0% found this document useful (0 votes)

667 views

CLC Genomics Workbench User Manual Subset

The document describes various analysis functions available in CLC Genomics Workbench software for high-throughput sequencing data, including importing sequencing data from different platforms, multiplexing, trimming sequences, de novo assembly, mapping reads to a reference genome, detecting SNPs and other variations, ChIP-Seq analysis, RNA-Seq analysis, and more. It provides details on parameters and options for each analysis function.

Uploaded by

adhalalala

Available Formats

Download as PDF, TXT or read online on Scribd

0% found this document useful (0 votes)

667 views

CLC Genomics Workbench User Manual Subset

Uploaded by

adhalalala

Available Formats

Download as PDF, TXT or read online on Scribd

You are on page 1/ 222

an

ua
l
m
e
et
pl
co
m
of
et
Su
bs

CLC Genomics Workbench

Manual for

CLC Genomics Workbench 5.1

Windows, Mac OS X and Linux
April 10, 2012
This software is for research purposes only.

CLC bio
Finlandsgade 10-12
DK-8200 Aarhus N
Denmark

Contents
1 Introduction to CLC Genomics Workbench

2 High-throughput sequencing

2.1

Import high-throughput sequencing data . . . . . . . . . . . . . . . . . . . . . .

2.2

Multiplexing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.3

Trim sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.4

De novo assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.5

Map reads to reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.6

Mapping reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.7

Mapping table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.8

Color space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.9

Interpreting genome-scale mappings . . . . . . . . . . . . . . . . . . . . . . . .

2.10 Merge mapping results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.11 SNP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.12 DIP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103

2.13 ChIP sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108
2.14 RNA-Seq analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
2.15 Expression profiling by tags . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
2.16 Small RNA analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142
3 Expression analysis

159

3.1

Experimental design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160

3.2

Transformation and normalization . . . . . . . . . . . . . . . . . . . . . . . . . . 172

3.3

Quality control . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177

3.4

Statistical analysis - identifying differential expression . . . . . . . . . . . . . . . 189

CONTENTS

3.5

Feature clustering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197

3.6

Annotation tests . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203

3.7

General plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210

Bibliography

216

219

Index

Chapter 1

Introduction to CLC Genomics Workbench

This manual is a subset of the complete user manual for CLC Genomics Workbench. It only
contains the sections that are special for Next Generation Sequencing and expression analysis.
For the complete user manual, see http://www.clcbio.com/usermanuals.
You will see some missing references, indicated by two question marks ??. They refer to chapters
in the complete user manual.

Chapter 2

High-throughput sequencing
Contents
2.1

Import high-throughput sequencing data . . . . .

2.1.1
454 from Roche Applied Science . . . . . . .
2.1.2
Illumina Genome Analyzer from Illumina . . .
2.1.3
SOLiD from Life Technologies . . . . . . . . .
2.1.4
Fasta format . . . . . . . . . . . . . . . . . .
2.1.5
Sanger sequencing data . . . . . . . . . . . .
2.1.6
Ion Torrent PGM from Life Technologies . . .
2.1.7
Complete Genomics . . . . . . . . . . . . . .
2.1.8
General notes on handling paired data . . . .
2.1.9
SAM and BAM mapping files . . . . . . . . .
2.1.10 Tabular mapping files . . . . . . . . . . . . .
2.2
Multiplexing . . . . . . . . . . . . . . . . . . . . .
2.2.1
Sort sequences by name . . . . . . . . . . .
2.2.2
Process tagged sequences . . . . . . . . . .
2.3
Trim sequences . . . . . . . . . . . . . . . . . . .
2.3.1
Quality trimming . . . . . . . . . . . . . . . .
2.3.2
Adapter trimming . . . . . . . . . . . . . . .
2.3.3
Length trimming . . . . . . . . . . . . . . . .
2.3.4
Trim output . . . . . . . . . . . . . . . . . . .
2.4
De novo assembly . . . . . . . . . . . . . . . . . .
2.4.1
How it works . . . . . . . . . . . . . . . . . .
2.4.2
Resolve repeats using reads . . . . . . . . .
2.4.3
Optimization of the graph using paired reads
2.4.4
Bubble resolution . . . . . . . . . . . . . . .
2.4.5
Converting the graph to contig sequences . .
2.4.6
Summary . . . . . . . . . . . . . . . . . . . .
2.4.7
Randomness in the results . . . . . . . . . .
2.4.8
SOLiD data support in de novo assembly . .
2.4.9
De novo assembly parameters . . . . . . . .
2.4.10 De novo assembly report . . . . . . . . . . .

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

8
9
10
15
18
19
20
22
22
23
25
27
27
30
36
36
38
44
44
46
47
50
52
54
55
56
56
56
57
58

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.5

2.6

2.7
2.8

2.9

Map reads to reference . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.5.1

Starting the read mapping . . . . . . . . . . . . . . . . . . . . . . . . . .

2.5.2

Including or excluding regions (masking) . . . . . . . . . . . . . . . . . .

2.5.3

Mapping parameters

. . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.5.4

General mapping options . . . . . . . . . . . . . . . . . . . . . . . . . .

2.5.5

Assembly reporting options . . . . . . . . . . . . . . . . . . . . . . . . .

Mapping reports . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.6.1

Detailed mapping report . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.6.2

Summary mapping report . . . . . . . . . . . . . . . . . . . . . . . . . .

Mapping table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Color space . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.8.1

Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.8.2

Error modes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.8.3

Mapping in color space . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.8.4

Viewing color space information . . . . . . . . . . . . . . . . . . . . . .

Interpreting genome-scale mappings

. . . . . . . . . . . . . . . . . . . . . .

2.9.1

Getting an overview - zooming and navigating . . . . . . . . . . . . . . .

2.9.2

Single reads - coverage and conflicts . . . . . . . . . . . . . . . . . . . .

2.9.3

Interpreting genomic re-arrangements . . . . . . . . . . . . . . . . . . .

2.9.4

Output from the mapping . . . . . . . . . . . . . . . . . . . . . . . . . .

2.9.5
2.9.6

Extract parts of a mapping . . . . . . . . . . . . . . . . . . . . . . . . .

Find broken pair mates . . . . . . . . . . . . . . . . . . . . . . . . . . .

90
92

2.9.7

Working with multiple contigs from read mappings

. . . . . . . . . . . .

2.10 Merge mapping results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.11 SNP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.11.1

Assessing the quality of the neighborhood bases . . . . . . . . . . . . .

2.11.2

Significance of variation: is it a SNP? . . . . . . . . . . . . . . . . . . . .

2.11.3

Reporting the SNPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

2.11.4

Adjacent SNPs affecting the same codon

. . . . . . . . . . . . . . . . . 102

2.12 DIP detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103

2.12.1

Experimental support of a DIP

2.12.2

Reporting the DIPs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 107

2.13 ChIP sequencing

. . . . . . . . . . . . . . . . . . . . . . . 105

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108

2.13.1

Peak finding and false discovery rates . . . . . . . . . . . . . . . . . . . 109

2.13.2

Peak refinement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111

2.13.3

Reporting the results . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113

2.14 RNA-Seq analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116

2.14.1

Defining reference genome and mapping settings . . . . . . . . . . . . . 118

2.14.2

Exon identification and discovery . . . . . . . . . . . . . . . . . . . . . . 122

2.14.3

RNA-Seq output options . . . . . . . . . . . . . . . . . . . . . . . . . . . 123

2.14.4

Interpreting the RNA-Seq analysis result . . . . . . . . . . . . . . . . . . 126

2.15 Expression profiling by tags . . . . . . . . . . . . . . . . . . . . . . . . . . . 131

2.15.1

Extract and count tags

. . . . . . . . . . . . . . . . . . . . . . . . . . . 132

2.15.2

Create virtual tag list . . . . . . . . . . . . . . . . . . . . . . . . . . . . 135

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.15.3

Annotate tag experiment . . . . . . . . . . . . . . . . . . . . . . . . . . 139

2.16 Small RNA analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142

2.16.1

Extract and count . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142

2.16.2

Downloading miRBase . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146

2.16.3

Annotating and merging small RNA samples . . . . . . . . . . . . . . . . 147

2.16.4

Working with the small RNA sample . . . . . . . . . . . . . . . . . . . . 155

2.16.5

Exploring novel miRNAs . . . . . . . . . . . . . . . . . . . . . . . . . . . 157

The so-called Next Generation Sequencing (NGS) technologies encompass a range of technologies
generating huge amounts of sequencing data at a very high speed compared to traditional Sanger
sequencing. The CLC Genomics Workbench lets you import, trim, map, assemble and analyze
DNA sequence reads from these high-throughput sequencing machines:
The 454 FLX System from Roche
Illumina's Genome Analyzer
SOLiD system from Applied Biosystems (read mapping is performed in color space, see
section 2.8)
Ion Torrent from Life Technologies
The CLC Genomics Workbench supports paired data from all platforms. Knowing the approximate
distance between two reads can enable better determination over repeat regions, where assembly
of short reads can be difficult, and enhances the possibility of correctly assembling data. It also
enables a wide array of new approaches to interpreting the sequencing data.
The first section in this chapter focuses on importing NGS data. These data are different from
general data formats accepted by the CLC Genomics Workbench, and require more explanation.
After the import section, the trimming capability of the CLC Genomics Workbenchis described.
This includes the ability to trim on quality and length, as well as trim on adapters and de-multiplex
datasets.
After these sections, we go on to describe the various analysis possibilities available once you
have imported your data into the CLC Genomics Workbench.

2.1

Import high-throughput sequencing data

This section describes how to import data generated by high-throughput sequencing machines.
Clicking on the button in the top toolbar labelled NGS Import will bring up a list of the supported
data types as shown in figure 2.1.
Going to:
File | Import High-Throughput Sequencing Data (

will bring up the same list of formats.

Select the appropriate format and then fill in the information as explained in the following
sections.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.1: Choosing what kind of data you wish to import.

Please note that alignments of Complete Genomics data can be imported using the SAM/BAM
importer, see section 2.1.7 below.

2.1.1

454 from Roche Applied Science

Choosing the Roche 454 import will open the dialog shown in figure 2.2.

Figure 2.2: Importing data from Roche 454.

We support import of two kinds of data from 454 GS FLX systems:
Flowgram files (.sff) which contain both sequence data and quality scores amongst others.
However, the flowgram information is currently not used by CLC Genomics Workbench. There
is an extra option to make use of clipping information (this will remove parts of the sequence
as specified in the .sff file).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Fasta/qual files:
454 FASTA files (.fna) which contain the sequence data.
Quality files (.qual) which contain the quality scores.
For all formats, compressed data in gzip format is also supported (.gz).
The General options to the left are:
Paired reads. The paired protocol for 454 entails that the forward and reverse reads are
separated by a linker sequence. During import of paired data, the linker sequence is
removed and the forward and reverse reads are separated and put into the same sequence
list (their status as forward and reverse reads is preserved). You can change the linker
sequence in the Preferences (in the Edit menu) under Data. Since the linker for the FLX
and Titanium versions are different, you can choose the appropriate protocol during import,
and in the preferences you can supply a linker for both platforms (see figure 2.3. Note that
since the FLX linker is palindromic, it will only be searched on the plus strand, whereas the
Titanium linker will be found on both strands. Some of the sequences may not have the
linker in the middle of the sequence, and in that case the partial linker sequence is still
removed, and the single read is put into a separate sequence list. Thus when you import
454 paired data, you may end up with two sequence lists: one for paired reads and one
for single reads. Note that for de novo assembly projects, only the paired list should be
used since the single reads list may contain reads where there is still a linker sequence
present but only partially due to sequencing errors. Read more about handling paired data
in section 2.1.8.
Discard read names. For high-throughput sequencing data, the naming of the individual
reads is often irrelevant given the huge amount of reads. This option allows you to discard
this option to save disk space.
Discard quality scores. Quality scores are visualized in the mapping view and they are used
for SNP detection. If this is not relevant for your work, you can choose to Discard quality
scores. One of the benefits from discarding quality scores is that you will gain a lot in terms
of reduced disk space usage and memory consumption. If you have selected the fna/qual
option and choose to discard quality scores, you do not need to select a .qual file.
Note! During import, partial adapter sequences are removed (TCAG and ATGC), and if the
full sequencing adapters GCCTTGCCAGCCCGCTCAG, GCCTCCCTCGCGCCATCAG or their reverse
complements are found, they are also removed (including tailing Ns). If you do not wish to remove
the adapter sequences (e.g. if they have already been removed by other software), please
uncheck the Remove adapter sequence option.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis. There is an option to put the import data into a separate folder.
This can be handy for better organizing subsequent analysis results and for batching (see section
??).

2.1.2

Illumina Genome Analyzer from Illumina

Choosing the Illumina import will open the dialog shown in figure 2.4.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.3: Specifying linkers for 454 import.

The file formats accepted are:
Fastq
Scarf
Qseq
Paired data in any of these formats can be imported.
Note that there is information inside qseq and fastq files specifying whether a read has passed
a quality filter or not. If you check Remove failed reads these reads will be ignored during import.
For qseq files there is a flag at the end of each read with values 0 (failed) or 1 (passed). In
this example, the read is marked as failed and if Remove failed reads is checked, the read is
removed.
M10

28680

29475

CATGGCCGTACAGGAAACACACATCATAGCATCACACGA

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

For fastq files, part of the header information for the quality score has a flag where Y means
failed and N means passed. In this example, the read has not passed the quality filter:
@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
Note! In the Illumina pipeline 1.5-1.7, the letter B in the quality score has a special meaning. 'B'
is used as a trim clipping. This means that when selecting Illumina pipeline 1.5-1.7, the reads
are automatically trimmed when a B is encountered in the input file. This will happen also if you
choose to discard quality scores during import.
If you import paired data and one read in a pair is removed during import, the remaining mate
will be saved in a separate sequence list with single reads.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.4: Importing data from Illumina's Genome Analyzer.

For all formats, compressed data in gzip format is also supported (.gz).
The General options to the left are:
Paired reads. For paired import, you can select whether the data is Paired-end or Mate-pair.
For paired data, the Workbench expects the first reads of the pairs to be in one file and
the second reads of the pairs to be in another. When importing one pair of files, the first
file in a pair will is assumed to contain the first reads of the pair, and the second file is
assumed to contain the second read in a pair. So, for example, if you had specified that the
pairs were in forward-reverse orientation, then the first file would be assumed to contain
the forward reads. The second file would be assumed to contain the reverse reads.
When loading files containing paired data, the CLC Genomics Workbench sorts the files
selected according to rules based on the file naming scheme:
For files coming off the CASAVA1.8 pipeline, we organize pairs according to their
identifier and chunk number. Files named with _R1_ are assumed to contain the first
sequences of the pairs, and those with _R2_ in the name are assumed to contain the
second sequence of the pairs.
For other files, we sort them all alphanumerically, and then group them two by two.
This means that files 1 and 2 in the list are loaded as pairs, files 3 and 4 in the list
are seen as pairs, and so on.
In the simplest case, the files are typically named as shown in figure 2.4. In this
case, the data is paired end, and the file containing the forward reads is called
s_1_1_sequence.txt and the file containing reverse reads is called s_1_2_sequence.txt.
Other common filenames for paired data, like _1_sequence.txt, _1_qseq.txt,
_2_sequence.txt or _2_qseq.txt will be sorted alphanumerically. In such cases,

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

files containing the final _1 should contain the first reads of a pair, and those containing
the final _2 should contain the second reads of a pair.
For files from CASAVA1.8, files with base names like these: ID_R1_001, ID_R1_002,
ID_R2_001, ID_R2_002 would be sorted in this order:
1.
2.
3.
4.

ID_R1_001
ID_R2_001
ID_R1_002
ID_R2_002

The data in files ID_R1_001 and ID_R2_001 would be loaded as a pair, and ID_R1_002,
ID_R2_002 would be loaded as a pair.
Within each file, the first read of a pair will have a 1 somewhere in the information line.
In most cases, this will be a /1 at the end of the read name. In some cases though
(e.g. CASAVA1.8), there will be a 1 elsewhere in the information line for each sequence.
Similarly, the second read of a pair will have a 2 somewhere in the information line - either
a /2 at the end of the read name, or a 2 elsewhere in the information line.
If you do not choose to discard your read names on import (see next parameter setting), you
can quickly check that your paired data has imported in the pairs you expect by looking at
the first few sequence names in your imported paired data object. The first two sequences
should have the same name, except for a 1 or a 2 somewhere in the read name line.
Paired-end and mate-pair data are handled the same way with regards to sorting on
filenames. Their data structure is the same the same once imported into the Workbench.
The only difference is that the expected orientation of the reads: reverse-forward in the
case of mate pairs, and forward-reverse in the case of paired end data. Read more about
handling paired data in section 2.1.8.
Discard read names. For high-throughput sequencing data, the naming of the individual
reads is often irrelevant given the huge amount of reads. This option allows you to discard
quality scores to save disk space.
Discard quality scores. Quality scores are visualized in the mapping view and they are
used for SNP detection. If this is not relevant for your work, you can choose to Discard
quality scores. One of the benefits from discarding quality scores is that you will gain a
lot in terms of reduced disk space usage and memory consumption. Read more about the
quality scores of Illumina below.
MiSeq de-multiplexing. For MiSeq multiplexed data, one file includes all the reads
containing barcodes/indices from the different samples (in case of paired data it will be two
files). Using this option, the data can be divided into groups based on the barcode/index.
This is typically the desired behavior, because subsequent analysis can then be executed
in batch on all the samples and results can be compared at the end. This is not possible if
all samples are in the same file after import. The reads are connected to a group using the
last number in the read identifier.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis. There is an option to put the import data into a separate folder.
This can be handy for better organizing subsequent analysis results and for batching (see section
??).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Quality scores in the Illumina platform

The quality scores in the FASTQ format come in different versions. You can read more about
the FASTQ format at http://en.wikipedia.org/wiki/FASTQ_format. When you select
to import Illumina data and click Next there is an option to use different quality score schemes
at the bottom of the dialog (see figure 2.5).

Figure 2.5: Selecting the quality score scheme.

There are three options:
Automatic. Choosing this option, the Workbench attempts to automatically detect the
quality score format. Sometimes this is not possible, and you have to specify the format
yourself. In the cases where the Workbench is unable to determine the format, it is usually
one of the Illumina Pipeline format files. If there are characters ; < = > or ? in the quality
score information, it is the old Illumina pipeline format (ASCII values 59 to 63).
NCBI/Sanger or Illumina 1.8 and later. Using a Phred scale encoded using ASCII 33 to
93. This is the standard for fastq formats except for the early Illumina data formats (this
changed with version 1.8 of the Illumina Pipeline).
Illumina Pipeline 1.2 and earlier. Using a Solexa/Illumina scale (-5 to 40) using ASCII 59
to 104. The Workbench automatically converts these quality scores to the Phred scale on
import in order to ensure a common scale for analyses across data sets from different
platforms (see details on the conversion next to the sample below).
Illumina Pipeline 1.3 and 1.4. Using a Phred scale using ASCII 64 to 104.
Illumina Pipeline 1.5 to 1.7. Using a Phred scale using ASCII 64 to 104. Values 0 (@) and
1 (A) are not used anymore. Value 2 (B) has special meaning and is used as a trim clipping.
This means that when selecting Illumina Pipeline 1.5 and later, the reads are automatically
trimmed when a B is encountered in the input file.
Small sample of all three kinds of files are shown below. The names of the reads have no
influence on the quality score format:
NCBI/Sanger Phred scores:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

@SRR001926.1 FC00002:7:1:111:750 length=36

TTTTTGTAAGGAGGGGGGTCATCAAAATTTGCAAAA
+SRR001926.1 FC00002:7:1:111:750 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIFIIIIIB<IH
@SRR001926.7 FC00002:7:1:110:453 length=36
TTATATGGAGGCTTTAAGAGTCATAGGTTGTTCCCC
+SRR001926.7 FC00002:7:1:110:453 length=36
IIIIIIIIIII:III?=IIIIII+&III/3I8F/&
Illumina Pipeline 1.2 and earlier (note the question mark at the end of line 4 - this is one of the
values that are unique to the old Illumina pipeline format):
@SLXA-EAS1_89:1:1:672:654/1
GCTACGGAATAAAACCAGGAACAACAGACCCAGCA
+SLXA-EAS1_89:1:1:672:654/1
cccccccccccccccccccc]ccVcZccbSYb?
@SLXA-EAS1_89:1:1:657:649/1
GCAGAAAATGGGAGTGAAAATCTCCGATGAGCAGC
+SLXA-EAS1_89:1:1:657:649/1
ccccccccccbccbccbcccbcccZcc^bR^
The formulas used for converting the special Solexa-scale quality scores to Phred-scale:
Qphred = 10 log10 p
Qsolexa = 10 log10

p
1p

A sample of the quality scores of the Illumina Pipeline 1.3 and 1.4:
@HWI-E4_9_30WAF:1:1:8:178
GCCAGCGGCGCAAAATGNCGGCGGCGATGACCTTC
+HWI-E4_9_30WAF:1:1:8:178
babaaaa\ababaaaaREXabaaaaaaaaaaaaaa
@HWI-E4_9_30WAF:1:1:8:1689
GATGGAGATCTCGACCTNATAGGTGCCCTCATCGG
+HWI-E4_9_30WAF:1:1:8:1689
aab]_aaaaaaaaaa[ERabaaa\aaaaaaaa[
Note that it is not possible to see from that data itself that it is actually not Illumina Pipeline 1.2
and earlier, since they use the same range of ASCII values.
To learn more about ASCII values, please see http://en.wikipedia.org/wiki/Ascii#ASCII_
printable_characters.

2.1.3

SOLiD from Life Technologies

Choosing the SOLiD import will open the dialog shown in figure 2.6.
The file format accepted is the csfasta format which is the color space version of fasta format.
If you want to import quality scores, a qual files should also be provided. The reads in a csfasta
file look like this:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.6: Importing data from SOLiD from Applied Biosystems.

>2_14_26_F3
T011213122200221123032111221021210131332222101
>2_14_192_F3
T110021221100310030120022032222111321022112223
>2_14_233_F3
T011001332311121212312022310203312201132111223
>2_14_294_F3
T213012132300000021323212232.03300033102330332
All reads start with a T which specifies the right phasing of the color sequence.
If a reads has a . as you can see in the last read in the example above, it means that the color
calling was ambiguous (this would have been an N if we were in base space). In this case, the
Workbench simply cuts off the rest of the read, since there is no way to know the right phase of
the rest of the colors in the read. If the read starts with a dot, it is not imported. If all reads start
with a dot, a warning dialog will be displayed. In the quality file, the equivalent value is -1, and
this will also cause the read to be clipped.
When the example above is imported into the Workbench, it looks as shown in figure 2.7.
For more information about color space, please see section 2.8.
In addition to the native csfasta format used by SOLiD, you can also input data in fastq
format. This is particularly useful for data downloaded from the Sequence Read Archive at
NCBI (http://www.ncbi.nlm.nih.gov/Traces/sra/). An example of a SOLiD fastq file is
shown here with both quality scores and the color space encoding:
@SRR016056.1.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_130.1 length=50
T31000313121310211022312223311212113022121201332213
+SRR016056.1.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_130.1 length=50

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.7: Importing data from SOLiD from Applied Biosystems. Note that the fourth read is cut
off so that the color following the dot are not included
!*%;2%%050%03%%5*.%%%),%%%%&%%%%%%%%%%%%%3+%%%
@SRR016056.2.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_223.1 length=50
T20002201120021211012010332211122133212331221302222
+SRR016056.2.1 AMELIA_20071210_2_YorubanCGB_Frag_16bit_2_51_223.1 length=50
!%%)%))&%(((&%/&)%+(%%%&%%%%%%%%%%%%%%%+%%%%%%+
For all formats, compressed data in gzip format is also supported (.gz).
The General options to the left are:
Paired reads. When you import paired data, two different protocols are supported:
Mate-pair. For mate-pair data, the reads should be in two files with _F3 and _R3
in front of the the file extension. The orientation of the reads is expected to be
forward-forward.
Paired-end. For paired-end data, the reads should be in two files with _F3 and _F5-P2
or _F5-BC. The orientation is expected to be forward-reverse.
Read more about handling paired data in section 2.1.8.
An example of a complete list of the four files needed for a SOLiD mate-paired data set
including quality scores:
dataset_F3.csfasta
dataset_R3.csfasta

dataset_F3.qual
dataset_R3.qual

or
dataset_F3.csfasta
dataset_R3.csfasta

dataset_F3_.QV.qual
dataset_R3_.QV.qual

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Discard quality scores. Quality scores are visualized in the mapping view and they are
used for SNP detection. If this is not relevant for your work, you can choose to Discard
quality scores. One of the benefits from discarding quality scores is that you will gain a lot
in terms of reduced disk space usage and memory consumption. If you choose to discard
quality scores, you do not need to select a .qual file.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis. There is an option to put the import data into a separate folder.
This can be handy for better organizing subsequent analysis results and for batching (see section
??).

2.1.4

Fasta format

Data coming in a standard fasta format can also be imported using the standard Import ( ), see
section ??. However, using the special high-throughput sequencing data import is recommended
since the data is imported in a "leaner" format than using the standard import. This also means
that all descriptions from the fasta files are ignored (usually there are none anyway for this kind
of data).
The dialog for importing data in fasta format is shown in figure 2.8.

Figure 2.8: Importing data in fasta format.

Compressed data in gzip format is also supported (.gz).
The General options to the left are:
Paired reads. For paired import, the Workbench expects the forward reads to be in one file
and the reverse reads in another. The Workbench will sort the files before import and then
assume that the first and second file belong together, and that the third and fourth file

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

belong together etc. At the bottom of the dialog, you can choose whether the ordering of the
files is Forward-reverse or Reverse-forward. As an example, you could have a data set with
two files: sample1_fwd containing all the forward reads and sample1_rev containing
all the reverse reads. In each file, the reads have to match each other, so that the first
read in the fwd list should be paired with the first read in the rev list. Note that you can
specify the insert sizes when running mapping and assembly. If you have data sets with
different insert sizes, you should import each data set individually in order to be able to
specify different insert sizes. Read more about handling paired data in section 2.1.8.
Discard read names. For high-throughput sequencing data, the naming of the individual
reads is often irrelevant given the huge amount of reads. This option allows you to discard
this option to save disk space.
Discard quality scores. This option is not relevant for fasta import, since quality scores are
not supported.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis. There is an option to put the import data into a separate folder.
This can be handy for better organizing subsequent analysis results and for batching (see section
??).

2.1.5

Sanger sequencing data

Although traditional sequencing data (with chromatogram traces like abi files) is usually imported
using the standard Import ( ), see section ??, this option has also been included in the
High-Throughput Sequencing Data import. It is designed to handle import of large amounts of
sequences, and there are three differences from the standard import:
All the sequences will be put in one sequence list (instead of single sequences).
The chromatogram traces will be removed (quality scores remain). This is done to improve
performance, since the trace data takes up a lot of disk space and significantly impacts
speed and memory consumption for further analysis.
Paired data is supported.
With the standard import, it is practically impossible to import up to thousands of trace files and
use them in an assembly. With this special High-Throughput Sequencing import, there is no limit.
The import formats supported are the same: ab, abi, ab1, scf and phd.
For all formats, compressed data in gzip format is also supported (.gz).
The dialog for importing data Sanger sequencing data is shown in figure 2.9.
The General options to the left are:
Paired reads. The Workbench will sort the files before import and then assume that the first
and second file belong together, and that the third and fourth file belong together etc. At the
bottom of the dialog, you can choose whether the ordering of the files is Forward-reverse or
Reverse-forward. As an example, you could have a data set with two files: sample1_fwd

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.9: Importing data from Sanger sequencing.

for the the forward read and sample1_rev for the reverse reads. Note that you can specify
the insert sizes when running the mapping and the assembly. If you have data sets with
different insert sizes, you should import each data set individually in order to be able to
specify different insert sizes. Read more about handling paired data in section 2.1.8.
Discard read names. For high-throughput sequencing data, the naming of the individual
reads is often irrelevant given the huge amount of reads. This option allows you to discard
this option to save disk space.
Discard quality scores. Quality scores are visualized in the mapping view and they are
used for SNP detection. If this is not relevant for your work, you can choose to Discard
quality scores. One of the benefits from discarding quality scores is that you will gain a lot
in terms of reduced disk space usage and memory consumption.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis. There is an option to put the import data into a separate folder.
This can be handy for better organizing subsequent analysis results and for batching (see section
??).

