Advances in Microbiology, 2012, 2, 317-326

http://dx.doi.org/10.4236/aim.2012.23038 Published Online September 2012 (http://www.SciRP.org/journal/aim)

Molecular Profiling of Drug Resistant Isolates of

Mycobacterium tuberculosis in North India
Dinesh K. Tripathi1*, Kanchan Srivastava2*, Surya Kant2, Kishore K. Srivastava1#
1
Department of Microbiology, Central Drug Research Institute, Lucknow, India
Department of Pulmonary Medicine, Chhatrapati Shahuji Maharaj Medical University, Lucknow, India
Email: #[email protected]

Received May 9, 2012; revised June 7, 2012; accepted June 18, 2012

ABSTRACT
Multidrug-resistant tuberculosis (MDR-TB) is a major public health problem because treatment is complicated, cure
rates are well below those for drug susceptible tuberculosis (TB), and patients may remain infectious for months or
years despite receiving the best available therapy. To gain a better understanding of MDR-TB, we characterized isolates
recovered from 69 patients with MDR-TB, by use of IS6110 restriction fragment-length polymorphism (RFLP) analysis;
spacer oligonucleotide genotyping (i.e. spoligotyping). Clinical isolates from patients with tuberculosis have been considered to contain clonally expanded Mycobacterium tuberculosis (MTB) strain. Over the years, the identification
method based on IS6110 insertion sequences has been established as the standard for typing strains of MTB. IS6110
RFLP fingerprinting is very convincing when it is applied to classify MTB isolates harboring a large number of IS6110
in their chromosomes. Therefore, in the present study we have characterized the isolates from the patients suffering
from MDR TB, on the basis of conserved Variable Number Tandem Repeats (VNTR), Direct Repeats (DR) and Insertion Sequences (IS) IS6110 elements. The polymorphic data showed significant level of dissimilarities among all the
MDR isolates of MTB. Comparative studies with the DR and VNTR data substantiate that polymorphism occur among
MDR-TB cases as shown by the number of repeats present in different clinical isolates.
Keywords: Mycobacterium; Drug Resistance; IS6110; Polymorphism

1. Introduction
Although Tuberculosis (TB) is a preventable and treatable disease, it remains one of the leading infectious diseases worldwide. As a result of inadequate treatment, the
proportion of patients with MDR-TB is constantly increasing, and the extensively drug resistant TB (XDR-TB)
has become a new global threat. One important advance
in the field of tuberculosis research has been the development of molecular techniques that allow the identification and tracking of individual strains of MTB. This new
discipline, the molecular epidemiology of tuberculosis,
began with the identification of IS6110, a novel mycobacterial insertion sequence which formed the basis of a
reproducible genotyping technique for MTB [1].
The spread of MDR-TB, due to emergence of MTB
isolates has increased worldwide and reached epidemic
proportion in many countries [2-4]. MDR-TB, which is
caused by MTB, isolates that are resistant to, at least,
Rifampicin (RIF) and Isoniazid (INH), is a serious public
health hazard [5,6]. Treating MDR-TB can be difficult
because loss of use of the 2 most potent anti-TB drugs
*

Authors have equally contributed.

Corresponding author.

Copyright 2012 SciRes.

(i.e., INH and RIF) means that only less MDR-TB can be
cured by short-course chemotherapy [7-11], for other
patients, bacillary growth is merely suppressed as long as
treatment is continued [9,11]. Furthermore, 8% - 35% of
patients with MDR-TB have persistently active disease
that is refractory to multidrug therapy [12-16]. Consequently, in most studies, the cure rates for MDR-TB remain well below those for drug-susceptible TB, and
mortality rates may be substantial, even among HIVnegative patients [12]. In addition, patients with MDR-TB
those do not respond to treatment are a constant source of
transmission of multidrug-resistant MTB [17-20]. In contrast to most bacteria, for MTB acquisition of drug resistance does not occur as a result of horizontal transfer of
resistance-bearing genetic elements. Rather, acquisition
of drug resistance by MTB results from mutations (caused
by nucleotide substitutions, insertions, or deletions) in
specific resistance-determining regions of the genetic
targets (or their promoters) or activating enzymes of
anti-TB chemotherapeutic agents [21]. Inadequate therapy or sub therapeutic drug level may provide a selective
growth advantage and, thus, may favor the growth of a
resistant phenotype that can ultimately predominate in
AiM

318

persons in whom the disease was originally caused by

drug susceptible isolates [5]. Moreover, in patients with
MDR-TB, selection for additional mutations may be accomplished by adding a single drug to a failing regimen
[20]. In the human lung, selection of drug-resistance mutations in MTB occurs predominantly within lung cavities for which high bacterial loads, active mycobacterial
replication, and reduced exposure to host defense mechanisms have been reported [20-22]. Because MTB in sputum samples obtained from patients originates from lung
cavities, molecular analysis of serially recovered sputum
isolates allowed us to study aspects of the genetic evolution of drug resistance in the human host.
RIF and INH are two crucial bactericidal drugs helps
in clearing nearly 80% MTB cells primarily in the cavities. Other drugs, Ethambutol (EMB) and Pyrazinamide
(PYZ) are supporting drugs during the initial phase [23,
24]. Therefore, immediate identification of these resistant
isolates is very important for adjustments in treatment
[25-27]. RIF were introduced in1972 as an anti TB drug
and has excellent sterilizing activity. It acts by binding to
the -subunit of RNA polymerase (rpoB) [28], the enzyme responsible for transcription and expression of
mycobacterial genes, resulting in inhibition of the bacterial transcription activity and thereby killing the organism. Mutations in the 81-bp core region of rpoB were
reported to be responsible for resistance in at least 95%
of the isolates [27,29,30]. This region is located between
codons 507 to 533 with the most common changes in
codons Ser531.eu, His526Tyr and Asp16 Val [30,31].
The INH enters the bacterial cell as prodrug it is activated to a toxic substance in the cell by a catalase peroxides encoded by a katG gene [32] and subsequently affects intracellular targets such as mycolic acid biosynthesis, an important component of the cell wall, which
eventually results in loss of cellular integrity and the
bacterial death.
Genetic and biochemical studies have shown that resistance to EMB is mediated by mutations in the embB
gene, which encodes arabinisyl transferase, an integral
membrane protein that is inhibited by the drug. Various
studies have identified five mutations in codon 306 ATG
of the embB gene that alter its first or third base ATG to
GTG CTG/ATA ATC or to ATT, resulting in three different amino acid substitutions (Met to Val, Leu or Ile) in
the EMB resistant isolates. These five mutations are associated with 70% - 90% of all embB resistant isolates
[11,33,34]. The early and rapid detection of multidrug
resistance is essential for efficient treatment and control
of MTB. The culture based methods for detection of
MTB infection and drug susceptibility testing usually
take more than a month, due to the slow growth of this
bacterium. The use of molecular methods for the identification of mutations in the genes may offers means for
Copyright 2012 SciRes.

