0% found this document useful (0 votes)
186 views6 pages

HW 13

This document provides instructions for homework assignment 13 involving DNA sequence analysis. Students are asked to write a program that reads DNA sequences from an input file, counts the nucleotides, calculates nucleotide mass percentages, identifies codons, and determines if each sequence encodes a protein. The program should prompt the user for input and output file names and write the results to the output file in a specified format. Arrays should be used to store and transform the sequence data during analysis.

Uploaded by

David M Rodgers
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
186 views6 pages

HW 13

This document provides instructions for homework assignment 13 involving DNA sequence analysis. Students are asked to write a program that reads DNA sequences from an input file, counts the nucleotides, calculates nucleotide mass percentages, identifies codons, and determines if each sequence encodes a protein. The program should prompt the user for input and output file names and write the results to the output file in a specified format. Arrays should be used to store and transform the sequence data during analysis.

Uploaded by

David M Rodgers
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 6

CS101 Spring 2014 Homework #13

Array processing exercises; more file input/output


1. Aim
This assignment will give you some more practice with file processing and array manipulation. This assignment will also give us an
opportunity to explore passing arrays as parameters and returning arrays from methods. This assignment will also give you some
experience with incremental program development. Please make sure you read this specification carefully, and completely understand
what is to be done before you begin working on it. [Recall the CS101 mantra: Think before you code!].

2. Files Needed
You will need several input files (and corresponding output files for validation) from the Oak assignment page. Your programs output
must match the expected output exactly.
You will not be provided with any starter files for this homework. Create a project in Eclipse for this assignment. For each exercise
below, create a Java class with the appropriate name. When you create each program, be sure to have Eclipse create the public static
void main method for you. Be sure to include the standard header comments at the top of each file.

3. To be Handed In
The file DNA.java should be submitted on-line via the homework #13 page in Oak. Be sure to name the files/classes as specified.

4. Exercises
Complete the following exercise by writing appropriate Java code in the file DNA.java1. Create an Eclipse project for this assignment.
Place a copy of the two provided input files (dna.txt and ecoli.txt) in the projects main directory.

Background Information:
Note: This section explains some information from the field of biology that is related to this assignment. It is for your information
only; you do not need to fully understand it to complete the assignment.
Deoxyribonucleic acid (DNA) is a complex biochemical macromolecule that carries genetic information for cellular life forms and
some viruses. DNA is also the mechanism through which genetic information from parents is passed on during reproduction. DNA
consists of long chains of chemical compounds called nucleotides. Four nucleotides are present in DNA: Adenine (A), Cytosine (C),
Guanine (G), and Thymine (T). DNA has a double-helix structure (see diagram below) containing complementary chains of these four
nucleotides connected by hydrogen bonds.
Certain regions of the DNA are called genes. Most genes encode instructions for building proteins (they're called "protein-coding"
genes). These proteins are responsible for carrying out most of the life processes of the organism.
Nucleotides in a gene are organized into codons. Codons are groups of three nucleotides and are written as the first letters of their
nucleotides (e.g., TAC or GGA). Each codon uniquely encodes a single amino acid, a building block of proteins.
The process of building proteins from DNA has two major phases called transcription and translation, in which a gene is replicated
into an intermediate form called mRNA, which is then processed by a structure called a ribosome to build the chain of amino acids
encoded by the codons of the gene.

This assignment was originally given at the University of Washington, where CSE professor Martin Tompa was given special
acknowledgement for its development.

The chemical structure of DNA.

DNA translation.

The sequences of DNA that encode proteins occur between a start codon (which we will assume to be ATG) and a stop codon (which
is any of TAA, TAG, or TGA). Not all regions of DNA are genes; large portions that do not lie between a valid start and stop codon
are called intergenic DNA and have other (possibly unknown) functions. Computational biologists examine large DNA data files to
find patterns and important information, such as which regions are genes. Sometimes they are interested in the percentages of mass
accounted for by each of the four nucleotide types. Often high percentages of Cytosine (C) and Guanine (G) are indicators of
important genetic data. For more information, visit the Wikipedia page about DNA: http://en.wikipedia.org/wiki/DNA

