ground atoms. Nevertheless,
due to their intimate relationship to ordered trees, the resulting kernels and
distances can easily be adapted for use with ordered and unordered trees.
Because ground terms are hierachically structured, there is a natural way
of decomposing them. We assume that two ground terms and the type of
each of the arguments are given. One can then inductively dene a kernel on
ground terms KT erm (t, s):
303
kc (t, s)
if s and t are constants
304
B2
A1
C3
G1
A4
B5
B5
C6
D7
D7
G2
G3
specic one. The nodes in the subgraph, that is, the more general graph, play
the role of logical variables, and, as for OI-subsumption, two dierent nodes
(or logical variables) must be mapped onto dierent nodes (or terms) in the
subsumed graph. An alternative is the notion of subgraph homeomorphism,
which is closely related to -subsumption, introduced in Sect. 5.4, and does
allow for two nodes in the more general graph being mapped onto the same
node in the more specic graph. For simplicity, we employ in this chapter a
restricted form of subgraph isomorphism called induced subgraph ismorphism.
It is restricted because it employs subgraphs that are induced by the subset relation at the level of vertices.3 More formally, Gs = (Vs , Es , ls ) is an
(induced) subgraph of a graph G = (V, E, l) if and only if
Vs V, Es = E (Vs Vs ), and v Vs : ls (v) = l(v)
(9.46)
(9.47)
(9.48)
(9.49)
Graph isomorphisms are important because one typically does not distinguish
two graphs that are isomorphic, a convention that we will follow throughout
this book. The notion is also used in the denition of the generality relation.
An injective function f : V1 V2 is a subgraph isomorphism from G1 =
(V1 , E1 , l1 ) to G2 = (V2 , E2 , l2 ) if G1 is an (induced) subgraph of G2 and f is
a graph isomorphism from G1 to G2 .
3
The more general notion of subgraph ismorphism takes into account the edges as
well, but this is more complicated.
305
(9.50)
306
but may contain an innite number of walks. For instance, in graph G2 , the
sequence 4, 6, 5, 4, 6, 5, 7 is a walk (in label notation ACBACBD).
The feature mapping considered by G
artner et al. [2003] is based on the
features s with s :
(9.52)
s (G) = |s| |{w|w is a walk in G encoding s}|
where the k are decay factors as before. The interesting point about the
resulting kernel Kwalk is that it can be computed in polynomial time when
choosing the geometric or the exponential series for the i . (In the geometric
i
series, i = i ; in the exponential one, i = i! ).
The algorithm for computing Kwalk employs product graphs and adjacency
matrices, which we now introduce. Given two labeled graphs G1 = (V1 , E1 , l1 )
and G2 = (V2 , E2 , l2 ), the product graph G12 = G1 G2 is dened as
V12 = {(v1 , v2 ) V1 V2 |l1 (v1 ) = l2 (v2 )}
2
|(u1 , v1 ) E1 and (u2 , v2 ) E2 }
E12 = {((u1 , u2 ), (v1 , v2 )) V12
(v1 , v2 ) V12 :
(9.53)
B2,5
A1,4
C3,6
G12
Fig. 9.4. The product graph G1 G2 of G1 and G2
307
001
A12 = 1 0 0
010
and the second power of the matrix is
A212
010
= 0 0 1
100
The reader may want to verify that there are indeed only three walks of length
2 through the product graph and that these correspond to (1, 4) to (2, 5), (2, 5)
to (3, 6) and (3, 6) to (1, 4).
Gaertner et al. show that
Kwalk (G1 , G2 ) =
|V12 |
i,j=1
n An12
ij
(9.54)
308
edit-distance. The third observation is that some distances do not rely on generalizations of the two instances but rather on a correspondence, a so-called
match or matching, of the parts of one instance to those of the second one.
Thus, very often, distances are related to generalization and matchings. In
this section, we shall rst study the relationship between metrics and generalization, and then introduce a wide variety of metrics for vectors, sets, strings,
atoms and graphs.
9.5.1 Generalization and Metrics
We consider partially ordered pattern or hypothesis spaces (Le , ), where we
write, as in Chapter 5, s g (or s g) to denote that s is more specic
than (or strictly more specic than) g. Throughout this section, it will be
assumed that the relation is partially ordered, that is, it is reexive, antisymmetric and transitive. Recall from Chapter 5 that not all generalization
relations satisfy these requirements. We shall also assume
1. that there is a function size | | : Le R that is anti-monotonic w.r.t. ,
that is,
g, s Le : s g |s| |g|
(9.55)
(9.56)
2. that the minimally general generalizations and maximally general specizializations, introduced in Eq. 3.26, of two patterns are dened and
yield at least one element:
mgg(x, y) = min{l Le |x l and y l}
mgs(x, y) = min{l Le |l x and l s}
(9.57)
(9.58)
We also dene:
|mgg(x, y)| = maxmmgg(x,y) |m|
(9.59)
(9.60)
(9.61)
309
(9.62)
or, equivalently,
x, y : 2|x| + 2|y| 2|mgg(x, y)| + 2|mgs(x, y)|.
(9.63)
When a distance function satises the diamond equation, the distance from
x to y via mgg(x, y) is shorter than that via mgs(x, y). This is illustrated in
Fig. 9.5. De Raedt and Ramon [2008] show that the distance d
is a metric if
it satises the diamond inequality (and (Le , ) is a partial order and the size
| | satises the above stated requirements). Metrics obtained in this way are
called generalization distances.
mgg(X, Y )
mgs(X, Y )
Fig. 9.5. The diamond inequality. Adapted from [De Raedt and Ramon, 2008]
This is a fairly interesting result, because it connects the key notion from
logical learning (generality) with the key notion of distance-based learning
(metrics). Its use will be illustrated below, when developing metrics for vectors, sets, sequences, trees and graphs.
9.5.2 Vectors and Tuples
There are two ways to obtain a distance metric on vectors or tuples. The rst
applies the idea of decomposition. For (symbolic) attribute-value representations, it is convenient to dene
di (xi , yi )
(9.64)
datt (x, y) =
i
310
The distance datt will be a metric provided all the functions di are metrics as
well. A convenient choice for the function di is , the distance corresponding
to the kernel from Eq. 9.34:
0 if x = y
(x, y) =
(9.65)
1 otherwise
The second way of obtaining the same distance is to use the natural generalization relation on attribute-value representations and then dene a generalization distance. Using the notation of logical atoms to represent attribute-value
tuples, the subsumption relation on logical atoms studied in Sect. 5.3 as the
generalization relation, and the number of constants in a description as size
yields the same metric datt .
Example 9.18. Consider the examples
playtennis(sunny, hot, high, no)
playtennis(sunny, mild, low, no)
and their generalization
playtennis(sunny, X, Y, no)
Thus the distance according to d
is 2 + 2 2 = 2, which is the same as that
when using the datt with .
Exercise 9.19. Prove that datt is a metric when all of the di are metrics.
Exercise 9.20. Show that d
satises the diamond inequality in this case.
When working with tuples on continuous attributes, it is convenient to
use the natural distance da (x, y) = |x y| on R. Decomposing the vectors
along the dierent dimensions and adding the corresponding distances yields
the distance dman , known in the literature as the Manhattan or cityblock
distance:
da (xi , yi )
(9.66)
dman (x, y) =
i
9.5.3 Sets
Even though sets are like vectors relatively simple data structures, they
are much more challenging from a distance point of view. There actually
exists a wide range of possible distance measures and metrics for sets. It is
instructive to develop a number of key representatives carefully and to relate
them to notions of generalization and matching, which will be useful for more
complex data structures.
311
(9.67)
(9.68)
yj Y
yj Y
xi X
The expression minyj Y del (xi , yj )) captures the idea that the distance d(xi , Y )
from xi to the set Y is given by the distance of xi to the closest point on Y .
This formulation tries to match elements of one set to elements of the other
sets. The reader may want to verify that dSet = dSet , that is, applying decomposition with the distance at the level of elements results in the distance
dSet for sets specied in Eq. 9.67.
Exercise 9.21. Show that, in general, the distance dSetdel is not a metric
even when del is. Hint: use da (x, y) = |x y| dened on R as del .
A renement of the formulation in Eq. 9.69 does work. It is perhaps the
most famous metric for sets, the Hausdor metric. It follows a similar pattern:
dHDdel (X, Y ) = max max min del (xi , yj ) , max min del (xi , yj )
xi X
yj Y
yj Y
xi X
(9.70)
312
The Hausdor metric is based on the previous idea that the distance d(x, Y )
between an instance x and a set of instances Y is dened as minyY del (x, y).