2.1.6

Ion Torrent PGM from Life Technologies

Choosing the Ion Torrent import will open the dialog shown in figure 2.10.
We support import of two kinds of data from the Ion Torrent system:
SFF files (.sff)
Fastq files (.fastq). Quality scores are expected to be in the NCBI/Sanger format (see
section 2.1.2)

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.10: Importing data from Ion Torrent.

For all formats, compressed data in gzip format is also supported (.gz).
The General options to the left are:
Paired reads. The CLC Genomics Workbench supports both paired end and mate pair
protocols.
Paired end Paired end data from Ion Torrent comes in two files per data set. The first file
in is assumed to contain the first reads of the pair, and the second file is assumed
to contain the second read in a pair. On import, the orientation of the reads is set
to forward - reverse. When the reads have been imported, there will be one file with
intact pairs, and one file where one part of the pair is missing (in this case, "single"
is appended to the file name). The Workbench connects the right sequences together
in the pair based on the read name. Read more about handling paired data in section
2.1.8.
Mate pair The mate pair protocol for Ion Torrent entails that the two reads are separated by
a linker sequence. During import of paired data, the linker sequence is removed and
the two reads are separated and put into the same sequence list. You can change the
linker sequence in the Preferences (in the Edit menu) under Data. When looking for
the linker sequence, the Workbench requires 80 % of the maximum alignment score,
using the following scoring scheme: matches = 1, mismatches = -2 and indels = -3.
Some of the sequences may not have the linker in the middle of the sequence, and
in that case the partial linker sequence is still removed, and the single read is put
into a separate sequence list. Thus when you import Ion Torrent mate pair data, you
may end up with two sequence lists: one for paired reads and one for single reads.
Note that for de novo assembly projects, only the paired list should be used since
the single reads list may contain reads where there is still a linker sequence present
but only partially due to sequencing errors. Read more about handling paired data in
section 2.1.8.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Discard read names. For high-throughput sequencing data, the naming of the individual
reads is often irrelevant given the huge amount of reads. This option allows you to discard
this option to save disk space.
Discard quality scores. Quality scores are visualized in the mapping view and they are used
for SNP detection. If this is not relevant for your work, you can choose to Discard quality
scores. One of the benefits from discarding quality scores is that you will gain a lot in terms
of reduced disk space usage and memory consumption. If you have selected the fna/qual
option and choose to discard quality scores, you do not need to select a .qual file.
For sff files, you can also decide whether to use the clipping information in the file or not.

2.1.7

Complete Genomics

With CLC Genomics Workbench 5.1 you can import evidence files from Complete Genomics.
Support for other data types from Complete Genomics will be added later. The evidence files can
be imported using the SAM/BAM importer, see section 2.1.9.
In order to import the data it need to be converted first. This is achieved using the CGA tools
that can be downloaded from http://www.completegenomics.com/sequence-data/
cgatools/.
The procedure for converting the data is the following.
1. Download the human genome in fasta format and make sure the chromosomes are named
chr<number>.fa, e.g. chr9.fa.
2. Run the fasta2crr tool with a command like this:
cgatools fasta2crr --input chr9.fa --output chr9.crr
3. Run the evidence2sam tool with a command like this:
cgatools evidence2sam --beta -e evidenceDnbs-chr9-.tsv -o chr9.sam -s chr9.crr

where the .tsv file is the evidence file provided by Complete Genomics (you can find sample
data sets on their ftp server: ftp://ftp2.completegenomics.com/.
4. Import (

) the fasta file from 1. into the Workbench.

5. Use the SAM/BAM importer (section 2.1.9) to import the file created by the evidence2sam
tool.
Please refer to the CGA documentation for a description about these tools. Note that this is not
software supported by CLC bio.

2.1.8

General notes on handling paired data

During import, information about the orientation of paired data is stored by the CLC Genomics
Workbench. This means that all subsequent analyses will automatically take differences in
orientation into account. Once imported, both reads of a pair will be stored in the same sequence
list. The forward and reverse reads (e.g. for paired-end data) simply alternate so that the first
read is forward, the second read is the mate reverse read; the third is again forward and the

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

fourth read is the mate reverse read. When deleting or manipulating sequence lists with paired
data, be careful not break this order.
You can view and edit the orientation of the reads after they have been imported by opening the
read list in the Element information view ( ), see section ?? as shown in figure 2.11.

Figure 2.11: The paired orientation and distance.

In the Paired status part, you can specify whether the CLC Genomics Workbench should treat the
data as paired data, what the orientation is and what the preferred distance is. The orientation
and preferred distance is specified during import and can be changed in this view.
Note that the paired distance measure that is used throughout the CLC Genomics Workbench is
always including the full read sequence. For paired-end libraries it means from the beginning of
the forward read to the beginning of the reverse read.

2.1.9

SAM and BAM mapping files

The CLC Genomics Workbench supports import and export of files in SAM (Sequence Alignment/Map) and BAM format which are generic formats for storing large nucleotide sequence
alignments. Read more and see the format specification at http://samtools.sourceforge.
net/.
Please note that the CLC Genomics Workbench also supports SAM and BAM files from Complete
Genomics.
For a detailed explanation of the SAM and BAM files exported from CLC Genomics Workbench,
please see section ??.
The idea behind the importer is that you import the sam/bam file which includes all the reads
and then you specify one or more reference sequences which have already been imported into
the Workbench. The Workbench will then combine the two to create a mapping result ( ) or
mapping tables ( ). To import a SAM or BAM file:
File | Import High-Throughput Sequencing Data (
( )

) | SAM/BAM Mapping Files

This will open a dialog where you choose the reference sequences to be used as shown in
figure 2.12.
Select one or more reference sequence. Note that the name of your reference sequence has to

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.12: Defining reference sequences.

match the reference name specified in the SAM/BAM file. Click Next.

Figure 2.13: Selecting the SAM/BAM file containing all the read information.
In this dialog, select (

) one or more SAM/BAM files as shown in figure 2.13.

In the panel below, all the reference sequences found in the SAM/BAM file will be listed included
their lengths. In addition, it is indicated in the Status column whether they match the reference
sequences selected from the Workbench. This can be used to double-check that the naming of
the references are the same. (Note that reference sequences in a SAM/BAM file cannot contain

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

spaces. If a reference sequence in the Workbench contains spaces, the space will be replaced
with _ when comparing with the SAM/BAM file.). Figure2.14 shows an example where a reference
sequence has not been provided (input missing) and one where the lengths of the reference
sequences do not match (Length differs).

Figure 2.14: When there is inconsistency in the naming and sizes of reference sequences, this is
shown in the dialog prior to import.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis.
Note that this import operation is very memory-consuming for large data sets.

2.1.10

Tabular mapping files

The CLC Genomics Workbench supports import and export of files in tabular format such as Eland
files coming from the Illumina Pipeline. The importer is quite flexible which means that it can
be used to import any kind of mapping file in a tab-delimited format where each line in the file
represents one read.
The idea behind the importer is that you import the mapping file which includes all the reads and
then you specify one or more reference sequences which have already been imported into the
Workbench. The Workbench will then combine the two to create mapping results ( ) or mapping
tables ( ). To import a tabular mapping file:
File | Import High-Throughput Sequencing Data (

) | Tabular Mapping Files (

This will open a dialog where you choose the reference sequences to be used as shown in
figure 2.15.
Select one or more reference sequence. Note that the name of your reference sequence has to
match the reference name specified in the file. Click Next.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.15: Defining reference sequences.

Figure 2.16: Defining reference sequences.

In this dialog, select (

) one or more tab delimited files as shown in figure 2.16.

Once the tab delimited file has been selected, you have to specify the following information:
Data columns. The Workbench needs to know how the file is organized in order to create a
result where the reads have been mapped correctly.
Reference name. Select the column where the name reference sequence is specified.
In the example above, this is in column 1.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Match start position. The position on the reference sequence where the read is
mapped. The numbering starts from position 1.
Match strand. Whether the read is mapped the positive or negative strand. This
should be specified using F / R (denoting forward and reverse reads) or + / -.
Read name. Whether the read is mapped the positive or negative strand. This should
be specified using F / R (denoting forward and reverse reads) or + / -.
Match length. The start position of the read is set above. In this section you specify the
length of the match which can be done in any of the following ways:
Use fixed read length. If all reads have the same length, and if the read length or
match end position is not provided in the file, you can specify a fixed length for all the
reads.
Use end position. If you have a match end position just as a match start position, this
can be used to determine match length.
Use match descriptor. This can be used to denote mismatches in the alignment. For
a 35 base read, 35 denotes an exact match and 32C2 denotes substitution of a C at
the 33rd position.
Note that the Workbench looks in the first line of the file to provide a preview when filling in this
information.
Click Next to adjust how to handle the results (see section ??). We recommend choosing Save
in order to save the results directly to a folder, since you probably want to save anyway before
proceeding with your analysis.
Note that this import operation is very memory-consuming for large data sets.

2.2

Multiplexing

When you do batch sequencing of different samples, you can use multiplexing techniques to run
different samples in the same run. There is often a data analysis challenge to separate the
sequencing reads, so that the reads from one sample are mapped together. The CLC Genomics
Workbench supports automatic grouping of samples for two multiplexing techniques:
By name. This supports grouping of reads based on their name.
By sequence tag. This supports grouping of reads based on information within the
sequence (tagged sequences).
The details of these two functionalities are described below.

2.2.1

Sort sequences by name

With this functionality you will be able to group sequencing reads based on their file name. A
typical example would be that you have a list of files named like this:
...

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

A02__Asp_F_016_2007-01-10
A02__Asp_R_016_2007-01-10
A02__Gln_F_016_2007-01-11
A02__Gln_R_016_2007-01-11
A03__Asp_F_031_2007-01-10
A03__Asp_R_031_2007-01-10
A03__Gln_F_031_2007-01-11
A03__Gln_R_031_2007-01-11
...
In this example, the names have five distinct parts (we take the first name as an example):
A02 which is the position on the 96-well plate
Asp which is the name of the gene being sequenced
F which describes the orientation of the read (forward/reverse)
016 which is an ID identifying the sample
2007-01-10 which is the date of the sequencing run
To start mapping these data, you probably want to have them divided into groups instead of
having all reads in one folder. If, for example, you wish to map each sample separately, or if you
wish to map each gene separately, you cannot simply run the mapping on all the sequences in
one step.
That is where Sort Sequences by Name comes into play. It will allow you to specify which part
of the name should be used to divide the sequences into groups. We will use the example
described above to show how it works:
Toolbox | High-throughput Sequencing (
Name ( )

) | Multiplexing (

) | Sort Sequences by

This opens a dialog where you can add the sequences you wish to sort. You can also add
sequence lists or the contents of an entire folder by right-clicking the folder and choose: Add
folder contents.
When you click Next, you will be able to specify the details of how the grouping should be
performed. First, you have to choose how each part of the name should be identified. There are
three options:
Simple. This will simply use a designated character to split up the name. You can choose
a character from the list:
Underscore _
Dash Hash (number sign / pound sign) #
Pipe |
Tilde ~
Dot .

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Positions. You can define a part of the name by entering the start and end positions, e.g.
from character number 6 to 14. For this to work, the names have to be of equal lengths.
Java regular expression. This is an option for advanced users where you can use a special
syntax to have total control over the splitting. See more below.
In the example above, it would be sufficient to use a simple split with the underscore _ character,
since this is how the different parts of the name are divided.
When you have chosen a way to divide the name, the parts of the name will be listed in the table
at the bottom of the dialog. There is a checkbox next to each part of the name. This checkbox is
used to specify which of the name parts should be used for grouping. In the example above, if
we want to group the reads according to sample ID and gene name, these two parts should be
checked as shown in figure 2.17.

Figure 2.17: Splitting up the name at every underscore (_) and using the sample ID and gene name
for grouping.
At the middle of the dialog there is a preview panel listing:
Sequence name. This is the name of the first sequence that has been chosen. It is shown
here in the dialog in order to give you a sample of what the names in the list look like.
Resulting group. The name of the group that this sequence would belong to if you proceed
with the current settings.
Number of sequences. The number of sequences chosen in the first step.
Number of groups. The number of groups that would be produced when you proceed with
the current settings.
This preview cannot be changed. It is shown to guide you when finding the appropriate settings.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish. A
new sequence list will be generated for each group. It will be named according to the group, e.g.
Asp016 will be the name of one of the groups in the example shown in figure 2.17.
Advanced splitting using regular expressions
You can see a more detail explanation of the regular expressions syntax in section ??. In this
section you will see a practical example showing how to create a regular expression. Consider a
list of files as shown below:
...
adk-29_adk1n-F
adk-29_adk2n-R
adk-3_adk1n-F
adk-3_adk2n-R
adk-66_adk1n-F
adk-66_adk2n-R
atp-29_atpA1n-F
atp-29_atpA2n-R
atp-3_atpA1n-F
atp-3_atpA2n-R
atp-66_atpA1n-F
atp-66_atpA2n-R
...
In this example, we wish to group the sequences into three groups based on the number after the
"-" and before the "_" (i.e. 29, 3 and 66). The simple splitting as shown in figure 2.17 requires
the same character before and after the text used for grouping, and since we now have both a "-"
and a "_", we need to use the regular expressions instead (note that dividing by position would
not work because we have both single and double digit numbers (3, 29 and 66)).
The regular expression for doing this would be (.*)-(.*)_(.*) as shown in figure 2.18.
The round brackets () denote the part of the name that will be listed in the groups table at the
bottom of the dialog. In this example we actually did not need the first and last set of brackets,
so the expression could also have been .*-(.*)_.* in which case only one group would be
listed in the table at the bottom of the dialog.

2.2.2

Process tagged sequences

Multiplexing as described in section 2.2.1 is of course only possible if proper sequence names
could be assigned from the sequencing process. With many of the new high-throughput
technologies, this is not possible.
However, there is a need for being able to input several different samples to the same sequencing
run, so multiplexing is still relevant - it just has to be based on another way of identifying the
sequences. A method has been proposed to tag the sequences with a unique identifier during
the preparation of the sample for sequencing [Meyer et al., 2007].
With this technique, each sequence will have a sample-specific tag - a special sequence of
nucleotides before and after the sequence of interest. This principle is shown in figure 2.19

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.18: Dividing the sequence into three groups based on the number in the middle of the
name.
(please refer to [Meyer et al., 2007] for more detailed information).

Figure 2.19: Tagging the target sequence. Figure from [Meyer et al., 2007].
The sample-specific tag - also called the barcode - can then be used to distinguish between the
different samples when analyzing the sequence data. This post-processing of the sequencing
data has been made easy by the multiplexing functionality of the CLC Genomics Workbench which
simply divides the data into separate groups prior to analysis. Note that there is also an example
using Illumina data at the end of this section.
Before processing the data, you need to import it as described in section 2.1.
The first step is to separate the imported sequence list into sublists based on the barcode of the
sequences:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Toolbox | High-throughput Sequencing (
Sequences ( )

32
) | Multiplexing (

) | Process Tagged

This opens a dialog where you can add the sequences you wish to sort. You can also add
sequence lists.
When you click Next, you will be able to specify the details of how the de-multiplexing should be
performed. At the bottom of the dialog, there are three buttons which are used to Add, Edit and
Delete the elements that describe how the barcode is embedded in the sequences.
First, click Add to define the first element. This will bring up the dialog shown in 2.20.

Figure 2.20: Defining an element of the barcode system.

At the top of the dialog, you can choose which kind of element you wish to define:
Linker. This is a sequence which should just be ignored - it is neither the barcode nor the
sequence of interest. Following the example in figure 2.19, it would be the four nucleotides
of the SrfI site. For this element, you simply define its length - nothing else.
Barcode. The barcode is the stretch of nucleotides used to group the sequences. For that,
you need to define what the valid bases are. This is done when you click Next. In this
dialog, you simply need to specify the length of the barcode.
Sequence. This element defines the sequence of interest. You can define a length interval
for how long you expect this sequence to be. The sequence part is the only part of the read
that is retained in the output. Both barcodes and linkers are removed.
The concept when adding elements is that you add e.g. a linker, a barcode and a sequence in the
desired sequential order to describe the structure of each sequencing read. You can of course
edit and delete elements by selecting them and clicking the buttons below. For the example from
figure 2.19, the dialog should include a linker for the SrfI site, a barcode, a sequence, a barcode
(now reversed) and finally a linker again as shown in figure 2.21.
If you have paired data, the dialog shown in figure 2.21 will be displayed twice - one for each part
of the pair.
Clicking Next will display a dialog as shown in figure 2.22.
The barcodes can be entered manually by clicking the Add ( ) button. You can edit the barcodes
and the names by clicking the cells in the table. The name is used for naming the results.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.21: Processing the tags as shown in the example of figure 2.19.

Figure 2.22: Specifying the barcodes as shown in the example of figure 2.19.
In addition to adding barcodes manually, you can also Import ( ) barcode definitions from an
Excel or CSV file. The input format consists of two columns: the first contains the barcode
sequence, the second contains the name of the barcode. An acceptable csv format file would
contain columns of information that looks like:
"AAAAAA","Sample1"
"GGGGGG","Sample2"
"CCCCCC","Sample3"

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

The Preview column will show a preview of the results by running through the first 10,000 reads.
At the top, you can choose to search on both strands for the barcodes (this is needed for some
454 protocols where the MID is located at either end of the read).
Click Next to specify the output options. First, you can choose to create a list of the reads that
could not be grouped. Second, you can create a summary report showing how many reads were
found for each barcode (see figure 2.23).

Figure 2.23: An example of a report showing the number of reads in each group.
There is also an option to create subfolders for each sequence list. This can be handy when the
results need to be processed in batch mode (see section ??).
A new sequence list will be generated for each barcode containing all the sequences where
this barcode is identified. Both the linker and barcode sequences are removed from each of
the sequences in the list, so that only the target sequence remains. This means that you can
continue the analysis by doing trimming or mapping. Note that you have to perform separate
mappings for each sequence list.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

An example using Illumina barcoded sequences

The data set in this example can be found at the Short Read Archive at NCBI: http://www.
ncbi.nlm.nih.gov/sra/SRX014012. It can be downloaded directly in fastq format via
the URL http://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?cmd=dload&run_
list=SRR030730&format=fastq. The file you download can be imported directly into the
Workbench.
The barcoding was done using the following tags at the beginning of each read: CCT, AAT, GGT,
CGT (see supplementary material of [Cronn et al., 2008] at http://nar.oxfordjournals.
org/cgi/data/gkn502/DC1/1).
The settings in the dialog should thus be as shown in figure 2.24.

Figure 2.24: Setting the barcode length at three

Click Next to specify the bar codes as shown in figure 2.25 (use the Add button).

Figure 2.25: A preview of the result

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

With this data set we got the four groups as expected (shown in figure 2.26). The Not grouped
list contains 445,560 reads that will have to be discarded since they do not have any of the
barcodes.

Figure 2.26: The result is one sequence list per barcode and a list with the remainders

2.3

Trim sequences

CLC Genomics Workbench offers a number of ways to trim your sequence reads prior to assembly
and mapping, including adapter trimming, quality trimming and length trimming. Note that
different types of trimming are performed sequentially in the same order as they appear in the
trim dialogs:
1. Quality trimming based on quality scores
2. Ambiguity trimming to trim off e.g. stretches of Ns
3. Adapter trimming
4. Base trim to remove a specified number of bases at either 3' or 5' end of the reads
5. Length trimming to remove reads shorter or longer than a specified threshold
The result of the trim is a list of sequences that have passed the trim (referred to as the trimmed
list below) and optionally a list of the sequences that have been discarded and a summary report
(list of discarded sequences). The original data will be not be changed.
To start trimming:
Toolbox | High-throughput Sequencing (

) | Trim Sequences (

This opens a dialog where you can add sequences or sequence lists. If you add several sequence
lists, each list will be processed separately and you will get a a list of trimmed sequences for
each input sequence list.
When the sequences are selected, click Next.

2.3.1

Quality trimming

This opens the dialog displayed in figure 2.27 where you can specify parameters for quality
trimming.
The following parameters can be adjusted in the dialog:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.27: Specifying quality trimming.

Trim using quality scores. If the sequence files contain quality scores from a base-caller
algorithm this information can be used for trimming sequence ends. The program uses the
modified-Mott trimming algorithm for this purpose (Richard Mott, personal communication):
Quality scores in the Workbench are on a Phred scale in the Workbench (formats using
other scales are converted during import). First step in the trim process is to convert the
Q
quality score (Q) to error probability: perror = 10 10 . (This now means that low values are
high quality bases.)
Next, for every base a new value is calculated: Limit perror . This value will be negative
for low quality bases, where the error probability is high.
For every base, the Workbench calculates the running sum of this value. If the sum drops
below zero, it is set to zero. The part of the sequence to be retained after trimming is
the region between the first positive value of the running sum and the highest value of the
running sum. Everything before and after this region will be trimmed off.
A read will be completely removed if the score never makes it above zero.
At http://www.clcbio.com/files/usermanuals/trim.zip you find an example
sequence and an Excel sheet showing the calculations done for this particular sequence to
illustrate the procedure described above.
Trim ambiguous nucleotides. This option trims the sequence ends based on the presence
of ambiguous nucleotides (typically N). Note that the automated sequencer generating the
data must be set to output ambiguous nucleotides in order for this option to apply. The
algorithm takes as input the maximal number of ambiguous nucleotides allowed in the
sequence after trimming. If this maximum is set to e.g. 3, the algorithm finds the maximum
length region containing 3 or fewer ambiguities and then trims away the ends not included
in this region.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.3.2

Adapter trimming

Clicking Next will allow you to specify adapter trimming.

The CLC Genomics Workbench comes with a set of predefined adapter sequences from the most
common kits provided by the high-throughput sequencing vendors. You can easily add or modify
the adapters on this list in the preferences:
Edit | Preferences (

) | Data

This will display the adapter trim panel as shown in figure 2.28 where each row represents an
adapter sequence including the settings used for trimming.

Figure 2.28: Editing the set of adapters for adapter trimming.

At the bottom of the panel, you have the following options:
Add Default Rows. If you have deleted or changed the pre-defined set of adapters, you can
add them to the list using this button (note that they will not replace existing adapters).
Delete Row. Delete the selected adapter.
Add Row. Add a new empty row where you can specify your own adapter settings.
All the information in the panel can be edited by clicking or double-clicking. The Strand, Alignment
score and Action settings can also be modified when running the trim (see figure 2.34).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Action to perform when a match is found

For each read sequence in the input to trim, the Workbench performs a Smith-Waterman
alignment [Smith and Waterman, 1981] with the adapter sequence to see if there is a match
(details described below). When a match is found, the user can specify three kinds of actions:
Remove adapter. This will remove the adapter and all the nucleotides 5' of the match. All
the nucleotides 3' of the adapter match will be preserved in the read that will be retained
in the trimmed reads list. If there are no nucleotides 3' of the adapter match, the read is
added to the List of discarded sequences (see section 2.3.4).
Discard when not found. If a match is found, the adapter sequence is removed (including
all nucleotides 5' of the match as described above) and the rest of the sequence is retained
in the list of trimmed reads. If no match is found, the whole sequence is discarded and put
in the list of discarded sequences. This kind of adapter trimming is useful for small RNA
sequencing where the remnants of the adapter is an indication that this is indeed a small
RNA.
Discard when found. If a match is found, the read is discarded. If no match is found, the
read is retained in the list of trimmed reads. This can be used for quality checking the data
for linker contaminations etc.
When is there a match?
To determine whether there is a match there is a set of scoring thresholds that can be adjusted
and inspected by double-clicking the Alignment score column. This will bring up a dialog as
shown in figure 2.29.

Figure 2.29: Setting the scoring thresholds for adapter trimming.

At the top, you can choose the costs for mismatch and gaps. A match is rewarded one point (this
cannot be changed), and per default a mismatch costs 2 and a gap (insertion or deletion) costs
3. A few examples of adapter matches and corresponding scores are shown below.
In the panel below, you can set the Minimum score for a match to be accepted. Note that
there is a difference between an internal match and an end match. The examples above are

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

CGTATCAATCGATTACGCTATGAATG
||||||| ||||
TTCAATCGGTTAC

11 matches - 2 mismatches = 7

CGTATCAATCGATTACGCTATGAATG
|||||||||| ||||
ATCAATCGAT-CGCT

14 matches - 1 gap = 11

CGTATCAATCGATTACGCTATGAATG
|||||||
TTCAATCGGG

7 matches - 3 mismatches = 1

Figure 2.30: Three examples showing a sequencing read (top) and an adapter (bottom). The
examples are artificial, using default setting with mismatch costs = 2 and gap cost = 3.
all internal matches where the alignment of the adapter falls within the read. Below are a few
examples showing an adapter match at the end:

CGTATCAATCGATTACGCTATGAATG
|||||
GATTCGTAT

5 matches = 5 (as end match)

CGTATCAATCGATTACGCTATGAATG
|| ||||
GATTCGCATCA

6 matches - 1 mismatch = 4 (as end match)

CGTATCAATCGATTACGCTATGAATG
|||| |||||
CGTA-CAATC

9 matches - 1 gap = 6 (as end match)

CGTATCAATCGATTACGCTATGAATG
||||||||||
GCTATGAATG

10 matches = 10 (as internal match)

Figure 2.31: Four examples showing a sequencing read (top) and an adapter (bottom). The
examples are artificial.
In the first two examples, the adapter sequence extends beyond the end of the read. This is what
typically happens when sequencing e.g. small RNAs where you sequence part of the adapter.
The third example shows an example which could be interpreted both as an end match and an
internal match. However, the Workbench will interpret this as an end match, because it starts
at beginning (5' end) of the read. Thus, the definition of an end match is that the alignment of
the adapter starts at the read's 5' end. The last example could also be interpreted as an end
match, but because it is a the 3' end of the read, it counts as an internal match (this is because
you would not typically expect partial adapters at the 3' end of a read). Also note, that if Remove
adapter is chosen for the last example, the full read will be discarded because everything 5' of
the adapter is removed.
Below, the same examples are re-iterated showing the results when applying different scoring
schemes. In the first round, the settings are:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Allowing internal matches with a minimum score of 6

Not allowing end matches
Action: Remove adapter
The result would be the following (the retained parts are green):

CGTATCAATCGATTACGCTATGAATG
||||||| ||||
TTCAATCGGTTAC

11 matches - 2 mismatches = 7

CGTATCAATCGATTACGCTATGAATG
|||||||||| ||||
ATCAATCGAT-CGCT

14 matches - 1 gap = 11

CGTATCAATCGATTACGCTATGAATG
|||||||
TTCAATCGGG

7 matches - 3 mismatches = 1

CGTATCAATCGATTACGCTATGAATG
|||||
GATTCGTAT

5 matches = 5 (as end match)

CGTATCAATCGATTACGCTATGAATG
|| ||||
GATTCGCATCA

6 matches - 1 mismatch = 4 (as end match)

CGTATCAATCGATTACGCTATGAATG
|||| |||||
CGTA-CAATC

9 matches - 1 gap = 6 (as end match)

CGTATCAATCGATTACGCTATGAATG
||||||||||
GCTATGAATG

10 matches = 10 (as internal match)

Figure 2.32: The results of trimming with internal matches only. Red is the part that is removed
and green is the retained part. Note that the read at the bottom is completely discarded.
A different set of adapter settings could be:
Allowing internal matches with a minimum score of 11
Allowing end match with a minimum score of 4
Action: Remove adapter
The result would be:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

CGTATCAATCGATTACGCTATGAATG
||||||| ||||
TTCAATCGGTTAC

11 matches - 2 mismatches = 7

CGTATCAATCGATTACGCTATGAATG
|||||||||| ||||
ATCAATCGAT-CGCT

14 matches - 1 gap = 11

CGTATCAATCGATTACGCTATGAATG
|||||||
TTCAATCGGG

7 matches - 3 mismatches = 1

CGTATCAATCGATTACGCTATGAATG
|||||
GATTCGTAT

5 matches = 5 (as end match)

CGTATCAATCGATTACGCTATGAATG
|| ||||
GATTCGCATCA

6 matches - 1 mismatch = 4 (as end match)

CGTATCAATCGATTACGCTATGAATG
|||| |||||
CGTA-CAATC

9 matches - 1 gap = 6 (as end match)

CGTATCAATCGATTACGCTATGAATG
||||||||||
GCTATGAATG

10 matches = 10 (as internal match)

Figure 2.33: The results of trimming with both internal and end matches. Red is the part that is
removed and green is the retained part.
Other adapter trimming options
When you run the trim, you specify the adapter settings as shown in figure 2.34.
You select an adapter to be used for trimming by checking the checkbox next to the adapter
name. You can overwrite the settings defined in the preferences regarding Strand, Alignment
score and Action by simply clicking or double-clicking in the table.
At the top, you can specify if the adapter trimming should be performed in Color space. Note that
this option is only available for sequencing data imported using the SOLiD import (see section
2.1.3). When doing the trimming in color space, the Smith-Waterman alignment is simply done
using colors rather than bases. The adapter sequence is still input in base space, and the
Workbench then infers the color codes. Note that the scoring thresholds apply to the color space
alignment (this means that a perfect match of 10 bases would get a score of 9 because 10
bases are represented by 9 color residues). Learn more about color space in section 2.8.
Besides defining the Action and Alignment scores, you can also define on which strand the
adapter should be found. This can be done in two ways:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.34: Trimming your sequencing data for adapter sequences.