Assignment:
The assignment involves processing data from genome files. Your program should work with the two given input files. If you are
curious (this is not required), the National Center for Biotechnology Information publishes many other bacteria genome files. The last
page tells you how to use your program to process other published genome files.
In this assignment you read an input file containing named sequences of nucleotides and produce information about them. For each
nucleotide sequence, your program counts the occurrences of each of the four nucleotides (A, C, G, and T). The program also
computes the mass percentage occupied by each nucleotide type, rounded to one digit past the decimal point. Next the program
reports the codons (trios of nucleotides) present in each sequence and predicts whether or not the sequence is a protein-coding gene.
For us, a protein-coding gene is a string that matches all of the following constraints*:

begins with a valid start codon (ATG)


ends with a valid stop codon (one of the following: TAA, TAG, or TGA)
contains at least 5 total codons (including its initial start codon and final stop codon)
Cytosine (C) and Guanine (G) combined account for at least 25% of its total mass

(*These are approximations for our assignment, not exact constraints used in computational biology to identify proteins.)
The DNA input data consists of line pairs. The first line of each pair has the name of the nucleotide sequence, and the second is the
nucleotide sequence itself. Each character in a sequence of nucleotides will be A, C, G, T, or a dash character, "-". The nucleotides in
the input can be either upper or lowercase.
Input file dna.txt (partial):
cure for cancer protein
ATGCCACTATGGTAG
captain picard hair growth protein
ATgCCAACATGgATGCCcGATAtGGATTgA
bogus protein
CCATt-AATgATCa-CAGTt
...

The dash "-" characters represent "junk" or "garbage" regions in the sequence. For most of the program they should be ignored in
your computations, though they do contribute to the total mass of the sequence as described later.

Program Behavior:
Your program begins with an introduction and prompts for input and output file names. You may assume the user will type the name
of an existing input file that is in the proper format. Your program reads the input file to process its nucleotide sequences and outputs
the results into the given output file. Notice the nucleotide sequence is output in uppercase, and that the nucleotide counts and mass
percentages are shown in A, C, G, T order. A given codon such as GAT might occur more than once in the same sequence.
Log of execution (user input in green):
This program reports information about DNA
nucleotide sequences that may encode proteins.
Input file name? dna.txt
Output file name? dna-out.txt
Do not hard-code file names in your code. The input file name used in the above log is dna.txt, but the input file could have a
different name. You should not need the string "dna.txt" anywhere in your program's code. Similarly, the output file name
happens to be named dna-out.txt in the log shown on this page, but this will not always be the case, and your code should not
contain the string "dna-out.txt". Your programs output must match this output exactly (use a file comparison program, such as
windiff on Windows).
Output file dna-out.txt after above execution (partial):
Region Name:
Nucleotides:
Nuc. Counts:
Total Mass%:
Codons List:
Is Protein?:

cure for cancer protein


ATGCCACTATGGTAG
[4, 3, 4, 4]
[27.3, 16.8, 30.6, 25.3] of 1978.8
[ATG, CCA, CTA, TGG, TAG]
YES

Region Name:
Nucleotides:
Nuc. Counts:
Total Mass%:
Codons List:
Is Protein?:

captain picard hair growth protein


ATGCCAACATGGATGCCCGATATGGATTGA
[9, 6, 8, 7]
[30.7, 16.8, 30.5, 22.1] of 3967.5
[ATG, CCA, ACA, TGG, ATG, CCC, GAT, ATG, GAT, TGA]
YES

Region Name:
Nucleotides:
Nuc. Counts:
Total Mass%:
Codons List:
Is Protein?:

bogus protein
CCATT-AATGATCA-CAGTT
[6, 4, 2, 6]
[32.3, 17.7, 12.1, 29.9] of 2508.1
[CCA, TTA, ATG, ATC, ACA, GTT]
NO

...

Implementation Guidelines, Hints, and Development Strategy:


The main purpose of this assignment is to demonstrate your understanding of arrays and array traversals with for loops. Therefore,
you should use arrays to store the various data for each sequence. In particular, your nucleotide counts, mass percentages, and
codons should all be stored using arrays. Additionally you should use arrays and for loops to transform the data from one form to
another as follows:

from the original nucleotide sequence string to nucleotide counts;


from nucleotide counts to mass percentages; and
from the original nucleotide sequence string to codon triplets.