But then, the distance between two sets X and Y is dened as the maximum
distance of a point in X to the set Y , that is, maxxX minyY del (x, y). Unfortunately this is not a metric, because the symmetry requirement does not
hold. Symmetry can be restored by taking the maximum of the distance of
X to Y and that of Y to X, and this is exactly what the Hausdor distance
does. The Hausdor metric is a metric whenever the underlying distance del
is a metric.
Example 9.22. (from Ramon [2002]) Let Le = R2 and consider the Manhattan
distance dman . Let
X = {(0, 0), (1, 0), (0, 1)}
and
Y = {(2, 2), (1, 3), (3, 3)}
One can then easily verify that
d((0, 0), Y ) = 3
d((1, 0), Y ) = 2
d((0, 1), Y ) = 2
d((2, 2), X) = 3
d((1, 2), X) = 2
d((3, 3), X) = 5
Therefore,
dHDdman (X, Y ) = 5
Even though the Hausdor metric is a metric, it does not capture much information about the two sets as it is completely determined by the distance
of the most distant elements of the sets to the nearest neighbor in the other
set.
Exercise 9.23. Show that the function
dmin (X, Y ) =
min
xi X,yj Y
del (xi , yj )
313
elements in the other set, which may be undesirable. Many distances therefore
employ matchings, which associate one element in a set to at most one other
element. Formally, a matching m between two sets X and Y is a relation
m X Y such that every element of X and of Y is associated with at most
one other element of the other set. Furthermore, if |m| = min(|X|, |Y |), then
the matching is called maximal.
Example 9.24. Consider the sets X = {a, b, c} and Y = {d, e}. Then one
matching is {(a, d), (c, e)}. It is also maximal.
Given a matching m, dene the distance:
d(m, X, Y ) =
del (x, y) +
(x,y)m
|X m1 (Y )| + |Y m(X)|
M (9.71)
2
where M is a large constant, larger than the largest possble distance according
to del between two possible instances. So, M > maxx,y del (x, y).
This can be used to dene a matching distance for sets:
dSetmatch (X, Y ) =
min
mmatching(X,Y )
d(m, X, Y )
(9.72)
Example 9.25. Consider the sets X = {a, b, c} and Y = {a, e}, the matching
{(a, a), (c, e)}, the distance and set M = 4 then
d(m, X, Y ) = (a, a) + (c, e) +
2+0
4=3
2
314
= arg max
f F low
f (y, t)
(9.75)
there is a node xi for each element of the set X, as well as an extra sink
node x for X,
there is a node yi for each element of the set Y , as well as an extra sink
node y for Y ,
315
a
(5, 2) : 3
(2, 6) : 2
(1, 3) : 1
s
(2, 5) : 2
t
(4, 1) : 3
Fig. 9.6. The minimum cost maximum ow problem. The labels (cap, cost) : f low
denote the optimal f low through the edge, the capacity cap of the edge, and the
cost per unit of ow through the edge
316
x1
y1
(1, 0)
x2
(1, 0)
(1, d(xi , yj ))
(1, 0)
s
(1, 0)
y2
x3
(N, 0)
(, M/2)
(N, 0)
(1, 0)
(, 0)
Fig. 9.7. The minimum cost maximum ow problem. The labels (cap, cost) denote the capacities and the costs per ow of the edges. Adapted from [Ramon and
Bruynooghe, 2001]
dHamming (s, t) =
(si , ti )
(9.76)
Applying the generalization distance to strings leads also to a Hamming distance (up to a factor 2).
Example 9.26. Consider the strings abcdefgh and xbcdyfgh. Their lgg would
be -bcd-fgh of size 6, and hence the generalization distance between these
two strings is 4, whereas the Hamming distance between them is 2.
More popular distances for strings (certainly in the eld of bioinformatics)
are edit distances, which also produce alignments. They do not usually require
the strings to be of equal length. The best known example of such a distance
is the Levenshtein distance [1966], which formed the basis for many routinely
applied techniques in bioinformatics applications, such as the famous Blast
algorithm [Altschul et al., 1990]. More formally, the edit distance between
two strings is dened as the minimum number of operations needed to turn
one string into the other. The allowed operations are the insertion, deletion
and substitution of a symbol in .
Example 9.27. For instance, the string artificial (English) can be turned
into artificieel (Dutch) using two operations. Inserting an e and substituting an a by an e. If one assumes that all operations have unit cost, the
Levenshtein distance dlev (artificieel, artificial) = 2. The parts of the
two strings that match are typically depicted as an alignment. For our example, there are two possible alignments:
artificieel
|||||||| +|
artifici-al
317
artificieel
||||||||+ |
artificia-l
M (i 1, j 1) + (si , tj )
M (i, j) = min M (i 1, j) + 1
insert for i, j 1
M (i, j 1) + 1
delete
(9.77)
An example computation is depicted in Table 9.1.
Table 9.1. Computing the Levenshtein distance
a
r
t
i
f
i
c
i
e
e
l
0
1
2
3
4
5
6
7
8
9
10
11
a
1
0
1
2
3
4
5
6
7
8
9
10
r
2
1
0
1
2
3
4
5
6
7
8
9
t
3
2
1
0
1
2
3
4
5
6
7
8
i
4
3
2
1
0
1
2
3
4
5
6
7
f
5
4
3
2
1
0
1
2
3
4
5
6
i
6
5
4
3
2
1
0
1
2
3
4
5
c
7
6
5
4
3
2
1
0
1
2
3
4
i
8
7
6
5
4
3
2
1
0
1
2
3
a
9
8
7
6
5
4
3
2
1
1
2
3
l
10
9
8
7
6
5
4
3
2
2
2
2
The best aligment can be obtained by storing in each cell M (i, j) of the
matrix a backward pointer to the previous best cell, that is, that points to
318
that cell which yielded the minimum value in the recursive case. When the
algorithm terminates, the backwards pointers can be followed from the cell
M (n + 1, m + 1), which contains the minimum edit-distance.
Exercise 9.28. Compute the Levenshtein distance and the least common
subsequence of machine learning and machinelles lernen.
9.5.5 Atoms and Trees
Shan-Hwei Nienhuys-Cheng [1997] introduced the following metric for ground
atoms or terms dterm (t, s)
(t, s)
(g, h)
dterm (t, s) =
1
2k
One can arrive at this distance in various possible ways. First, following the
idea of decomposition, there is a clear analogy with the kernel Kterm in Eq.
9.45. The key dierence other than the use of instead of lies in the factor
1
2k , which is needed to obtain a metric that satises the triangle inequality.
Second, the distance can be viewed as a matching or edit-distance, cf. Eq.
9.73, where the cost of the matching is 0 and the edit cost for extending the
common part by inserting arguments in the term depends on the position and
1
.
depth of the term as indicated by the factor 2k
From a logical perspective, there is one drawback of the distance dterm
(and also of the kernel Kterm ): they take into account neither variables nor
unication.
Example 9.29.
dterm (r(a, b, d), r(a, c, c)) =
2
6
and
2
6
This is counterintuive as the similarity between r(a, b, b) and r(a, c, c) is larger
than that between r(a, b, d) and r(a, c, c). This is clear when looking at the
lggs. The lgg of the second pair of terms is more specic than that of the rst
one. Therefore one would expect their distance to be smaller.
dterm (r(a, b, b), r(a, c, c)) =
319
(9.79)
So, the distance dlgg measures how far the terms are from their lgg, and
c(lgg(t, s) t) indicates the cost for specializing the lgg to t. This can be
related to the size of the substitution needed so that lgg(t, s) = t, as the
following example illustrates.
Example 9.30. Applying this idea to the instances in the previous example
yields
dlgg (r(a, b, d), r(a, c, c)) = c r(a, X, Y ) sr(a, b, d) +c r(a, X, Y ) r(a, c, c)
and
dlgg (r(a, b, b), r(a, c, c)) = c r(a, X, X) r(a, b, b) + c r(a, X, X) r(a, c, c)
Under any reasonable denition of the cost c, the latter expression will be
smaller than the former. For instance, Hutchinson uses as c a measure on
the size of the substitutions; more specically, he assigns a weight to each
functor and constant symbol, and then takes the sum of the symbols occurring on the right-hand side of the substitutions. In the example, this yields
c(r(a, X, X) r(a, b, b)) = size({X/a}) = wb , and c(r(a, X, Y ) r(a, b, d)) =
size({X/b, Y /d}) = wb + wc .
The distances studied by Hutchinson [1997] and Ramon [2002] capture some
interesting logical intuitions but still exhibit some problems (for instance, how
to measure the distance between p(X, Y, Z) and p(W, W, W )). Furthermore,
they are also quite involved, especially when applied to clauses rather than
terms or atoms, which explains why we do not discuss them in more detail
here.
9.5.6 Graphs
To develop a metric on graphs, it is useful to look for a notion of mimimally
general generalization, or alignment, and to apply the generalization distance.