ET AL.

D. K. TRIPATHI

rapid screening of the drug resistance among the MTB

isolates and initiation of early treatment [27,28,30].
In the above context, we in the present study have
typed the drug resistant isolates on the basis of DR and
VNTR and compared those with the standard IS6110.

2. Materials and Methods

2.1. Collection of MTB Isolates
Three consecutive morning sputum samples from each
patient were collected in properly labeled screw cap disposable plastic bottles after oral gurgling with normal
water. Sputum samples were processed and stained for
Acid Fast Bacilli (AFB). One sputum sample from each
smear positive patient was processed, inoculated on
Lowenstein Jensen (LJ) slants and incubated in automated culture system at 37C for six weeks (Table 1).
The preliminary identification of mycobacterium isolates depends on their growth on LJ slants. Specific identification is accomplished by the performance of ZiehlNeelsen (Z-N) stain and battery of biochemical tests. The
positive cultures include growth in LJ medium after decontamination of sputum samples and incubation at 37C
for 4 - 6 weeks.
MTB isolates recovered from 69 HIV-negative, and
smear positive cases of both sexes, age varied from 18 to
62 years with MDR-TB that was refractory to chemotherapy given for >12 months. All subjects were selected
from Department of Pulmonary Medicine, CSM Medical
University, Lucknow and residents from the peripheral
region of Uttar Pradesh attending OPD of CSMMU, UP.
Drug susceptibility was tested every 2 - 3 months. For all
patients, treatment regimens were adjusted on the basis
of the results of these evaluations, at month intervals. We
performed a detailed microbiological analysis of MTB
isolates recovered from these patients. History relevant to
tuberculosis such as time and duration, AFB load, outcome of Patients was recorded in predesigned data sheet
(Table 2).

2.2. Drug susceptibility Testing (DST)

The phenotypic resistance of all isolates was determined
at baseline. Resistance to RIF and INH was in LJ medium that contained 2 g/ml RIF or 0.1 g /ml. INH.
Table 1. Results of culture of smear (AFB) positive sputum
specimen (n = 69).
S. No. Results of Culture

Number

Percentage (%)

Growth of Mycobacteria

69

87.34

Contamination

03

03.94

No growth of Mycobacteria

04

05.06

Total

76

100

AiM

ET AL.

D. K. TRIPATHI

319

Table 2. Profile of selected tuberculosis (TB) patients.

S. No.

Age Range (in Years)

Total M/Fa Ratio

Duration of Treatment
(in Months) Mean

Patients Outcome Status

Alive/Deceasedc

Sputum AFB Loadb

19 - 30

12

8/4

18 - 55 (36.5)

1.0 - 2.5

10/2

31 - 40

13 11/2

21 - 82 (51.5)

2.0 - 2.5

08/5

41 - 50

26 24/2

20 - 54 (37.0)

2.0 - 2.5

19/7

51 - 62

18 15/3

06 - 14 (10.0)

2.5 - 3.0

11/07

Note: aMale/Female: (M/F); bSputum smears were recorded as having 1 - 4, 4 - 40, or 140 bacilli/high power fields, and they were given a score of 1, 2, or 3;
c
During the study.

Other anti tuberculosis agents were also determined on

LJ medium that contained critical concentration of 7.5
g/ml EMB, 10 g/ ml Streptomycin(SM), 5 g/ml,
Kanamycin (KM), 2 g/ml Ofloxacin (Ofx), 10 g/ ml
Ethionamide (ETO). Phenotypic susceptibility testing for
PZA was not performed. All inoculated LJ drug and control media were incubated at 37C for 3 weeks. The media were examined at 48 h then weekly. The reading for
drug susceptibility were taken at 3 weeks after that drug
deterioration and the growth on control and drug containing media were recorded according to Kent and
Kubica [35]. Drug resistance was expressed in proportion
method, where a strain is considered to be drug resistant
if the number of colonies that grow on a drug containing
media is 1 % or more of colonies that grow on a drug
free media. The control media must show good growth at
least 50 to 150 colonies MTB H37Rv strain has been
used as a control strain (Tables 3 and 4).

Table 3. Drug resistance and susceptibility profile for 177

patients.
Name of drugs

No. of sensitive
strains (%)

No. of resistant
strains (%)

Isoniazid (INH)

110 (62.14)

67 (37.85)

Rifampicin (RIF)

101 (57.06)

76 (42.93)

Streptomycin (SM)

155 (87.57)

22 (12.42)

Ethambutol (EMB)

163 (92.09)

14 (07.90)

Pyrazinamide (PZA)

Not done

--

Ethionamide (ETO)

All (100)

Nil

Kanamycin (KM)

174 (98.0)

03 (1.69)

Capriomycin (CM)

173 (97.74)

04 (2.26)

Amikacin (AM)

All

Nil

2.3. DNA Isolation

Ofloxacin (Ofx)

All

Nil

The mycobacteria were cultured in LJ medium for 3

weeks. The cells were harvested, and chromosomal DNA
was extracted by an enzymatic lysis method [36,37]. The
bacteria were pelleted by centrifugation and resuspended
in a 10 mM Tris-HCl-1 mM EDTA buffer (pH 8.0) [36].
Cell walls were digested with Lysozyme (10 mg/ml),
Proteinase K (10 mg/ml), and 10% SDS. DNA was extracted using 0.3 M cetyltrimethylammonium bromide
(CTAB) and 5M NaCl, purified by Phenol chloroform
extraction. DNA was precipitated by adding 1 volume of
isopropanol to the aqueous supernatant. After 30 min
incubation at 20C the mixture was centrifuged for 15
min. at 10,000 g, the pellet was washed once with 70%
ethanol, air-dried and finally suspended in Mili Q water
[38].