Defining either Plus or Minus for the individual adapter sequence (this can be done either
in the Preferences or in the dialog shown in figure 2.34). Note that all the definitions above
regarding 3' end and 5' end also apply to the minus strand (i.e. selecting the Minus strand
is equivalent to reverse complementing all the reads). The adapter in this case should be
defined as you would see it on the plus strand of the reverse complemented read. Figure
2.35 below shows a few examples of an adapter defined on the minus strand.
Checking the Search on both strands checkbox will search both the minus and plus strand
for the adapter sequence (the result would be equivalent to defining two adapters and
searching one on the plus strand and one on the minus strand).
Below is an example showing hits for an adapter sequence defined as CTGCTGTACGGCCAAGGCG,
searching on the minus strand. You can see that if you reverse complemented the adapter you

ACCGAGAAACGCCTTGGCCGTACAGCAG
|||||||||||||||||||

ACCGATAAACGCCTTGGCCGTACAGCAGATGCC
||||||||| |||||||||
18 matches - 2 mismatches = 16

19 matches = 19

CTGCTGTACGGCCAAGGCG
CTGCTGTACGGCCAAGGCG

Figure 2.35: An adapter defined as CTGCTGTACGGCCAAGGCG searching on the minus strand.

Red is the part that is removed and green is the retained part. The retained part is 3' of the
match on the minus strand, just like matches on the plus strand.
would find the hit on the plus strand, but then you would have trimmed the wrong end of the
read. So it is important to define the adapter as it is, without reverse complementing.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Below the adapter table you find a preview listing the results of trimming with the current settings
on 1000 reads in the input file (reads 1001-2000 when the read file is long enough). This is
useful for a quick feedback on how changes in the parameters affect the trimming (rather than
having to run the full analysis several times to identify a good parameter set). The following
information is shown:
Name. The name of the adapter.
Matches found. Number of matches found based on the strand and alignment score
settings.
Reads discarded. This is the number of reads that will be completely discarded. This can
either be because they are completely trimmed (when the Action is set to Remove adapter
and the match is found at the 3' end of the read), or when the Action is set to Discard
when found or Discard when not found.
Nucleotides removed. The number of nucleotides that are trimmed include both the ones
coming from the reads that are discarded and the ones coming from the parts of the reads
that are trimmed off.
Avg. length This is the average length of the reads that are retained (excluding the ones
that are discarded).
Note that the preview panel is only showing how the adapter trim affects the results. If other
kinds of trimming (quality or length trimming) is applied, this will not be reflected in the preview
but still influence the results.
Next time you run the trimming, your previous settings will automatically be remembered. Note
that if you change settings in the Preferences, they may not be updated when running trim
because the last settings are always used. Any conflicts are illustrated with text in italics. To
make the updated preference take effect, press the Reset to CLC Standard Settings ( ) button.

2.3.3

Length trimming

Clicking Next will allow you to specify length trimming as shown in figure 2.36.
At the top you can choose to Trim bases by specifying a number of bases to be removed from
either the 3' or the 5' end of the reads. Below you can choose to Discard reads below length.
This can be used if you wish to simply discard reads because they are too short. Similarly, you
can discard reads above a certain length. This will typically be useful when investigating e.g.
small RNAs (note that this is an integral part of the small RNA analysis together with adapter
trimming).

2.3.4

Trim output

Clicking Next will allow you to specify the output of the trimming as shown in figure 2.37.
No matter what is chosen here, the list of trimmed reads will always be produced. In addition the
following can be output as well:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.36: Trimming on length.

Figure 2.37: Specifying the trim output. No matter what is chosen here, the list of trimmed reads
will always be produced.
Create list of discarded sequences. This will produce a list of reads that have been
discarded during trimming. When only parts of the read has been discarded, it will now
show up in this list.
Create report. An example of a trim report is shown in figure 2.38. The report includes the
following:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Trim summary.

Name. The name of the sequence list used as input.

Number of reads. Number of reads in the input file.
Avg. length. Average length of the reads in the input file.
Number of reads after trim. The number of reads retained after trimming.
Percentage trimmed. The percentage of the input reads that are retained.
Avg. length after trim. The average length of the retained sequences.

Read length before / after trimming. This is a graph showing the number of reads of
various lengths. The numbers before and after are overlayed so that you can easily
see how the trimming has affected the read lengths (right-click the graph to open it in
a new view).
Trim settings A summary of the settings used for trimming.
Detailed trim results. A table with one row for each type of trimming:
Input reads. The number of reads used as input. Since the trimming is done
sequentially, the number of retained reads from the first type of trim is also the
number of input reads for the next type of trimming.
No trim. The number of reads that have been retained, unaffected by the trimming.
Trimmed. The number of reads that have been partly trimmed. This number plus
the number from No trim is the total number of retained reads.
Nothing left or discarded. The number of reads that have been discarded either
because the full read was trimmed off or because they did not pass the length
trim (e.g. too short) or adapter trim (e.g. if Discard when not found was chosen
for the adapter trimming).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
This will start the trimming process.
If you trim paired data, the result will be a bit special. In the case where one part of a paired read
has been trimmed off completely, you no longer have a valid paired read in your sequence list.
In order to use paired information when doing assembly and mapping, the Workbench therefore
creates two separate sequence lists: one for the pairs that are intact, and one for the single
reads where one part of the pair has been deleted. When running assembly and mapping, simply
select both of these sequence lists as input, and the Workbench will automatically recognize that
one has paired reads and the other has single reads.

2.4

De novo assembly

The de novo assembly algorithm of CLC Genomics Workbench offers comprehensive support for
a variety of data formats, including both short and long reads, and mixing of paired reads (both
insert size and orientation).
The de novo assembly process has two stages:
1. First, simple contig sequences are created by using all the information that are in the read
sequences. This is the actual de novo part of the process. These simple contig sequences
do not contain any information about which reads the contigs are built from. This part is
elaborated in section 2.4.1.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.38: A report with statistics on the trim results.

2. Second, all the reads are mapped using the simple contig sequence as reference. This is
done in order to show e.g. coverage levels along the contigs and enabling more downstream
analysis like SNP detection and creating mapping reports. Note that although a read aligns
to a certain position on the contig, it does not mean that the information from this read was
used for building the contig, because the mapping of the reads is a completely separate
part of the algorithm.
If you wish to only have the simple contig sequences as output, this can be chosen when starting
the de novo assembly (see section 2.4.9).

2.4.1

How it works

CLC bio's de novo assembly algorithm works by using de Bruijn graphs. This is similar to how
most new de novo assembly algorithms work [Zerbino and Birney, 2008, Zerbino et al., 2009, Li
et al., 2010, Gnerre et al., 2011]. The basic idea is to make a table of all sub-sequences of a
certain length (called words) found in the reads. The words are relatively short, e.g. about 20
for small data sets and 27 for a large data set (the word size is determined automatically, see
explanation below).
Given a word in the table, we can look up all the potential neighboring words (in all the examples
here, word of length 16 are used) as shown in figure 2.39.
Typically, only one of the backward neighbors and one of the forward neighbors will be present in

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.39: The word in the middle is 16 bases long, and it shares the 15 first bases with the
backward neighboring word and the last 15 bases with the forward neighboring word.
the table. A graph can then be made where each node is a word that is present in the table and
edges connect nodes that are neighbors. This is called a de Bruijn graph.
For genomic regions without repeats or sequencing errors, we get long linear stretches of
connected nodes. We may choose to reduce such stretches of nodes with only one backward
and one forward neighbor into nodes representing sub-sequences longer than the initial words.
Figure 2.40 shows an example where one node has two forward neighbors:

Figure 2.40: Three nodes connected, each sharing 15 bases with its neighboring node and ending
with two forward neighbors.
After reduction, the three first nodes are merged, and the two sets of forward neighboring nodes
are also merged as shown in figure 2.41.

Figure 2.41: The five nodes are compacted into three. Note that the first node is now 18 bases
and the second nodes are each 17 bases.
So bifurcations in the graph leads to separate nodes. In this case we get a total of three nodes
after the reduction. Note that neighboring nodes still have an overlap (in this case 15 nucleotides
since the word length is 16).
Given this way of representing the de Bruijn graph for the reads, we can consider some different
situations:
When we have a SNP or a sequencing error, we get a so-called bubble (this is explained in detail
in section 2.4.4) as shown in figure 2.42.

Figure 2.42: A bubble caused by a heterozygous SNP or a sequencing error.

Here, the central position may be either a C or a G. If this was a sequencing error occurring only
once, we would see that one path through the bubble will only be words seen a single time. On
the other hand if this was a heterozygote SNP we would see both paths represented more or
less equally. Thus, having information about how many times this particular word is seen in all
the reads is very useful and this information is stored in the initial word table together with the
words.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

The most difficult problem for de novo assembly is repeats. Repeat regions in large genomes
often get very complex: a repeat may be found thousands of times and part of one repeat may
also be part of another repeat. Sometimes a repeat is longer than the read length (or the paired
distance when pairs are available) and then it becomes impossible to resolve the repeat. This
is simply because there is no information available about how to connect the nodes before the
repeat to the nodes after the repeat.
In the simple example, if we have a repeat sequence that is present twice in the genome, we
would get a graph as shown in figure 2.43.

Figure 2.43: The central node represents the repeat region that is represented twice in the genome.
The neighboring nodes represent the flanking regions of this repeat in the genome.
Note that this repeat is 57 nucleotides long (the length of the sub-sequence in the central node
above plus regions into the neighboring nodes where the sequences are identical). If the repeat
had been shorter than 15 nucleotides, it would not have shown up as a repeat at all since the
word length is 16. This is an argument for using long words in the word table. On the other hand,
the longer the word, the more words from a read are affected by a sequencing error. Also, for
each extra nucleotide in the words, we get one less word from each read. This is in particular an
issue for very short reads. For example, if the read length is 35, we get 16 words out of each
read of the word length is 20. If the word length is 25, we get only 11 words from each read.
To strike a balance, CLC bio's de novo assembler chooses a word length based on the amount
of input data: the more data, the longer the word length. It is based on the following:
word
word
word
word
word
word
word
word
word
word
word
word
word
word
word
word
word
word
word
etc.

size
size
size
size
size
size
size
size
size
size
size
size
size
size
size
size
size
size
size

12:
13:
14:
15:
16:
17:
18:
19:
20:
21:
22:
23:
24:
25:
26:
27:
28:
29:
30:

0 bp - 30000 bp
30001 bp - 90002 bp
90003 bp - 270008 bp
270009 bp - 810026 bp
810027 bp - 2430080 bp
2430081 bp - 7290242 bp
7290243 bp - 21870728 bp
21870729 bp - 65612186 bp
65612187 bp - 196836560 bp
196836561 bp - 590509682 bp
590509683 bp - 1771529048 bp
1771529049 bp - 5314587146 bp
5314587147 bp - 15943761440 bp
15943761441 bp - 47831284322 bp
47831284323 bp - 143493852968 bp
143493852969 bp - 430481558906 bp
430481558907 bp - 1291444676720 bp
1291444676721 bp - 3874334030162 bp
3874334030163 bp - 11623002090488 bp

This pattern (multiplying by 3) continues until word size of 64 which is the max. Please note that
the range of word sizes is 12-24 on 32-bit computers and 12-64 on 64-bit computers. See how

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

to adjust the word size in section 2.4.9

2.4.2

Resolve repeats using reads

Having build the de Bruijn graph using words CLC bio's de novo assembler removes repeats and
errors using reads. This is done in the following order:
Remove weak edges
Remove dead ends
Resolve repeats using reads without conflicts
Resolve repeats with conflicts
Remove weak edges
Remove dead ends
Each phase will be explained in the following subsections.
Remove weak edges
The de Bruijn graph is expected to contain artifacts from errors in the data. The number of reads
agreeing upon an error is likely to be low especially compared to the number of reads without
errors for the same region. When this relative difference is large enough, it's possible to conclude
something is an error.
In the remove weak edges phase we consider each node and calculate the number c1 of edges
connected to the node and the number of times k1 a read is passing through these edges. An
average of reads going through an edge is calculated avg1 = k1 /c1 and then the process is
repeated using only those edges which have more than or equal avg1 reads going though it. Let
c2 be the number of edges which meet this requirement and k2 the number of reads passing
through these edges. A second average avg2 = k2 /c2 is used to calculate a limit,
limit =

log(avg2 ) avg2
+
2
40

and each edge connected to the node which has less than or equal limit number of reads
passing through it will be removed in this phase.
Remove dead ends
Some read errors might occur more often than expected, either by chance or because they are
systematic sequencing errors. These are not removed by the "Remove weak edges" phase and
will cause "dead ends" to occur in the graph which are short paths in the graph that terminate
after a few nodes. Furthermore, the "Remove weak edges" sometimes only removes a part of
the graph which will also leave dead ends behind. Dead ends are identified by searching for
paths in the graph where there exits an alternative path containing four times more nucleotides.
All nodes in such paths are then removed in this step.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Resolve repeats without conflicts

Repeats and other shared regions between the reads lead to ambiguities in the graph. These
must be resolved otherwise the region will be output as multiple contigs, one for each node in
the region.
The algorithm for resolving repeats without conflicts considers a number of nodes called the
window. To start with, a window only contains one node, say R. We also define the border nodes
as the nodes outside the window connected to a node in the window. The idea is to divide the
border nodes into sets such that border nodes A and C are in the same set if there is a read
going through A, through nodes in the window and then through C. If there are strictly more than
one of these sets we can resolve the repeat area, otherwise we expand the window.

Figure 2.44: A set of nodes.

In the example in figure 2.44 all border nodes A, B, C and D are in the same set since one can
reach every border nodes using reads (shown as red lines). Therefore we expand the window and
in this case add node C to the window as shown in figure 2.45.

Figure 2.45: Expanding the window to include more nodes.

After the expansion of the window, the border nodes will be grouped into two groups being set A,
E and set B, D, F. Since we have strictly more than one set, the repeat is resolved by copying the
nodes and edges used by the reads which created the set. In the example the resolved repeat is
shown in figure 2.46.

Figure 2.46: Resolving the repeat.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

The algorithm for resolving repeats without conflict can be described the following way:
1. A node is selected as the window
2. The border is divided into sets using reads going through the window. If we have multiple
sets, the repeat is resolved.
3. If the repeat cannot be resolved, we expand the window with nodes if possible and go to
step 2.
The above steps are performed for every node.
Resolve repeats with conflicts
In the previous section repeats were resolved without excluding any reads that goes through the
window. While this lead to a simpler graph, the graph will still contain artifacts which have to be
removed. The next phase removes most of these errors and is similar to the previous phase:
1. A node is selected as the initial window
2. The border is divided into sets using reads going through the window. If we have multiple
sets, the repeat is resolved.
3. If the repeat cannot be resolved, the border nodes are divided into sets using reads going
through the window where reads containing errors are excluded. If we have multiple sets,
the repeat is resolved.
4. The window is expanded with nodes if possible and step 2 is repeated.
The algorithm described above is similar to the algorithm using in previous section except step
3, where the reads with errors are excluded. This is done by calculating an average avg1 = m1 /c1
where m1 is the number of reads going through the window and c1 is the number of distinct
pairs of border nodes having one (or more) of these reads connecting them. A second average
avg2 = m2 /c2 is calculated where m2 is the number of reads going through the window having
at least avg1 or more reads connecting their border nodes and c2 the number of distinct pairs
of border nodes having avg1 or more reads connecting them. Then, a read between two border
nodes B and C is excluded if the number of reads going through B and C is less than or equal to
limit given by
log(avg2 ) avg2
limit =
+
2
16
An example were we resolve a repeat with conflicts is given in 2.47 where we have a total
of 21 reads going through the window with avg1 = 21/3 = 7, avg2 = 20/2 = 10 and limit =
1/2 + 10/16 = 1.125. Therefore all reads between border nodes B and C are excluded resulting
in two sets of border nodes A, C and B, D. The resolved repeat is shown in figure 2.48.

2.4.3

Optimization of the graph using paired reads

When paired reads are available, we can use the paired information to resolve large repeat
regions that are not spanned by individual reads, but are spanned by read pairs. Given a set
of paired reads that align to two nodes connected by a repeat region, the repeat region may be

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.47: A repeat with conflicts.

Figure 2.48: Resolving a repeat with conflicts.

resolved for those nodes if we can find a path connecting the nodes with a length corresponding
to the paired read distance. However, such a path must be supported by a minimum of four sets
of paired reads before the repeat is resolved.
If it's not possible to resolve the repeat, scaffolding is performed where paired read information
is used to determine the distances between contigs and the orientation of these. Scaffolding
is only considered between contigs with a minimum length of 120 to ensure that enough paired
read information is available. An iterative greedy approach is used when performing scaffolding
where short gaps are closed first, thus increasing the paired read information available for closing
gaps (see figure 2.49).

Figure 2.49: Performing iterative scaffolding of the shortest gaps allows long pairs to be optimally
used. i1 shows three contigs with dashed arches indicating potential scaffolding. i2 is after first
iteration when the shortest gap has been closed and long potential scaffolding has been updated.
i3 is the final results with three contigs in one scaffold.
Contigs in the same scaffold are output as one large contig with Ns inserted in between. The
number of Ns inserted correspond to the estimated distance between contigs which is calculated
based on the paired read information. More precisely, for each set of paired reads spanning two
contigs a distance estimate is calculated based on the supplied distance between the reads.
The average of these distances is then used as the final distance estimate. It is possible to get
a negative distance estimate which happens when the paired information indicate that contigs
overlap but for some reason could not be joined in the graph. Additional information about
repeats being resolved using paired reads and scaffolded contigs is available as annotations on

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

the contig sequences and as summary in the report (see section 2.6.2).There are three types of
annotations:
Scaffold refers to the estimated gap region between two contigs where Ns are inserted.
The region may have a negative size and therefore not contain any Ns.
Contigs joined is when a repeat or another ambiguous structure in the graph was solved
using paired reads, thus enabling the join of two contigs.
Alternatives excluded refers to the exclusion of an unknown graph structure using paired
reads which resulted in a join of two contigs.

2.4.4

Bubble resolution

Before the graph structure is converted to contig sequences, bubbles are resolved. As mentioned
previously, a bubble is defined as a bifurcation in the graph where a path furcates into two nodes
and then merge back into one. An example is shown in figure 2.50.

Figure 2.50: A bubble caused by a heteroygous SNP or a sequencing error.

In this simple case the assembler will collapse the bubble and use the variant that has the
highest count of words. For a diploid genome with a heterozygous variant, there will a fifty-fifty
distribution of reads on the two variants, and this means that the choice of one allele over the
other will be arbitrary. If heterozygous variants are important, they can be identified after the
assembly by mapping the reads back to the contig sequences and performing standard variant
calling. For random sequencing errors, it is more straightforward; given a reasonable level of
coverage, the erroneous variant will be suppressed.
Figure 2.51 shows an example of a data set where the reads have systematic errors. Some
reads include five As and others have six. This is a typical example of the homopolymer errors
seen with the 454 and Ion Torrent platforms.

Figure 2.51: Reads with systematic errors.

When these reads are assembled, this site will give rise to a bubble in the graph. This is not a
problem in itself, but if there are several of these sites close together, the two paths in the graph
will not be able to merge between each site. This happens when the distance between the sites
is smaller than the word size used (see figure 2.52).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.52: Several sites of errors that are close together compared to the word size.
In this case, the bubble will be very large because there are no complete words in the regions
between the homopolymer sites, and the graph will look like figure 2.53.

Figure 2.53: The bubble in the graph gets very large.

If the bubble is too large, the assembler will have to break it into several separate contigs instead
of producing one single contig.
The maximum size of bubbles that the assembler should try to resolve can be set by the user. In
the case from figure 2.53, a bubble size spanning the three error sites will mean that the bubble
will be resolved (see figure 2.54).

Figure 2.54: The bubble size needs to be set high enough to encompass the three sites.
The bubble size is especially important for reads generated by sequencing platforms yielding long
reads with either systematic errors or a high error rate. In this case, a higher bubble size is
recommended. Our benchmarks indicate that setting the bubble size at approximately twice the
read length will produce a good result. But please use this as an advice for a starting point for
testing different settings rather than a solid rule to apply at all times.

2.4.5

Converting the graph to contig sequences

The output of the assembly is not a graph but a list of contig sequences. When all the previous
optimization and scaffolding steps have been performed, a contig sequence will produced for
every non-ambiguous path in the graph. If the path cannot be fully resolved, Ns are inserted as
an estimation of the distance between two nodes as explained in section 2.4.3.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.4.6

Summary

So in summary, the de novo assembly algorithm goes through these stages:

Make a table of the words seen in the reads.
Build a de Bruijn graph from the word table.
Use the reads to resolve the repeats in the graph.
Use the information from paired reads to resolve larger repeats and perform scaffolding if
necessary.
Output resulting contigs based on the paths, optionally including annotations from the
scaffolding step.
These stages are all performed by the assembler program.

2.4.7

Randomness in the results

A side-effect of the very compact data structures needed in order to keep the memory consumption
low, is that the results will vary slightly from run to run, using the same data set. When counting
the number of occurrences of a word, the assembler does not keep track of the exact number
(which would consume a lot of memory) but uses an approximation which relies on some
probability calculations. When using a multi-threaded CPU, the data structure is build in different
ways for each run, and this means that the probability calculations for certain parts of the
algorithm will be a bit different from run to run. This leads to differences in the results.
It should be noted that the differences are minor and will not affect the overall results. Keep in
mind that whether you use CLC bio's assembler or other assemblers, there will never be one
correct answer to the problem of de novo assembly. In this perspective, the small differences
should not be considered a problem.

2.4.8

SOLiD data support in de novo assembly

SOLiD sequencing is done in color space. When viewed in nucleotide space this means that a
single sequencing error changes the remainder of the read. An example read is shown in figure
2.55.

Figure 2.55: How an error in color space leads to a phase shift and subsequent problems for the
rest of the read sequence
Basically, this color error means that C's become A's and A's become C's. Likewise for G's and
T's. For the three different types of errors, we get three different ends of the read. Along with
the correct reads, we may get four different versions of the original genome due to errors. So if
SOLiD reads are just regarded in nucleotide space, we get four different contig sequences with
jumps from one to another every time there is a sequencing error.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Thus, to fully accommodate SOLiD sequencing data, the special nature of the technology has to
be considered in every step of the assembly algorithm. Furthermore, SOLiD reads are fairly short
and often quite error prone. Due to these issues, we have chosen not to include SOLiD support
in the first algorithm steps, but only use the SOLiD data where they have a large positive effect
on the assembly process: when applying paired information.

2.4.9

De novo assembly parameters

To start the assembly:

Toolbox | High-throughput Sequencing (

) | De Novo Assembly (

In this dialog, you can select one or more sequence lists or single sequences.
Click Next to set the parameters for the assembly. This will show a dialog similar to the one in
figure 2.56.

Figure 2.56: Setting parameters for the assembly.

At the top, you select the Word size and the Bubble size to be used. The principles of setting
the word size are described in section 2.4.1. When using automatic calculation, you can see the
word size in the History ( ) of the result files. Please note that the range of word sizes is 12-24
on 32-bit computers and 12-64 on 64-bit computers. The meaning of the bubble size parameter
is explained in section 2.4.4. The bubble size used when the setting is automatic is 50 for reads
shorter than 110 bp, and for longer reads it is the average read length. The value used is also
recorded in the History ( ) of the result files.
The next option is to specify Guidance only reads. Only the pair information on these reads will
be used, and the reads will only contribute in the scaffolding step. The construction of the word
table and the graph will not be based on these reads. An example of a use case for this is SOLiD
data which has a high error rate when used in base space. By using SOLiD for guidance only, it
is possible to make use of the pair information without having the errors complicating the graph.
You can also specify the Minimum contig length when doing de novo assembly. Contigs below

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

this length will not be reported. The default value is 200 bp.
Finally, there is an option to Perform scaffolding. The scaffolding step is explained in greater
detail in section 2.4.3. This will also cause scaffolding annotations to be added to the contig
sequences (except when you also choose to Update contigs, see below).
When you click Next, you will see the dialog shown in figure 2.57

Figure 2.57: Parameters for mapping reads back to the contigs.

At the top, you choose whether a read mapping should be performed after the initial contig
creation. If you choose to do that, you can specify the parameters for the read mapping. These
are all explained in section 2.5.3.
At the bottom, you can choose to Update contigs based on mapped reads. This means that
the original contig sequences produced from the de novo assembly will be updated to reflect the
mapping of the reads (in most cases it will mean no change, but in some cases, the subsequent
mapping step leads to new information). In effect, this means that all contig sequences in the
output will be supported by at least one read mapped back. Note that if this option is selected,
the contig lengths may get below the threshold specified in figure 2.56 because this threshold is
applied to the original contig sequences. If the Update contigs based on mapped reads option
is not selected, the original contig sequences from the assembler will be preserved completely
also in situations where the reads that are mapped back do not support the contig sequences.
If you update the contigs, it means that scaffolding annotations will not be added to the contig
sequences (since the contig sequences may change in this process it is not possible to place
these annotations correctly). This in turn affects the de novo assembly report which will not have
statistics about scaffolding when the update contigs option is selected.

2.4.10

De novo assembly report

In the last dialog of the de novo assembly, you can choose to create a report of the results (see
figure 2.58).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.58: Creating a de novo assembly report.

The report contains the following information when both scaffolding and read mapping is
performed:
Nucleotide distribution . This includes Ns when scaffolding has been performed.
Contig measurements . This section includes statistics about the number and lengths of contigs.
When scaffolding is performed and the update contigs option is not selected, there will be
two separate sections with these numbers: one including the scaffold regions with Ns and
one without these regions.
N25, N50 and N75 . The N25 contig set is calculated by summarizing the lengths of the
biggest contigs until you reach 25 % of the total contig length. The minimum contig
length in this set is the number that is usually used to report the N25 value of a de
novo assembly. The same goes with N50 and N75 which are the 50 % and 75 % of
the total contig length, respectively.
Minimum, maximum and average . This refers to the contig lengths.
Count The total number of contigs.
Total The number of bases in the result. This can be used for comparison with the
estimated genome size to evaluate how much of the genome sequence is included in
the assembly.
Contig length distribution . A graph showing the number of contigs of different lengths.
Accumulated contig lengths . This shows the summarized contig length on the y axis and the
number of contigs on the x axis, with the biggest contigs ranked first. This answers the
question: how many contigs are needed to cover e.g. half of the genome.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Mapping information . The rest of the sections provide statistics from the read mapping (if
performed). These are explained in section 2.6.2.

2.5

Map reads to reference

This section describes how to map a number of sequence reads to one or more reference
sequences. When the reads come from a set of known sequences with relatively few variations,
read mapping is often the right approach to assembling the data. The result of mapping reads to
a reference is a "mapping" or a "mapping table" which is the term we use for an alignment of
reads against a reference sequence.

2.5.1

Starting the read mapping

To start the read mapping:

Toolbox | High-throughput Sequencing (

) | Map Reads to Reference (

In this dialog, select the sequences or sequence lists containing the sequencing data. Note that
the reference sequences should be selected in the next step.
When the sequences are selected, click Next, and you will see the dialog shown in figure 2.59.

Figure 2.59: Specifying the reference sequences and masking.