For graphs, a natural notion is given by the maximal common subgraph.
Formally, a maximal common subgraph m(G1 , G2 ) of two graphs G1 and
G2 is a graph G such that 1) there exist subgraph isomorphisms from G to G1
and from G to G2 and 2) there exists no graph containing more nodes than
G that satises 1). Like kernels, we employ the restricted notion of induced
subgraph ismorphism here. The notion of a maximal common subgraph is
illustrated in Fig. 9.8.
320
A
G4
C
m(G4 , G5 )
G5
The computation of a maximal common subgraph is an NP-complete problem and the maximal common subgraph of two graphs is not necessarily
unique. Notice that a maximal common subgraph is uniquely characterized
by and can therefore be represented by the (maximal) subgraph isomorphism
f from G1 to G2 that maps vertices in G1 to vertices in G2 . Such a maximal
subgraph isomorphism is computed using a backtracking algorithm due to
[McGregor, 1982], of which a variant along the lines of [Bunke et al., 2002] is
summarized in Algo. 9.3.
The algorithm repeatedly adds a pair of nodes (n1 , n2 ) V1 V2 to the
function f , and when doing so it ensures that the resulting mapping is a
feasible subgraph isomorphism by testing that the mapping f is injective
and that for any two tuples (n1 , m1 ) and (n2 , m2 ) f : (n1 , n2 ) E1 if
and only if (m1 , m2 ) E2 . If the cardinality of the resulting mapping fm
is larger than that of previously considered subgraph ismorphisms, then the
maximal subgraph isomorphism and corresponding size are updated. Finally,
if the function fm can still be expanded because there are still unmatched
and untried vertices in V1 , and one cannot prune these renements (because
the size of fm plus the number of such vertices is larger than maxsize), the
procedure is called recursively.
The maximal common subgraph can be used as a minimally general generalization. A natural size measure on graphs is the number of vertices they
contain. It is possible to show that the size and generality relation satisfy the
necessary requirements for generalization distances; cf. [De Raedt and Ramon,
2008]. Therefore, the distance
dgraph (G1 , G2 ) = |G1 | + |G2 | 2|mcs(G1 , G2 )|
(9.80)
|mcs(G1 , G2 )|
max(|G1 |, |G2 |)
(9.81)
321
Exercise 9.32. Apply Algo. 9.3 to compute the maximal common subgraph
of G4 and G5 as in Fig. 9.8.
Exercise 9.33. * Discuss the relationship between the concept of maximal common subgraph and maximally general generalization under OIsubsumption. (Hint: represent graphs as sets of facts.)
322
323
9.7 Conclusions
In this chapter we have studied how logical and relational representations can
be used together with support vector machines and instance-based learning
techniques. After a short introduction to these classes of machine learning
techniques, we have studied how distance metrics and kernels can be dened.
For kernels, convolution and decomposition can be used to dene kernels for
complex data structures in terms of kernels for simple data structures. For
distance metrics, we have investigated the relation of edit-distances to the
generality relation, and we have argued that, under certain conditions, distances can be generated using a size measure and the minimimally general
generalization operation. Variants of this idea, based on the notion of matching, have also been introduced. These principles have then been applied to
some well known data structures, such as sets, strings, trees and graphs.
324
is contained in [Ramon, 2002], which also forms the basis for the present
overview, though some new materials and insights from [De Raedt and Ramon,
2008] have been incorporated.
Within logic learning, the rst distance measure for relational data was
contributed by Bisson [1992b] for use in clustering, and later employed in the
RIBL system of Emde and Wettschereck [1996]. RIBL is a relational k-nearest
neighbour algorithm. Further contributions to distance-based learning were
made by Kirsten and Wrobel [2000] in the context of clustering (k-means and
k-medoid) and by Horvath et al. [2001] for instance-based learning. However,
the distances employed in this line of work were not metrics. The systems
based on this type of distance performed quite well in practice, but at the
same time they motivated a more theoretical stream of work that focussed
on developing metrics for relational representations, in particular the work of
Ramon [2002] and Nienhuys-Cheng [1997, 1998].
Due to the importance of structured data, there is a lot of interest in
developing kernels for dierent types of data structures. A seminal contribution in this regard is the notion of a convolution kernel due to Haussler
[1999]. Since then, many kernels have been developed for a variety of data
structures, including multi-instance learning [G
artner et al., 2002], graphs
[Kashima et al., 2003, G
artner et al., 2003] and hypergraphs [Wachman and
Khardon, 2007] and terms in higher-order logic [G
artner et al., 2004]. To the
best of the authors knowledge, there have only been a few attempts to integrate kernel methods with logic; cf. Muggleton et al. [2005], Passerini et al.
[2006], Landwehr et al. [2006]. Some recent contributions are contained in an
ongoing series of workshops on Mining and Learning with Graphs [Frasconi
et al., 2007].
Various exciting applications of distance and kernels for structured, relational data exist. Well known are the applications to structure activity relationship prediction [Ralaivola et al., 2005], analysis of NMR spectra [Dzeroski
et al., 1998], and classical music expression analysis [Tobudic and Widmer,
2005].
10
Computational Aspects of Logical and
Relational Learning
326
computational complexity of relational learning systems: it is computationally expensive, typically NP-hard or even undecidable in the general case, and
repeated a large number of times in any relational learning system. So, if one
can optimize the coverage test, one can also improve the overall performance
of the relational learning system.
10.1.1 Coverage as -Subsumption
In general, when working with denite clause logic (allowing for functors,
recursion and background knowledge), the typical coverage test (B H |=
e, where H and B are sets of denite clauses and e is a denite clause) is
undecidable. From a practical perspective, it often suces to consider a purely
relational setting, in which H denes a single predicate and neither are there
functors nor is there recursion. In this case, coverage testing corresponds to
-subsumption. Indeed, to see this, consider the Bongard problem in Ex. 4.11
and Fig. 4.4 as a typical illustration of this setting.
Example 10.1. Consider the two basic encodings (corresponding to Ex. 4.11
and 4.27 respectively). Using the rst representation, the example e can be
encoded as a clause, for instance, pos circle(c), triangle(t), in(t, c) and the hypothesis would consist of clauses such as pos circle(X), triangle(T), in(T, C).
Clearly, the hypothesis covers the example if and only if there is a clause
c H that -subsumes e. Using the second representation, identiers are
added to the facts and the resulting example is encoded as pos(e2) and the
facts in(e2, t1, c1), circle(e2, c1), triangle(e2, t2) are part of the (extensional)
background theory B. To test whether a hypothesis H dening pos/1 covers the example, consider each clause c H in turn, and test whether head(c)
unies with the example (yielding the substitution ), and if it does, test
whether body(c) succeeds in the background theory. For instance, in our example, body(c) is circle(e2, X), triangle(e2, T), in(e2, T, C), and it succeeds
on our background theory. If the background theory is extensional, evaluating
the query corresponds again to performing a -subsumption test; cf. also Ex.
5.17.
So, in the simplest relational learning setting, coverage testing corresponds
to -subsumption. In more complex relational settings, involving intensional
background knowledge, functors, or recursion, coverage testing even becomes
computationally harder. -subsumption is a known NP-complete problem,
which explains why relational learning is computationally much more expensive than learning within propositional representations. At the same time,
because -subsumption is central to relational learning, it is worthwhile to
empirically analyze it and to optimize -subsumption tests in relational learning systems.
327
the
the
the
the
number
number
number
number
n of variables in q,
m of predicate symbols in q,
L of constants in B, and
N of atoms for predicate symbols in q.
If the query would not be connected, it could easily be optimized; cf. also below.
328
Fig. 10.1. (Reprinted with permission from [Giordana and Saitta, 2000], page 223).
The probability Psol that a random query succeeds in a random database, averaged
over 1000 pairs (q, B) for each (m, L) point. Also, n = 10 and N = 100. On the
horizontal plane, the contour plots points corresponding to Psol values in the interval
(0.1,0.9)
329
Fig. 10.2. (Reprinted with permission from [Giordana and Saitta, 2000], page 225.)
The computational cost for a single coverage test with a Monte Carlo method (in
seconds on a Sparc Enterprise 450).
330
settings and within the setting where each example is completely encoded in
a single clause (as in the rst representation of Ex. 10.1). A further advantage
of separately encoding the examples is related to memory management. When
working with a huge data set, rather than having to run coverage tests on the
overall database, one can retrieve the example from the database and run the
coverage test on a much smaller database. This possibility is often combined
with the idea of inverting the loops in data mining systems in order to minimize the number of passes through the database. Indeed, many traditional
machine learning systems possess a subroutine that operates as follows: for
each candidate renement h, for each example e, test whether e is covered by
h. Using this scheme, the number of passes through the database is equal to
the number of renements considered by the subroutine. When inverting the
two loops, one obtains: for each example e, for each hypothesis h, test whether
e is covered by h. As a consequence, one needs only a single pass through the
database, which is much more ecient according to database principles.