Cycloserine (CS)

All

Nil

p-amino salicylic acid (PAS)

None

--

Sensitive to all drugs

None*

--

--

All Total-177

Resistance to any drugs

*

MDR: Multi-drug resistant: Resistance to both Isoniazid and Rifampicin

with or without Resistance to other drug.

Table 4. Multidrug resistance pattern of clinical isolates to

anti tuberculosis drugs.
S. No.

No. of
drugs

2 Drugs

Name of drug
*

2.4. PCR Amplification

The primers (Table 5) were used to amplify the flanking
regions of the VNTR, DR and IS6110 insertion sequence
[38]. PCR was performed using an automated gradient
thermal cycler (Bio-Rad) and all reaction buffers contained 10 mM Tris/HC1 (pH 8.3), 50 mM KC1, 1 - 5 mM
Copyright 2012 SciRes.

3 Drugs

RIF + INH

30 (43.47)

RIF + SM

21 (30.43)

RIF + EMB

05 (07.24)

RIF + INH + SM

07 (10.14)

04 (05.79)

15.93:06.21

02 (02.89)

02.89:01.12

RIF + INH + SM

No. of resistant Total (%)

strains
69:177

4 Drugs *RIF + INH + EMB + SM

81.15:31.63

Rifampicin (RIF); Isoniazid (INH); Streptomycin (SM); Ethambutol (EMB).

AiM

D. K. TRIPATHI

320

Table 5. PCR primers used for gene amplification.

ET AL.

3. Results

S. No.

Primer

Sequence

3.1. Patients

DR0272

F-5AGCGATCCTGCTGGTGG3
R-3TGCTGTTAGGGTCAAACG5

DR0642

F-5CCACTAGCAGATGGCCGTT3
R-3GCTCCAAGCGTAGTGATCCT5

DR2068

F-5CACGACGTAGACGAATGC3
R-3ATGACACGCTTTCTGCCC5

DR3074

F-5GTCACGATTGACACGCGGT3
R-3CATGGCCTCCGTTGTACTC5

DR3319

F-5TGGTAGGTCTGGTTCCGC3
R-3ATGTGCATCCTCAACGGG5

DR3991

F-5CCAACCTAGGCGTGTTCG3
R-3GATGTTCACCCCGAATGG5

DR4110

F-5TTTAGACGATCGCACCGC3
R-3AACGGAATCGTGGTCAGC5

VNTR4052

F-5GAGCCAAATCAGGTCCGG3
R-3GAGGTATCAACGGGCTTGT5

VNTR4120

F-5GTTCACCGGAGCCAACC3
R-3GAGGTGGTTTCGTGGTCG5

10

VNTR4156

F-5ACCGCAAGGCTGATGATCC3
R-3GTGCATCTCGTCGACTTCC5

11

VNTR4348

F-5ACAAGGAGAGCGGTGTCG3
R-3CATCCTGTAGATGGCGGC5

12

IS6110

F-5CCTGCGAGCGTAGGCGTCGG3
R-3CTCGTCCAGCGCCGCTTCGG5

A total of 177 sputum smear positive pulmonary tuberculosis patients were studied. Out of 177, 76 RIF resistant cases were selected. Among 76 cases 58 were male
and remaining 18 were female (76.31% and 23.68%). All
of them were in the age group of 19 - 62 years (Table 2).
Of the 76 cases, 60 (78.94%) were in low income group
and only 16 (21.05%) from middle-income group. Majority, of the patients came from urban area. Of these 76
smear positive cases, culture for Mycobacteria were
positive in 69 (87.34%) cases, contamination in 3 (3.97%)
and no growth of Mycobacteria in 4 (5.06%) cases (Table 1). Some of the patients were mono drug resistant
initially but they converted into MDR cases. Study was
carried out on 69 RIF resistant and other drugs resistant
cases.
During the study period, sixty nine patients previously
had TB; none of the patients had extra pulmonary TB
and Diabetes mellitus. Most patients excreted large numbers of bacilli in sputum (median score, 2.0) (Table 2),
some patients died during the study, most likely as a result of cachexia and/or chronic respiratory failure. Patients who died had more extensive disease compared
with patients who survived. At the time that TB was
originally diagnosed, all patients were treated with World
Health Organization category I therapy (i.e., treatment
with INH, RIF, PZA and EMB for 2 months, followed by
treatment with either INH and RIF or INH, RIF, and
PZA for an additional 4 months) for varying lengths of
time [36]. Once MDR-TB was diagnosed, the patients
were switched to treatment regimens tailored to the phenotypic drug-susceptibility profile of their isolates. At
entry to the study, therapy was again adjusted according
to phenotypic drug susceptibility, treatment history, and
the side effect profile.

MgCl2, 0.2 mM of each dNTP (Fermentas, USA), 2 - 5

units Taq polymerase (Fermentas, USA), l M of each
primer, and 100 ng template DNA in a final volume of
100 l. The amplification profile consisted of a denaturation step at 95C for five minutes, followed by 30 cycles
with denaturation at 95C for one minute, primer annealing at 65C, 67C and 55C for one minute, and extension at 72C for one minute. The PCR products were
electrophoresed through 1.5% - 2% agarose gels and
stained with ethidium bromide. Visualization was done
on a UV light illuminator (Chemidoc) the copy number
of the amplified products was inferred from the difference between the molecular weights of the amplified
products of the samples and those of the H37Rv strain.
To estimate the length of the amplified products were
used to compare with standard molecular weight markers
(Fermentas, USA).
In the present study we have characterized 69 isolates
from the patients suffering from MDR TB, on the basis
of conserved VNTR, DR and IS6110 elements. The sets
of DNA primers (VNTR = #4, DR = #7 and IS6110 = #1)
were designed from the MTB genome and were used to
amplify the genomic DNAs of isolates. Sequences of
primers listed below were used for VNTR, DR, and IS
elements. The position of each locus is reported earlier
[39-41].
Copyright 2012 SciRes.