At the top you select one or more reference sequences by clicking the Browse and select
element ( ) button. You can select either single sequences or a list of sequences as reference
sequences. When multiple reference sequence are used, the result of the mapping will be a
mapping table with one entry per reference sequence.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.5.2

Including or excluding regions (masking)

The next part of the dialog lets you mask the reference sequences. Masking refers to a
mechanism where parts of the reference sequence are not considered in the mapping. This
can be extremely useful for example when mapping human data, where more than 50 % of the
sequence consists of repeats. Note that you should be careful masking all the repeat regions
if your sequenced data contains the repeats. If you do that, some of the reads that would have
matched a masked repeat region perfectly may be placed wrongly at another position even with
a less-perfect match and lead to wrong results.
In order to mask e.g. repeat regions when doing read mapping, the repeat regions have to be
annotated on the reference sequences.
Because the masking is based on annotations, any kind of annotations can be selected for
masking. This means that you can choose to e.g. only map against the genes in the genome, or
only the exons. As long as the reference sequences contain the relevant information in the form
of annotations, it can be masked.
To mask a reference sequence, first click the Include / exclude regions checkbox, and second
click the Select annotation type ( ) button.
This will bring up a dialog with all the annotation types of the reference sequences listed to the
left. Select one or more annotation types and click Add ( ) button. Then select at the bottom
whether you wish to Include or Exclude these annotation types. If you include, it means that only
the regions covered by the selected type of annotations will be used in the read mapping. If you
exclude, it means that all of the reference sequences except the regions covered by the selected
type of annotations will be used in the read mapping.
You can see an example in figure 2.60.

Figure 2.60: Masking for repeats. The repeat region annotation type is selected and excluded in
the mapping.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.5.3

Mapping parameters

Click Next to set the parameters for the mapping. This will show a dialog similar to the one in
figure 2.61.

Figure 2.61: Setting parameters for mapping.

In order to understand what is going on here, a little explanation is needed: The CLC Genomics
Workbench supports assembly of mixed data sets. This means that you can assemble and map
both short reads, long reads, single reads and paired reads in one go. This makes it easy to
combine the information from different sources, but it also makes the parameters a little more
complex, because each data set may need its own parameters.
At the top of the dialog shown in figure 2.61 is a table of all the sequence lists that were chosen
in the first step. Clicking one of the lists shows the parameters that will be used this particular
data set. Note that the Workbench automatically categorizes each of the lists into short/long
reads and single/paired. Reads are considered short when they are less than 56 nucleotides,
unless the data is in color space where the long reads algorithm is always applied regardless of
the read length.
In the example in figure 2.61, you first adjust the parameters for the data set called
s_1_1_sequence and then click the next data set called Ecoli.FLX and adjust parameters for this data set (as shown in figure 2.62). Because these data sets are different in terms
of length and single/paired content, you have to set the parameters for each one. If you had two
similar data sets, you could select both of them in the table and then change the settings for
both.
Each of the parameters are described below:
Common parameters for short and long reads
Three parameters are identical for both short and long reads:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.62: Setting parameters for the mapping.

Mismatch cost The cost of a mismatch between the read and the reference sequence.
Insertion cost The cost of an insertion in the read (causing a gap in the reference sequence)
Deletion cost The cost of having a gap in the read.
Global alignment Per default, the reads are aligned locally, allowing a number of "unaligned"
nucleotides at the ends of the read. By selecting the global alignment option, you force the
whole read to be aligned to the reference. Mismatches at the ends will then count as any
other mismatch.
The score for a match is always 1.
Short reads parameters
For short reads, there is a threshold that determines whether the read should be included in the
mapping:
Limit The relationship between the length of the read and the score. A limit of 8 (which is default)
means that the total score for the alignment has to be more than the length of the read
minus 8. This is explained in detail with examples below. This means that with the default
costs, two mismatches, two deletions or two insertions will be allowed. If no mismatches
or gaps are involved, it means that up to 8 unaligned nucleotides in the ends would be
allowed. For very short reads, a limit of 5 could typically be used instead, allowing up to one
mismatch and two unaligned nucleotides in the ends (or no mismatches and five unaligned
nucleotides).
Given a certain quality threshold, it is possible to guarantee that all optimal ungapped alignments
are found for each read. Alignments of short reads to reference sequences usually contain no

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

gaps, so the short read assembly operates with a strict scoring threshold to allow the user to
specify the amount of errors to accept.
With other short read mapping programs like Maq and Soap, the threshold is specified as the
number of allowed mismatches. This works because those programs do global alignment. For
local alignments it is a little more complicated.
The default alignment scoring scheme for short reads is +1 for matches and -2 for mismatches.
The limit for accepting an alignment is given as the alignment score relative to the read length.
For example, if the score limit is 8 below the length, up to two mismatches are allowed as well
as two ending nucleotides not assembled (remember that a mismatch costs 2 points, but when
there is a mismatch, a potential match is also lost). Alternatively, with one mismatch, up to 5
unaligned positions are allowed. Or finally, with no mismatches, up to 8 unaligned positions are
allowed. See figure 2.63 for examples. The default setting is exactly this limit of 8 below the
length.
CGTATCAATCGATTACGCTATGAATG
||||||||||||||||||||
ATCAATCGATTACGCTATGA

CGTATCAATCGATTACGCTATGAATG
|||||||||||||||||||
TTCAATCGATTACGCTATGA

CGTATCAATCGATTACGCTATGAATG
|||||||| |||||||||||
ATCAATCGGTTACGCTATGA

CGTATCAATCGATTACGCTATGAATG
||||||| |||||||||||
TTCAATCGGTTACGCTATGA

CGTATCAATCGATTACGCTATGAATG
||||||| ||||||||||
CTCAATCGGTTACGCTATGA

CGTATCAATCGATTACGCTATGAATG
||||| || |||||||||||
ATCAACCGGTTACGCTATGA

CGTATCAATCGATTACGCTATGAATG
||||||| |||| ||||||
TTCAATCGGTTACCCTATGA

CGTATCAATCGATTACGCTATGAATG
|||||||||| ||||
ATCAATCGATTGCGCTCTTT

CGTATCAATCGATTACGCTATGAATG
||||||| |||| |||||
TTCAATCGGTTACCCTATGC

CGTATCAATCGATTACGCTATGAATG
||||||||||||
AGCTATCGATTACGCTCTTT

Figure 2.63: Examples of ungapped alignments allowed for a 20 bp read with a scoring limit
of 8 below the length using the default scoring scheme. The scores are noted to the right of
each alignment. For reads this short, a limit of 5 would typically be used instead, allowing up to
one mismatch and two unaligned nucleotides in the ends (or no mismatches and five unaligned
nucleotides).
Note that if you choose to do global alignment, the default setting means that up to two
mismatches are allowed (because "unaligned positions" at the ends are counted as mismatches
as well).
The match score is always +1. If the mismatch cost is changed, the default score limit will also
change to:
score limit = 3 (1 + mismatch cost) 1
The default mismatch score of -2 equals a mismatch cost of 2 and a score limit of 8 below the
read length, as stated above. For any mismatch cost, the default score limit allows any alignment
scoring strictly better than 3 mismatches.
The maximum score limit also depends on the mismatch cost:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

max score limit = 4 (1 + mismatch cost) 1

Gapped alignment is also allowed for short reads. Contrary to ungapped alignments, it is very
difficult to guarantee that all gapped alignments of a certain quality are found. The scoring limit
discussed above applies to both gapped and ungapped alignments and there is a guarantee
that there are no ungapped exceeding the limit, but there is is no such guarantee for gapped
alignments. This being said, the program does a good effort to find the best gapped alignments
and usually succeeds. Besides the limit, there are also two options related to mapping of color
space data (from SOLiD systems). If you do not have color space data, these will be disabled
and are not relevant.
Color space alignment This will determine if mapping is to be performed in color space. This is
strongly recommended for SOLiD data.
Color error cost The cost of a color error.
An example of a color space data set is shown in figure 2.64.

Figure 2.64: Setting parameters for the mapping.

For more details about this, please see section 2.8 which explains how color space mapping is
performed in greater detail.
Long reads parameters
For long reads, the read mapping as two stages: First, the optimal alignment of the read is
found, based on the costs specified above (e.g. to favor mismatches over indels). Second, a
filtering process determines whether this match is good enough for the read to be included in the
alignment. The filtering threshold is determined by two fractions:
Length fraction Set minimum length fraction of a read that must match the reference sequence.
Setting a value at 0.5 means that at least half the read needs to match the reference
sequence for the read to be included in the final mapping.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Similarity Set minimum fraction of identity between the read and the reference sequence. If you
want the reads to have e.g. at least 90% identity with the reference sequence in order to
be included in the final mapping, set this value to 0.9. Note that the similarity fraction does
not apply to the whole read; it relates to the Length fraction. With the default values, it
means that at least 50 % of the read must have at least 90 % identity.
Paired reads
At the bottom you can specify how Paired reads should be handled. You can read more about
how paired data is imported and handled in section 2.1.8. If the sequence list used as input
contains paired reads, this option will automatically be shown - if it contains single reads, this
option will not be shown.
For the paired reads, you can specify a distance interval between the two sequences in a pair.
This will be used to determine how far it can expect the two reads to be from each other. This
value includes the length of the read sequence as well (not just the distance in between). If
you set this value very precisely, you will miss some of the opportunities to detect genomic
rearrangements as described in section 2.9.3. On the other hand, a precise distance interval will
give a more accurate assembly in the places where there are not significant variation between
the sequencing data and the reference sequence.
We recommend running the detailed mapping report (see section 2.6.1) and check that the
paired distances reported show a nice distribution and that not too many pairs are broken.
The approach taken for determining the placement of read pairs is the following:
First, all the optimal placements for the two individual reads are found.
Then, the allowed placements according to the paired distance interval are found.
If both reads can be placed independently but no pairs satisfies the paired criteria, the
reads are treated as independent and not marked as a pair.
If only one pair of placements satisfy the criteria, the reads are placed accordingly and
marked as uniquely placed even if either read may have multiple optimal placements.
If several placements satisfy the paired criteria, the read is treated as a "non-specific
match" (see section 2.5.4 for more information.)
By default, mapping is done with local alignment of reads to a set of reference sequences.
The advantage of performing local alignment instead of global alignment is that the ends are
automatically removed if there are sufficiently many sequencing errors there. If the ends of the
reads contain vector contamination or adapter sequences, local alignment is also desirable. Note
that the aligned region has to be greater than the length threshold set.

2.5.4

General mapping options

When you click Next, you will see the dialog shown in figure 2.65
At the top, you can choose to Add conflict annotations to the consensus sequence. Note that
there may be a huge number of annotations and that it may give a visually cluttered overview of

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.65: Conflict resolution and annotation.

the mapping of the reads. A subtle detail about the annotations - if you add annotations, you will
be able to see resolved conflicts in the table view ( ) of the mapping (e.g. if you edit the bases
after mapping). If there are no annotations, only the non-resolved conflicts are shown.
If there is a conflict between reads, i.e. a position where there is disagreement about which base
is correct, you can specify how the consensus sequence should reflect the conflict:
Vote (A, C, G, T). The conflict will be solved by counting instances of each nucleotide and
then letting the majority decide the nucleotide in the consensus. In case of equality, ACGT
are given priority over one another in the stated order.
Unknown nucleotide (N). The consensus will be assigned an 'N' character in all positions
with conflicts.
Ambiguity nucleotides (R, Y, etc.). The consensus will display an ambiguity nucleotide
reflecting the different nucleotides found in the reads. For an overview of ambiguity codes,
see Appendix ??.
At the bottom of the dialog, you can specify how Non-specific matches should be treated. The
concept of Non-specific matches refers to a situation where a read aligns at more than one
position. In this case you have two options:
Random. This will place the read in one of the positions randomly.
Ignore. This will not include the read in the final mapping.
Note that a read is only considered non-specific when the read matches equally well at several
alignment positions. If there are e.g. two possible alignment positions and one of them is a
perfect match and the other involves a mismatch, the read is placed at the position with the
perfect match and it is not marked as a non-specific match.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.5.5

Assembly reporting options

Click Next lets you choose how the output of the assembly should be reported (see figure 2.66).

Figure 2.66: Assembly reporting options.

First, you can choose to save or open the results, and if you wish to see a log of the process
(see section ??).
No matter what you choose, you will always see the visual read mapping, but in addition you
have two extra output options:
Create Report. This will generate a summary report as described in section 2.6.2.
Create list of non-mapped sequences. This will put all the reads that could not be mapped
to the reference into a sequence list.
If you have used more than one reference sequence, the Workbench creates a table which makes
it easier to get an overview. The table includes this information:
1. Length of reference sequence
2. Length of consensus sequence
3. Number of reads
4. Average coverage
5. Total number of conflicts
Double-clicking one of the rows in the table will open the corresponding mapping. Furthermore,
you can select a number of rows and click the Open Consensus at the bottom of the table. That
will open a sequence list of all the consensus sequences of the selected rows.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Clicking Finish will start the mapping. See section ?? for general information about viewing
and editing the resulting mappings. For special information about genome-size mapping, see
section 2.9.

2.6

Mapping reports

You can create two kinds of reports regarding read mappings and de novo assemblies: First, you
can choose to generate a summary report about the mapping process itself (see section 2.5.5).
This report is described in section 2.6.2 below. Second, you can generate a detailed statistics
report after the mapping or assembly has finished. This report is useful if you want to generate
statistics across results made in different processes, and it generates more detailed statistics
than the summary mapping report. This report is described below.

2.6.1

Detailed mapping report

To create a detailed mapping report:

Toolbox | High-throughput Sequencing (

) | Create Detailed Mapping Report (

This opens a dialog where you can select mapping results ( )/ ( ) or RNA-Seq analysis results
( ) (see sections 2.4 and 2.5 for information on how to create a contig and section 2.14 for
information on how to create RNA-Seq analysis results).
Clicking Next will display the dialog shown in figure 2.67

Figure 2.67: Parameters for mapping reports.

The first option is to set thresholds for grouping long and short contigs. The grouping is used
to show statistics like number of contigs, mean length etc for the contigs in each group. This
is only relevant for de novo assemblies. Note that the de novo assembly in the CLC Genomics
Workbench per default only reports contigs longer than 200 bp (this can be changed when running
the assembly).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Click Next to select output options as shown in figure 2.68

Figure 2.68: Optionally create a table with detailed statistics per reference.
Per default, an overall report will be created as described below. In addition, by checking Create
table with statistics for each reference you can create a table showing detailed statistics for
each reference sequence (for de novo results the contigs act as reference sequences, so it will
be one row per contig). The following sections describe the information produced.
Reference sequence statistics
For reports on results of read mapping, section two concerns the reference sequences. The
reference identity part includes the following information:
Reference name The name of the reference sequence.
Reference Latin name The reference sequence's Latin name.
Reference description Description of the reference.
If you want to inspect and edit this information, right-click the reference sequence in the contig
and choose Open This Sequence and switch to the Element info ( ) tab (learn more in section
??). Note that you need to create a new report if you want the information in the report to be
updated. If you update the information for the reference sequence within the contig, you should
know that it doesn't affect the original reference sequence saved in the Navigation Area.
The next part of the report reports coverage statistics including GC content of the reference
sequence. Note that coverage is reported on two levels: including and excluding zero coverage
regions. In some cases, you do not expect the whole reference to be covered, and only the
coverage levels of the covered parts of the reference sequence are interesting. On the other
hand, if you have sequenced the full genome that you use as reference, the overall coverage is
probably the most relevant number (i.e. including zero coverage regions).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

A position on the reference is counted as "covered" when at least one read is aligned to it. Note
that unaligned ends (faded nucleotides at the ends) that are produced when mapping using local
alignment do not contribute to the coverage. In the example shown in figure 2.69, there is a
region of zero coverage in the middle and one time coverage on each side. Note that the gaps to
the very right are within the same read which means that these two positions on the reference
sequence are still counted as "covered".

Figure 2.69: A region of zero coverage in the middle and one time coverage on each side. Note
that the gaps to the very right are within the same read which means that these two positions on
the reference sequence are still counted as "covered".
The identity section is followed by some statistics on the zero-coverage regions; the number,
minimum and maximum length, mean length, standard deviation, total length and a list of the
regions. If there are too many regions, they will not all be listed in the report (if there are more
than 20, only the first 10 are reported).
Next follow two bar plots showing the distribution of coverage with coverage level on the x-axis and
number of contig positions with that coverage on the y-axis. An example is shown in figure 2.70.

Figure 2.70: Distribution of coverage - to the left for all the coverage levels, and to the right for
coverage levels within 3 standard deviations from the mean.
The graph to the left shows all the coverage levels, whereas the graph to the right shows
coverage levels within 3 standard deviations from the mean. The reason for this is that for

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

complex genomes, you will often have a few regions with extremely high coverage which will
affect the resolution of the graph, making it impossible to see the coverage distribution for the
majority of the contigs. These coverage outliers are excluded when only showing coverage within
3 standard deviations from the mean. Note that zero-coverage regions are not shown in the
graph but reported in text below (this information is also in the zero-coverage section). Below
the second coverage graph there are some statistics on the data that is outside the 3 standard
deviations.
One of the biases seen in sequencing data concerns GC content. Often there is a correlation
between GC content and coverage. In order to investigate this correlation, the report includes
a graph plotting coverage against GC content (see figure 2.71). Note that you can see the GC
content for each reference sequence in the table above.

Figure 2.71: The plot displays, for each GC content level (0-100 %), the mean read coverage of
100bp reference segments with that GC content.
The plot displays, for each GC content level (0-100 %), the mean read coverage of 100bp
reference segments with that GC content.
At the end follows statistics about the reads which are the same for both reference and de novo
assembly (see section 2.6.1 below).
Contig statistics for de novo assembly
After the summary there is a section about the contig lengths. For each set of contigs, you can
see the number of contigs, minimum, maximum and mean lengths, standard deviation and total
contig length (sum of the lengths of all contigs in the set). The contig sets are:
N25 contigs The N25 contig set is calculated by summarizing the lengths of the biggest contigs
until you reach 25 % of the total contig length. The minimum contig length in this set is the
number that is usually used to report the N25 value of a de novo assembly.
N50 This measure is similar to N25 - just with 50 % instead of 25 %. This is probably the most
well-known measure of de novo assembly quality - it is a more informative way of measuring
the lengths of contigs.
N75 Similar to the ones above, just with 75 %.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

All contigs All contigs that were selected.

Long contigs This contig set is based on the threshold set in the dialog in figure 2.67.
Short contigs This contig set is based on the threshold set in the dialog in figure 2.67. Note
that the de novo assembly in the CLC Genomics Workbench per default only reports contigs
longer than 200 bp.
Next follow two bar plots showing the distribution of coverage with coverage level on the x-axis and
number of contig positions with that coverage on the y-axis. An example is shown in figure 2.72.

Figure 2.72: Distribution of coverage - to the left for all the coverage levels, and to the right for
coverage levels within 3 standard deviations from the mean.
The graph to the left shows all the coverage levels, whereas the graph to the right shows
coverage levels within 3 standard deviations from the mean. The reason for this is that for
complex genomes, you will often have a few regions with extremely high coverage which will
affect the resolution of the graph, making it impossible to see the coverage distribution for
the majority of the contigs. These coverage outliers are excluded when only showing coverage
within 3 standard deviations from the mean. Below the second coverage graph there are some
statistics on the data that is outside the 3 standard deviations. At the end follows statistics
about the reads which are the same for both reference and de novo assembly (see section 2.6.1
below).
Read statistics
This section contains simple statistics for all mapped reads, non-specific matches (reads that
match more than place during the assembly), non-perfect matches and paired reads. Note!
Paired reads are counted as two, even though they form one pair. The section on paired reads
also includes information about paired distance and counts the number of pairs that were broken
due to:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Wrong distance When starting the mapping, a distance interval is specified. If the reads during
the mapping are placed outside this interval, they will be counted here.
Mate inverted If one of the reads has been matched as reverse complement, the pair will be
broken (note that the pairwise orientation of the reads is determined during import).
Mate on other contig If the reads are placed on different contigs, the pair will also be broken.
Mate not matched If only one of the reads match, the pair will be broken as well.
Below these tables follow two graphs showing distribution of paired distances (see figure 2.73)
and distribution of read lengths. Note that the distance includes both the read sequence and the
insert between them as explained in section 2.1.8.

Figure 2.73: A bar plot showing the distribution of distances between intact pairs.

2.6.2

Summary mapping report

If you choose to create a report as part of the read mapping (see section 2.5.5), this report will
summarize the results of the mapping process. An example of a report is shown in figure 2.74
The information included in the report is:
Summary statistics. A summary of the mapping statistics:
Reads. The number of reads and the average length.
Mapped. The number of reads that are mapped and their average length.
Not mapped. The number of reads that do not map and their average length.
References. Number of reference sequences.
Parameters. The settings used are reported for the process as a whole and for each
sequence list used as input.
Distribution of read length. For each sequence length, you can see the number of reads
and the distribution in percent. This is mainly useful if you don't have too much variance in
the lengths as you have in e.g. Sanger sequencing data.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.74: The summary mapping report.

Distribution of matched reads lengths. Equivalent to the above, except that this includes
only the reads that have been matched to a contig.
Distribution of non-matched reads lengths. Show the distribution of lengths of the rest of
the sequences.
You can copy the information from the report by selecting in the report and click Copy (
can also export the report in Excel format.

2.7

). You

Mapping table

When several reference sequence are used or you are performing de novo assembly with the
reads mapped back to the contig sequences, (see sections ?? and 2.5.5), all your mapping data
will be accessible from a table ( ). It means that all the individual mappings are treated as one
single file to be saved in the Navigation Area as a table.
An example of a mapping table for a de novo assembly is shown in figure 2.75.
The information included in the table is:
Name. When mapping reads to a reference, this will be the name of the reference sequence.
Length of consensus sequence. The length of the consensus sequence. Subtracting this
from the length of the reference will indicate how much of the reference that has not been
covered by reads.
Number of reads. The number of reads. Reads hitting multiple places on different reference
sequences are placed according to your input for Non-specific matches
Average coverage. This is simply summing up the bases of the aligned part of all the reads
divided by the length of the reference sequence.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.75: The mapping table.

For read mapping, there is more information taken from the reference sequence used as input.
An example of a contig table produced by mapping reads to a reference is shown in figure 2.76.

Figure 2.76: The contig table.

Besides the information that is also in the de novo table, there is information about name,
common name and Latin name of each reference sequence.
At the bottom of the table, there are two buttons which apply to the rows that you select (press
Ctrl + A - +A on Mac - to select all):
Open Mapping. Simply opens the read mapping for visual inspection. You can also open
one mapping simply by double-clicking in the table.
Open Consensus/Open Contig. Creates a sequence list of all the consensus sequences.
This can be used for further analysis or exported ( ) in e.g. fasta format. For de novo
assembly results, it is the contig sequences that are opened.
Extract Subset. Creates a new mapping table with the mappings that you have selected.
You can copy the textual information from the table by selecting in the table and click Copy (
This can then be pasted into e.g. Excel. You can also export the table in Excel format.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.8
2.8.1

Color space
Sequencing

The SOLiD sequencing technology from Applied Biosystems is different from other sequencing
technologies since it does not sequence one base at a time. Instead, two bases are sequenced
at a time in an overlapping pattern. There are 16 different dinucleotides, but in the SOLiD
technology, the dinucleotides are grouped in four carefully chosen sets, each containing four
dinucleotides. The colors are as follows:
Base 1
A
C
G
T

Base 2
C G

Notice how a base and a color uniquely defines the following base. This approach can be used to
deduce a whole sequence from the initial nucleotide and a series of colors. Here is a sequence
and the corresponding colors.
Sequence
Colors

T A C T C C A T G C A

The colors do not uniquely define the sequence. Here is another sequence with the same list of
colors:
Sequence
Colors

A T G A G G T A C G T

But if the first nucleotide is known, the colors do uniquely define the remaining sequence. This
is exactly the strategy used in SOLiD sequencing: The first nucleotide is known from the primer
used, and the remaining nucleotides are deduced from the colors.

2.8.2

Error modes

As with other sequencing technologies, errors do occur with the SOLiD technology. If a single
nucleotide is changed, two colors are affected since a single nucleotide is contained in two
overlapping dinucleotides:
Sequence
Colors

T A C T C C A T G C A

Sequence
Colors

T A C T C C A A G C A

Sometimes, a wrong color is determined at a given position. Due to the dependence between
dinucleotides and colors, this affects the remaining sequence from the point of the error:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Sequence
Colors

T A C T C C A T G C A

Sequence
Colors

T A C T C C A A C G T

Thus, when the instrument makes an error while determining a color, the error mode is very
different from when a single nucleotide is changed. This ability to differentiate different types of
errors and differences is a very powerful aspect of SOLiD sequencing. With other technologies
sequencing errors always appear as nucleotide differences.

2.8.3

Mapping in color space

Reads from a SOLiD sequencing run may exhibit all the same differences to a reference sequence
as reads from other technologies: mismatches, insertions and deletions. On top if this, SOLiD
reads may exhibit color errors, where a color is read wrongly and the rest of the read is affected.
If such an error is detected, it can be corrected and the rest of the read can be converted to what
it would have been without the error.
Consider this SOLiD read:
Read
Colors

T A C T C C A A C G T

The first nucleotide (T) is from the primer, so is ignored in the following analysis. Now, assume
that a reference sequence is this:
Reference
Colors

G C A C T G C A T G C A C

Here, the colors are just inferred since they are not the result of a sequencing experiment.
Looking at the colors, a possible alignment presents itself:
Reference
Colors
Read
Colors

G C A C T G C A T G C A C
| | | : | |: : : :
| | | : | | : : : :
A C T C C A A C G T

In the beginning of the read, the nucleotides match (ACT), then there is a mismatch (G in
reference and C in read), then two more matches (CA), and finally the rest of the read does not
match. But, the colors match at the end of the read. So a possible interpretation of the alignment
is that there is a nucleotide change in position four of the read and a color space error between
positions six and seven in the read. Such an interpretation can be represented as:
Reference
Read

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Here, the * represents a color error. The remaining part of the displayed read sequence has
been adjusted according to the inferred error. So this alignment scores nine times the match
score minus the mismatch cost and a color error cost. This color error cost is a new parameter
that is introduced when performing read mapping in color space.
Note that a color error may be inferred before the first nucleotide of a read. This is the very first
color after the known primer nucleotide that is wrong, changing the whole read.
Here is an example from a set of real SOLiD data that was reference assembled by taking color
space into account using ungapped global alignments.
444_1840_767_F3 has 1 match with a score of 35:
1046535 GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA 1046569
|||||||||||||||||||||||||||||||||||
GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA

reference
reverse read

444_1840_803_F3 has 0 matches

444_1840_980_F3 has 1 match with a score of 29:
2620828 GCACGAAAACGCCGCGTGGCTGGATGGT*CAAC*GTC 2620862
||||||||||||||||||||||||||||*||||*|||
GCACGAAAACGCCGCGTGGCTGGATGGT*CAAC*GTC

reference
read

444_1840_1046_F3 has 1 match with a score of 32:

3673206 TT*GGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC 3673240
||*|||||||||||||||||||||||||||||||||
TT*GGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC

reference
reverse read

444_1841_22_F3 has 0 matches

444_1841_213_F3 has 1 match with a score of 29:
1593797 CTTTG*AGCGCATTGGTCAGCGTGTAATCTCCTGCA 1593831
|||||*|||||||| |||||||||||||||||||||
CTTTG*AGCGCATTAGTCAGCGTGTAATCTCCTGCA

reference
reverse read

The first alignment is a perfect match and scores 35 since the reads are all of length 35. The next
alignment has two inferred color errors that each count is -3 (marked by * between residues), so
the score is 35 - 2 x 3 = 29. Notice that the read is reported as the inferred sequence taking
the color errors into account. The last alignment has one color error and one mismatch giving a
score of 34 - 3 - 2 = 29, since the mismatch cost is 2.
Running the same reference assembly without allowing for color errors, the result is:
444_1840_767_F3 has 1 match with a score of 35:
1046535 GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA 1046569
|||||||||||||||||||||||||||||||||||
GATACTCAATGCCGCCAAAGATGGAAGCCGGGCCA

reference
reverse read

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

444_1840_803_F3 has 0 matches

444_1840_980_F3 has 0 matches
444_1840_1046_F3 has 1 match with a score of 29:
3673206 TTGGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC 3673240
|||||||||||||||||||||||||||||||||
AAGGTCAGGGTCTGGGCTTAGGCGGTGAATGGGGC

reference
reverse read

444_1841_22_F3 has 0 matches

444_1841_213_F3 has 0 matches

The first alignment is still a perfect match, whereas two of the other alignment now do not match
since they have more than two errors. The last alignment now only scores 29 instead of 32,
because two mismatches replaced the one color error above. This shows the power of including
the possibility of color errors when aligning: many more matches are found.
The reference assembly program in the CLC Genomics Workbench does not directly support alignment in color space only, but if such an alignment was carried out, sequence 444_1841_213_F3
would have three errors, since a nucleotide mismatch leads to two color space differences. The
alignment would look like this:
444_1841_213_F3 has 1 match with a score of 26:
1593797 CTTTG*AGCGCATT*G*GTCAGCGTGTAATCTCCTGCA 1593831
|||||*||||||||*|*|||||||||||||||||||||
CTTTG*AGCGCATT*G*GTCAGCGTGTAATCTCCTGCA

reference
reverse read

So, the optimal solution is to both allow nucleotide mismatches and color errors in the same
program when dealing with color space data. This is the approach taken by the assembly program
in the CLC Genomics Workbench.
Note! If you set the color error cost as low as 1 while keeping the mismatch cost at 2 or above,
a mismatch will instead be represented as two adjacent color errors.