Third, one can optimize the -subsumption procedure itself. In Chapter
2, the standard SLD-resolution procedure employed in Prolog for executing
queries on a database was introduced. It essentially employs backtracking
to answer queries. Backtracking is not necessarily the most ecient way of
answering queries on a relational database.
Example 10.2. To illustrate this point, consider the (somewhat articial)
query
rank(X), suit(Y), X = f, Y = s
and the simple card database shown below:
suit(d)
suit(h)
rank(a)
rank(7)
rank(8)
rank(9)
suit(c)
suit(s)
rank(10)
rank(k)
rank(q)
rank(f)
331
rank(X), X = f
suit(Y), Y = s.
These sub-queries can be executed independently of one another and the resulting answer substitutions can be combined. Using this optimization on the
original query only eight substitutions for X and four for Y are considered.
This optimization can also be performed iteratively. Given a connected query
l1 , , ln , one can rst solve l1 yielding substitution 1 , and then answer the remaining query l2 1 , , ln 1 . Even though the original query
l1 , , ln may be connected, instantiating l1 may cause the remaining query
l2 1 , , ln 1 to be no be longer connected. If this is the case, it may be
worthwhile to divide the remaining query again. Another possible optimization concerns the automatic reordering of the literals in the query according
to the growing number of possible answers or tuples. For our example query,
the literal for rank has 8, for suit, 4, and for each occurrence of =, 1 possible
answers. Using this optimization, the original query is rewritten into
X = f, Y = s, rank(X), suit(Y)
which directly yields a solution without backtracking. The above two optimizations can be combined by rst dividing the query into sub-queries and
then reordering the literals in the resulting sub-queries. Optimizations along
this line (and corresponding Prolog code for meta-interpreters) are discussed
extensively by [Costa et al., 2003b]. In the authors experience, using such
optimizations (by, for instance, incorporating some of the readily available
meta-interpreters by [Costa et al., 2003b]) can yield speedups of the overall
learning system of a factor 5 to 10.
Rather than optimizing the way Prolog executes queries, queries can be
executed in an alternative way. A rst alternative employs a relational or
deductive database management system instead of a Prolog implementation
to determine which examples are covered by the hypotheses. In contrast to
typical Prolog engines, database management systems are optimized to deal
with large databases, and hence, when the data set mined is large, the database
system may produce results when Prolog implementations run into problems
due to the size of the database. However, naively coupling a relational learning
system to a traditional database management system that targets data sets
that reside on disk is not necessarily a solution as it may result in a signicant
overhead. According to the authors experience, using a naive coupling with
such a database management system for carrying out coverage tests may slow
down the system by a factor of 20 for molecular databases. One reason for this
is that database systems are optimized to return all answers to a particular
query, whereas a Prolog engine is optimized to return the rst few answers
only. To decide whether a hypothesis covers a particular example, only one
answer is needed; cf. also below. At present, the question of how to eciently
couple a relational learner to a database system remains open. One promising
direction may be to use in-memory databases and another possible approach
is sketched in Yin et al. [2006].
332
The reader unfamiliar with constraint satisfaction problems may want to consult
[Russell and Norvig, 2004] for an excellent introduction.
333
Example 10.6. The previous set of queries can be written using a query pack:
in(X, Y), (true or (triangle(X), (true or red(Y))) or (circle(X), (true or red(Y))))
334
The rst question has the standard answer in computer science, where
ecient corresponds to polynomial. Two forms of eciency are considered in
computational learning theory: sample complexity and computational complexity. The sample complexity expresses the number of examples needed before
a high-quality solution is obtained, whereas the computational complexity
refers to the time and memory requirements of particular learning problems
or algorithms.
The second question is somewhat harder to answer, because there exist
many dierent notions of learnable within the computational learning theory
literature. They all have to do with a notion of convergence to a desirable
hypothesis given evidence (in the form of examples or answers to particular
queries; cf. Sect. 7.3.2). A full discussion of all possibilities is outside the scope
of this book,3 though we present some key notions in the following subsection.
10.2.1 Notions of Learnability
In Chapter 7, we encountered some notions of convergence. First, there was the
Horn algorithm by Angluin et al. [1992] that exactly identies theories. Exact
identication requires that the learner halt after processing a nite number of
examples and queries and output a theory that is (logically) equivalent to the
target theory. In the case of Horn, there were further guarantees concerning
the complexity of the algorithm. Indeed, the number of queries as well as the
computation time required were both polynomial in the size parameters of
the target theory.
Second, there is the Model Inference System algorithm by Shapiro
[1983], which identies theories in the limit. Systems that identify theories
in the limit are presented with a potentially innite sequence of examples
e1 , ..., en , ... of the target theory T ,4 and have to output a sequence T1 , ..., Tn , ...
of theories such that Ti is consistent with the rst i examples e1 , ..., ei . A
system identies a theory in the limit if and only if, for all possible theories
and all possible sequences of examples (in which each example eventually
occurs), there is a number i such that Ti is equivalent to the target theory T
and j > i : Tj = Ti . So, systems that identify interpretations in the limit
converge in a nite number of steps upon a theory that is correct. The key
dierence with exact identication is the system is not required to know when
the point of convergence occurs.
Thirdly, there is the more recent and also more popular PAC-learning
(probably approximately correct learning) setting introduced by Valiant [1984]
on which we will focus in this section. Whereas the Model Inference System and the Horn algorithm employed membership and equivalence queries
3
335
(10.1)
336
337
338
The depth of a term in a clause is dened as the minimum length of its linking
chains. A term in a clause is linked with a linking chain of length 0 if it occurs in
the head of the clause, and with a linking chain of length d + 1 if another term
in the same literal is linked with a linking chain of length d in the clause [Kietz,
1993].
339
For instance, for V = {v1 , v2 } and C = {{v1 }, {v2 }}, the following positive
examples are constructed:
h(c1 ) p(c1 , c11 ), t2 (c11 ), f1 (c11 ), f2 (c11 ), p(c1 , c12 ), t1 (c12 ), t2 (c12 ), f2 (c12 )
h(c2 ) p(c2 , c21 ), t1 (c21 ), f1 (c21 ), f2 (c21 ), p(c2 , c22 ), t1 (c22 ), t2 (c22 ), f1 (c12 )
as well as the negative
h(d) p(d, d1 ), t2 (d1 ), f1 (d1 ), f2 (d1 ), p(d, d2 ), t1 (d2 ), f1 (d2 ), f2 (d2 )
A solution for this learning task is now given by
h(X) p(X, X1 ), t1 (X1 ), t2 (X1 )
which corresponds to the truth assignment v1 = true = v2 .
Exercise 10.11. Show how to compute a solution to the learning task of the
previous example by computing the lgg of the positive examples. Show that
it does not subsume the negative. Show also that for C = {{v1 }, {v1 }}, the
resulting learning problem does not have a solution.
Exercise 10.12. ** Show that the reduction sketched in the previous example is indeed a polynomial reduction. (The solution to this exercise and the
previous one can be found in [Kietz and Dzeroski, 1994].)
The above example shows that a particular inductive logic programming
problem is not PAC-learnable. The weakness of this result (and of that of any
PAC-learning result based on the hardness of the consistency problem) is that
it only provides limited insight into the learning task. Indeed, even though it
was shown that learning a single clause in Lnd
12 is not tractable, it might well
be the case that other, more expressive languages would be PAC-learnable.
As such, the above result does not exclude the possibility that learning sets
of clauses in Lnd
12 is PAC-learnable.
A second proof technique for obtaining negative PAC-learning results relies
on the seminal work by Schapire [1990]. This result essentially states that a
language cannot be PAC-learnable (under certain complexity theory assumptions) if there exists a concept in the language for which the covers test cannot
be evaluated in polynomial time. This is sometimes referred to as evaluation
hardness. More formally, it is required that there exist a hypothesis h L such
that testing whether h covers an example e cannot be performed in time polynomial in e and h. The result by Schapire is quite intuitive. Indeed, learning
systems typically need to (repeatedly) test whether a candidate hypothesis
covers particular examples, and therefore the learning task is expected to be
harder than testing coverage. Even though the result by Schapire is intuitively
clear, its proof is quite involved. Nevertheless, this result together with the
complexity of typical coverage tests (such as -subsumption) indicates that
there is little hope of obtaining positive PAC-learning results for large classes
of inductive logic programming problems. The proof technique of evaluation
340
341
A third proof technique for obtaining PAC-learning results, called predictionpreserving reducibility, directly reduces one PAC-learning problem to another.