3.2. Phenotypic and Genotypic Resistance Profile

of M. tuberculosis
All 69 isolates displayed phenotypic resistance to RIF
and taken together the isolates from all 69 patients were
highly resistant to many of the most potent first and second line agents. Identification tests for Mycobacterium
isolates were done in accordance with the standard procedures. Tables 3 and 4 show the sensitivity and resistance pattern of 69 strains of MTB to 4 anti tuberculosis
drugs. All strains were resistant to one or more drugs.
Highest mono drug resistance (42.93%) was found in
RIF either alone or in combination with other drugs
[43.47%]. Our study identified 30 isolates were resistant
to both INH and RIF; the other 39 isolates were resistant
to all the three and four drugs tested (Tables 3 and 4).
AiM

D. K. TRIPATHI

Genotypic results are adding power to this approach

that based on the detection of DNA polymorphism within
the DR cluster and VNTR- PCR are gold standard techniques for strain typing (Table 5) and for the study of the
global molecular epidemiology of MTB (Tables 6 and 7).
These tools provide information like latent infection,
Strain-specific patterns, and drug resistance in various
isolates. The Polymorphic data showed significant level
of dissimilarities among all the MDR isolates of MTB.
Out of 69 patients, a number of VNTRs were detected,
without showing any standard profile. The polymorphism
of each tandem repeat locus was found to be different;
they had moderate or high allelic diversity which are
useful for the differentiation of MTB strains. Molecular
genotyping based on VNTR-PCR analyses has several
advantages over standard IS6110 RFLP and other typing
methods. Five types of DRs were amplified with each
other of the primer sets used. When compared the DR
and VNTR data, we could only observe that polymor-

ET AL.

321

phism occur among clinical isolates of MDR-TB and

there are number of fingerprints present (Figures 1 and 2,
Table 7).

4. Discussion
In 1993, the National Tuberculosis Program (NTP) in
India was strengthened in the form of Revised National
Tuberculosis Control Program (RNTCP). Like HIVAIDS, threat perception due to occurrence of multidrug
resistance has assumed considerable gravity in constructing the epidemic situation analysis and appropriate
intervention. In this study drug resistance of MTB to at
least one drug were found in all selected cases. This
situation is highly alarming. Resistances (37.85%) were
found in INH which is the most popular drug, followed
by RIF (42.9%) cases. Resistances to SM were found in
12.42% cases and to EMB 7.90% cases [42-44]. The
efficiency of current tuberculosis control program in any

Table 6. Grouping of clinical isolates on the basis of IS6110.

Groups

No. of Patient Samples in Which IS6110 Positive

No. of Patients Samples in Which IS6110 Negative

1, 2, 9, 10, 17, 19, 23, 34

3, 4, 20, 21, 22

5, 11, 13, 14, 15, 16, 18, 24, 25, 26, 27, 28 to33, 35, 38 to 46, 48 to 63, 65 to
71

8, 36, 37, 47, 64

Table 7. Polymorphism in pulmonary isolates with various DRs and VNTRs.

S. No.

Primers Name (DR/VNTR)

Polymorphism Shows in Patients Samples

Direct Repeats (DR) Band Size of Primers

1

DR0272 305 kb

3 - 8, 18 - 22

DR0642 231 kb

1 - 6, All bands are of same size.

DR2068 336 kb

6 - 12, All bands are of same size.

DR3074 172 kb

6 - 12, All bands are of same size.

DR3319 574 kb

2 - 8, 2 - 5, 7 - 9.

DR3991 534 kb

2 - 9, All bands are of same size.

DR4110 531 kb

18 - 24

Variable Number Tandem Repeats (VNTR)

8

VNTR4052 879 kb

4 - 10

VNTR4120 447 kb

5 - 11

10

VNTR4156 704 kb

6 - 12

11

VNTR4348 516 kb

7 - 14

Copyright 2012 SciRes.

AiM

D. K. TRIPATHI

322

ET AL.

Figure 1. Primer IS6110, M-DNA ladder, lane 1-70-clinical isolates ctrl-control.

Figure 2. Polymorphism in clinical isolates with various primers; A-P1 [DR0272]; B-P2 [DR0642]; C-P3 [DR2068]; D-P4
[DR3074]; E-P5 [DR3319]; F-P6 [DR3991]; G-P7 [DR4110]; H-P8 [VNTR4052]; I-P9 [VNTR4120]; J-P10 [VNTR4156];
K-P11 [VNTR4348].

country is assayed by drug resistant pattern [45-47].

ICDDRB, Dhaka reported resistance to any drug was
48.4%, resistance to INH, RMP, SM and EMB was
17.4%, 7.4%, 45.3% and 9.9% respectively [48]. Lina et
al. [49] reported drug resistance to INH, RMP, SM, EMB
Copyright 2012 SciRes.

and MDR-TB was 30.41%, 58.55%, 46.95%, 3.67% and

25.25% respectively. A similar study from Haryana, India shows MDR-TB of the same order (24%). In a recent
review of the Indian situation [2] from the TRC, Chennai
has concluded that the magnitude of the drug resistance
AiM