These transformations are summarized by the following diagram using the "cure for cancer" protein data:
Nucleotides: "ATGCCACTATGGTAG"
Counts:

What is computed
{4, 3, 4, 4}

Mass %: {27.3, 16.8, 30.6, 25.3}

Resulting output
Nuc. Counts: [4, 3, 4, 4]
Total Mass%: [27.3, 16.8, 30.6, 25.3] of 1978.8

Nucleotides: "ATGCCACTATGGTAG"
Codons: {ATG, CCA, CTA, TGG, TAG}

Codons List: [ATG, CCA, CTA, TGG, TAG]


Is protein?: YES

Recall that you can print any array using the method Arrays.toString. For example:
int[] numbers = {10, 20, 30, 40};
System.out.println("my data is " + Arrays.toString(numbers)); // my data is [10, 20, 30, 40]

To compute mass percentages, use the following as the mass of each nucleotide (grams/mol). The dashes representing "junk" regions
are excluded from many parts of your computations, but they do contribute mass to the total.

Adenine (A): 135.128


Cytosine (C): 111.103
Guanine (G): 151.128
Thymine (T): 125.107
Junk (-): 100.000

For example, the mass of the sequence ATGG-AC is (135.128 + 125.107 + 151.128 + 151.128 + 100.000 + 135.128 + 111.103) or
908.722. Of this, 270.256 (29.7%) is from the two Adenines; 111.103 (12.2%) is from the Cytosine; 302.256 (33.3%) is from the two
Guanines; 125.107 (13.8%) is from the Thymine; and 100.000 (11.0%) is from the "junk" dash.
We suggest that you write this program incrementally, adding a section of code and getting it to work correctly before moving on to
the next section of code. Start by writing the code to read the input file. Try writing code to simply read each protein's name and
sequence of nucleotides and print them. Read each line from the input file using Scanners nextLine method. This will read an
entire line of input and return it as a String.
Next, write code to pass over a nucleotide sequence and count the number of As, Cs, Gs, and Ts. You can use a String's charAt
method to get individual characters. Put your counts into an array of size 4. To map between nucleotides and array indexes, you may
want to write a method that converts a single character (i.e. A, C, T, G) into indices (i.e. 0 to 3 respectively).
Once you have the counts working correctly, you can convert your counts into a new array of percentages of mass for each nucleotide
using the preceding nucleotide mass values (this requires that you have also computed the total mass of the sequence). If you've
written code to map between nucleotide letters and array indexes, it may also help you to look up mass values in an array such as the
following (should be defined as a class constant):
double[] masses = {135.128, 111.103, 151.128, 125.107};
You may store your mass percentages already rounded to one digit past the decimal or you can round when printing the mass
percentages array using printf. If you choose to store the percentages pre-rounded, use Math.round as follows:
double num = 1.6666667;
double rounded = Math.round(num * 10.0) / 10.0;
System.out.print("the answer is " + rounded); // the answer is 1.7
Warning: do not round the total mass of the sequence prior to computing the mass percentages, otherwise your percentages may be
off.
Remember that the "junk" dashes do contribute mass to the total. For other parts of your program you may want to remove dashes
from the input; consider using the replaceAll method on the nucleotide string to eliminate these characters.

After computing mass percentages, you must break apart the sequence into codons and examine each codon. You may wish to review
the methods of String objects as presented in Chapters 3 and 4, such as substring, charAt, indexOf, replaceAll,
toUpperCase, and toLowerCase.
We also suggest that you first get your program working correctly printing its output to the console before you save the output to a
file. Once you have your program printing correct output to the console, save the output to a file by using a PrintStream as
described in Section 6.4 of the textbook.
You may assume that the input file exists, is readable, and contains valid input. (In other words, you are not required to re-prompt for
input or output file names.) You may assume that each sequence's number of nucleotides (without dashes) will be a multiple of 3,
although the nucleotides on a line might be in either uppercase or lowercase or a combination. A sequence (without dashes) will never
be empty. Your program should overwrite any existing data in the output file (this is the default PrintStream behavior).