The idea is very similar to that of other reductions employed within theoretical computer science, such as reductions from one NP-complete problem (for
instance, SAT) to another (for instance, the consistency problem for Lnd
12 ).
This proof technique employs a slight variant of PAC-learnability, the socalled PAC-predictability. The key dierence between PAC-predictability and
PAC-learnability of a language L is that in the case of PAC-predictability it is
not required that the output hypothesis belong to the language L of hypotheses. Instead, it is required that the output hypothesis evaluate in polynomial
time (in the size of its input).
Consider the two hypotheses languages Lh1 over Le1 and Lh2 over Le2 ,
and suppose that there exist two functions fe : Le1 Le2 and fh : Lh1 Lh2
with the following properties:
e H if and only if fe (e) fh (H)
size(fh (H)) is polynomial in size(H)
fe (e) can be computed in polynomial time
(10.3)
Then we say that predicting Lh1 reduces to predicting Lh2 , notation Lh1
Lh2 [Pitt and Warmuth, 1990]. The rst condition states that membership
be preserved, the second that the size of hypotheses be preserved within a
polynomial factor, and the last that the instance mapping fe run in polynomial
time.
If Lh1 Lh2 , one can use a learning algorithm for Lh2 to learn concepts
in Lh1 by rst mapping the data set E1 (represented in Le1 ) to the data set
E2 = {fe (e)|e E1 } (represented in Le2 ), and then employing the learning
algorithm for Lh2 to learn a hypothesis H2 . The hypothesis H2 can then be
used for predicting the class of (unseen) examples e Le1 by testing whether
fe (e) is covered by H2 . Pitt and Warmuth [1990] have shown that if Lh1
Lh2 and Lh2 is PAC-predictable, then Lh1 is PAC-predictable. Predictionpreserving reducibilities can now be used in two directions. First, to show
that Lh1 is PAC-predictable, it suces to nd a PAC-predictable language
Lh2 and a prediction-preserving reduction such that Lh1 Lh2 . By taking the
contra-position of the theorem by Pitt and Warmuth [1990], one can also show
that a language Lh1 is not PAC-predictable (and therefore not PAC-learnable)
if it reduces to a language Lh2 that is not PAC-predictable. PAC-reducibility
is, hence, a powerful tool to obtain an understanding of the relative diculty
of learning problems.
Exercise 10.15. * Prove the positive result for jk-clausal theories and learning from interpretations using a prediction-preserving reduction to the set of
monomials. Assume that monomials (conjunctions of boolean attributes) are
PAC-learnable.
Exercise 10.16. ** Specify a prediction-preserving reduction from r-term
DNF to the language Lf1 . R-term DNF formulae are boolean formulae of the
342
10.3 Conclusions
Throughout this chapter, we have focused on computational aspects of logical and relational learning. First, we addressed implementation issues, where
we emphasized the need for ecient coverage testing. This lead us to investigate the eciency of -subsumption testing in the phase-transition framework,
and discuss various possible optimizations, such as sampling, use of interpretations, and query-packs. Second, we investigated logical and relational learning from a theoretical computer science perspective, that is, we discussed the
convergence and complexity of logical and relational learning systems. Various frameworks for learnability were considered, such as identication in the
limit and probably approximately correct learning. Although most results are
negative, we also presented some positive results for simple settings.
343
1991]. The famous Horn algorithm and its variants for exact identication
of Horn theories from examples are described in [Angluin et al., 1992, Frazier
and Pitt, 1993]. The role of queries for learning is investigated in [Angluin,
1987, 2004].
The rst results concerning PAC-learning of logical and relational learning
are due to Haussler [1989] and, in an inductive logic programming context,
to Dzeroski et al. [1992]. Early negative results are also due to Kietz [1993];
see also [Kietz and Dzeroski, 1994]. An excellent introduction to computational learning theory for logical and relational learning is given by Cohen
and Page [1995]. Various other interesting results can be found in [Cohen,
1995, De Raedt and Dzeroski, 1994, Reddy and Tadepalli, 1997, 1998, Arias
and Khardon, 2000, Khardon, 1999]. Worth mentioning is also the work on the
polynomial learnability of elementary formal systems by Miyano et al. [2000].
Elementary formal systems employ a denite-clause-like syntax to specify formal languages and manipulate strings. Further results can be found in the
proceedings of the annual conferences on Computational Learning Theory
and Algorithmic Learning Theory.
For Matthew
Young man going east
11
Lessons Learned
Whereas the previous chapters introduced dierent aspects of logical and relational learning, the present chapter constitutes an attempt to summarize
some of the main lessons learned that may be important for future developments in machine learning and articial intelligence research. Taken together
these lessons put logical and relational learning in a new perspective.
346
11 Lessons Learned
347
Logical and relational learning has also studied how the richer representations can be transformed into simpler representations. In this regard, logical
and relational learning has contributed several propositionalization techniques
(cf. Sect. 4.12) that transform structured machine learning and data mining
problems into a simpler format, typically a feature-vector or an attribute-value
representation, though also more complex intermediate representations (such
as multi-instance representations) are possible. The resulting problems can
directly be input into the (more) standard machine learning and data mining
algorithms that employ at representations such as support-vector and kernel
methods, decision tree learners, etc. Two types of techniques can be distinguished: static propositionalization, which rst maps the logical or relational
learning problem onto the simpler format, and then invokes learners on the
simpler representations, and dynamic approaches, which incrementally construct a set of good features by coupling the propositionalization step with
the learning step.
Aggregation (cf. Sect. 4.13) can play an important role in propositionalization as it summarizes the information about multiple values into a single
value.
Propositionalization and aggregation have to be exercised with care because there is a risk of losing information, though propositionalization and
aggregation techniques have proven to be eective for many classication
problems.
348
11 Lessons Learned
The theory of logical and relational learning has contributed a rich variety
of frameworks for reasoning about the generality of hypotheses, cf. Chapter 5.
When using hypotheses in the form of logical formulae, the generality relation
coincides with that of logical entailment. Typically, a hypothesis G is said to
be more general than a hypothesis S if G entails S, that is, if G |= S. Applying
a deductive inference operator leads to specializations, and applying inverted
deductive operators, that is, inductive operators, leads to generalizations. A
multitude of operators for generalization and specialization have been devised
and are theoretically well-understood. Dierent operators exist that depend on
the form of the hypotheses (single or multiple clause), the presence or absence
of a background theory, the type of inference rule (deductive or inductive),
and the search strategy applied (heuristic or complete search).
Many of the frameworks for generality can also be downgraded for use
with more specialized representations, such as for instance graphs. The two
most important frameworks for deciding whether one clause is more general
than another one are -subsumption [Plotkin, 1970] and OI-subsumption [Esposito et al., 1996]. Specialized to graphs, these denitions correspond to the
well-known notions of subgraph-isomorphism and -homeomorphism. As a consequence, it is easy (not to say straightforward) to adapt many of the results
and operators of the subsumption frameworks to those of the graph-morphism
ones. This can be used to obtain methods and algorithms for enumerating
graphs with dierent properties. At the same time, some variants of the subsumption framework that take into account background knowledge in the form
of sets of clauses or rules might be adapted towards the graph mining setting,
potentially leading to a new class of graph mining systems.
349
mation. This is not only useful when performing deduction in logic, but also
in the above sketched knowledge-based model construction approach. For instance, in a logical Markov model context, abstract state transitions such
as p(X) q(X), where p(X) is an abstract state, can be instantiated to
grounded states, that is, p(c1). The abstract state transition can then be instantiated to p(c1) q(c1) denoting that a transition to state q(c1) occurs
(perhaps with a particular probability). The value c1 is propagated from one
state to the next and realizes a kind of memory in the Markov model. This
mechanism by itself is important as it adds expressive power as shown, for instance, in Logical HMMs [Kersting et al., 2006]. Even though logical Markov
models and Markov logic use elements of logic, they are not a purely logical
representation because they merge graphical models and logic. As a consequence, logic is no longer used as a target language but rather as a means for
realizing interesting intermediate representations.
350
11 Lessons Learned
11.9 Applications
Logical and relational learning is applicable to a wide variety of problem domains.
Even though the book has stressed machine learning and data mining principles rather than applications, the reader should be aware that logical and
relational learning are applicable to a wide variety of problem areas. Indeed,
some well-known applications of logical and relational learning include natural
language learning [Cussens and Dzeroski, 2000], in bio- and chemo-informatics
[King et al., 2004, Page and Craven, 2003], drug design [King et al., 1992],
qualitative reasoning [Bratko et al., 1992], music analysis [Tobudic and Widmer, 2005], activity recognition [Liao et al., 2005], robotics [Kersting et al.,
2007, Limketkai et al., 2005], intelligent assistants [Myers et al., 2007], ecological modeling [Dzeroski et al., 1994], text and web mining [Craven and
Slattery, 2001], user modeling [Jacobs and Blockeel, 2001], game playing [Ramon et al., 2001], validation and verication [Cohen, 1994b, De Raedt et al.,
1991]. Overviews of some of these applications can be found in [Bratko and
Muggleton, 1995, Page and Craven, 2003, Bratko and Dzeroski, 1995, Dzeroski
and Bratko, 1996, Dzeroski, 2001, Cussens and Dzeroski, 2000].