2.8.4

Viewing color space information

Importing data from SOLiD systems (see section 2.1.3) will from CLC Genomics Workbench
version 3.1 be imported as color space. This means that if you open the imported data, it will
look like figure 2.77
In the Side Panel under Nucleotide info, you find the Color space encoding group which lets you
define a few settings for how the colors should appear. These settings are also found in the side
panel of mapping results and single sequences.
Infer encoding This is used if you want to display the colors for non-color space sequence (e.g.
a reference sequence). The colors are then simply inferred from the sequence.
Show corrections This is only relevant for mapping results - it will show where the mapping
process has detected color errors. An example of a color error is shown in figure 2.78.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.77: Color space sequence list.

Hide unaligned ends This option determines whether color for the unaligned ends of reads
should be displayed. It also controls whether colors should be shown for gaps. The idea
behind this is that these color dots will interfere with the color alignment, so it is possible
to turn them off.

Figure 2.78: One of the dots have both a blue and a green color. This is because this color
has been corrected during mapping. Putting the mouse on the dot displays the small explanatory
message.

2.9

Interpreting genome-scale mappings

A big challenge when working with high-throughput sequencing projects is interpretation of the
data. Section 2.11 describes how to automatically detect SNPs, whereas this section describes
the manual inspection and interpretation techniques which are guided by visual information about
the mapping. (We will not cover all the functionalities of the mapping view here, instead we refer
to section ?? for general information about viewing and editing the resulting mappings).
Of particular interest for high-throughput sequencing data is probably the opportunity to extract
part of mapping result, see section 2.9.5.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.9.1

Getting an overview - zooming and navigating

Results from mapping high-throughput sequencing data may be extremely large, requiring an
extra effort when you navigate and zoom the view. Besides the normal zoom tools and scrolling
via the arrow keys, there are some of the settings in the Side Panel which can help you navigate
a large mapping:
Gather sequences at top. Under Read layout at the top of the Side Panel. you find this
option. When you zoom in, only the reads aligning to the visible part of the view will be
shown. This will save a lot of vertical scrolling.
Compactness. Under Read layout, you can use different modes of compactness. This
affects the way reads are shown. For example, you can display reads as Packed - very
thin stacked lines as shown in figure 2.79. The compactness also affects what information
should be displayed below the reads (i.e. quality scores or chromatogram traces).
Text size. Under Text format at the bottom of the Side Panel, you decrease the size of the
text. This can improve the overview of the results (at the expense of legibility of sequence
names etc.).

2.9.2

Single reads - coverage and conflicts

When you only have single reads data, coverage is one of the main resources for interpretation.
You can display a coverage graph by clicking the checkbox in the Side Panel as shown in
figure 2.79.

Figure 2.79: The coverage graph can be displayed in the Side Panel under Alignment info.
If you wish to see the exact coverage at a certain position, place the mouse cursor on the graph
and see the exact value in the status bar at the very lower right corner of the Workbench window.
Learn how to export the data behind the graph in section ??.
When you zoom out on a large reference sequence, it may be difficult to discern smaller regions
of low coverage. In this case, click the Find Low Coverage button at the top of the Side Panel.
Clicking once will select the first part of the mapping with coverage at or below the number

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

specified above the button (Low coverage threshold). Click again to find the next part with low
coverage.
When mapping reads to a reference, a region of no coverage indicates genome-scale mutations.
If the sequencing data contains e.g. a deletion, this will appear as a region of no coverage.
Problems during the sequencing process will also result in low coverage regions. In this case, you
may wish to re-sequence these parts, e.g. using traditional "Sanger"-sequencing techniques. Due
to the integrated nature of the CLC Genomics Workbench you can easily go to the primer designer
and design PCR and sequencing primers to cover the low-coverage region. First select the low
coverage region (and some extra nucleotides in order to get a good quality of the sequencing in
the area of interest), and then:
right-click the selection | Open Selection in New View (
( ) at the bottom of the view

) | Show Primer Design

Interpreting genomic re-arrangements

Most of the analyses in this section are based on paired data which allows for much more
powerful approaches to detecting genome rearrangements. Figure 2.80 shows a part of a
mapping with paired reads.
You can see that the sequences are colored blue and this leads us to the color settings in the
Side Panel: under Residue coloring you find the group Sequence colors where you can specify
the following colors:
Mapping. The color of the consensus and reference sequence. Black per default.
Forward. The color of forward reads (single reads). Green per default.
Reverse. The color of reverse reads (single reads). Red per default.
Paired. The color of paired reads. Blue per default.
Non-specific matches. When a read would have matched another place in the mapping, it
is considered a double match. This color will "overrule" the other colors. Note that if your
mapping with several reference sequences, either using de novo assembly or read mapping
with multiple reference sequences, a read is considered a double match when it matches
more than once across all the contigs/references. A double match is yellow per default.
The settings are shown in figure 2.81.
In addition to these colors, there are three graphs that will prove helpful when inspecting the
paired reads, both found under Alignment info in the Side Panel (see figure 2.82):
Paired distance. Displays the average distance between the forward and the reverse read
in a pair.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.80: Paired reads are shown with both sequences in the pair on the same line. The letters
are probably too small to read, but it gives you the impression of how it looks.
Single paired reads. Displays the percentage of the reads where only one of the reads in a
pair matches.
Non-perfect matches. Displays the percentage of the reads covering the current position
which have at least one mismatch or a gap (the mismatch or gap does not need to be on
this position - if there is just one anywhere on the read, it will count).
Non-specific matches. Displays the percentage of the reads which match more than once.
Note that if you are mapping against several sequences, either using de novo assembly
or read mapping with multiple reference sequences, a read is considered a non-sepcific
match when it matches more than once across all the contigs/references. A non-specific
match is yellow per default.
These three graphs in combination with the read colors provide a great deal of information,
guiding interpretations of the mapping result. A few examples will give directions on how to take
advantage of these powerful tools:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.81: Coloring of the reads.

Figure 2.82: More information about paired reads can be displayed in the Side Panel.
Insertions
Looking at the Single paired reads graph in figure 2.83, you can see a sudden rise and fall. This
means that at this position, only one part of the pair matches the reference sequence.

Figure 2.83: More information about paired reads can be displayed in the Side Panel.
Zooming in on the reads, you see how the color of the reads changes (see figure 2.84. They go
from blue (paired) to green, meaning that at this point, the reverse part of the paired reads no
longer match the reference sequence.
Since their reverse partners do not match the reference, there must be an insertion in the
sequenced data. Looking further down the view, the color changes from green to a combination

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.84: Zooming where the single reads kick in.

of red (only reverse reads match) and blue (see figure 2.85).

Figure 2.85: Zooming where the paired reads kick in again.

The reverse reads colored in red have a forward counterpart which do not match the reference
sequence, for the same reason as we see the lonely forward reads before the insertion. Among
the reverse reads, the "ordinary" paired reads start again, marking the end of the insertion.
As we now have established the presence of an insertion, it would be nice to know the exact
location of insertion. You can see its exact position in figure 2.85 where the green reads stop
matching the reference and the reverse reads take over (marked by the vertical red selection
line).
Deletions
Deletions are much easier to detect - they are simply areas of no coverage (see figure 2.86).

Figure 2.86: A deletion in the sequenced data results in coverage of 0.

Depending on the size of the deletion, you will see a rise in other graphs as well:
A small deletion will result in an increase of the Paired distance, because the gap between
the forward and the reverse read will just extend the deletion. This is the case in figure 2.86.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

A larger deletion will result in an increase of Single paired reads when the deletion is larger
than the maximum distance allowed between paired reads (because the "other" part of
the read has a match which is too far away). This maximum value can be changed when
mapping the reads, see section 2.5. This is not illustrated.
When you zoom in on the deletion, you can see how the distance between the reads increase
(see figure 2.87).

Figure 2.87: Each part of the pair still match because the deletion is smaller than the maximum
distance between the reads.

Duplications
In figure 2.88, the Non-specific matches graph is now shown.

Figure 2.88: A rise in the Non-specific matches.

The Non-specific matches are reads that match more than once on the reference sequence.
Zooming in on the reads puts a new color into play as shown in figure 2.89.
The yellow color means that the reads also match other positions on the reference, and this
indicates that there is a duplication.
For a smaller duplication, you will see an increase in the Paired distance, because some of the
reads are then matched to the other part of the duplication (this is shown in figure 2.90.
Inversions
The interesting part in figure 2.91 is once again the Single paired reads graph which display a
distinct pattern.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.89: Non-specific matches are shown in yellow.

Figure 2.90: Paired distance increases.

Figure 2.91: Two peaks in the Single paired reads graph.

The explanation of this is as follows. When the first peak starts, it is because the reverse part of
the pairs no longer matches the reference sequence. This is shown in detail in figure 2.92.
Scrolling further along the view we can see the starting point of the inverted region. This is were
the forward reads ends. At the same point, you will see a new pattern: a combination of reverse
and paired reads as shown in figure 2.93.
The forward counterpart of the reverse reads has no match because of the inversion, whereas
the paired reads have been reversed compared to the other paired reads in the mapping (this
is not visible in the user interface, but a conclusion you can draw from the pattern of the other
reads). Scrolling to the end of the inversion, you will see a similar pattern as in the beginning - it
is just mirrored: Forward reads kick in at the end of the inversion, and reverse reads take over at
when we get back to a "normal" sequence (see figure 2.94).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.92: Just before the inversion, only the forward reads match.

Figure 2.93: The inversion starts where the reads shift from green (forward) to a combination of
red and blue (reverse and paired) reads.

Figure 2.94: The inversion ends where the reads shift from green (forward) to a combination of red
and blue (reverse and paired) reads.

2.9.4

Output from the mapping

Due to the integrated nature of CLC Genomics Workbench it is easy to use the consensus
sequences as input for additional analyses. There are three options when you are viewing a
mapping:
right-click the name of the consensus sequence (to the left) | Open Copy of
Sequence | Save ( ) the new sequence
right-click the name of the consensus sequence (to the left) | Open Copy of
Sequence Including Gaps | Save ( ) the new sequence
right-click the name of the consensus sequence (to the left) | Open This Sequence
Open Copy of Sequence creates a copy of the sequence, omitting all gap regions, which can be
saved and used independently.
Open Copy of Sequence Including Gaps replaces all gaps with Ns. Any regions that appear to be
deletions will be removed if this option is chosen. For example:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

reference CCCGGAAAGGTTT
consensus CCC--AAA--TTT
match1
CCC--AAA
match2
TTT
Here, if you chose to open a copy of the consensus with gaps, you would get this output
CCCAAANNTTT
Open This Sequence will not create a new sequence but simply let you see the sequence in a
sequence view. This means that the sequence still "belong" to the mapping and will be saved
together with the mapping. It also means that if you add annotations to the sequence, they will
be shown in the mapping view as well. This can be very convenient e.g. for Primer design ( ).
If you wish to BLAST the consensus sequence, simply select the whole contig for your BLAST
search. It will automatically extract the consensus sequence and perform the BLAST search.
In order to preserve the history of the changes you have made to the contig, the contig itself
should be saved from the contig view, using either the save button ( ) or by dragging it to the
Navigation Area.

2.9.5

Extract parts of a mapping

Sometimes it is useful to extract part of a mapping for in-depth analysis. This could be the case
if you have performed an assembly of several genes and you want to look at a particular gene or
region in isolation.
This is possible through the right-click menu of the reference or consensus sequence:
Select on the reference or consensus sequence the part of the contig to extract |
Right-click | Extract from Selection
This will present the dialog shown in figure 2.95.
The purpose of this dialog is to let you specify what kind of reads you want to include. Per default
all reads are included. The options are:
Paired status Include intact paired reads When paired reads are placed within the paired distance specified, they will fall into this category. Per default, these reads are colored in
blue.
Include paired reads from broken pairs When a pair is broken, either because only one
read in the pair matches, or because the distance or relative orientation is wrong,
the reads are placed and colored as single reads, but you can still extract them by
checking this box.
Include single reads This will include reads that are marked as single reads (as opposed
to paired reads). Note that paired reads that have been broken during assembly are
not included in this category. Single reads that come from trimming paired sequence
lists are included in this category.
Match specificity Include specific matches Reads that only are mapped to one position.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.95: Selecting the reads to include.

Include non-specific matches Reads that have multiple equally good alignments to the
reference. These reads are colored yellow per default.
Alignment quality Include perfectly aligned reads Reads where the full read is perfectly aligned
to the reference sequence (or consensus sequence for de novo assemblies). Note
that at the end of the contig, reads may extend beyond the contig (this is not visible
unless you make a selection on the read and observe the position numbering in the
status bar). Such reads are not considered perfectly aligned reads because they don't
align in their entire length.
Include reads with less than perfect alignment Reads with mismatches, insertions or deletions, or with unaligned nucleotides at the ends (the faded part of a read).
Note that only reads that are completely covered by the selection will be part of the new contig.
One of the benefits of this is that you can actually use this tool to extract subset of reads from a
contig. An example work flow could look like this:
1. Select the whole reference sequence
2. Right-click and Extract from Selection
3. Choose to include only paired matches
4. Extract the reads from the new file (see section ??)
You will now have all paired reads from the original mapping in a list.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.9.6

Find broken pair mates

Figure 2.96 shows an example of a read mapping with paired reads (shown in blue). In this
particular region, there are some broken pairs (red and green reads). Pairs are marked as broken
if the respective orientation or distance between the reads is not right (see general info on
handling paired data in section 2.1.8), or if one of the reads do not map at all.

Figure 2.96: Broken pairs.

In some situations it is useful to investigate where the mate of the broken pairs map. This would
indicate genomic rearrangements, mis-assemblies of de novo assembly etc. In order to see this,
select the region in question on the reference sequence, right-click and choose Find Broken Pair
Mates.
This will open the dialog shown in figure 2.97.
The purpose of this dialog is to let you specify if you want to annotate the resulting broken pair
overview with annotation information. In this case, you would see if there are any overlapping
genes at the position of the mates.
In addition, the dialog provides an overview of the broken pairs that are contained in the selection.
Click Next and Finish, and you will see an overview table as shown in figure 2.98.
The table includes the following information for both parts of the pair:
Reference The name of the reference sequence where it is mapped
Start and end The position on the reference sequence where the read is aligned

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.97: Finding the mates of broken pairs.

Figure 2.98: An overview of the broken pairs.

Match count The number of possible matches for the read. This value is always 1, unless the
read is a non-specific match (marked in yellow)
Annotations Shows a list of the overlapping annotations, based on the annotation type selected
in figure 2.97.
You can select some or all of these broken pairs and extract them as a sequence list for further
analysis by clicking the Create New Sequence List button at the bottom of the view.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.9.7

Working with multiple contigs from read mappings

Alternatively, if you have several mappings in a table (as described in section 2.5.5), you can
extract the consensus sequences by selecting the relevant rows and clicking on the button
labeled Extract Contig at the bottom of the view.
The sequence(s) you extract are copies of the consensus sequences. Tey are not attached to
the original mapping.
The button marked Extract Subset allows you to extract a subset of your mappings to a new
mapping object.
If you have annotated open reading frames on your sequences and wish to analyze each of
these regions separately, e.g. translating and BLASTing or using other protein analysis tools, you
can extract all the ORF annotations by using our Extract Annotations plug-in, available from the
Plug-in Manager ( ). This will give you a sequence list containing all the ORFs, making it easy
to do batch analyses with other tools from CLC Genomics Workbench.

2.10

Merge mapping results

If you have performed two mappings with the same reference sequences, you can merge the
results using the Merge Mapping Results ( ). This can be useful in situations where you have
already performed a mapping with one data set, and you receive a second data set that you want
to have mapped together with the first one. In this case, you can run a new mapping of the
second data set and merge the results:
Toolbox | High-throughput Sequencing (

) | Merge Mapping Results (

This opens a dialog where you can select two or more mapping results. Note that they have to be
based on the same reference sequences (it doesn't have to be the same file, but the sequence
(the residues) should be identical).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
. For all the mappings that could be merged, a new mapping will be created. If you have
used a mapping table as input, the result will be a mapping table. Note that the consensus
sequence is updated to reflect the merge. The consensus voting scheme for the first mapping is
used to determine the consensus sequence. This also means that for large mappings, the data
processing can be quite demanding for your computer.

2.11

SNP detection

Instead of manually checking all the conflicts of a mapping to discover significant single-nucleotide
variations, CLC Genomics Workbench offers automated SNP detection (see our Bioinformatics
explained article on SNPs at http://www.clcbio.com/BE). The SNP detection in CLC
Genomics Workbench is based on the Neighborhood Quality Standard (NQS) algorithm of [Altshuler
et al., 2000] (also see [Brockman et al., 2008] for more information).
Based on your specifications on what you consider a valid SNP, the SNP detection will scan
through the entire data and report all the SNPs that meet the requirements:
Toolbox | High-throughput Sequencing (

) | SNP detection (

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

This opens a dialog where you can select read mappings ( )/ ( ) to scan for SNPs (see
sections 2.4 and 2.5 for information on how to map reads). You can also select RNA-Seq results
( ) as input.
Clicking Next will display the dialog shown in figure 2.99

Figure 2.99: SNP detection parameters.

2.11.1

Assessing the quality of the neighborhood bases

The SNP detection will look at each position in the mapping to determine if there is a SNP at this
position. In order to make a qualified assessment, it also considers the general quality of the
neighboring bases. The Window size is used to determine how far away from the current position
this quality assessment should extend, and it can be specified in the upper part of the dialog.
Note that at the ends of the read, an asymmetric window of the specified length is used.
If the mapping is based on local alignment of the reads, there will be some reads with un-aligned
ends (these ends are faded when you look at the mapping). These unaligned ends are not
included in the scanning for SNPs but they are included in the quality filtering (elaborated below).
In figure 2.100, you can see an example with a window size of 11. The current position is
high-lighted, and the horizontal high-lighting marks the nucleotides considered for a read when
using a window size of 11.
For each read and within the given window size,1 the following two parameters are used to assess
the quality:
Minimum average quality of surrounding bases. The average quality score of the nucleotides in a read within the specified window length has to exceed this threshold for the
base to be included in the SNP calculation for this position (learn more about importing
quality scores from different sequencing platforms in section 2.1).
1

The window size is defined as the number of positions in the local alignment between that particular read and the
reference sequence (for de novo assembly it would be the consensus sequence).)

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.100: An example of a window size of 11 nucleotides.

Max. number of gaps and mismatches. The number of gaps and mismatches allowed
within the window length of the read. Note that this is excluding the "mismatch" that is
considered a potential SNP. If there are more gaps or mismatches, this read will not be
included in the SNP calculation at this position. Unaligned regions (the faded parts of a
read) also count as mismatches, even if some of the bases match.
Note that for sequences without quality scores, the quality score settings will have no effect. In
this case only the gap/mismatch threshold will be used for filtering low quality reads.
Figure 2.100 shows an example of a read with a mismatch, marked in dark blue. The mismatch
is inside the window of 11 nucleotides.
When looking at a position near the end of a read (like the read at the bottom in figure 2.100),
the window will be asymmetric as shown in figure 2.101. The window size will thus still be 11 in
this case.

Figure 2.101: A window near the end of a read.

Besides looking horizontally within a window for each read, the quality of the central base is also
examined: Minimum quality of central base. This is the quality score for the central base, i.e.
the bases in the column high-lighted in figure 2.102. Bases with a quality score below this value
are not considered in the SNP calculation at this position.
In addition to low-quality reads, reads that match more than once on the reference sequence(s)

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Figure 2.102: A column of central bases in the neighborhood.

are also ignored. These reads are also called Non-specific matches and are colored in yellow in
the view.

2.11.2

Significance of variation: is it a SNP?

At a given position, when the reads with low quality and multiple matches have been removed,
the reads which pass the quality assessment will be compared to the reference sequence to see
if they are different at this position (for de novo assembly the consensus sequence is used for
comparison). For a variation to count as a SNP, it has to comply with the significance threshold
specified in the dialog shown in figure 2.99.
Minimum coverage. If SNPs were called in areas of low coverage, you would get a higher
amount of false positives. Therefore you can set the minimum coverage for a SNP to be
called. Note that the coverage is counted as the number of valid reads at the current
position (i.e. the reads remaining when the quality assessment has filtered out the bad
ones).
Minimum variant frequency. This option is the threshold for the number of reads that
display a variant at a given position. The threshold can be set as a frequency percentage
or as a count. Setting the percentage at 35 % means that at least 35 % of the validated
reads at this position should have a different base.
Below, there is an Advanced option letting you specify additional requirements. These will only
take effect if the Advanced checkbox is checked.
Minimum paired coverage. In samples based on paired data, more confidence is often
attributed to valid paired reads than to single reads. You can therefore set the minimum
coverage of valid paired reads in addition to the minimum coverage of all reads. Again,
the paired coverage is counted as the number of valid reads completely covering the SNP
(the space between mating pairs does not cover anything.) Note that when a value is
provided for minimum paired coverage, reads from broken pairs will not be considered for
SNP detection.
Maximum coverage. Although it sounds counter-intuitive at first, there is also a good
reason to be suspicious about high-coverage regions. Read coverage often displays peaks

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

in repetitive regions where the alignment is not very trustworthy. Setting the maximum
coverage threshold a little higher than the expected average coverage (allowing for some
variation in coverage) can be helpful in ruling out false positives from such regions. You can
see the distribution of coverage by creating a detailed mapping report (see section 2.6.1).
The result table created by the SNP detection includes information about coverage, so you
can specify a high threshold in this dialog, check the coverage in the result afterwards, and
then run the SNP detection again with an adjusted threshold.
Minimum variant count. This option is the threshold for the number of reads that display a
variant at a given position. In addition to the percentage setting in the simple panel above,
these settings are based on absolute counts. If the count required is set to 3, and the
sufficient count is set to 5, it means that even though less than the required percentage
of the reads have a variant base, it will still be reported as a SNP if at least 5 reads
have it. However, if the count is 2, the SNP will not be called, regardless the percentage
setting. This distinction is especially useful with deep sequencing data where you have
very high coverage and many different alleles. In this case, the percentage threshold is not
suitable for finding valid SNPs in a small subset of the data. If you are not interested in
reporting SNPs based on counts but only rely on the relative frequency, you can simply set
the sufficient count number very high.
Positions where the reference sequences (consensus sequences for de novo assembly) have
gaps and unaligned ends of the reads (faded part of the read) will not be considered in the SNP
detection.
The last setting in this dialog (figure 2.99) concerns ploidy: Maximum expected variations. This
is not a filtering option but a reporting option that is related to the minimum variant frequency
setting. If the frequency or count threshold is set low enough the algorithm can call more allelic
variants than the ploidy number of the organism sequenced. Such a result may occur as a
real result but is inconsistent with the common assumption of an infinite sites mutation model
where mutations are assumed to be so rare that they never affect the same position twice.
For this reason, you can use the maximum expected variations setting to mark reported SNPs
as "complex" when they involve more allelic variations then expected from the ploidy number
under an infinite sites model. Note, that with this interpretation the "complex" flag holds true
regardless of whether the sequencing data are generated from a population sample or from an
individual sample (however, see below for an exception). For example, using a minimum variant
frequency of 30% with a diploid organism, you are allowing SNPs with up to 3 variations within the
sequencing reads, and by then setting the maximum expected variations count to 2 (the default),
any SNPs with 3 variations will be marked as "complex" (see below). A ploidy level of 1 with two
allelic variants represents a special case. Two allelic variants can occur if all reads are found to
agree on one base that differs from the reference. Here, the number of allelic variants is higher
than the ploidy level. but this is not inconsistent with an infinite sites mutation model and will
not be termed complex. Two allelic variants can also occur if two variants are found within the
sequencing reads where one of the variants is the same as the reference. Again, the data are not
inconsistent with an infinite sites model if the sequencing data are generated from a population
sample, but they are inconsistent with a clonal mutation-free origin of a sample from a single
individual. For this reason we have chosen to also designate this latter case as "complex".
When there are ambiguity bases in the reads, they will be treated as separate variations. This
means that e.g. a Y will not be collapsed with C or T in other reads. Rather, the Ys will be
counted separately.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.11.3

Reporting the SNPs

When you click Next, you will be able to specify how the SNPs should be reported (see figure
2.103).

Figure 2.103: Reporting options for SNP detection.

Add SNP annotations to reference. This will add an annotation for each SNP to the
reference sequence.
Add SNP annotations to consensus. This will add an annotation for each SNP to the
consensus sequence.
Create table. This will create a table showing all the SNPs found in the data set. The
table will provide a valuable overview, whereas the annotations are useful for detailed
inspection of a SNP, and also if the consensus sequence is used in further analysis in the
CLC Genomics Workbench. The table displays the same information as the annotation for
each SNP.
Genetic code. When reporting the effect of a SNP on the amino acid, this translation table
specified here is used.
Merge SNPs located within same codon. This will merge SNPs that fall within the same
codon (see section 2.11.4).
Figure 2.104 shows a SNP annotation.
The SNP in figure 2.104 is within a coding region and you can see that one of the variations
actually changes the protein product (from Lys to Thr). Placing your mouse on the annotation will
reveal additional information about the SNP as shown in figure 2.105.
The SNP annotation includes the following additional information:
Reference position. The SNP's position on the reference sequence.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

100

Figure 2.104: A SNP annotation within a coding region.

Figure 2.105: A SNP annotation with associated information.

Consensus position. The SNP's position on the consensus sequence.
Variation type. The SNP is described as complex, if it has more variations than specified
in the ploidy setting in figure 2.99.
Length. The length of the SNP will always be one, as the name implies, unless two SNPs
are found within the same codon (see section 2.11.4).
Reference. The base found in the reference sequence. For results from de novo assembly,
it will be the base found in the consensus sequence.
Variants. The number of variants among the reads.
Allele variations. Displays which bases are found at this position. In the example shown in
figure 2.104, the reference sequence has a T whereas some of the reads have a G.
Frequencies. The frequency of a given variant. In the example shown in figures 2.104 and
2.105, 61 % of the reads have a G and 39 % have a T.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

101

Counts. This is similar to the frequency just reported in absolte numbers. In the example
shown in figures 2.104 and 2.105, 14 reads have a G and 9 have a T.
Coverage. The coverage at the SNP position. Note that only the reads that pass the quality
filter will be reported here.
Variant numbers and frequencies. The information from the Allele variations, frequencies
and counts are also split apart and reported for each variant individually (variant #1, #2
etc., depending on the ploidy setting.
Overlapping annotations. This line shows if the SNP is covered by an annotation. The
annotation's type and name will displayed. For annotated reference sequences, this
information can be used to tell if the SNP is found in e.g. a coding or non-coding region of
the genome. Note that annotations of type Variation and Source are not reported.
Amino acid change. If the reference sequence of the is annotated with ORF or CDS
annotations, the SNP detection will also report whether the SNP is synonymous or nonsynonymous. If the SNP variant changes the amino acid in the protein translation, the new
amino acid will be reported (see figure 2.106). Note that adjacent SNPs within the same
codon are reported as one SNP in order to determine the impact on the protein level (see
section 2.11.4)..
The same information is also recorded in the table. An example of a table is shown in figure 2.106.

Figure 2.106: A table of SNPs.

In addition to the information shown as annotation, the table also includes the name of the
mapping (since the table can include SNPs for many mappings, you need to know which one it
belongs to). The table can be Exported ( ) as a csv file (comma-separated values) and imported
into e.g. Excel. Note that the CSV export includes all the information in the table, regardless of

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

102

filtering and what has been chosen in the Side Panel. If you only want to use a subset of the
information, simply select and Copy ( ) the information. The columns in the SNP and DIP tables
have been synchronized to enable merging in a spreadsheet.
Note that if you make a split view of the table and the mapping (see section ??), you will be
able to browse through the SNPs by clicking in the table. This will cause the view to jump to the
position of the SNP.
If you wish to investigate the SNPs further, you can use the filter option (see section ??). Figure
2.107 show how to make a filter that only shows homozygote SNPs.

Figure 2.107: Filtering away the SNPs that have more than one allele variant.
You can also use the filter to show e.g. nonsynonymous SNPs (filter the Amino acid change
column to not being empty as shown in figure 2.108).

Figure 2.108: Filtering the SNP table to only display nonsynonymous SNPs.