D. K. TRIPATHI

problem is principally due to acquired resistance (replaced in recent times by the term drug resistance among
previously treated cases). In New Delhi, a similar extent
of acquired drug resistance was reported. Institute of
Thoracic medicine in Chennai had shown acquired resistance of about 63% among patients from District Tuberculosis Centers of Tamil Nadu. Resistance to INH and
RIF (MDR TB) was of the order of 20.3%. It was considered 53% that initial drug resistance in India (freshly
defined as, drug resistance among new cases) could be at
a lower order than similarly placed countries globally, as
distinct from the acquired drug resistance situation given
above. There could be 5% - 10% resistance to INH, [20,
29,50,51]. This could be reflecting the primary drug resistance problem in the Indian context [2,52-54].
In this study 69 isolates resistant to two or more of the
tested drug was identified. This is comparable to what
has been reported in the neighboring countries, with resistance to INH and RIF being more common than resistance to EMB. The simultaneous resistance to INH and
EMB that was detected in (3%) of the isolates is in
agreement with previous reports [9,15,51], and the simultaneous resistance to RIF and EMB detected in
(7.24%) of the isolates is consistent with a previous study
[7-9]. Resistance to RIF is increasing because of widespread application that results in selection of resistant
mutants, and is seen in cases noncompliant with TB
treatment [51,52]. In this context, resistance to RIF can
be assumed to be a surrogate marker for MDR-TB [11,
48]. Phenotypic susceptibility testing for PZA was not
performed, because the results of this test can be difficult
to reproduce and may not correlate well with drug susceptibility in vivo [12,13].
In conclusion, our results of MDR-TB underline the
importance of strengthening classical case finding and
treatment of smear-positive patients according to the ongoing DOTS program. The introduction of the rapid,
specific and technically affordable molecular techniques
can be used and interpreted in conjunction with conventional methods to detect more active cases of MDR-TB
cases. The Polymerase Chain Reaction (PCR) appears to
be a simple and accurate method that allows genotyping
to be undertaken more quickly and in a less costly manner. It is applicable for direct detection in stained sputum
smear preparations, which help in reducing the time
needed for bacterial growth, and should facilitate the
adequate choice of anti tuberculosis therapy [1,14,40,]
that limits the extent and severity of MDR-TB transmission and infection.
INH and RIFs resistance in MTB complex (MTC)
isolates are mainly based on mutations in a limited number of genes. However, mutation frequencies vary in different mycobacterial populations. In this work, we analyzed the distribution of resistance-associated mutations
Copyright 2012 SciRes.

ET AL.

323

in MTB. The application of DNA fingerprinting can provide valuable insights into the pathogenesis of tuberculosis and may help in identifying strains of MTB with specific properties such as virulence and failure of drug response. Most of the epidemiological applications of
RFLP analysis have used an insertion sequence known as
IS6110 [39,52-55]. It was initially described by Thierry
et al. [56] and has been shown to be distributed throughout the MTB complex.
Spoligotyping, in addition to IS6110 RFLP, can be
useful in determining more distant relationships among
isolates. In our current study, the relative instability of
IS6110 RFLP was found in one of two MDR outbreak
strains; however, not fewer than four of nine of the
IS6110 RFLP patterns showed a minor and different alteration. Therefore, the transposition rate may be strongly
related to the M. tuberculosis genotype represented.
DNA fingerprinting of MTB has been shown to be a
powerful epidemiologic tool because it exploits variability in both the no. and genomic position of insertion sequences and tandem repeats to generate strain specific
patterns [2,54,56].
The integration of VNTR-typing with conventional
approaches has the potential to be a powerful new technology, which provides a robust and high resolution tool
for the molecular epidemiology of the MTB complex.
The direct repeat (DR) locus is the characteristic of the
MTB complex. The DR locus consists of multiple tandem 36-bp repeats interspersed with variable spacers of
about equal size. Polymorphism of the DR locus (absence or presence of single Direct variant repeat DVR),
has been exploited widely for distinguishing among
clinical isolates of the MTB by using spacer oligonucleotide typing., In the present study we have used all the
three control group of genes and tried to demonstrate the
differences among clinical isolates of MDR TB Isolates.
In the present study, polymorphic data showed significant level of dissimilarities among all the MDR isolates
of MTB. Out of 69 patients, a number of VNTRs were
detected, without showing any standard profile. Similarly
two types of DRs were amplified with each of the primer
sets used (Table 5). When we compared the DR and
VNTR data we could only claim that polymorphism occur among clinical isolates of MDR-TB and since there
are number of fingerprints present [53-55].
Over the past decade, much has been learned of the
drug targets and mechanisms of resistance to first-line
and several second-lines anti tuberculosis agents (Table
4) [42,43,53,54]. As mentioned above, MTB generally
acquires drug resistance via de novo nsSNP, small deletions, or insertions in specific chromosomal loci, unlike
most other pathogenic bacteria, which often acquire drug
resistance via horizontal transfer. This attribute of MTB
drug resistance, coupled with fast and efficient DNA
AiM

D. K. TRIPATHI

324

sequencing methods, makes studying drug resistance

highly amenable for molecular epidemiologic investigations [41,46,47,54,57]. Molecular epidemiologic studies
on drug resistance have generally sought to examine the
nature (e.g., genotype-specific mutations, association of
specific mutations with phenotypic resistance) and extent
(e.g., prevalence of specific mutations in a population) of
drug resistance and patient risk factors (e.g., HIV) for
acquiring resistance. The report by Bifani et al. [57,58]
provides an example of a study of the nature and evolution of drug resistance during a clonal MDR-TB outbreak.

ET AL.

[5]

I. Mokrousov, O. Narvskaya, E. Limeschenko, T. Otten

and B. Vyshnevskiy, Detection of Ethambutol Resistant
M. tuberculosis Isolates by Multiplex Allele Specific PCR
Assay Targeting embB 306 Mutations, Journal of Clinical Microbiology, Vol. 40, No. 5, 2002, pp. 1617-1620.
doi:10.1128/JCM.40.5.1617-1620.2002

[6]

I. Mokrousov, T. Otten and M. Filipenko, Detection of

Isoniazid Resistant M. tuberculosis Isolates by Multiplex
Allele Specific PCR Assay Targeting katG Codons 351
Variation, Journal of Clinical Microbiology, Vol. 40, No.
7, 2002, pp. 2509-2512.
doi:10.1128/JCM.40.7.2509-2512.2002

[7]

A. Van Rie, A. Warren and R. I. Mshanga, Analysis for a

Limited Number of Gene Codons Can Predict Drug Resistance of M. tuberculosis in a High-Incidence Community, Journal of Clinical Microbiology, Vol. 39, No. 2,
2001, pp. 636-641. doi:10.1128/JCM.39.2.636-641.2001

[8]

L. M. Parsons, M. Salfinger and A. Coleridge, Phenotypic

and Molecular Characterization of M. tuberculosis Isolates
to both Isoniazid and Ethambutol, Antimicrobial Agents
and Chemotherapy, Vol. 49, No. 6, 2005, pp. 2218-2225.
doi:10.1128/AAC.49.6.2218-2225.2005

[9]

Z. Yang, R. Durmaz and D. Yang, Simultaneous Detection of Isoniazid, Rifampicin, and Ethambutol by a Single
Multiplex Allele Specific Polymerase Chain Reaction
(PCR) Assay, Diagnostic Microbiology & Infectious Disease, Vol. 53, No. 3, 2005, pp. 201-208.
doi:10.1016/j.diagmicrobio.2005.06.007

5. Conclusions
MTB is an obligate pathogen that does not naturally replicate outside of its host environment. As such, MTC
members are believed to have coevolved with hominids
for millions of years. Consequently, it is very possible
that, unlike other opportunistic pathogens, viable tubercle
bacilli encode the minimum ensemble of virulence genes
required for successful infection, replication, and dissemination. Thus, the relative success of one clonal MTB
family over another might rely on the relationship between levels of gene expression and environmental factors and the host.
Strain analysis, together with virulence studies, will
help pinpointing isolates associated with higher morbidity and mortality, with the aim of directing efforts to limit
the spread of those strains within the region.