Style Guidelines:
For this assignment you are required to have the following four class constants:

one for the minimum number of codons a valid protein must have, as an integer (default of 5)
a second for the percentage of mass from C and G in order for a protein to be valid, as an integer (default of 25)
a third for the number of unique nucleotides (4, representing A, C, G, and T)
a fourth for the number of nucleotides per codon (3)

For full credit it should be possible to change the first two constant values (minimum codons and minimum mass percentage) and
cause your program to change its behavior for evaluating protein validity. The other two constants won't ever be changed but are still
useful to make your program more readable. Refer to these constants in your code and do not refer to the bare number such as 4 or 3
directly. You may use additional constants if they make your code clearer.
We will grade your method structure strictly on this assignment. Use at least four nontrivial methods besides main. These methods
should use parameters and returns, including arrays, as appropriate. The methods should be well-structured and avoid redundancy. No
one method should do too large a share of the overall task. The textbook's case study at the end of Chapter 7 is a good example of a
larger program with methods that pass arrays as parameters.
In particular, we require that you have the following particular method in your program:

A method to print all file output for a given potential protein (nucleotides, counts, %, is it a protein, etc.)

In other words, all output to the file should be done through one method called on each nucleotide sequence from the input. Your other
methods should do the computations to gather information to be passed to this output method. That is, you should have various
methods to create/gather all the necessary information, after which you pass the information to a single method to generate all the
output.
Your main method should be a concise summary of the overall program. It is okay for main to contain some code such as println
statements. But main should not perform too large a share of the overall work itself, such as examining each character of an input
line. Also avoid "chaining," when many methods call each other without ever returning to main. For reference, our solution is around
130 lines long (not counting blank lines) and has 8 significant methods besides main, though you don't need to match this (we also
wrote several insignificant methods, containing just one or two lines of code, to enhance overall readability of the code).
We will also check strictly for redundancy on this assignment. If you have a very similar piece of code that is repeated several times in
your program, eliminate the redundancy such as by creating a method, by using for loops over the elements of arrays, and/or by
factoring if/else code as described in section 4.3 of the textbook.
Since arrays are a key component of this assignment, part of your grade comes from using arrays properly. For example, you should
reduce redundancy as appropriate by using traversals over arrays (for loops over the array's elements). This is preferable to writing
out a separate statement for each array element (a statement for element [0], then another for [1], then for [2], etc.). Also carefully
consider how arrays should be passed as parameters and/or returned from methods as you are decomposing your program. Recall that
arrays use reference semantics when passed as parameters, meaning that an array passed to a method can be modified by that method
and the changes will be seen by the caller.

You are limited to features in Chapters 1 through 7. Follow past style guidelines such as indentation, names, variables, types, line
lengths, and comments (at the beginning of your program, on each method, and on complex sections of code).

Additional Input Files (Optional):


If you would like to generate additional input files to test your program, you can create them from actual NCBI genetic data. The
following web site has many data files that contain complete genomes for bacterial organisms:
ftp://ftp.ncbi.nih.gov/genomes/Bacteria/
The site contains many directories with names of organisms. After entering a directory, you can find and save a genome file (a file
whose name ends with .fna) and a protein table (a file whose name ends with .ptt). On the assignment page in Oak we will provide you
with a program to convert these .fna and .ptt files into input files suitable for your homework.

5. Additional requirements
A. You must start your program with header comments that provide your name, VUnetID, email address, the date the program
was last modified, an honor statement (I have neither given nor received unauthorized help on this assignment), and a short
description of the program (see the examples distributed with homework #2).
B. Each method that you write (except main), should be preceded by a block of Javadoc comments which describe what the
method does, what the parameters are, and what it returns. Any required preconditions should also be clearly stated.
C. Use static methods to break the problem into logical parts. None of your methods should be more than 25 lines long,
preferably shorter (most of our methods are 12 lines or less). Lines that are blank, or contain only comments or a single curly
brace do not count.
D. You should use a consistent programming style. This should include the following.
a. Meaningful variable & method names
b. Consistent indenting
c. Use of "white-space" and blank lines to make the code more readable
d. Use of comments to explain pieces of tricky code
e. Lines that do not extend beyond column 100 (or column 80 is even better)
See the code examples in the class text for a good formatting style.

6. Submission for grading


Once you have completed the exercise, submit the file DNA.java for grading by visiting the homework #13 page in Oak.

7. Grading
This lab is worth 30 points. Your grade will be based on whether your solution is correct or not, and on how closely you followed the
directions above. Remember that programming style will now be a larger part of your grade.

You might also like