References
A. Aamodt and E. Plaza. Case-based reasoning: Foundational issues, methodological variations, and system approaches. AI Communications, 7(1):39
59, 1994.
H. Ade and M. Denecker. Abductive inductive logic programming. In Proceedings of the 14th International Joint Conference on Articial Intelligence.
Morgan Kaufmann, 1995.
H. Ade, L. De Raedt, and M. Bruynooghe. Declarative Bias for Specic-toGeneral ILP Systems. Machine Learning, 20(1/2):119 154, 1995.
R. Agrawal and R. Srikant. Fast algorithms for mining association rules. In
J. B. Bocca, M. Jarke, and C. Zaniolo, editors, Proceedings of 20th International Conference on Very Large Data Bases, pages 487499. Morgan
Kaufmann, 1994.
R. Agrawal, T. Imielinski, and A. Swami. Mining association rules between
sets of items in large databases. In P. Buneman and S. Jajodia, editors,
Proceedings of the 1993 ACM SIGMOD International Conference on Management of Data, pages 207216. ACM Press, 1993.
D. Aha, D. Kibler, and M. Albert. Instance-based learning algorithms. Machine Learning, 6:3766, 1991.
J. Allen. Natural Language Understanding. Benjamin/Cummings Publishing
Company, 1987.
S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. Basic
local alignment search tool. Journal of Molecular Biology, 215(3):403410,
1990.
C. R. Anderson, P. Domingos, and D. S. Weld. Relational Markov models
and their application to adaptive web navigation. In D. Hand, D. Keim,
O. R. Zane, and R. Goebel, editors, Proceedings of the 8th ACM SIGKDD
International Conference on Knowledge Discovery and Data Mining (KDD2002), pages 143152. ACM Press, 2002.
D. Angluin. Queries revisited. Theoretical Computer Science, 313(2):175194,
2004.
352
References
References
353
354
References
J. S. Breese, R. P. Goldman, and M. P. Wellman. Introduction to the special section on knowledge-based construction of probabilistic and decision
models. Cybernetics, 24(11):15771579, 1994.
L. Breiman, J. Friedman, C. J. Stone, and R. A. Olshen. Classication and
Regression Trees. Chapman and Hall, 1984.
R. E. Bryant. Graph-based algorithms for boolean function manipulation.
IEEE Trans. Computers, 35(8):677691, 1986.
B. G. Buchanan and T. M. Mitchell. Model-directed learning of production
rules. In D. A. Waterman and F. Hayes-Roth, editors, Pattern-Directed
Inference Systems. Academic Press, 1978.
H. Bunke and K. Shearer. A graph distance metric based on the maximal
common subgraph. Pattern Recognition Letters, 19(3):255 259, 1998.
H. Bunke, P. Foggia, C. Guidobaldi, C. Sansone, and M. Vento. A comparison of algorithms for maximum common subgraph on randomly connected
graphs. In T. Caelli, A. Amin, R. P. W. Duin, M. S. Kamel, and D. de Ridder, editors, Structural, Syntactic, and Statistical Pattern Recognition, volume 2396 of Lecture Notes in Computer Science, pages 123132. Springer,
2002.
W. Buntine. Induction of Horn-clauses: Methods and the plausible generalization algorithm. International Journal of Man-Machine Studies, 26:499520,
1987.
W. Buntine. Generalized subsumption and its application to induction and
redundancy. Articial Intelligence, 36:375399, 1988.
W. Buntine. Operations for learning with graphical models. Journal of Articial Intelligence Research, 2:159225, 1994.
S. Chakrabarti. Mining the Web: Discovering Knowledge from Hypertext Data.
Morgan Kaufmann, 2002.
E. Charniak. Tree-bank grammars. In Proceedings of the 13th National Conference on Articial Intelligence, volume 2, pages 10311036. AAAI Press,
1996.
P. Clark and R. Boswell. Rule induction with CN2: Some recent improvements. In Y. Kodrato, editor, Proceedings of the 5th European Working
Session on Learning, volume 482 of Lecture Notes in Articial Intelligence,
pages 151163. Springer, 1991.
P. Clark and T. Niblett. The CN2 algorithm. Machine Learning, 3(4):261284,
1989.
B. L. Cohen and C. Sammut. Object recognition and concept learning with
CONFUCIUS. Pattern Recognition Journal, 15(4):309 316, 1982.
W. W. Cohen. Grammatically biased learning: Learning logic programs using
an explicit antecedent description language. Articial Intelligence, 68:303
366, 1994a.
W. W. Cohen. Recovering Software Specications with ILP. In Proceedings
of the 12th National Conference on Articial Intelligence, pages 142148,
1994b.
References
355
356
References
References
357
358
References
References
359
360
References
References
361
362
References
References
363
364
References
References
365
366
References
J. J. McGregor. Backtrack search algorithms and the maximal common subgraph problem. Software Practice and Experience, 12(1):2334, 1982.
S. Menchetti, F. Costa, and P. Frasconi. Weighted decomposition kernels. In
L. De Raedt and S. Wrobel, editors, Proceedings of the 22nd International
Machine Learning Conference, pages 585592. ACM Press, 2005.
R. S. Michalski. A theory and methodology of inductive learning. In R. S.
Michalski, J. G. Carbonell, and T. M. Mitchell, editors, Machine Learning:
An Articial Intelligence Approach, volume 1. Morgan Kaufmann, 1983.
T. M. Mitchell. Generalization as search. Articial Intelligence, 18:203226,
1982.
T. M. Mitchell. Machine Learning. McGraw-Hill, 1997.
S. Miyano, A. Shinohara, and T. Shinohara. Polynomial-time learning of
elementary formal systems. New Generation Computing, 18(3):217242,
2000.
R. J. Mooney. Learning for semantic interpretation: Scaling up without dumbing down. In J. Cussens and S. Dzeroski, editors, Learning Language in
Logic, volume 1925 of Lecture Notes in Computer Science, pages 5766.
Springer, 2000.
R. J. Mooney and M. E. Cali. Induction of rst-order decision lists: Results
on learning the past tense of English verbs. Journal of Articial Intelligence
Research, 3:124, 1995.
K. Morik, S. Wrobel, J.-U. Kietz, and W. Emde. Knowledge Acquisition and
Machine Learning: Theory, Methods and Applications. Academic Press,
1993.
S. Morishita and J. Sese. Traversing itemset lattice with statistical metric pruning. In Proceedings of the 19th ACM SIGACT-SIGMOD-SIGART
Symposium on Principles of Database Systems, pages 226236. ACM Press,
2000.
S. Muggleton. Inverting implication. In S. Muggleton, editor, Proceedings of
the 2nd International Workshop on Inductive Logic Programming, Report
ICOT TM-1182, pages 1939, 1992a.
S. Muggleton. Inverse entailment and Progol. New Generation Computing,
13(3-4):245286, 1995.
S. Muggleton. Duce, an oracle based approach to constructive induction. In
Proceedings of the 10th International Joint Conference on Articial Intelligence, pages 287292. Morgan Kaufmann, 1987.
S. Muggleton. Inductive logic programming. New Generation Computing, 8
(4):295317, 1991.
S. Muggleton, editor. Inductive Logic Programming. Academic Press, 1992b.
S. Muggleton. Learning structure and parameters of stochastic logic programs.
In S. Matwin and C. Sammut, editors, Proceedings of the 12th International
Conference on Inductive Logic Programming, volume 2583 of Lecture Notes
in Articial Intelligence, pages 198206. Springer, 2003.
References
367
368
References
S.-H. Nienhuys-Cheng and R. de Wolf. Foundations of Inductive Logic Programming, volume 1228 of Lecture Notes in Articial Intelligence. Springer,
1997.
S. Nijssen and J. Kok. Faster association rules for multiple relations. In
Proceedings of the 17th International Joint Conference on Articial Intelligence, pages 891896. Morgan Kaufmann, 2001.
S. Nijssen and J. Kok. Ecient query discovery in Farmer. In N. Lavrac,
D. Gamberger, H. Blockeel, and L. Todorovski, editors, Proceedings of the
7th European Conference on Principles and Practice of Knowledge Discovery in Databases, volume 2838 of Lecture Notes in Articial Intelligence,
pages 350362. Springer, 2003.