2.11.4

Adjacent SNPs affecting the same codon

Figure 2.109 shows an example where two adjacent SNPs are found within the same codon.
The CLC Genomics Workbench can report these SNPs as one SNP in order to evaluate the
combined effect on the translation to protein. If these SNPs were considered individually,

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

103

Figure 2.109: Two adjacent SNPs in the same codon.

the predicted amino acid change for each individual SNP would not have been reflecting the
sequencing data.
The CLC Genomics Workbench will first find the individual SNPs and in the cases where two SNPs
are found within the same codon, they are considered for a merge. Note that the merged SNP
needs to be supported by the same reads that gave rise to the individual SNP calls. Consider the
case shown in figure 2.110, where there are still two adjacent SNPs within the same codon, but
there are no reads supporting the merged SNP.
In this case, no SNP will be reported since there are no reads supporting the merged SNP.
Note that both the individual SNP and the merged SNP need to fulfill the quality filtering and
significance criteria to be reported. When reporting merged SNPs please be aware that these
will find it harder to pass through the quality filtering since there are requirements for both the
individual SNPs and the merged SNP to be fulfilled.

2.12

DIP detection

CLC Genomics Workbench offers automated detection of small deletion/insertion polymorphisms

(also known as DIPs) when reads are mapped to a reference.
If you have high coverage in your mapping, you will often find a lot of gaps in the consensus
sequence. This is because just a single insertion in one of the reads will cause a gap in all
other sequences at this position. The majority of all these gaps should simply be ignored as they
were introduced due to sequencing errors in a single read or a very few reads. Automated DIP
detection can be used to find the gaps that are significant. If you want to use the consensus
sequence for other purposes, you can simply ignore all the gaps (they will disappear once the
consensus sequence is out of the mapping view), and the significant ones can then be annotated
as DIPs (see section 2.12.2).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

104

Figure 2.110: Two adjacent SNPs in the same codon but with different reads.
In CLC Genomics Workbench, a DIP is a deletion or an insertion of consecutive nucleotides
present in experimental sequencing data when compared to a reference sequence. Automated
DIP detection is therefore possible only for results from read mapping.
The terms "deletion" and "insertion" are understood as events that have happened to the
sequencing sample relative to the reference sequence: when the local alignment between a
read and the reference exhibits gaps in the read, nucleotides have been deleted (in the read,
relative to the reference), and when the local alignment exhibits gaps in the reference sequence,
nucleotides have been inserted (in the read, relative to the reference). Figure 2.111 shows an
insertion (of TC, to the left) and a deletion (of CC, to the right).

Figure 2.111: Two DIPs, an insertion and a deletion.

The automated DIP detection in CLC Genomics Workbench bases all reported DIPs on DIPs found
in individual reads. The length of reported deletions and insertions is therefore bounded by the
number of insertions and deletions allowed per read by the read mapping algorithm.
In most situations, a DIP in a single read is not sufficient experimental evidence. The CLC
Genomics Workbench allows you to specify how many reads must cover and agree on a DIP in
order for it to be reported by the automated DIP detection. Two reads agree on a deletion if their
local alignments to the reference sequence both contain the same number of consecutive gaps
aligned to the same reference positions. Likewise, two reads agree on an insertion if their local
alignments specify the same number of consecutive gaps at the same position in the reference

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

105

sequence and the nucleotides inserted in the two reads are the same. Figure 2.112 shows some
reads disagreeing on an insertion (of TC or TA?, on the left) and agreeing on a deletion (of CC,
on the right).

Figure 2.112: Disagreement and agreement of DIPs.

Based on your specifications on what you consider a valid DIP, the DIP detection will scan through
the entire mapping and report all the DIPs that meet the requirements:
Toolbox | High-throughput Sequencing (

) | DIP detection (

This opens a dialog where you can select read mapping results (
section 2.5 for information on how to map reads to a reference).

2.12.1

)
)/ (

) to scan for DIPs (see

Experimental support of a DIP

Clicking Next will display the dialog shown in figure 2.113.

Figure 2.113: DIP detection parameters.

To avoid false positives, the automated DIP detection of CLC Genomics Workbench ignores reads
that have multiple hit positions on the reference (marked by yellow color) or reads that come
from broken pairs.
In addition, CLC Genomics Workbench allows you to specify thresholds for the experimental
support of reported DIPs, thus filtering the DIPs found in single, valid reads, see figure 2.113.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

106

Minimum coverage. DIPs called in areas of low coverage will likely result in a higher amount
of false positives. Therefore you can set the minimum coverage for a DIP to be called. Note
that the coverage is counted as the number of valid reads completely covering the DIP.
Minimum variant frequency. Often reads do not completely agree on a DIP, and you may
want to report only the most frequent variants at each DIP site. This threshold can be
specified as the percentage of the reads or the absolute number of reads. By default,
the frequency in percent is set to 35%, which means that at least 35% of the valid reads
covering the DIP site must agree on the DIP for it to be reported. In effect, this means that
at most two different variants will be reported at each site, which is reasonable for diploid
organisms. If a DIP is frequent enough to be reported, the DIP annotation or table entry will
contain information about all other variants which are also frequent enough---even if they
are not DIPs.
Below, there is an Advanced option letting you specify additional requirements. These will only
take effect if the Advanced checkbox is checked.
Minimum paired coverage. In based on paired data, more confidence is often attributed
to valid paired reads than to single reads. You can therefore set the minimum coverage
of valid paired reads in addition to the minimum coverage of all reads. Again, the paired
coverage is counted as the number of valid reads completely covering the DIP (the space
between mating pairs does not cover anything.) Note that regardless of this setting, reads
from broken pairs are never considered for DIP detection.
Maximum coverage. Read coverage often displays peaks in repetitive regions where the
alignment is not very trustworthy. Setting the maximum coverage threshold a little higher
than the expected average coverage (allowing for some variation) can be helpful in ruling
out false positives from such regions.
Minimum variant counts. This option is the threshold for the number of reads that display
a DIP at a given position. In addition to the percentage setting in the simple panel above,
these settings are based on absolute counts. If the count required is set to 3, and the
sufficient count is set to 5, it means that even though less than the required percentage of
the reads have a DIP, it will still be reported as a DIP if at least 5 reads have it. However, if
the count is 2, the DIP will not be called, regardless the percentage setting. This distinction
is especially useful with deep sequencing data where you have very high coverage and many
different alleles. In this case, the percentage threshold is not suitable for finding valid DIPs
in a small subset of the data. If you are not interested in reporting DIPs based on counts
but only rely on the relative frequency, you can simply set the sufficient count number very
high.
Maximum expected variations. This is not a filtering option, but is related to the minimum
variant frequency setting. By setting the frequency threshold low enough to allow more
variants than the ploidy of the organism sequenced, you can use the maximum expected
variations setting to mark reported DIPs as "complex", if they involve more variations then
expected from the ploidy. For example, using a minimum variant frequency of 30% with a
diploid organism, you are allowing DIPs with up to 3 variations, and then by setting the
maximum expected variations count to 2 (the default), any DIPs with 3 variations will be
marked as complex (see below).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.12.2

107

Reporting the DIPs

When you click Next, you will be able to specify how the DIPs should be reported:
Annotate reference sequence(s). This will add an annotation for each DIP to the reference
sequences in the input.
Annotate consensus sequence(s). This will add an annotation for each DIP to the
consensus sequences in the input. In either way, DIP annotations contain the following
information:
Reference position. The first position of the DIP in the reference sequence.
Consensus position. The first position of the DIP in the consensus sequence.
Variation type. Will be "DIP" or "Complex DIP", depending on the value of the
maximum expected variations setting and the actual number of variations found at the
DIP site.
Length. The length of the DIP. Note that only small deletions and insertions are found.
This is because the DIP detection is based on the alignment of the reads generated
by the mapping process, and the mapping only allows a few insertions/deletions (see
section 2.5 for information on how to map reads to a reference).
Reference. The residues found in the reference sequence (either gaps for insertions
or bases for deletions).
Variants. The number of variants among the reads.
Allele variation. The variations found in the reads at the DIP site. Contains only those
variations whose frequency is at least that specified by the minimum variant frequency
setting.
Frequencies. The frequencies of the variations, both absolute (counts) and relative
(percentage of coverage).
Coverage. The number of valid reads completely covering the DIP site.
Variant numbers and frequencies. The information from the Allele variations, frequencies and counts are also split apart and reported for each variant individually (variant
#1, #2 etc., depending on the ploidy setting.
Overlapping annotations. Says if the DIP is covered, in part or in whole, by an
annotation. The annotation's type and name will displayed. For annotated reference
sequences, this information can be used to tell if the DIP is found in e.g. a coding
or non-coding region of the genome. Note that annotations of type Variation and
Source are not reported.
Amino acid change. If the reference sequence of is annotated with ORF or CDS
annotations, the DIP detection will also report whether the DIP changes the amino
acid sequence resulting from translation, and, if so, whether the change involves
frame-shifting.
Create table. This will create a table showing all the DIPs found. The table will provide
a valuable overview, whereas the annotations are useful for detailed inspection of a DIP,
and also if the annotated sequences are used for further analysis in the CLC Genomics
Workbench.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

108

Figure 2.114: DIPs detected witin a coding region.

Figure 2.114 shows the result of a DIP detection output as annotations on the reference
sequence. The DIP detection found the DIPs of figure 2.112.
The DIPs occur within a coding region (identified by the long yellow annotation) and you can
see that they both shift the frame of the translation, since their sizes are not divisible by 3.
Placing your mouse on the annotations will reveal detailed information about the DIPs as shown
in figure 2.115.

Figure 2.115: A DIP annotation with detailed information.

The same information is also recorded in the table output. An example of a table is shown in
figure 2.116.
In addition to the information shown as annotation, the table also includes the name of the
mapping (since the table can include DIPs for many references, you need to know which one it
belongs to). The table can be Exported ( ) as a csv file (comma-separated values) and imported
into e.g. Excel. Note that the CSV export includes all the information in the table, regardless of
filtering and what has been chosen in the Side Panel. If you only want to use a subset of the
information, simply select and Copy ( ) the information. The columns in the SNP and DIP tables
have been synchronized to enable merging in a spreadsheet.
Note that if you make a split view of the table and the mapping (see section ??), you will be
able to browse through the DIPs by clicking in the table. This will cause the view to jump to the
position of the DIP.

2.13

ChIP sequencing

CLC Genomics Workbenchcan perform analysis of Chromatin immunoprecipitation sequencing

(ChIP-Seq) data based on the information contained in a single sample subjected to immuno-

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

109

Figure 2.116: A table of DIPs.

precipitation (ChIP-sample) or by comparing a ChIP-sample to a control sample where the
immunoprecipitation step is omitted. The first step in a ChIP-Seq analysis is to map the reads
to a reference (see section 2.5) which maps your reads against one or more specified reference
sequences. If both a ChIP- and a control sample is used, these must be mapped separately
to produce separate ChIP- and control samples. These samples are then used as input to the
ChIP-Seq tool which surveys the pattern in coverage to detect significant peaks:
Toolbox | High-throughput Sequencing (

) | ChIP-Seq Analysis (

This opens a dialog where you can select one or more mapping results (
ChIP-samples. Control samples are selected in the next step.

2.13.1

)/ (

) to use as

Peak finding and false discovery rates

Clicking Next will display the dialog shown in figure 2.117.

If the option to include control samples is included, the user must select the appropriate sample
to use as control data. If the mapping is based on several reference sequences, the Workbench
will automatically match the ChIP-samples and controls based on the length of the reference
sequences.
The peak finding algorithm includes the following steps:
Calculate the null distribution of background sequencing signal
Scan the mappings to identify candidate peaks with a higher read count than expected from
the null distribution
Merge overlapping candidate peaks
Refine the set of candidate peaks based on the count and the spatial distribution of reads
of forward and reverse orientation within the peaks

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

110

Figure 2.117: Peak finding and false discovery rates.

The estimation of the null distribution of coverage and the calculation of the false discovery rates
are based on the Window size and Maximum false discovery rate (%) parameters. The Window
size specifies the width of the window that is used to count reads both when the null distribution
is estimated and for the subsequent scanning for candidate peaks.
The Maximum false discovery rate specifies the maximum proportion of false positive peaks
that you are willing to accept among your called peaks. A value of 10 % means that you are
willing to accept that 10 % of the peaks called are expected to be false discoveries.
To estimate the false discovery rate (FDR) we use the method of [Ji et al., 2008] (see also
Supplementary materials of the paper).
In the case where only a ChIP-sample is used, a negative binomial distribution is fitted to the
counts from low coverage regions. This distribution is used as a null distribution to obtain the
numbers of windows with a particular count of reads that you would expect in the absence of
significant binding. By comparing the number of windows with a specific count you expect to see
under the null distribution and the number you actually see in your data, you can calculate a false
discovery rate for a given read count for a given window size as: 'fraction of windows with read
count expected under the null distribution'/'fraction of windows with read count observed'.
In the case where both a ChIP- and a control sample are used, a sampling ratio between the
samples is first estimated, using only windows in which the total numbers of reads (that is, the
sum of those in the sample and those in the control) is small.P
The sampling ratio is estimated
sample
sample =
as the ratio of the cumulated
sample
read
counts
(c
) to cumulated control
i ki
P
read counts (ccontrol = i kicontrol ) in these windows. The sampling ratio is used to estimate the
proportion of the reads that are expected to be ChIP-sample reads under the null distribution,
as p0 = csample /(csample + ccontrol ). For a given total read count, n, of a window, the numbers
of reads expected in the ChIP-sample under the null distribution can then be estimated from
the binomial distribution with parameters n and p0 . By comparing the expected and observed
numbers, a false discovery rate can then be calculated. Note, that when a control sample is
used different null-distributions are estimated for different total read counts, n.
In both cases, the user can specify whether the null distribution should be estimated separately
for each reference sequence by checking the option Analyze each reference separately.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

111

Because the ChIP-seq experimental protocol selects for sequencing input fragments that are
centered around a DNA-protein binding site it is expected that true peaks will exhibit a signature
distribution where forward reads are found upstream of the binding site and reverse reads are
found downstream of the binding site leading to reduced coverage at the exact binding site. For
this reason, the algorithm allows you to shift forward reads towards the 3' end and reverse reads
towards the 5' end in order to generate a more marked peak prior to the peak detection step. This
is done by checking the Shift reads based on fragment length box. To shift the reads you also
need to input the expected length of the sequencing input fragments by setting the Fragment
length parameter, this is the size of the fragment isolated from gel (L in the illustration below).
The illustration below shows a peak where the forward reads are in one window and the reverse
reads fall in another window (window 1 and 3).
------------------------------------------------------------------------------|--------------------->
---->
<--<---

reference
(actual sequenced fragment length = L bp)
reads
reads
reads
reads.

|--------------------|--------------------|------------1
2
3

window size W

If the reads are not shifted, the algorithm will count 2 reads in window 1 and 3. But if the forward
reads are shifted 0.5XL to the right and reverse reads are shifted 0.5xL to left, the algorithm will
find 4 reads in window 2 as shown below:
--------------------------------------------------------- reference
----------------------|-----------------(actual sequenced fragment length = L basepairs)
---->
reads
---->
reads
<--reads
<--reads
|--------------------|--------------------|------------1
2
3

window size W

So shifting reads will increase the signal to noise ratio.

The following peak refinement step, the reporting of the peak and the visualization will use the
original position of the reads, so the shifting is only a virtual shift performed as part of the peak
detection.

2.13.2

Peak refinement

Clicking Next will display the dialog shown in figure 2.118.

This dialog presents the parameters and options that can be used to refine the set of candidate
peaks discovered when scanning the read mapping. All three refinement options again utilize
the fact that coverage around a true DNA-protein binding site is expected to exhibit a signature
distribution where forward reads are found upstream of the binding site and reverse reads
are found downstream of the binding site. Peak refinement can be performed both with- and
without a control sample but the algorithm only uses information contained in the reads from the
ChIP-samples, not the control samples.
If the Boundary refinement option is checked, the algorithm will estimate the position of the
DNA-protein binding interaction and place the resulting annotations on this region, rather than on

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

112

Figure 2.118: Peak refinement settings.

the region where a peak in coverage is found. A center of sequencing intensity is defined for all
forward reads as the median value of the center points of all forward reads and likewise for all
reverse reads. The "refined peak" is thus defined as the region between these two points.
One of the advantages of including this boundary refinement is that shorter regions can be given
as input to subsequent pattern discovery analysis.
By checking the Filter peaks based on difference in read orientation counts the algorithm will
calculate the normalized difference in the number of forward and reverse reads within a peak as
|count forward reads - count reverse reads|
count forward reads + count reverse reads
The desired maximum value of this parameter can be set in the Normalized difference of read
counts field and any candidate peak with a value above this will then be dismissed. Setting a
low value will ensure that peaks are only called if there is a well balanced number of forward and
reverse reads.
As an example if you have 15 forward reads and 5 reverse reads, you will end up with a value of
0.5. With the default limit set to 0.4, a peak like that would be excluded.
By checking the Filter peaks based on spatial distribution of read orientation the algorithm
will evaluate how clearly separated the location of forward and reverse reads are within a
peak. This is done via the Wilcoxon rank-sum test (see http://en.wikipedia.org/wiki/
Mann-Whitney-Wilcoxon_test). The null hypothesis here is that the positions of forward
and reverse reads within a peak are drawn from the same distribution i.e. that their locations
are not significantly different and the alternative hypothesis is that the forward reads have a
sum of ranked positions that is shifted to lower positions than the reverse reads. Peaks will
be dismissed if the probability of the null hypothesis exceeds the value set in the Maximum
probability field.
Setting a low Maximum probability will ensure that peaks are only called if there is a clear
signature distribution where forward reads are found upstream of reverse reads within the peak.
A general comment about peak filtering is that the relevant statistics are all reported in the peak

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

113

table that the algorithm outputs. If it is desirable to explore a large set of candidate peaks
it is recommended to use no or relatively loose filtering criteria and then use the advanced
table filtering options to explore the effect of the different parameters (see section ??). It may
be desirable to omit the addition of annotations in this exploratory analysis and rely on the
information in the table instead. Once a desired set of parameters is found, the algorithm can
be rerun using these as filtering criteria to add annotations to the reference sequence and to
produce a final list of peaks.

2.13.3

Reporting the results

When you click Next, you will be able to specify how the results should be reported (see
figure 2.119).

Figure 2.119: Output options.

The different output options are described in detail below. Note, that it is not possible to output
a graph and table of read counts in the case where a control sample is used. These options are
therefore disabled in this case.
Graph and table of background distribution and false discovery statistics
An example of a FDR graph based on a single ChIP-sample is shown in figure 2.120.
The graph shows the estimated background distribution of read counts in discrete windows and
the observed counts and can thus be used to inspect how well the estimated distribution fits the
observed pattern of coverage.
The FDR table displays the observed and expected fraction of windows with a given read count
and also shows the rate of false discovery related to a given level of coverage within a window:
# reads - the number of reads within a window.
# windows - the number of windows with the given read count. A window of a fixed width is
slid across the sequence. For every window position the number of reads in that window
is recorded and stored as the read count. After this, the windows are counted based on

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

114

Figure 2.120: FDR graph.

their recorded read counts. # windows of read count x is thus the number of windows that
were found to contain x reads during this process. This is done to establish the background
distribution of coverage and to evaluate the fit of the estimated distribution.
Observed - the observed faction of windows with the given read count.
Expected under null - the expected fraction of windows with a given read count, under the
null distribution.
FDR % - the false discovery rate which is the fraction of the peaks with the given read count
that can be expected to be false positives.
An example is shown in figure 2.121.

Figure 2.121: FDR table.

From this table you can see that less than 5% of the called peaks with 9 reads can be expected
to be false discoveries and for peaks with 11 reads the FDR is less than 1%.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

115

Peak table and annotations

The main result is the table showing the peaks and the annotations added to the reference
sequence.
An example of a peak table is shown in figure 2.122.

Figure 2.122: ChIP sequencing peak table.

The table includes information about each peak that has been found:
Name. If the mapping was based on more than one reference sequence, the name of the
reference sequence in question will be shown here.
Region. The position of the peak. To find that position in the ChIP-sample mapping, you
can make a split view of the table and the mapping (see section ??). You will then be able
to browse through the peaks by clicking in the table. This will cause the view to jump to the
position of the peak region.
Length. The length of the peak.
FDR (%). The false discovery rate for the peak (learn more in section 2.13.1).
# Reads. The total number of reads covering the peak region.
# Forward reads. The number of forward reads covering the peak region.
# Reverse reads. The number of reverse reads covering the peak region. The normalized
difference in the count of forward-reverse reads is calculated based on these numbers (see
figure 2.118).
Normalized difference. See section 2.13.2.
P-value. The p-value is for the Wilcoxon rank sum test for the equality of location of forward
and reverse reads in a peak. See section 2.13.2.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

116

Max forward coverage. The refined region described in section 2.13.2 is calculated based
on the maximum coverage of forward and reverse reads.
Max reverse coverage. See previous.
Refined region. The refined region.
Refined region length. The length of the refined region.
5' gene. The nearest gene upstream, based on the start position of the gene. The number
in brackets is the distance from the peak to the gene start position.
3' gene. The nearest gene downstream, based on the start position of the gene. The
number in brackets is the distance from the peak to the gene start position.
Overlapping annotations. Displays any annotations present on the reference sequence
that overlap the peak.
Note that if you make a split view of the table and the mapping (see section ??), you will be
able to browse through the peaks by clicking in the table. This will cause the view to jump to the
position of the peak.
An example of a peak is shown in figure 2.123.
If you want to extract the sequence of all the peak regions to a list, you can use the
Extract Annotations plug-in (see http://www.clcbio.com/index.php?id=938) to extract
all annotations of the type "Binding site".

2.14

RNA-Seq analysis

Based on an annotated reference genome and mRNA sequencing reads, the CLC Genomics
Workbench is able to calculate gene expression levels as well as discover novel exons. The
key annotation types for RNA-Seq analysis of eukaryotes are of type gene and type mRNA. For
prokaryotes, annotations of type gene are considered.
The approach taken by the CLC Genomics Workbench is based on [Mortazavi et al., 2008].
The RNA-Seq analysis is done in several steps: First, all genes are extracted from the reference
genome (using annotations of type gene). Other annotations on the gene sequences are
preserved (e.g. CDS information about coding sequences etc). Next, all annotated transcripts
(using annotations of type mRNA) are extracted. If there are several annotated splice variants,
they are all extracted. Note that the mRNA annotation type is used for extracting the exon-exon
boundaries.
An example is shown in figure 2.124.
This is a simple gene with three exons and two splice variants. The transcripts are extracted as
shown in figure 2.125.
Next, the reads are mapped against all the transcripts plus the entire gene (see figure 2.126).
From this mapping, the reads are categorized and assigned to the genes (elaborated later in this
section), and expression values for each gene and each transcript are calculated. After that,
putative exons are identified.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

117

Figure 2.123: Inspecting an annotated peak. The green lines represent forward reads and the red
lines represent reverse reads.

Figure 2.124: A simple gene with three exons and two splice variants.

Figure 2.125: All the exon-exon junctions are joined in the extracted transcript.
Details on the process are elaborated below when describing the user interface. To start the
RNA-Seq analysis analysis:
Toolbox | High-throughput Sequencing (

) | RNA-Seq Analysis (

This opens a dialog where you select the sequencing reads (not the reference genome or
transcriptome). The sequencing data should be imported as described in section 2.1.
If you have several different samples that you wish to measure independently and compare
afterwards, you should run the analysis in batch mode (see section ??).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

118

Figure 2.126: The reference for mapping: all the exon-exon junctions and the gene.
Click Next when the sequencing data is listed in the right-hand side of the dialog.

2.14.1

Defining reference genome and mapping settings

You are now presented with the dialog shown in figure 2.127.

Figure 2.127: Defining a reference genome for RNA-Seq.

At the top, there are two options concerning how the reference sequences are annotated:
Use reference with annotations. Typically, this option is chosen when you have an
annotated genome sequence. Choosing this option means that gene and mRNA annotations
on the sequence will be used if you choose the option Eukarotes in the next window. If you
choose the option Prokaryotes in the next window, the annotations of type gene only are
used. See section 2.14.1 for more information.
Use reference without annotations. This option is suitable for situations like mapping back
reads to un-annotated EST consensus sequences. The reference in this case is a list of
sequences. A common situation is for a multi-fasta file to be imported into the Workbench
to be used for this purpose. Each sequence in the list will be treated as a "gene" (or
"transcript"). Note that the Workbench uses prokaryote settings here. This means that it
does not look for new exons (see section 2.14.2) and it assumes that the sequences have
no introns).
Just below these two options, you click to select the reference sequences.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

119

Next, you can choose to extend the region around the gene to include more of the genomic
sequence by changing the value in Flanking upstream/downstream residues. This also means
that you are able to look for new exons before or after the known exons (see section 2.14.2).
When the reference has been defined, click Next and you are presented with the dialog shown in
figure 2.128.

Figure 2.128: Defining mapping parameters for RNA-Seq.

The mapping parameters are:
Maximum number of mismatches. This parameter is available if you use short reads
(shorter than 56 nucleotides, except for color space data which are always treated as long
reads). This is the maximum number of mismatches to be allowed. Maximum value is 3,
except for color space where it is 2.
Minimum length fraction. For long reads, you can specify how much of the sequence
should be able to map in order to include it. The default is 0.9 which means that at least
90 % of the bases need to align to the reference.
Minimum similarity fraction. This also applies to long reads and it is used to specify how
exact the matching part of the read should be. When using the default setting at 0.8 and
the default setting for the length fraction, it means that 90 % of the read should align with
80 % similarity in order to include the read.
Maximum number of hits for a read. A read that matches to more distinct places in the
references than the 'Maximum number of hits for a read' specified will not be mapped (the
notion of distinct places is elaborated below). If a read matches to multiple distinct places,
but below the specified maximum number, it will be randomly assigned to one of these
places. The random distribution is done proportionally to the number of unique matches
that the genes to which it matches have, normalized by the exon length (to ensure that
genes with no unique matches have a chance of having multi-matches assigned to them,
1 will be used instead of 0, for their count of unique matches). This means that if there

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

120

are 10 reads that match two different genes with equal exon length, the two reads will be
distributed according to the number of unique matches for these two genes. The gene that
has the highest number of unique matches will thus get a greater proportion of the 10
reads.
Places are distinct in the references if they are not identical once they have been transferred
back to the gene sequences. To exemplify, consider a gene with 10 transcripts and 11
exons, where all transcripts have exon 1, and each of the 10 transcripts have only one of
the exons 2 to 11. Exon 1 will be represented 11 times in the references (once for the
gene region and once for each of the 10 transcripts). Reads that match to exon 1 will
thus match to 11 of the extracted references. However, when transferring the mappings
back to the gene it becomes evident that the 11 match places are not distinct but in fact
identical. In this case the read will not be discarded for exceeding the maximum number of
hits limit, but will be mapped. In the RNA-seq action this is algorithmically done by allowing
the assembler to return matches that hit in the 'maximum number of hits for a read' plus
'the maximum number of transcripts' that the genes have in the specified references. The
algorithm post-processes the returned matches to identify the number of distinct matches
and only discards a read if this number is above the specified limit. Similarly, when a
multi-match read is randomly assigned to one of it's match places, each distinct place is
considered only once.
Strand-specific alignment. When this option is checked, the reads will only be mapped
in their forward orientation (genes on the minus strand are reverse complemented before
mapping). This is useful in places where genes overlap but are on different strands because
it is possible to assign the reads to the right gene. Without the strand-specific protocol,
this would not be possible (see [Parkhomchuk et al., 2009]).
There is also a checkbox to Use color space which is enabled if you have imported a data set
from a SOLiD platform containing color space information. Note that color space data is always
treated as long reads, regardless of the read length.
Paired data in RNA-Seq
The CLC Genomics Workbench supports the use of paired data for RNA-Seq. A combination of
single reads and paired reads can also be used. There are three major advantages of using
paired data:
Since the mapped reads span a larger portion of the reference, there will be less nonspecifically mapped reads. This means that there is in general a greater accuracy in the
expression values.
This in turn means that there is a greater chance of accurately measuring the expression
of transcript splice variants. Since single reads (especially from the short reads platforms)
will usually only span one or two exons, there are many cases where the expression splice
variants sharing the same exons cannot be determined accurately. With paired reads, more
combinations of exons will be identified as unique for a particular splice variant.2
2

Note that the CLC Genomics Workbench only calculates the expression of the transcripts already annotated on
the reference.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

121

It is possible to detect Gene fusions where one read in a pair maps in one gene and
the other part maps in another gene. If several reads exhibit the same pattern, there is
evidence of a fusion gene.
At the bottom you can specify how Paired reads should be handled. You can read more about
how paired data is imported and handled in section 2.1.8. If the sequence list used as input for
the mapping contains paired reads, this option will automatically be shown - if it contains single
reads, this option will not be shown. Learn more about mapping paired data in section 2.5.3.
When counting the mapped reads to generate expression values, the CLC Genomics Workbench
needs to decide how to handle paired reads. The standard behavior is this: if two reads map
as a pair, the pair is counted as one. If the pair is broken, none of the reads are counted.
The reasoning is that something is not right in this case, it could be that the transcripts are
not represented correctly on the reference, or there are errors in the data. In general, more
confidence is placed with an intact pair. If a combination of paired and single reads are used,
"true" single reads will also count as one (the single reads that come from broken pairs will not
count).
In some situations it may be too strict to disregard broken pairs. This could be in cases where
there is a high degree of variation compared to the reference or where the reference lacks
comprehensive transcript annotations. By checking the Use 'include broken pairs' counting
scheme, both intact and broken pairs are now counted as two. For the broken pairs, this means
that each read is counted as one. Reads that are single reads as input are still counted as one.
When looking at the mappings, reads from broken pairs have a darker color than reads that are
intact pairs or originally single reads.
Finding the right reference sequence for RNA-Seq
For prokaryotes, the reference sequence needed for RNA-Seq is quite simple. Either you input
a genome annotated with gene annotations, or you input a list of genes and select the Use
reference without annotations.
For eukaryotes, it is more complex because the Workbench needs to know the intron-exon
structure as explained in in the beginning of this section. This means that you need to have
a reference genome with annotations of type mRNA and gene (you can see the annotations of
a sequence by opening the annotation table, see section ??). You can obtain an annotated
reference sequence in different ways:
Download the sequences from NCBI from within the Workbench (see section ??). Figure
2.129 shows an example of a search for the human refseq chromosomes.
Retrieve the annotated sequences in supported format, e.g. GenBank format, and Import
( ) them into the Workbench.
Download the unannotated sequences, (e.g. in fasta format) and annotate them using
a GFF/GTF file containing gene and mRNA annotations (learn more at http://www.
clcbio.com/annotate-with-gff). Please do not over-annotate a sequence that is
already marked up with gene and mRNA annotations unless you are sure that the annotation
sets are exclusive. Overlapping gene and mRNA annotations will lead to useless RNA-Seq
results.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

122

You need to make sure the annotations are the right type. GTF files from Ensembl
are fully compatible with the RNA-Seq functionality of the CLC Genomics Workbench:
ftp://ftp.ensembl.org/pub/current_gtf/. Note that GTF files from UCSC cannot
be used for RNA-Seq since they do not have information to relate different transcript variants
of the same gene.
If you annotate your own files, please ensure that you use annotation types gene and, if
it is a eurkarote, mRNA. To annotate with these types, they must be spelled correctly, and
the RNA part of mRNA must be in capitals. Please see see section ??annotation table.