6. Acknowledgements
The work was supported by CSIR-CDRI SIP-0026 and
DST WOS-A LS-24/2008 to KS [WOS-A LS-24/2008].
This is CSIR-CDRI communication #127/2012/KKS.

REFERENCES
[1]

[2]

D. van Soolingen, P. E. W. de Hass, P. W. M. Hermans, P.

M. Groenen and J. D. van Embden, Comparison of Various Repetitive DNA Elements as Genetic Markers for
Strain Differentiation and Epidemiology of M. tuberculosis, Journal of Clinical Microbiology, Vol. 31, No. 8,
1993, pp. 1987-1995.
P. Venkataraman and Paramasivan, Drug Resistance in
Tuberculosis and Issues Related to Multidrug Resistance
in Planning for TB Control in India, The Health Administrator, Special Issue on Tuberculosis, Vol. 15, 2002, pp.
127-136.

[3]

Centers for Disease Control and Prevention (CDC), Extensively Drug-Resistant Tuberculosis-United States,
1993-2006.

[4]

D. A. Mitchison, Drug Resistance in Tuberculosis, European Respiratory Journal, Vol. 25, No. 2, 2005, pp. 376379. doi:10.1183/09031936.05.00075704

Copyright 2012 SciRes.

[10] A. Hristea, D. Otelea, S. Paraschiv, A. Macri, C. Baicus, O.

Moldovan, M. Tinischi, V. Arama and A. Streinu-Cercel,
Detection of M. tuberculosis Resistance Mutations to
Rifampin and Isoniazid by Real-Time PCR, Indian Journal of Medical Microbiology, Vol. 28, No. 3, 2010, pp.
211-216. doi:10.4103/0255-0857.66474
[11] I. Mokrousov, T. Otten, B. Vyshnevskiy and O. Narvskaya,
Allele-Specific rpoB PCR Assays for Detection of Rifampin-Resistant M. tuberculosis in Sputum Smear, Antimicrobial Agents and Chemotherapy, Vol. 47, No. 7,
2003, pp. 2231-2235.
doi:10.1128/AAC.47.7.2231-2235.2003
[12] G. Canetti, W. Fox, A. Khomenko, H. T. Mahler, N. K.
Menon, D. A. Mitchison, N. Rist and N. A. Smelev, Advances in Techniques of Testing Mycobacterial Drug
Sensitivity and the Use of Sensitivity Tests in Tuberculosis
Control Programmes, Bulletin of the World Health Organization, Vol. 41, No. 1, 1969, pp. 21-43.
[13] T. H. Weniger, J. Krawczyk, P. H. Supply, S. Niemann
and D. Harmsen, MIRU-VNTRplus: A Web Tool for
Polyphasic Genotyping of M. tuberculosis Complex Bacteria, Nucleic Acids Research, Vol. 38, Suppl. 2, 2010, pp.
1-6. doi:10.1093/nar/gkq351
[14] R. Johnson, M. E. Streicher, E. G. Louw, R. M. Warren, P.
D. van Helden and T. C. Victor, Drug Resistance in M.
tuberculosis, Current Issues in Molecular Biology, Vol. 8,
No. 2, 2006, pp. 97-112.
[15] B. Madison, B. Robinson-Dunn and I. George, Multicenter Evaluation of Ethambutol Susceptibility Testing of
M. tuberculosis by Agar Proportion 15 and Radiometric
Methods, Journal of Clinical Microbiology, Vol. 40, No.

AiM

D. K. TRIPATHI
11, 2002, pp. 3976-3979.
doi:10.1128/JCM.40.11.3976-3979.2002
[16] H. Rinder, K. T. Mieskes and T. Loscher, Heteroresistance in Mycobacterium tuberculosis, The International
Journal of Tuberculosis and Lung Disease, Vol. 5, No. 4,
2001, pp. 339-345.
[17] V. Nikolayevskyy, Y. Balabanova, T. Simak, N. Malomanova, I. Fedorin and F. Drobniewski, Performance of
the Genotype(R) MTBDR Plus Assay in the Diagnosis of
Tuberculosis and Drug Resistance in Samara, Russian
Federation, BMC Clinical Pathology, Vol. 10, 2009, pp.
2-22. doi:10.1186/1472-6890-9-2
[18] G. C. Baldeviano-Vidalon, N. Quispe-Torres and C.
Bonilla-Asald, Multiple Infection with Resistant and
Sensitive M. tuberculosis Isolates during Treatment of
Pulmonary Tuberculosis Patients, The International Journal of Tuberculosis and Lung Disease, Vol. 9, No. 10,
2005, pp. 1155-1160.
[19] S. A. Watterson, S. M. Wilson, M. D. Yates and F. A.
Drobniewski, Comparison of Three 18 Molecular Assays
for Rapid Detection of Rifampin Resistance in M. tuberculosis, Journal of Clinical Microbiology, Vol. 36, No. 7,
1998, pp. 1969-1973.
[20] C. Dye, S. Scheele, P. Dolin, V. Pathania and M. C.
Raviglione, Global Burden of Tuberculosis: Estimated
Incidence, Prevalence and Mortality by Country, Journal
of the American Medical Association, Vol. 282, No. 7,
1999, pp. 677-686.
[21] WHO, Anti-Tuberculosis Drug Resistance WHO/IUALD
Global Project on Anti-Tuberculosis Drug Resistance Surveillance, Geneva, 1997, WHO/TB/97.229.
[22] C. Dye, Z. Fengzeng, S. Scheele and B. Williams, Evaluating the Impact of Tuberculosis Control: Number of
Deaths Prevented by Short-Course Chemotherapy in
China, International Journal of Epidemiology, Vol. 29,
No. 3, 2000, pp. 558-564. doi:10.1093/ije/29.3.558
[23] WHO, Global Tuberculosis Control Surveillance: Planning, Financing, Geneva, 2009, pp. 1-303.
[24] WHO, Global Tuberculosis Control, Geneva, Switzerland, 2003.
[25] WHO, Anti Tuberculosis Drug Resistance in the World,
Prevalence and Trends, Geneva, Switzerland, 2000.
[26] WHO, Drug-Resistant Isolates of TB Increasing Worldwide, WHO 19, Geneva, 2000.
[27] L. Herrera-Len, T. Molina, P. Saz, J. A. Sez-Nieto and
M. S. Jimenez, New Multiplex PCR for Rapid Detection
of Isoniazid-Resistant M. tuberculosis Clinical Isolates,
Antimicrobial Agents and Chemotherapy, Vol. 49, No. 1,
2005, pp. 144-147.
doi:10.1128/AAC.49.1.144-147.2005
[28] C. Abe, I. Kobayashi and S. Mitarai, Biological and
Molecular Characteristics of M. tuberculosis Clinical Isolates with Low-Level Resistance to Isoniazid in Japan,
Journal of Clinical Microbiology, Vol. 46, No. 7, 2008, pp.
2263-2268. doi:10.1128/JCM.00561-08
[29] S. V. Ramaswamy and J. M. Musser, Molecular Genetic
Basis of Antimicrobial Agent Resistance in M. tuberculosis: 1998 Update, Tubercle and Lung Disease, Vol. 79,
Copyright 2012 SciRes.