S. Nijssen and J. Kok. A quickstart in frequent structure mining can make
a dierence. In W. Kim, R. Kohavi, J. Gehrke, and W. DuMouchel, editors, Proceedings of the 10th ACM SIGKDD International Conference on
Knowledge Discovery and Data Mining, pages 647652, 2004.
N. J. Nilsson. Probabilistic logic. Articial Intelligence, 28(1):7187, 1986.
N. J. Nilsson. The Mathematical Foundations of Learning Machines. Morgan
Kaufmann, 1990.
R. A. OKeefe. The Craft of Prolog. MIT Press, 1990.
D. Page and M. Craven. Biological applications of multi-relational data mining. SIGKDD Explorations, 5(1):6979, 2003.
A. Passerini, P. Frasconi, and L. De Raedt. Kernels on Prolog proof trees: Statistical learning in the ILP setting. Journal of Machine Learning Research,
7:207342, 2006.
M. J. Pazzani and D. Kibler. The utility of knowledge in inductive learning.
Machine Learning, 9(1):5794, 1992.
J. Pearl. Probabilistic Reasoning in Intelligent Systems: Networks of Plausible
Inference. Morgan Kaufmann, 1988.
C. Perlich and F. Provost. Aggregation-based feature invention and relational
concept classes. In L. Getoor, T. E. Senator, P. Domingos, and C. Faloutsos,
editors, Proceedings of the 9th ACM SIGKDD International Conference on
Knowledge Discovery and Data Mining, pages 167176. ACM Press, 2003.
A. Pfeer. The design and implementation of IBAL: A general-purpose probabilistic language. In L. Getoor and B. Taskar, editors, Introduction to
Statistical Relational Learning. MIT Press, 2007.
A. Pfeer. Probabilistic Reasoning for Complex Systems. PhD thesis, Stanford
University, 2000.
L. Pitt and M. Warmuth. Prediction-preserving reducibility. Journal of Computer and System Science, 41:430467, 1990.
G. D. Plotkin. A further note on inductive generalization. In Machine Intelligence, volume 6, pages 101124. Edinburgh University Press, 1971.
G. D. Plotkin. A note on inductive generalization. In Machine Intelligence,
volume 5, pages 153163. Edinburgh University Press, 1970.
D. Poole. A logical framework for default reasoning. Articial Intelligence,
36:2747, 1988.
References
369
370
References
References
371
372
References
References
373
For Matthew
Young man going east
Author Index
Aamodt, A. 323
Ade, H. 155, 221
Agrawal, R. 1, 14, 69, 174, 177
Aha, D. 297
Albert, M. 297
Allen, J. 233
Altschul, S. F. 316
Amini, A. 324
Amir, E. 252, 288
Anderson, C. R. 264, 288
Angluin, D. 188, 192, 208, 209, 211,
220, 221, 334, 335, 337, 342, 343
Arias, M. 221, 337, 343
Bacchus, F. 288
Badea, L. 155
Baldi, P. 6, 223, 236, 324
Bancilhon, F. 39
Banerji, R. B. 13, 155, 220
Barto, A. 274, 277, 288
Bengio, Y. 237
Bergadano, F. 13, 167, 180, 186
Berry, P. 350
Bhattacharya, I. 288
Biermann, A. 13, 342
Bishop, C. 239
Bisson, G. 322, 324
Blockeel, H. 81, 110, 113, 114, 145,
155, 157, 158, 167169, 171, 172,
376
Author Index
Clark, P. 164
Cocora, A. 350
Cohen, B. L. 13
Cohen, W. W. 182, 186, 337, 338,
340, 342, 343, 350
Conley, K. 350
Cormen, T. H. 314, 317
Costa, F. 303
Costa, V. Santos 254, 288, 331, 342
Cowell, R. G. 223
Craven, M. 2, 6, 350
Cristianini, N. 292, 323
Cussens, J. 223, 247, 254, 255, 257,
270, 271, 288
Feldman, J. 13
Feng, C. 14, 108, 142, 167, 185, 186,
210, 336
Fern, A. 283, 288
Fikes, R. 281
Flach, P. 17, 26, 39, 93, 113, 196,
218, 221, 305, 306, 324
Flener, P. 220
Foggia, P. 320
Fox, D. 288, 350
Francis, T. 350
Frasconi, P. 6, 223, 237, 303, 322,
Dantsin, E. 288
324, 347
Dawid, A. P. 223
Frazier,
M. 188, 192, 208, 209, 211,
de Haas, M. 114, 145, 155
220,
334,
337, 343
De Raedt, L. 14, 69, 70, 82, 109, 113,
Friedland,
L.
185
116, 137, 155, 167, 178, 184, 185,
Friedman,
J.
174
216, 217, 220, 221, 223, 247, 248,
Friedman, N. 14, 114, 247, 251, 253,
250, 273, 287289, 307, 309, 317,
267, 288, 346
320, 324, 337, 343, 349, 350
F
urnkranz, J. 164
de Salvo Braz, R. 252, 288
De Schreye, D. 196
Gallaire, H. 39
de Wolf, R. 25, 31, 39, 69, 70, 126,
Ganascia, J.-G. 106
132, 133, 139, 154
Garey, M. R. 129
Dehaspe, L. 14, 81, 157, 158, 169,
Garriga, G. C. 185
178, 184, 185, 221, 332, 333, 342,
G
artner, T. 302, 305, 306, 323, 324
346, 347, 350
Geibel, P. 114
Demoen, B. 331333, 342
Genesereth, M. 17, 39
Denecker, M. 196, 221, 288
Gervasio, M. 350
Dietterich, T. G. 78, 113, 165
Domingos, P. 223, 247, 254, 255, 288, Getoor, L. 5, 6, 14, 89, 91, 114, 251,
253, 267, 288, 346
348
Gillies, D. A. 12
Driessens, K. 283, 288, 347
Giordana, A. 13, 167, 327329, 332,
Durbin, R. 232, 236
342
Dzeroski, S. 14, 108, 113, 162, 166,
Giraud-Carrier, C. 93
185, 186, 283, 288, 324, 336339,
343, 347, 350
Gish, W. 316
Givan, R. 283, 288
Eddy, S. 232, 236
Goldman, R. P. 14
Eisele, A. 223, 247
Grobelnik, M. 108
Guidobaldi, C. 320
Elmasri, R. 218
Author Index
377
378
Author Index
Author Index
Rhee, J. 288
Richards, B. 220
Richardson, M. 223, 247, 254, 255,
288, 348
Rivest, R. L. 314, 317
Robinson, J. A. 28, 39, 147
Rollinger, C. R. 13, 186
Rosen, K. 306
Ross, R. B. 288
Roth, D. 221, 252, 288
Rouveirol, C. 103, 113, 155
Ruck, B. 350
Russell, S. 39, 223, 224, 226, 228,
230, 239, 240, 244, 274, 280,
286288, 332, 336, 343
Sablon, G. 137, 350
Saigo, H. 324
Saitta, L. 327329, 332, 342
Sammut, C. 13, 155, 220
Sanner, S. 274, 288
Sansone, C. 320
Sato, T. 14, 223, 247, 256, 259, 261,
262, 270, 288
Savnik, I. 221
Schapire, R. E. 339
Scheer, T. 342
Sch
olkopf, B. 291, 292, 323
Schulze-Kremer, S. 324
Sch
utze, H. 7, 232, 233, 235, 270, 287
Sebag, M. 327, 332, 342
Segal, E. 288
Semeraro, G. 155, 348
Sese, J. 63, 69
Shanahan, M. P. 221
Shapiro, E. Y. 13, 17, 39, 113, 154,
185, 187, 188, 192, 204, 205, 220,
334, 342, 343
Shawe-Taylor, J. 292, 323
Shearer, K. 320
Shinohara, A. 343
Shinohara, T. 343
Siebes, A. 114, 145, 155
Siems, K. 324
Simon, H. 12
379
Singla, P. 288
Siskind, J. M. 288
Slattery, S. 2, 6, 350
Small, P. 288
Smith, C. H. 342
Smola, A. 291, 292, 323, 324
Smyth, P. 6, 223
Spiegelhalter, D. J. 223
Srikant, R. 177
Srinivasan, A. 2, 3, 5, 14, 95, 109,
113, 185, 329, 331, 342
Stein, C. 314, 317
Stepp, R. E. 83
Sterling, L. 17, 39, 113
Sternberg, M. J. E. 2, 3, 5, 14, 95,
324
Stickel, M. E. 216
Stone, C. J. 174
Struyf, J. 331, 342
Subrahmanian, V. S. 288
Summers, P. D. 13
Sutton, R. 274, 277, 288
Swami, A. 1, 14, 69, 174
Swamidass, S. J. 324
Tadepalli, P. 221, 337, 343
Tambe, M. 350
Taskar, B. 253, 288
Tausend, B. 180, 186
Tesauro, G. 280
Tobudic, A. 324, 350
Toivonen, H. 8, 14, 69, 157, 158, 178,
185, 259, 260, 329, 346, 347
Toni, F. 196, 199, 221
Torge, S. 273
Tsuda, K. 324
Ungar, L. H. 109
Valiant, L. 113, 334, 337
Van Assche, A. 185
van der Laag, P. R. J. 154
Van Laer, W. 81, 169, 184, 331, 342
van Otterlo, M. 284, 286, 288
Vandecasteele, H. 331333, 342
380
Author Index
Varsek, A. 350
Vazirani, U. 44, 113, 334, 342
Vennekens, J. 259, 288
Vens, C. 110, 114, 145, 155, 185
Vento, M. 320
Verbaeten, S. 259
Vere, S. A. 13, 154
Wachman, G. 324
Walley, W. 350
Wang, C. 286, 288
Warmuth, M. 341
Washio, T. 14, 185
Watanabe, L. 185
Weber, I. 185
Weld, D. S. 264, 288
Wellman, M. P. 14
Wettschereck, D. 322, 324, 346
Index
OI-subsumption, 136
Q-learning, 279
-subsumption, 127
empirical, 327