Figure 2.129: Downloading the human genome from refseq.

2.14.2

Exon identification and discovery

Clicking Next will show the dialog in figure 2.130.

Figure 2.130: Exon identification and discovery.

The choice between Prokaryote and Eukaryote is basically a matter of telling the Workbench

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

123

whether you have introns in your reference. In order to select Eukaryote, you need to have
reference sequences with annotations of the type mRNA (this is the way the Workbench expects
exons to be defined - see section 2.14).
Here you can specify the settings for discovering novel exons. The mapping will be performed
against the entire gene, and by analyzing the reads located between known exons, the CLC
Genomics Workbench is able to report new exons. A new exon has to fulfill the parameters you
set:
Required relative expression level. This is the expression level relative to the rest of the
gene. A value of 20% means that the expression level of the new exon has to be at least
20% of that of the known exons of this gene.
Minimum number of reads. While the previous option asks for the percentage relative to
the general expression level of the gene, this option requires an absolute value. Just a few
matching reads will already be considered to be a new exon for genes with low expression
levels. This is avoided by setting a minimum number of reads here.
Minimum length. This is the minimum length of an exon. There has to be overlapping reads
for the whole minimum length.
Figure 2.131 shows an example of a putative exon.

Figure 2.131: A putative exon has been identified.

2.14.3

RNA-Seq output options

Clicking Next will allow you to specify the output options as shown in figure 2.132.
The standard output is a table showing statistics on each gene and the option to open the
mapping (see more below). Furthermore, the expression of individual transcripts is reported (for
eukaryotes). The expression measure used for further analysis can be specified as well. Per
default it is set to Genes RPKM. This can also be changed at a later point (see below).
Furthermore, you can choose to create a sequence list of the non-mapped sequences. This could
be used to do de novo assembly and perform BLAST searches to see if you can identify new
genes or at least further investigate the results.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

124

Figure 2.132: Selecting the output of the RNA-Seq analysis.

Gene fusion reporting
When using paired data, there is also an option to create a table summarizing the evidence for
gene fusions. And example is shown in figure 2.133.

Figure 2.133: An example of a gene fusion table.

The table includes the following columns for each part of the pair:
Gene. The name of the gene.
Reference. The name of the reference sequence (typically the chromosome name).
Position. The position of the gene.
Strand. The strand of the gene.
Most importantly, the table lists the number of read pairs that are supporting the combination of
genes listed. The threshold for when a combination of genes should be reported in the table can
be set in the RNA-Seq dialog in figure 2.132. The default value is 5.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

125

Note that the reporting of gene fusions is very simple and should be analyzed in much greater
detail before any evidence of gene fusions can be verified. The table should be considered more
of a pointer to genes to explore rather than evidence of gene fusions.
RNA-Seq report
In addition, there is an option to Create report. This will create a report as shown in figure 2.134.

Figure 2.134: Report of an RNA-Seq run.

The report contains the following information:
Sequence reads. Information about the number of reads.
Reference sequences. Information about the reference sequences used and their lengths
and the total number of genes found in the reference.
Transcripts per gene. A graph showing the number of transcripts per gene. For eukaryotes,
this will be equivalent to the number of mRNA annotations per gene annotation.
Exons per gene. A graph showing the number of exons per gene.
Exons per transcript. A graph showing the number of exons per transcript.
Read mapping. Shows statistics on:
Mapped reads. This number is divided into uniquely and non-specifically mapped
reads (see the point below on match specificity for details).
Unmapped reads.
Total reads. This is the number of reads used as input.
Paired reads. (Only included if paired reads are used). Shows the number of reads mapped
in pairs, the number of reads in broken pairs and the number of unmapped reads.
Match specificity. Shows a graph of the number of match positions for the reads. Most
reads will be mapped 0 or 1 time, but there will also be reads matching more than once

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

126

in the reference. This depends on the Maximum number of hits for a read setting in
figure2.127. Note that the number of reads that are mapped 0 times includes both the
number of reads that cannot be mapped at all and the number of reads that matches to
more than the 'Maximum number of hits for a read' parameter that you set in the second
wizard step. If paired reads are used, a separate graph is produced for that part of the
data.
Paired distance. (Only included if paired reads are used). Shows a graph of the distance
between mapped reads in pairs.
Detailed mapping statistics. This table divides the reads into the following categories.
Exon-exon reads. Reads that overlap two exons as specified in figure 2.130.
Exon-intron reads. Reads that span both an exon and an intron. If you have many
of these reads, it could indicate a low splicing-efficiency or that a number of splice
variants are not annotated on your reference.
Total exon reads. Number of reads that fall entirely within an exon or in an exon-exon
junction.
Total intron reads. Reads that fall entirely within an intron or in the gene's flanking
regions.
Total gene reads. All reads that map to the gene and it's flanking regions. This is the
mapped reads number used for calculating RPKM, see definition below.
For each category, the number of uniquely and non-specifically mapped reads are listed
as well as the relative fractions. Note that all this detailed information is also available
on the individual gene level in the RNA-Seq table ( )(see below). When the input data is
a combination of paired and single reads, the mapping statistics will be divided into two
parts.
Note that the report can be exported in pdf or Excel format.

2.14.4

Interpreting the RNA-Seq analysis result

The main result of the RNA-Seq is the reporting of expression values which is done on both the
gene and the transcript level (only eukaryotes).
Gene-level expression
When you open the result of an RNA-Seq analysis, it starts in the gene-level view as shown in
figure 2.135.
The table summarizes the read mappings that were obtained for each gene (or reference). The
following information is available in this table:
Feature ID. This is the name of the gene.
Expression values. This is based on the expression measure chosen in figure 2.132.
Transcripts. The number of transcripts based on the mRNA annotations on the reference.
Note that this is not based on the sequencing data - only on the annotations already on the
reference sequence(s).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

127

Figure 2.135: A subset of a result of an RNA-Seq analysis on the gene level. Not all columns are
shown in this figure
Detected transcripts. The number of transcripts which have reads assigned (see the
description of transcript-level expression below).
Exon length. The total length of all exons (not all transcripts).
Unique gene reads. This is the number of reads that match uniquely to the gene.
Total gene reads. This is all the reads that are mapped to this gene --- both reads that map
uniquely to the gene and reads that matched to more positions in the reference (but fewer
than the 'Maximum number of hits for a read' parameter) which were assigned to this gene.
Unique exon reads. The number of reads that match uniquely to the exons (including the
exon-exon and exon-intron junctions).
Total exon reads. Number of reads mapped to this gene that fall entirely within an exon
or in exon-exon or exon-intron junctions. As for the 'Total gene reads' this includes both
uniquely mapped reads and reads with multiple matches that were assigned to an exon of
this gene.
Unique exon-exon reads. Reads that uniquely match across an exon-exon junction of the
gene (as specified in figure 2.130). The read is only counted once even though it covers
several exons.
Total exon-exon reads. Reads that match across an exon-exon junction of the gene (as
specified in figure 2.130). As for the 'Total gene reads' this includes both uniquely mapped
reads and reads with multiple matches that were assigned to an exon-exon junction of this
gene.
Unique intron-exon reads. Reads that uniquely map across an exon-intron boundary. If
you have many of these reads, it could indicate that a number of splice variants are not
annotated on your reference.
Total intron-exon reads. Reads that map across an exon-intron boundary. As for the 'Total
gene reads' this includes both uniquely mapped reads and reads with multiple matches

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

128

that were assigned to an exon-intron junction of this gene. If you have many of these reads,
it could indicate that a number of splice variants are not annotated on your reference.
Exons. The number of exons based on the mRNA annotations on the reference. Note that
this is not based on the sequencing data - only on the annotations already on the reference
sequence(s).
Putative exons. The number of new exons discovered during the analysis (see more in
section 2.14.2).
RPKM. This is the expression value measured in RPKM [Mortazavi et al., 2008]: RPKM =
total exon reads
mapped reads(millions)exon length (KB) . See exact definition below. Even if you have chosen the
RPKM values to be used in the Expression values column, they will also be stored in a
separate column. This is useful to store the RPKM if you switch the expression measure.
See more in section 2.14.4.
Median coverage. This is the median coverage for all exons (for all reads - not only the
unique ones). Reads spanning exon-exon boundaries are not included.
Chromosome region start. Start position of the annotated gene.
Chromosome region end. End position of the annotated gene.
Double-clicking any of the genes will open the mapping of the reads to the reference (see
figure 2.136).

Figure 2.136: Opening the mapping of the reads. Zoomed out to provide a better overview.
Reads spanning two exons are shown with a dashed line between each end as shown in figure
2.136.
At the bottom of the table you can change the expression measure. Simply select another value
in the drop-down list. The expression measure chosen here is the one used for further analysis.
When setting up an experiment, you can specify an expression value to apply to all samples in
the experiment.
The RNA-Seq analysis result now represents the expression values for the sample, and it can be
further analyzed using the various tools described in chapter 3.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

129

Transcript-level expression
In order to switch to the transcript-level expression, click the Transcript-level expression (
button at the bottom of the view. You will now see a view as shown in figure 2.137.

Figure 2.137: A subset of a result of an RNA-Seq analysis on the transcript level. Not all columns
are shown in this figure
The following information is available in this table:
Feature ID. This is the gene name with a number appended to differentiate between
transcripts.
Expression values. This is based on the expression measure chosen in figure 2.132.
Transcripts. The number of transcripts based on the mRNA annotations on the reference.
Note that this is not based on the sequencing data - only on the annotations already on the
reference sequence(s).
Transcript length. The total length of all exons of that particular transcript.
Transcript ID. This information is retrieved from transcript_ID key on the mRNA annotation.
Unique transcript reads. This is the number of reads in the mapping for the gene that
are uniquely assignable to the transcript. This number is calculated after the reads have
been mapped and both single and multi-hit reads from the read mapping may be unique
transcript reads.
Total transcript reads. Once the 'Unique transcript read's have been identified and their
counts calculated for each transcript, the remaining (non-unique) transcript reads are
assigned randomly to one of the transcripts to which they match. The 'Total transcript
reads' counts are the total number of reads that are assigned to the transcript once this
random assignment has been done. As for the random assignment of reads among genes,
the random assignment of reads within a gene but among transcripts, is done proportionally
to the 'unique transcript counts' normalized by transcript length, that is, using the RPKM
(see the description of the 'Maximum number of hits for a read' option', 2.14.1). Unique
transcript counts of 0 are not replaced by 1 for this proportional assignment of non-unique
reads among transcripts.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

130

Ratio of unique to total (exon reads. This will show the ratio of the two columns described
above. This can be convenient for filtering the results to exclude the ones where you have
low confidence because of a relatively high number of non-unique transcript reads.
Exons. The number of exons for this transcript. Note that this is not based on the
sequencing data - only on the annotations already on the reference sequence(s).
RPKM. The RPKM value for the transcript, that is, the number of reads assigned to the
transcript divided by the transcript length and normalized by 'Mapped reads' (see below).
Relative RPKM. The RPKM value for the transcript divided by the maximum of the RPKM
values for transcripts for this gene.
Chromosome region start. Start position of the annotated gene.
Chromosome region end. End position of the annotated gene.
Definition of RPKM
RPKM, Reads Per Kilobase of exon model per Million mapped reads, is defined in this way
total exon reads
[Mortazavi et al., 2008]: RPKM = mapped reads(millions)exon
length (KB) .
Total exon reads This is the number in the column with header Total exon reads in the row for
the gene. This is the number of reads that have been mapped to a region in which an
exon is annotated for the gene or across the boundaries of two exons or an intron and
an exon for an annotated transcript of the gene. For eukaryotes, exons and their internal
relationships are defined by annotations of type mRNA.
Exon length This is the number in the column with the header Exon length in the row for the
gene, divided by 1000. This is calculated as the sum of the lengths of all exons annotated
for the gene. Each exon is included only once in this sum, even if it is present in more
annotated transcripts for the gene. Partly overlapping exons will count with their full length,
even though they share the same region.
Mapped reads The sum of all the numbers in the column with header Total gene reads. The
Total gene reads for a gene is the total number of reads that after mapping have been
mapped to the region of the gene. Thus this includes all the reads uniquely mapped to the
region of the gene as well as those of the reads which match in more places (below the
limit set in the dialog in figure 2.127) that have been allocated to this gene's region. A
gene's region is that comprised of the flanking regions (if it was specified in figure 2.127),
the exons, the introns and across exon-exon boundaries of all transcripts annotated for the
gene. Thus, the sum of the total gene reads numbers is the number of mapped reads for
the sample. This number can be found in the RNA-seq report's table 3.1, in the 'Total' entry
of the row 'Counted fragments'. (The term 'fragment' is used in place of the term 'read',
because if you analyze paired reads and have chosen the 'Default counting scheme' it is
'fragments' that is counted, rather than reads (two reads in a pair will be counted as one
fragment).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.15

131

Expression profiling by tags

Expression profiling by tags, also known as tag profiling or tag-based transcriptomics, is an extension of Serial analysis of gene expression (SAGE) using next-generation sequencing technologies.
With respect to sequencing technology it is similar to RNA-seq (see section 2.14), but with tag
profiling, you do not sequence the mRNA in full length. Instead, small tags are extracted from
each transcript, and these tags are then sequenced and counted as a measure of the abundance
of each transcript. In order to tell which gene's expression a given tag is measuring, the tags are
often compared to a virtual tag library. This consists of the 'virtual' tags that would have been
extracted from an annotated genome or a set of ESTs, had the same protocol been applied to
these. For a good introduction to tag profiling including comparisons with different micro array
platforms, we refer to ['t Hoen et al., 2008]. For more in-depth information, we refer to [Nielsen,
2007].
Figure 2.138 shows an example of the basic principle behind tag profiling. There are variations of
this concept and additional details, but this figure captures the essence of tag profiling, namely
the extraction of a tag from the mRNA based on restriction cut sites.

Figure 2.138: An example of the tag extraction process. 1+2. Oligo-dT attached to a magnetic bead
is used to trap mRNA. 3. The enzyme NlaIII cuts at CATG sites and the fragments not attached to
the magnetic bead are removed. 4. An adapter is ligated to the GTAC overang. 5. The adapter
includes a recognition site for MmeI which cuts 17 bases downstream. 6. Another adapter is added
and the sequence is now ready for amplification and sequencing. 7. The final tag is 17 bp. The
example is inspired by ['t Hoen et al., 2008].
The CLC Genomics Workbench supports the entire tag profiling data analysis work flow following
the sequencing:
Extraction of tags from the raw sequencing reads (tags from different samples are often

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

132

barcoded and sequenced in one pool).

Counting tags including a sequencing-error correction algorithm.
Creating a virtual tag list based on an annotated reference genome or an EST-library.
Annotating the tag counts with gene names from the virtual tag list.
Each of the steps in the work flow are described in details below.

2.15.1

Extract and count tags

First step in the analysis is to import the data (see section 2.1).
The next step is to extract the tags and count them:
Toolbox | High-throughput Sequencing (
Extract and Count Tags ( )

) | Expression Profiling by Tags (

) |

This will open a dialog where you select the reads that you have imported. Click Next when the
sequencing data is listed in the right-hand side of the dialog.
This dialog is where you define the elements in your reads. An example is shown in figure 2.139.

Figure 2.139: Defining the elements that make up your reads.

By defining the order and size of each element, the Workbench is now able to both separate
samples based on bar codes and extract the tag sequence (i.e. removing linkers, bar codes etc).
The elements available are:
Sequence This is the part of the read that you want to use as your final tag for counting and
annotating. If you have tags of varying lengths, add a spacer afterwards (see below).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

133

Sample keys Here you input a comma-separated list of the sample keys used for identifying the
samples (also referred to as "bar codes"). If you have not pooled and bar coded your data,
simply omit this element.
Linker This is a known sequence that you know should be present and do not want to be included
in your final tag.
Spacer This is also a sequence that you do not want to include in your final tag, but whereas
the linker is defined by its sequence, the spacer is defined by its length. Note that the
length defines the maximum length of the spacer. Often not all tags will be exactly the
same length, and you can use this spacer as a buffer for those tags that are longer than
what you have defined as your sequence. In the example in figure 2.139, the tag length is
17 bp, but a spacer is added to allow tags up to 19 bp. Note that the part of the read that
is extracted and used as the final tag does not include the spacer sequence. In this way
you homogenize the tag lengths which is usually desirable because you want to count short
and long tags together.
When you have set up the right order of your elements, click Next to set parameters for counting
tags as shown in figure 2.140.

Figure 2.140: Setting parameters for counting tags.

At the top, you can specify how to tabulate (i.e. count) the tags:
Raw counts This will produce the count for each tag in the data.
Sage Screen trimmed counts This will produce trimmed tag counts. The trimmed tag counts
are obtained by applying an implementation of the SAGEscreen method ( [Akmaev and
Wang, 2004]) to the raw tag counts. In this procedure, raw counts are trimmed using
probabilistic reasoning. In this procedure, if a tag with low count has a neighboring tag with
high count, and it is likely, based on the estimated mutation rate, that the low count tags
have arisen through sequencing errors of the tags with higher count, the count of the less
abundant tag will be attributed to the higher abundant neighboring tag. The implementation

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

134

of the SAGEscreen method is highly efficient and provides considerable speed and memory
improvements.
Next, you can specify additional parameters for the alignment that takes place when the tags are
tabulated:
Allowing indels Ticking this box means that, when SAGEscreen is applied, neighboring tags will,
in addition to tags which differ by nucleotide substitutions, also include tags with insertion
or deletion differences.
Color space This option is only available if you use data generated on the SOLiD platform.
Checking this option will perform the alignment in color space which is desirable because
sequencing errors can be corrected. Learn more about color space in section 2.8.
At the bottom you can set a minimum threshold for tags to be reported. Although the SAGEscreen
trimming procedure will reduce the number of erroneous tags reported, the procedure only
handles tags that are neighbors of more abundant tags. Because of sequencing errors, there
will be some tags that show extensive variation. There will by chance only be a few copies of
these tags, and you can use the minimum threshold option to simply discard tags. The default
value is two which means that tags only occurring once are discarded. This setting is a trade-off
between removing bad-quality tags and still keeping tags with very low expression (the ability to
measure low levels of mRNA is one of the advantages of tag profiling over for example micro
arrays ['t Hoen et al., 2008]).
Note! If more samples are created, SAGEscreen and the minimum threshold cut-offs will be
applied to the cumulated counts (i.e. all tags for all samples).
Clicking Next allows you to specify the output of the analysis as shown in figure 2.141.

Figure 2.141: Output options.

The options are:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

135

Create expression samples with tag counts This is the primary result showing all the tags and
respective counts (an example is shown in figure 2.142). For each sample defined via the
bar codes, there will be an expression sample like this. Note that all samples have the
same list of tags, even if the tag is not present in the given sample (i.e. there will be tags
with count 0 as shown in figure 2.142). The expression samples can be used in further
analysis by the expression analysis tools (see chapter 3).
Create sequence lists of extracted tags This is a simple sequence list of all the tags that were
extracted. The list is simple with no counts or additional information.
Create list of reads which have no tags This list contains the reads from which a tag could not
be extracted. This is most likely bad quality reads with sequencing errors that make them
impossible to group by their bar codes. It can be useful for troubleshooting if the amount
of real tags is smaller than expected.

Figure 2.142: The tags have been extracted and counted.

Finally, a log can be shown of the extraction and count process. The log gives useful information
such as the number of tags in each sample and the number of reads without tags.

2.15.2

Create virtual tag list

Before annotating the tag sample ( ) created above, you need to create a so-called virtual tag
list. The list is created based on a DNA sequence or sequence list holding, an annotated genome
or a list of ESTs. It represents the tags that you would expect to find in your experimental data
(given the reference genome or EST list reflects your sample). To create the list, you specify the
restriction enzyme and tag length to be used for creating the virtual list.
The virtual tag list can be saved and used to annotate experiments made from tag-based
expression samples as shown in section 2.15.3.
To create the list:
Toolbox | High-throughput Sequencing (
Create Virtual Tag List ( )

) | Expression Profiling by Tags (

) |

This will open a dialog where you select one or more annotated genomic sequences or a list of
ESTs. Click Next when the sequences are listed in the right-hand side of the dialog.
This dialog is where you specify the basis for extracting the virtual tags (see figure 2.143).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

136

Figure 2.143: The basis for the extraction of reads.

At the top you can choose to extract tags based on annotations on your sequences by checking
the Extract tags in selected areas only option. This option is applicable if you are using annotated
genomes (e.g. Refseq genomes). Click the small button ( ) to the right to display a dialog
showing all the annotation types in your sequences. Select the annotation type representing
your transcripts (usually mRNA or Gene). The sequence fragments covered by the selected
annotations will then be extracted from the genomic sequence and used as basis for creating
the virtual tag list.
If you use a sequence list where each sequence represents your transcript (e.g. an EST library),
you should not check the Extract tags in selected areas only option.
Below, you can choose to include the reverse complement for creating virtual tags. This is mainly
used if there is uncertainty about the orientation of sequences in an EST library.
Clicking Next allows you to specify enzymes and tag length as shown in figure 2.144.

Figure 2.144: Defining restriction enzyme and tag length.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

137

At the top, find the enzyme used to define your tag and double-click to add it to the panel on the
right (as it has been done with NlaIII in figure 2.144). You can use the filter text box so search
for the enzyme name.
Below, there are further options for the tag extraction:
Extract tags When extracting the virtual tags, you have to decide how to handle the situation
where one transcript has several cut sites. In that case there would be several potential
tags. Most tag profiling protocols extract the 3'-most tag (as shown in the introduction in
figure 2.138), so that would be one way of defining the tags in the virtual tag list. However,
due to non-specific cleavage, new alternative splicing or alternative polyadenylation ['t Hoen
et al., 2008], tags produced from internal cut sites of the transcript are also quite frequent.
This means that it is often not enough to consider the 3'-most restriction site only. The list
lets you select either All, External 3' which is the 3'-most tag or External 5' which is the
5' most tag (used by some protocols, for example CAGE - cap analysis of gene expression
- see [Maeda et al., 2008]). The result of the analysis displays whether the tag is found at
the 3' end or if it is an internal tag (see more below).
Tag downstream/upstream When the cut site is found, you can specify whether the tag is then
found downstream or upstream of the site. In figure 2.138, the tag is found downstream.
Tag length The length of the tag to be extracted. This should correspond to the sequence length
defined in figure 2.139.
Clicking Next allows you to specify the output of the analysis as shown in figure 2.145.

Figure 2.145: Output options.

The output options are:
Create virtual tag table This is the primary result listing all the virtual tags. The table is explained
in detail below.
Create a sequence list of extracted tags All the extracted tags can be represented in a raw
sequence list with no additional information except the name of the transcript. You can e.g.
Export ( ) this list to a fasta file.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

138

Output list of sequences in which no tags were found The transcripts that do not have a cut
site or where the cut site is so close to the end that no tag could be extracted are
presented in this list. The list can be used to inspect which transcripts you could potentially
fail to measure using this protocol. If there are tags for all transcripts, this list will not be
produced.
In figure 2.146 you see an example of a table of virtual tags that have been produced using the
3' external option described above.

Figure 2.146: A virtual tag table of 3' external tags.

The first column lists the tag itself. This is the column used when you annotate your tag count
samples or experiments (see section 2.15.3). Next follows the name of the tag's origin transcript.
Sometimes the same tag is seen in more than one transcript. In that case, the different origins
are separated by /// as it is the case for the tag of LOC100129681 /// BST2 in figure 2.146.
The row just below, UBA52, has the same name listed twice. This is because the analysis was
based on mRNA annotations from a Refseq genome where each splice variant has its own mRNA
annotation, and in this case the UBA52 gene has two mRNA annotations including the same tag.
The last column is the description of the transcript (which is either the sequence description
if you use a list of un-annotated sequences or all the information in the annotation if you use
annotated sequences).
The example shown in figure 2.146 is the simplest case where only the 3' external tags are
listed. If you choose to list All tags, the table will look like figure 2.147.
In addition to the information about the 3' tags, there are additional columns for 5' and internal
tags. For the internal tags there is also a numbering, see for example the top row in figure 2.147
where the TMEM16H tag is tag number 3 out of 16. This information can be used to judge how
close to the 3' end of the transcript the tag is. As mentioned above, you would often expect to
sequence more tags from cut sites near the 3' end of the transcript.
If you have chosen to include reverse complemented sequences in the analysis, there will be an
additional set of columns for the tags of the other strand, denoted with a (-).
You can use the advanced table filtering (see section ??) to interrogate the number of tags with
specific origins (e.g. define a filter where 3' origin != and then leave the text field blank).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

139

Figure 2.147: A virtual tag table where all tags have been extracted. Note that some of the columns
have been ticked off in the Side Panel.

2.15.3

Annotate tag experiment

Combining the tag counts ( ) from the experimental data (see section 2.15.1) with the virtual
tag list ( ) (see above) makes it possible to put gene or transcript names on the tag counts.
The Workbench simply compares the tags in the experimental data with the virtual tags and
transfers the annotations from the virtual tag list to the experimental data.
This is done on an experiment level (experiments are collections of samples with defined
groupings, see section 3.1):
Toolbox | High-throughput Sequencing (
Annotate Tag Experiment ( )

) | Expression Profiling by Tags (

You can also access this functionality at the bottom of the Experiment table (
figure 2.148.

) |

) as shown in

Figure 2.148: You can annotate an experiment directly from the experiment table.
This will open a dialog where you select a virtual tag list ( ) and an experiment ( ) of
tag-based samples. Click Next when the elements are listed in the right-hand side of the dialog.
This dialog lets you choose how you want to annotate your experiment (see figure 2.149).
If a tag in the virtual tag list has more than one origin (as shown in the example in figure 2.147)
you can decide how you want your experimental data to be annotated. There are basically two
options:
Annotate all This will transfer all annotations from the virtual tag. The type of origin is still
preserved so that you can see if it is a 3' external, 5' external or internal tag.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

140

Figure 2.149: Defining the annotation method.