ET AL.

325

No. 1, 1998, pp. 3-29. doi:10.1054/tuld.1998.0002

[30] C. Plinke, H. S. Cox, S. Kalon, D. Doshetov. RschGerdes and S. Niemann, Tuberculosis Ethambutol Resistance: Concordance between Phenotypic and Genotypic Test Results, Tuberculosis, Vol. 89, No. 6, 2009,
pp. 448-452. doi:10.1016/j.tube.2009.09.001
[31] J. I. Sekiguchi, T. Miyoshi-Akiyama and E. AugustynowiczKopec, Detection of Multidrug Resistance in Mycobacterium tuberculosis, Journal of Clinical Microbiology,
Vol. 45, No. 1, 2007, pp. 179-192.
doi:10.1128/JCM.00750-06
[32] N. Gonzalez, M. J. Torres, J. Aznar and J. C. Palomares,
Molecular Analysis of Rifampin and Isoniazid Resistance
of M. tuberculosis Clinical Isolates in Seville, Spain,
Tubercle and Lung Disease, Vol. 79, No. 3, 1999, pp.
187-190. doi:10.1054/tuld.1998.0195
[33] J. Wang, R. M. Burger and K. Drlica, Role of Superoxide
in Catalase-Peroxidase-Mediated Isoniazid Action against
Mycobacteria, Antimicrobial Agents and Chemotherapy,
Vol, 42, No. 3, 1998, pp. 709-711.
[34] S. V. Ramaswamy, A. G. Amin, S. Goksel, C. E. Stager, S.
J. Dou and H. L. Sahli, Molecular Genetic Analysis of
Nucleotide Polymorphisms Associated with Ethambutol
Resistance in Human Isolates of M. tuberculosis, Antimicrobial Agents and Chemotherapy, Vol. 44, No. 2, 2000,
pp. 326-336. doi:10.1128/AAC.44.2.326-336.2000
[35] P. T. Kent and G. P. Kubica, Public Health Mycobacteriology: A Guide for the Level III Laboratory. US Department of Health and Drug Resistance Pattern of M. tuberculosis Isolated from Patients Attending a Referral
Hospital Wadud et al. Bangladesh, Journal of Medical
Microbiology, Vol. 17, 2000, pp. 1132-1140
[36] J. P. Hosek, P. Svastova, M. Moravkova, I. Pavlik and M.
Bartos, Methods of Mycobacterial DNA Isolation from
Different Biological Material: A Review, Veterinary Medicine, Vol. 51, No. 5, 2006, pp. 180-192.
[37] E. Mazars, S. Lesjean, A. L. Banuls, M. Gilbert, V. Vincent, B. Gicquel, M. Tibayrenc, C. Locht and P. H. Supply,
High-Resolution Minisatellite-Based Typing as a Portable Approach to Global Analysis of M. tuberculosis
Molecular Epidemiology, Proceedings of the National
Academy of Sciences, Vol. 98, No. 4, 2001, pp. 1901-1906.
doi:10.1073/pnas.98.4.1901
[38] E. B. Hill, L. G. Wayne and M. Gross, Purification of
Mycobacterial Deoxyribonucleic Acid, Journal of Bacteriology, Vol. 112, No. 3, 1972, pp. 1033-1039.
[39] N. Smittipat and P. Palittapongarnpim, Identification of
Possible Loci of Variable Number of Tandem Repeats in
M tuberculosis, Tubercle and Lung Disease, Vol. 80, No.
2, 2000, pp. 69-74. doi:10.1054/tuld.2000.0236
[40] I. J. Wiid, C. Werely, N. Beyers, P. Donald, P. D. van
Helden, Oligonucleotide (GTG)5 as a Marker for M. tuberculosis Strain Identification. Journal of Clinical Microbiology, Vol. 32, No. 5, 1994, pp. 1318-1321.
[41] P. Palittapongampim, S. Chomyc, A. Fanning and D.
Kunimoto, DNA Fragment Length Polymorphism Analysis of M. tuberculosis Isolates by Arbitrarily Primed Polymerase Chain Reaction, The Journal of Infectious
AiM