equivalence class, 131
quotient set, 131
chains, 133
complexity, 129
k-means algorithm, 298
k-nearest neighbor algorithm, 297
Duce, 212
Foil, 161
Golem, 142
Horn algorithm, 208
Model Inference System, 199
Prism, 261
Progol, 140
Satchmo, 26
Strips, 281
Tilde, 168
Warmr, 174
abduction, 197
probabilistic, 263
abductive logic programming, 196
abductive operator, 193
absorbing state, 278
absorption, 148
abstract Q-learning, 283
accuracy, 47
action-value function, 276
aggregate function, 251
aggregation, 109
alignment, 316
alphabet, 53
answer substitution, 165
anti-monotonicity, 146
aggregate function, 146
distance, 308
language, 217
quality criterion, 50
anti-unication, 125
applications, 350
association rule, 175
atom, 21
attribute
continuous, 74
nominal, 74
ordinal, 74
attribute-value representation, 73
automatic programming, 84
background knowledge, 91, 350
extensional, 163
backtracing, 200
Bayes
law, 225
Bayesian logic program, 248
Bayesian network, 226
Bellman optimality equations, 276
bias, 179
parametrized, 182
declarative, 179
preference, 179
search, 179
semantic, 180
382
Index
syntactic, 180
Bongard problem, 80
boolean representation, 43
border, 53
negative, 55
positive, 55
bottom clause, 139
boundary set, 53
branch-and-bound, 62
candidate elimination, 66
canonical form, 57
centroid, 298
chain rule, 225
classication, 45
clausal logic, 21
clause, 21
body, 21
denite, 21
empty, 25
head, 21
Horn, 21
schema, 182
clique, 231
clustering, 297
combining rule, 251
completeness, 118
integrity theory, 214
refutation, 31
resolution, 30
compound term, 20
compression, 212
computational complexity, 334
computational learning theory, 333
concept learning, 45
condensed representation, 54
conditional independence, 225
conditional independency assumption,
228, 231
conditional likelihood, 239
conditional probability, 224
conditional probability distribution, 226
conditioning, 225
condence, 176
conjunctive hypotheses, 75
connected variables, 327
connection
converging, 229
diverging, 229
serial, 229
consistency problem, 338
constant, 18
constraint satisfaction, 332
convolution, 299
coverage
-subsumption, 326
extensional, 163
intensional, 163
probabilistic, 226
w.r.t. a model, 202
covering algorithm, 164
covers relation, 42
credit assignment, 195
d-separation, 229
decidability
logic, 35
decision list, 160
decision tree, 168
decoding, 235, 237, 259
decomposition, 299
deduction
inverse, 117
denite clause grammar, 87
denial, 21
dependency
predicate, 196
derivation
grammar, 234
SLD, 36
determinacy, 108, 166, 183, 336
diamond inequality, 309
disagreement set, 33
disambiguation, 235
discriminative model, 239
disjoint statement, 262
disjoint-sum, 260
disjunctive hypotheses, 75
distance, 296
edit, 308
Euclidean, 290
graph, 320
Hamming, 315
Hausdor, 311
matching , 313
measure, 296
metric, 296
relational, 322
Index
set, 310
term, 318
tuple, 309
distribution semantics, 261
divide-and-conquer, 168
domain
interpretation, 22
downgrading, 153, 346
dropping condition rule, 118
dual problem, 292
edit cost, 313
empirical risk, 45
Entity-Relationship model, 79
enumeration algorithm, 47
episodic, 278
equivalence query, 200
evaluation hardness, 339
exact identication, 334
exclusive explanations, 261
existential query, 200
expectation maximization, 242, 243
expected counts, 243
expected likelihood, 242
expected return, 275
explaining away, 229
explanation, 260
exploitation, 279
exploration, 279
extensional coverage, 129
extensional coverage test, 163
fact, 18, 21
failure-adjusted maximisation, 270
ltering, 237
ngerprints, 4
attening, 103
ow network, 314
frequency, 46
absolute, 46
relative, 46
frequent query mining, 177
fully observable, 240
function approximation, 44
function symbol, 20
functional, 183
functional dependency, 218
G set, 54
383
general-to-specic, 10, 58
generality, 10
relation, 48
generalization, 48
relative, 116
generalization distances, 309
generalized policy iteration, 277
generalized subsumption, 139
generate-and-test, 47
generative model, 239
goal, 22
Gram matrix, 293
grammar, 85
graph, 89
homeomorphism, 304
isomorphism, 304
mining, 89
greatest lower bound, 125, 134
Hasse diagram, 50
Herbrand
least Herbrand model, 27
model, 24
domain, 23
interpretation, 23
universe, 23
hidden Markov model, 236
hierarchy of representations, 97
identication, 148
identication in the limit, 208, 334
implication, 137
inclusion dependency, 219
inclusion-exclusion principle, 260
incorrect clause, 200
incremental, 190
independently and identically distributed, 239
individual-centered representation, 93
induction, 117
inductive inference, 11
inductive inference rule, 117
information gain, 172
inner product, 290
instantiation, 22
integrity constraint, 194, 214
intended interpretation, 188
intensional, 19
intensional coverage test, 163
384
Index
list, 20
literal, 21
log-linear, 232
logical learning, 2
logical representation, 2
logical sequence, 97
loop inversion, 330
loss function, 9, 45
MAP-hypothesis, 246
margin, 291
marginalization, 225
Markov assumption, 228
Markov Decision Process, 274
Markov logic, 254
Markov model, 236
hidden, 236
logical, 264
relational, 264
visible, 236
Markov networks, 231
matching, 313
materialization, 333
max margin, 291
maximal common subgraph, 319
maximally general specialization, 57
maximum a posteriori hypothesis, 246
maximum ow, 314
membership query, 200
metric, 296
minimal
integrity theory, 215
minimal model, 27
minimally general generalization, 57
minimum cost maximum ow, 314
missing data, 242
ML-hypothesis, 238
mode, 181
model theory, 22
model-based reinforcement learning,
277
model-free reinforcement learning, 277
monomial, 44
monotonicity
seeanti-monotonicity, 50
Monte Carlo methods, 278
most likely parse tree, 235
most likely proof tree, 259
most likely sequence, 237
Index
multi-instance learning, 76
multi-join learning, 78
multi-relational data mining, 14
multi-table multi-tuple, 79
multi-tuple learning, 78
multi-valued dependency, 219
multiple predicate learning, 189
noisy-or, 251
non-terminal symbol, 85
norm, 290
object identity, 135
operator
-subsumption, 133
OI-subsumption, 136
atom, 121
complete, 57
greatest lower bound, 57
inverse resolution, 147
least general generalization, 57
least upper bound, 57
maximally general specialization, 57
minimally general generalization, 57
nonredundant, 57
theory, 191
generalization, 56
ideal, 56
optimal, 56
propositional subsumption, 56
renement, 56
specialization, 56
optimal hyperplane, 292
oracle, 200
PAC-learnable, 335
PAC-learning, 334
PAC-predictability, 341
parameter estimation, 238
parameter tying, 244, 268
partial order, 49
partially observable, 242
phase-transition, 327
place, 124
policy, 275
improvement, 277
optimal, 276
position, 124
positive denite, 294
385
386
Index
Index
universal relation, 102
unsatisable, 24
upgrading, 158, 346
V-operator, 148
value iteration, 277
variable, 18
variable renaming, 36, 120
version space, 54
version space intersection, 68
view denition, 19
violates, 24
W-operator, 150
weighted information gain, 165
weighted set, 315
387