D. K. TRIPATHI

326
Diseases, Vol. 167, No. 4, 1993, pp. 975-978.
doi:10.1093/infdis/167.4.975

[42] R. C. Chan, M. M. M. Hui, E. W. Chan, et al., Genetic

and Phenotypic Characterization of Drug-Resistant M.
tuberculosis Isolates in Hong Kong, Journal of Antimicrobial Chemotherapy, Vol. 59, No. 5, 2007, pp. 866873.
[43] P. M. Gronen, A. E. Bunschoten, D. Van Soolingen and J.
D. A. van Embden, Nature of DNA Polymorphism in the
Direct Repeat Cluster of M. tuberculosis: Application for
Strain Differentiation by a Novel Typing Method, Molecular Microbiology, Vol. 10, No. 5, 1993 pp. 1057-1065.
doi:10.1111/j.1365-2958.1993.tb00976.x
[44] R. M. Warren, N. C. Gey van Pittius, M. Barnard, A.
Hesseling, E. Engelke, M. de Kock, M. C. Gutierrez, G. K.
Chege, T. C. Victor, E. G. Hoal and P. D. van Helden
Differentiation of M. tuberculosis Complex by PCR
Amplification of Genomic Regions of Difference, The
International Journal of Tuberculosis and Lung Disease,
Vol. 10, No. 7, 2006, pp. 818-822.
[45] WHO, TB Country Profile-Jordan, 2010.
www.who.int/tb/data
[46] H. Van Deutekom, P. H. Supply, P. E. W. Haas, E. Willery, S. P. Hoijng, C. Locht, R. A. Coutinho and D. van
Soolingen, Molecular Typing of M. tuberculosis by Mycobacterial Interspersed Repetitive Unit Variable-Number
Tandem Repeat Analysis, a More Accurate Method for
Identifying Epidemiological Links between Patients with
Tuberculosis, Journal of Clinical Microbiology, Vol. 43,
No. 9, 2005, pp. 4473-4479.
doi:10.1128/JCM.43.9.4473-4479.2005
[47] N. Thorne, A. Underwood, S. Gharbia and C. Arnold,
Evolutionary Clues from Comparative Analysis of M.
tuberculosis Variable-Number Tandem Repeat Sequences
within Genetic Families, Infection, Genetics and Evolution, Vol. 7, No. 2, 2005, pp. 239-246.
doi:10.1016/j.meegid.2006.09.006
[48] ICDDRB, Health and Science Bulletin, Vol. 1, 2002, pp.
6-10.
[49] D. Lina and P. M. Sweta, Drug Resistance in Tuberculosis, Bombey Hospital Journal, 1999.
www.bhj.org/journal/1999.4103.july99/original.253.htm
[50] L. Sandman, N. W. Schluger, A. L. Davidow and S. Bonk,
Risk Factors for Rifampin-Monoresistant Tuberculosis:
A Case-Control Study, American Journal of Respiratory
and Critical Care Medicine, Vol. 159, No. 2, 1999, pp.
468-472.
[51] A. Hristea, D. Otelea, S. Paraschiv, A. Macri, C. Baicus, O.

Copyright 2012 SciRes.

ET AL.
Moldovan, M. Tinischi, V. Arama and A. Streinu-Cercel,
Detection of M. tuberculosis Resistance Mutations to
Rifampin and Isoniazid by Real-Time PCR, Indian Association of Medical Microbiologists, Vol. 28, No. 3, 2010,
pp. 211-216. doi:10.4103/0255-0857.66474

[52] F. A. Post, P. A. Willcox, B. Mathema, L. M. Steyn, K.

Shean, S. V. Ramaswamy, E. A. Graviss, E. Shashkina, B.
N. Kreiswirth and G. Kaplan, Genetic Polymorphism in
M. tuberculosis Isolates from Patients with Chronic Multidrug-Resistant Tuberculosis, The Journal of Infectious
Diseases, Vol. 190, No. 1, 2004, pp. 99-106.
doi:10.1086/421501
[53] D. Van Soolingen, P. W. M. Hermans, P. E. W. de Haas,
D. R. Soll and J. D. van Embden, Occurrence and Stability of Insertion Sequences in Mycobacterium Tuberculosis Complex Strains: Evaluation of an Insertion Sequence-Dependent Polymorphism as a Tool in the Epidemiology of Tuberculosis, Journal of Clinical Microbiology, Vol. 29, No. 11, 1991, pp. 2578-2586.
[54] S. M. M. Roring, D. Brittain, A. E. Bunschoten, M. S.
Hughes, R. A. Skuce, J. D. A. Van Embden and S. D.
Neil, Spacer Oligotyping of Mycobacterium bovis Isolates Compared to Typing by Restriction Fragment Length
Polymorphism Analysis Using PGRS, DR and IS6110,
Veterinary Microbiology, Vol. 61, No. 1-2, 1998, pp. 111120. doi:10.1016/S0378-1135(98)00178-3
[55] K. L. Horan, R. Freeman., K. Weigel, M. Semret, S.
Pfaller, T. C. Covert, D. Van Soolingen, S. C. Leao, M. A.
Behr and G. A. Cangelosi, Novel Genetic Polymorphisms That Further Delineate the Phylogeny of the Mycobacterium tuberculosis Complex, Journal of Bacteriology, Vol. 188, No. 12, 2006, pp. 4271-4287.
[56] D. Thierry, M. D. Cave, K. D. Eisenach, J. T. Crawford, J.
H. Bates and B. Gicquel, IS6110, and IS-like Element of
M. tuberculosis Complex, Nucleic Acids Research, Vol.
18, No. 1, 1990, pp.188-192. doi:10.1093/nar/18.1.188
[57] P. B. Bifani, M. Mathema, S. Campo, B. Moghazeh, E.
Nivin, J. Shashkina, S. S. Driscoll, R. Munsiff, R. Frothingham and B. N. Kreiswirth, Molecular Identification of
Streptomycin Monoresistant M. tuberculosis Related to
Multidrug-Resistant W Strain, Emerging Infectious Diseases, Vol. 7, No. 5, 2001, pp. 842-848.
doi:10.3201/eid0705.010512
[58] P. Miotto, F. Piana, V. Penati, F. Canducci, G. B. Migliri
and D. M. Cirillo, Use of Genotype MTBDR Assay for
Molecular Detection of Rifampicin and Isoniazid Resistance in M. tuberculosis Clinical Isolates Isolated in Italy, Journal of Clinical Microbiology, Vol. 44, No. 7,
2006, pp. 2485-2491. doi:10.1128/JCM.00083-06

AiM