Only annotate highest priority This will look for the highest priority annotation and only add this
to the experiment. This means that if you have a virtual tag with a 3' external and an
internal tag, only the 3' external tag will be annotated (using the default prioritization). You
can define the prioritization yourself in the table below: simply select a type and press the
up ( ) and down ( ) arrows to move it up and down in the list. Note that the priority table
is only active when you have selected Only annotate highest priority.
Click Next to choose how you want to tags to be aligned (see figure 2.150).

When the tags

Figure 2.150: Settings for aligning the tags.

from the virtual tag list are compared to your experiment, the tags are matched using one of the
following options:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

Tag from experiment:
Tag1 from virtual tag list (internal):
Tag1 from virtual tag list (3 external):

141
CGTATCAATCGATTAC
||||||||||||||||
CGTATCAATCGATTAC
| ||||||||||||||
CCTATCAATCGATTAC

Require perfect match The tags need to be identical to be matched.

Allow single substitutions If there is up to one mismatch in the alignment, the tags will still be
matched. If there is a perfect match, single substitutions will not be considered.
Allow single substitutions or indels Similar to the previous option, but now single-base insertions and deletions are also allowed. Perfect matches are preferred to single-base
substitutions which are preferred to insertions, which are again preferred to deletions. 3
If you select any of the two options allowing mismatches or mismatches and indels, you can also
choose to Prefer high priority mutant. This option is only available if you have chosen to annotate
highest priority only in the previous step (see figure 2.149). The option is best explained through
an example: In this case, you have a tag that matches perfectly to an internal tag from the virtual
tag list. Imagine that in this example, you have prioritized the annotation so that 3' external tags
are of higher priority than internal tags. The question is now if you want to accept the perfect
match (of a low priority virtual tag) or the high-priority virtual tag with one mismatch? If you check
the Prefer high priority mutant, the 3' external tag in the example above will be used rather than
the perfect match.
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish. .
This will add extra annotation columns to the experiment. The extra columns corresponds to the
columns found in your virtual tag list. If you have chosen to annotate highest priority-only, there
will only be information from one origin-column for each tag as shown in figure 2.151.

Figure 2.151: An experiment annotated with prioritized tags.

Note that if you use color space data, only color errors are allowed when choosing anything but perfect match.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

2.16

142

Small RNA analysis

The small RNA analysis tools in CLC Genomics Workbench are designed to facilitate trimming
of sequencing reads, counting and annotating of the resulting tags using miRBase or other
annotation sources and performing expression analysis of the results. The tools are general
and flexible enough to accommodate a variety of data sets and applications within small RNA
profiling, including the counting and annotation of both microRNAs and other non-coding RNAs
from any organism. Both Illumina, 454 and SOLiD sequencing platforms are supported. For
SOLiD, adapter trimming and annotation is done in color space.
The annotation part is designed to make special use of the information in miRBase but more
general references can be used as well.
There are generally two approaches to the analysis of microRNAs or other smallRNAs: (1) count
the different types of small RNAs in the data and compare them to databases of microRNAs or
other smallRNAs, or (2) map the small RNAs to an annotated reference genome and count the
numbers of reads mapped to regions which have smallRNAs annotated. The approach taken by
CLC Genomics Workbench is (1). This approach has the advantage that it does not require an
annotated genome for mapping --- you can use the sequences in miRBase or any other sequence
list of smallRNAs of interest to annotate the small RNAs. In addition, small RNAs that would not
have mapped to the genome (e.g. when lacking a high-quality reference genome or if the RNAs
have not been transcribed from the host genome) can still be measured and their expression be
compared. The methods and tools developed for CLC Genomics Workbench are inspired by the
findings and methods described in [Creighton et al., 2009], [Wyman et al., 2009], [Morin et al.,
2008] and [Stark et al., 2010].
In the following, the tools for working with small RNAs are described in detail. Look at the tutorials
on http://www.clcbio.com/tutorials to see examples of analyzing specific data sets.

2.16.1

Extract and count

First step in the analysis is to import the data (see section 2.1).
The next step is to extract and count the small RNAs to create a small RNA sample that can be
used for further analysis (either annotating or analyzing using the expression analysis tools):
Toolbox | High-throughput Sequencing (
Count ( )

) | Small RNA Analysis (

) | Extract and

This will open a dialog where you select the sequencing reads that you have imported. Click Next
when the sequencing data is listed in the right-hand side of the dialog. Note that if you have
several samples, they should be processed separately.
This dialog (see figure 2.152) is where you specify whether the reads should be trimmed for
adapter sequences prior to counting. It is often necessary to trim off remainders of adapter
sequences from the reads before counting.
When you click Next, you will be able to specify how the trim should be performed as shown in
figure 2.153.
If you have chosen not to trim the reads for adapter sequence, you will see figure 2.154 instead.
The trim options shown in figure 2.153 are the same as described under adapter trim in section
2.3.2. Please refer to this section for more information.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

143

Figure 2.152: Specifying whether adapter trimming is needed.

Figure 2.153: Setting parameters for adapter trim.

It should be noted that if you expect to see part of adapters in your reads, you would typically
choose Discard when not found as the action. By doing this, only reads containing the adapter
sequence will be counted as small RNAs in the further analysis. If you have a data set where the
adapter may be there or not you would choose Remove adapter.
Note that all reads will be trimmed for ambiguity symbols such as N before the adapter trim.
Clicking Next allows you to specify additional options regarding trimming and counting as shown
in figure 2.154.
At the top you can choose to Trim bases by specifying a number of bases to be removed from
either the 3' or the 5' end of the reads. Below, you can specify the minimum and maximum
lengths of the small RNAs to be counted (this is the length after trimming). The minimum length
that can be set is 15 and the maximum is 55.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

144

Figure 2.154: Defining length interval and sampling threshold.

At the bottom, you can specify the Minimum sampling count. This is the number of copies of the
small RNAs (tags) that are needed in order to include it in the resulting count table (the small
RNA sample). The actual counting is very simple and relies on perfect match between the reads
to be counted together4 . This also means that a count threshold of 1 will include a lot of unique
tags as a result of sequencing errors. In order to set the threshold right, the following should be
considered:
If the sample is going to be annotated, annotations may be found for the tags resulting
from sequencing errors. This means that there is no negative effect of including tags with
a low count in the output.
When using un-annotated sequences for discovery of novel small RNAs, it may be useful to
apply a higher threshold to eliminate the noise from sequencing errors. However, this can
be done at a later stage by filtering the sample and creating a sub-set.
When multiple samples are compared, it is interesting to know if one tag which is abundant
in one sample is also found in another, even at a very low number. In this case, it is
useful to include the tags with very low counts, since they may become more trustworthy in
combination with information from other samples.
Setting the count threshold higher will reduce the size of the sample produced which will
reduce the memory and disk usage when working with the results.
Clicking Next allows you to specify the output of the analysis as shown in 2.155.
The options are:
Create sample This is the primary result showing all the tags and respective counts (an example
is shown in figure 2.156). Each row represents a tag with the actual sequence as the
feature ID and a column with Length and Count. The actual count is based on 100 %
4

Note that you can identify variants of the same miRNA when annotating the sample (see below).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

145

Figure 2.155: Output options.

similarity5 . The sample can be used in further analysis by the expression analysis tools
(see chapter 3) in the "raw" form, or you can annotate it (see below). The tools for working
with the data in the sample are described in section 2.16.4.
Create report This will create a summary report as described below.
Create list of reads discarded during trimming This list contains the reads where no adapter
was found (when choosing Discard when not found as the action).
Create list of reads excluded from sample This list contains the reads that passed the trimming
but failed to meet the sampling thresholds regarding minimum/maximum length and number
of copies.
The summary report includes the following information (an example is shown in figure 2.157):
Trim summary Shows the following information for each input file:
Number of reads in the input.
Average length of the reads in the input.
Number of reads after trim. The difference between the number of reads in the input
and this number will be the number of reads that are discarded by the trim.
Percentage of the reads that pass the trim.
Average length after trim. When analyzing miRNAs, you would expect this number to
be around 22. If the number is significantly lower or higher, it could indicate that the
trim settings are not right. In this case, check that the trim sequence is correct, that
the strand is right, and adjust the alignment scores. Sometimes it is preferable to
increase the minimum scores to get rid of low-quality reads. The average length after
trim could also be somewhat larger than 22 if your sequenced data contains a mixture
of miRNA and other (longer) small RNAs.
5

Note that you can identify variants of the same miRNA when annotating the sample (see below).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

146

Figure 2.156: The tags have been extracted and counted.

Read length before/after trimming Shows the distribution of read lengths before and after trim.
The graph shown in figure 2.157 is typical for miRNA sequencing where the read lengths
after trim peaks at 22 bp.
Trim settings The trim settings summarized. Note that ambiguity characters will automatically
be trimmed.
Detailed trim results This is described under adapter trim in section 2.3.2.
Tag counts The number of tags and two plots showing on the x-axis the counts of tags and on
the y-axis the number of tags for which this particular count is observed. The plot is in a
zoomed version where only the lower part of the y-axis is shown to make it possible to see
the numbers of tags higher counts.

2.16.2

Downloading miRBase

In order to make use of the additional information about mature regions on the precursor miRNAs
in miRBase, you need to use the integrated tool to download miRBase rather than downloading
it from http://www.mirbase.org/:
Toolbox | High-throughput Sequencing (
miRBase ( )

) | Small RNA Analysis (

) | Download

This will download a sequence list with all the precursor miRNAs including annotations for mature
regions. The list can then be selected when annotating the samples with miRBase (see section
2.16.3).
The downloaded version will always be the latest version (it is downloaded from ftp://
mirbase.org/pub/mirbase/CURRENT/miRNA.dat.gz). Information on the version number
of miRBase is also available in the History ( ) of the downloaded sequence list, and when using
this for annotation, the annotated samples will also include this information in their History ( ).

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

147

Figure 2.157: A summary report of the counting.

2.16.3

Annotating and merging small RNA samples

The small RNA sample produced when counting the tags (see section 2.16.1) can be enriched
by CLC Genomics Workbench by comparing the tag sequences with annotation resources such
as miRBase and other small RNA annotation sources. Note that the annotation can also be
performed on an experiment, set up from small RNA samples (see section 3.1.2).
Besides adding annotations to known small RNAs in the sample, it is also possible to merge
variants of the same small RNA to get a cumulated count. When initially counting the tags, the
Workbench requires that the trimmed reads are identical for them to be counted as the same
tag. However, you will often see different variants of the same miRNA in a sample, and it is
useful to be able to count these together. This is also possible using the tool to annotate and
merge samples.
Toolbox | High-throughput Sequencing (
and Merge Counts ( )

) | Small RNA Analysis (

) | Annotate

This will open a dialog where you select the small RNA samples ( ) to be annotated. Note
that if you have included several samples, they will be processed separately but summarized
in one report providing a good overview of all samples. You can also input Experiments ( )
(see section 3.1.2) created from small RNA samples. Click Next when the data is listed in the
right-hand side of the dialog.
This dialog (figure 2.158) is where you define the annotation resources to be used.
There are two ways of providing annotation sources:

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

148

Figure 2.158: Defining annotation resources.

Downloading miRBase using the integrated download tool (explained in section 2.16.2).
Importing a list of sequences, e.g. from a fasta file. This could be from Ensembl,
e.g. ftp://ftp.ensembl.org/pub/release-57/fasta/homo_sapiens/ncrna/
Homo_sapiens.GRCh37.57.ncrna.fa.gz or from ncRNA.org: http://www.ncrna.
org/frnadb/files/ncrna.zip.
Note: We recommend using the integrated download tool to import miRBase. Although it is
possible to import it as a fasta file, the same options with regards to species will not be available
if you import from a file.
The downloaded miRBase file contains all precursor sequences from the latest version of
miRBase http://www.mirbase.org/ including annotations defining the mature regions (see
an example in figure 2.159).

Figure 2.159: Some of the precursor miRNAs from miRBase have both 3' and 5' mature regions
(previously referred to as mature and mature*) annotated (as the two first in this list).
This means that it is possible to have a more fine-grained classification of the tags using miRBase
compared to a simple fasta file resource containing the full precursor sequence. This is the
reason why the miRBase annotation source is specified separately in figure 2.158.
At the bottom of the dialog, you can specify whether miRBase should be prioritized over the
additional annotation resource. The prioritization is explained in detail later in this section. To

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

149

prioritize one over the other can be useful when there is redundant information (e.g. if you have
an additional source that also contains all the miRNAs from miRBase and you prefer the miRBase
annotations when possible).
When you click Next, you will be able to choose which species from miRBase should be used
and in which order (see figure 2.160). Note that if you have not selected a miRBase annotation
source, you will go directly to the next step shown in figure 2.161.

Figure 2.160: Defining and prioritizing species in miRBase.

To the left, you see the list of species in miRBase. This list is dynamically created based on the
information in the miRBase file. Using the arrow button ( ) you can add species to the right-hand
panel. The order of the species is important since the tags are annotated iteratively based on
the order specified here. This means that in the example in figure 2.160, a human miRNA will
preferred over mouse, even if they are identical in sequence (the prioritization is elaborated
below). The up and down arrows ( )/ ( ) can be used to change the order of species.
When you click Next, you will be able to specify how the alignment of the tags against the
annotation sources should be performed (see figure 2.161).
The panel at the top is active only if you have chosen to annotate with miRBase. It is used to
define the requirements to the alignment of a read for it to be counted as a mature or mature*
tag:
Additional upstream bases This defines how many bases the tag is allowed to extend the
annotated mature region at the 5' end and still be categorized as mature.
Additional downstream bases This defines how many bases the tag is allowed to extend the
annotated mature region at the 3' end and still be categorized as mature.
Missing upstream bases This defines how many bases the tag is allowed to miss at the 5' end
compared to the annotated mature region and still be categorized as mature.
Missing downstream bases This defines how many bases the tag is allowed to miss at the 3'
end compared to the annotated mature region and still be categorized as mature.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

150

Figure 2.161: Setting parameters for aligning.

At the bottom of the dialog you can specify the Maximum mismatches (default value is 2).
Furthermore, you can specify if the alignment and annotation should be performed in color space
which is available when your small RNA sample is based on SOLiD data. 6 Finally, you can choose
whether the tags should be aligned against both strands of the reference or only the positive
strand. Usually it is only necessary to align against the positive strand.
At this point, a more elaborate explanation of the annotation algorithm is needed. The short read
mapping algorithm in the CLC Genomics Workbench is used to map all the tags to the reference
sequences which comprise the full precursor sequences from miRBase and the sequence lists
chosen as additional resources. The mapping is done in several rounds: the first round is done
requiring a perfect match, the second allowing one mismatch, the third allowing two mismatches
etc. No gaps are allowed. The number of rounds depend on the number of mismatches allowed7
(default is two which means three rounds of read mapping, see figure 2.161).
After each round of mapping, the tags that are mapped will be removed from the list of tags that
continue to the next round. This means that a tag mapping with perfect match in the first round
will not be considered for the subsequent one-mismatch round of mapping.
Following the mapping, the tags are classified into the following categories according to where
they match.
Mature 5' exact
Mature 5' super
Mature 5' sub
Mature 5' sub/super
6

Note that this option is only going to make a difference for tags with low counts. Since the actual tag counting in
the first place is done based on perfect matches, the highly abundant tags are not likely to have sequencing errors,
and aligning in color space does not add extra benefit for these.
7
For color space, the maximum number of mismatches is 2.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

151

Mature 3' exact

Mature 3' super
Mature 3' sub
Mature 3' sub/super
Precursor
Other
All these categories except Other refer to hits in miRBase. For hits on mirBase sequences we
distinguish between where on the sequences the tags match. The mirBase sequences may have
up to two mature micro RNAs annotated. We refer to a mature miRNA that is located closer (or
equally close) to the 5' end than to the 3' end as 'Mature 5''. A mature miRNA that is located
closer to the 3' end is referred to as 'Mature 3''. Exact means that the tag matches exactly to the
annotated mature 5' or 3' region; Sub means that the observed tag is shorter than the annotated
mature 5' or mature 3'; super means that the observed tag is longer than the annotated mature
5' or mature 3'. The combination sub/super means that the observed tag extends the annotation
in one end and is shorter at the other end. Precursor means that the tag matches on a mirBase
sequence, but outside of the annotated mature region(s). The Other category is for hits in the
other resources (the information about resource is also shown in the output).
An example of an alignment is shown in figure 2.162 using the same alignment settings as in
figure 2.161.

Figure 2.162: Alignment of length variants of mir-30a.

The two tags at the top are both classified as mature 5' super because they cover and extend
beyond the annotated mature 5' RNA. The third tag is identical to the annotated mature 5'. The

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

152

fourth tag is classified as precursor because it does not meet the requirements on length for it to
be counted as a mature hit --- it lacks 6 bp compared to the annotated mature 5' RNA. The fifth
tag is classified as mature 5' sub because it also lacks one base but stays within the threshold
defined in figure 2.161.
If a tag has several hits, the list above is used for prioritization. This means that e.g. a Mature 5'
sub is preferred over a Mature 3' exact. Note that if miRBase was chosen as lowest priority (figure
2.158), the Other category will be at the top of the list. All tags mapping to a miRBase reference
without qualifying to any of the mature 5' and mature 3' types will be typed as Precursor.
In case you have selected more than one species for miRBase annotation (e.g. Homo Sapiens
and Mus Musculus) the following rules for adding annotations apply:
1. If a tag has hits with the same priority for both species, the annotation for the top-prioritized
species will be added.
2. Read category priority is stronger than species category priority: If a read is a higher priority
match for a mouse miRBase sequence than it is for a human miRBase sequence the
annotation for the mouse will be used
Clicking Next allows you to specify the output of the analysis as shown in 2.163.

Figure 2.163: Output options.

The options are:
Create unannotated sample All the tags where no hit was found in the annotation source are
included in the unannotated sample. This sample can be used for investigating novel
miRNAs, see section 2.16.5. No extra information is added, so this is just a subset of the
input sample.
Create annotated sample This will create a sample as described in section 2.16.4. In this
sample, the following columns have been added to the counts.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

153

Name This is the name of the annotation sequence in the annotation source. For miRBase,
it will be the names of the miRNAs (e.g. let-7g or mir-147), and for other source, it will
be the name of the sequence.
Resource This is the source of the annotation, either miRBase (in which case the species
name will be shown) or other sources (e.g. Homo_sapiens.GRCh37.57.ncrna).
Match type The match type can be exact or variant (with mismatches) of the following
types:

Mature 5'
Mature 5'
Mature 5'
Mature 5'
Mature 3'
Mature 3'
Mature 3'
Mature 3'
Precursor
Other

super
sub
sub/super
super
sub
sub/super

Mismatches The number of mismatches.

Note that if a tag has two equally prioritized hits, they will be shown with // between the
names. This could be e.g. two precursor sequences sharing the same mature sequence
(also see the sample grouped on mature below).
Create grouped sample, grouping by Precursor/Reference This will create a sample as described in section 2.16.4. All variants of the same reference sequence will be merged to
create one expression value for all.
Expression values. The expression value can be changed at the bottom of the table. The
default is to use the counts in the mature 5' column.
Name. The name of the reference. For miRBase this will then be the name of the precursor.
Resource. The name of the resource that the reference comes from.
Exact mature 5'. The number of exact mature 5' reads.
Mature 5'. The number of all mature 5' reads including sub, super and variants.
Unique exact mature 5'. In cases where one tag has several hits (as denoted by the //
in the ungrouped annotated sample as described above), the counts are distributed
evenly across the references. The difference between Exact mature 5' and Unique
exact mature 5' is that the latter only includes reads that are unique to this reference.
Unique mature 5'. Same as above but for all mature 5's, including sub, super and variants.
Exact mature 3'. Same as above, but for mature 3'.
Mature 3'. Same as above, but for mature 3'.
Unique exact mature '3. Same as above, but for mature 3'.
Unique mature '3. Same as above, but for mature 3'.
Exact other. Exact match in the resources chosen besides miRBase.
Other. All matches in the resources chosen besides miRBase including variants. The last
two numbers are the only ones used when the reference is not from miRBase.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

154

Total. The total number of tags mapped and classified to the precursor/reference sequence.
Create grouped sample, grouping by Mature This will create a sample as described in section
2.16.4. This is also a grouped sample, but in addition to grouping based on the same
reference sequence, the tags in this sample are grouped on the same mature 5'. This
means that two precursor variants of the same mature 5' miRNA are merged. Note that it is
only possible to create this sample when using miRBase as annotation resource (because
the Workbench has a special interpretation of the miRBase annotations for mature as
described previously). To find identical mature 5' miRNAs, the Workbench compares all
the mature 5' sequences and when they are identical, they are merged. The names of the
precursor sequences merged are all shown in the table.
Expression values. The expression value can be changed at the bottom of the table. The
default is to use the counts in the mature 5' column.
Name. The name of the reference. When several precursor sequences have been merged,
all the names will be shown separated by //.
Resource. The species of the reference.
Exact mature 5'. The number of exact mature 5' reads.
Mature 5'. The number of all mature 5' reads including sub, super and variants.
Unique exact mature 5'. In cases where one tag has several hits (as denoted by the //
in the ungrouped annotated sample as described above), the counts are distributed
evenly across the references. The difference between Exact mature 5' and Unique
exact mature 5' is that the latter only includes reads that are unique to one of the
precursor sequences that are represented under this mature 5' sequence.
Unique mature 5'. Same as above but for all mature 5's, including sub, super and variants.
Create report. A summary report described below.
The summary report includes the following information (an example is shown in figure 2.164):
Summary Shows the following information for each input sample:
Number of small RNAs(tags) in the input.
Number of annotated tags (number and percentage).
Number of reads in the sample (one tag can represent several reads)
Number of annotated reads (number and percentage).
Resources Shows how many matches were found in each resource:
Number of sequences in the resource.
Number of sequences where a match was found (i.e. this sequence has been observed
at least once in the sequencing data).
Reads Shows the number of reads that fall into different categories (there is one table per input
sample). On the left hand side are the annotation resources. For each resource, the count
and percentage of reads in that category are shown. Note that the percentage are relative
to the overall categories (e.g. the miRBase reads are a percentage of all the annotated
reads, not all reads). This is information is shown for each mismatch level.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

155

Small RNAs Similar numbers as for the reads but this time for each small RNA tag and without
mismatch differentiation.
Read count proportions A histogram showing, for each interval of read counts, the proportion
of annotated (respectively, unannotated) small RNAs with a read count in that interval.
Annotated small RNAs may be expected to be associated with higher counts, since the
most abundant small RNAs are likely to be known already.
Annotations (miRBase) Shows an overview table for classifications of the number of reads that
fall in the miRBase categories for each species selected.
Annotations (Other) Shows an overview table with read numbers for total, exact match and
mutant variants for each of the other annotation resources.

Figure 2.164: A summary report of the annotation.

2.16.4

Working with the small RNA sample

Generally speaking, the small RNA sample comes in two variants:

The un-grouped sample, either as it comes directly from the Extract and Count ( ) or
when it has been annotated. In this sample, there is one row per tag, and the feature ID is
the tag sequence.
The grouped sample created using the Annotate and Merge Counts ( ) tool. In this
sample, each row represents several tags grouped by a common Mature or Precursor
miRNA or other reference.
Below, these two kinds of samples are described in further detail. Note that for both samples,
filtering and sorting can be applied, see section ??.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

156

The un-grouped sample

An example of an un-grouped annotated sample is shown in figure 2.165.

Figure 2.165: An ungrouped annotated sample.

By selecting one or more rows in the table, the buttons at the bottom of the view can be used to
extract sequences from the table:
Extract Reads ( ) This will extract the original sequencing reads that contributed to this tag.
Figure 2.166 shows an example of such a read. The reads include trim annotations (for
use when inspecting and double-checking the results of trimming). Note that if these reads
are used for read mapping, the trimmed part of the read will automatically be removed. If
all rows in the sample are selected and extracted, the sequence list would be the same as
the input except for the reads that did not meet the adapter trim settings and the sampling
thresholds (tag length and number of copies).
Extract Trimmed Reads (
removed.
Extract Small RNAs (

) The same as above, except that the trimmed part has been

) This will extract only one copy of each tag.

Note that for all these, you will be able to determine whether a list of DNA or RNA sequences
should be produced (when working within the CLC Genomics Workbench environment, this only
effects the RNA folding tools).

Figure 2.166: Extracting reads from a sample.

The button Create Sample from Selection ( ) can be used to create a new sample based on
the tags that are selected. This can be useful in combination with filtering and sorting.
The grouped sample
An example of a grouped annotated sample is shown in figure 2.167.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

157

Figure 2.167: A sample grouped on mature 5' miRNAs.

The contents of the table are explained in section 2.16.3. In this section, we focus on the tools
available for working with the sample.
By selecting one or more rows in the table, the buttons at the bottom of the view become active:
Open Read Mapping ( ) This will open a view showing the annotation reference sequence at
the top and the tags aligned to it as shown in figure 2.168. The names of the tags indicate
their status compared with the reference (e.g. Mature 5', Mature super 5', Precursor).
This categorization is based on the choices you make when annotating. You can also see
the annotations when using miRBase as the annotation source. In this example both the
mature 5' and the mature 3' are annotated, and you can see that both are found in the
sample. In the Side Panel to the right you can see the Match weight group under Residue
coloring which is used to color the tags according to their relative abundance. The weight
is also shown next to the name of the tag. The left side color is used for tags with low
counts and the right side color is used for tags with high counts, relative to the total counts
of this annotation reference. The sliders just above the gradient color box can be dragged
to highlight relevant levels of abundance. The colors can be changed by clicking the box.
This will show a list of gradients to choose from.
Create Sample from Selection ( ) This is used to create a new sample based on the tags that
are selected. This can be useful in combination with filtering and sorting.

2.16.5

Exploring novel miRNAs

One way of doing this would be to identify interesting tags based on their counts (typically you
would be interested in pursuing tags with not too low counts in order to avoid wasting efforts
on tags based on reads with sequencing errors), Extract Small RNAs ( ) and use this list of
tags as input to Map Reads to Reference ( ) using the genome as reference. You could then
examine where the reads match, and for reads that map in otherwise unannotated regions you
could select a region around the match and create a subsequence from this. The subsequence
could be folded and examined to see whether the secondary structure was in agreement with the
expected hairpin-type structure for miRNAs.

CHAPTER 2. HIGH-THROUGHPUT SEQUENCING

158

Figure 2.168: Aligning all the variants of this miRNA from miRBase, providing a visual overview of
the distribution of tags along the precursor sequence.

Chapter 3

Expression analysis
Contents
3.1

Experimental design . . . . . . . . . . . . . . . . . . . . . . . . .
3.1.1
Supported array platforms . . . . . . . . . . . . . . . . . . . .
3.1.2
Setting up an experiment . . . . . . . . . . . . . . . . . . . .
3.1.3
Organization of the experiment table . . . . . . . . . . . . . .
3.1.4
Adding annotations to an experiment . . . . . . . . . . . . . .
3.1.5
Scatter plot view of an experiment . . . . . . . . . . . . . . .
3.1.6
Cross-view selections . . . . . . . . . . . . . . . . . . . . . .
3.2
Transformation and normalization . . . . . . . . . . . . . . . . . .
3.2.1
Selecting transformed and normalized values for analysis . .
3.2.2
Transformation . . . . . . . . . . . . . . . . . . . . . . . . . .
3.2.3
Normalization . . . . . . . . . . . . . . . . . . . . . . . . . .
3.3
Quality control . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.3.1
Creating box plots - analyzing distributions . . . . . . . . . . .
3.3.2
Hierarchical clustering of samples . . . . . . . . . . . . . . .
3.3.3
Principal component analysis . . . . . . . . . . . . . . . . . .
3.4
Statistical analysis - identifying differential expression . . . . . .
3.4.1
Gaussian-based tests . . . . . . . . . . . . . . . . . . . . . .
3.4.2
Tests on proportions . . . . . . . . . . . . . . . . . . . . . .
3.4.3
Corrected p-values . . . . . . . . . . . . . . . . . . . . . . . .
3.4.4
Volcano plots - inspecting the result of the statistical analysis
3.5
Feature clustering . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.5.1
Hierarchical clustering of features . . . . . . . . . . . . . . .
3.5.2
K-means/medoids clustering . . . . . . . . . . . . . . . . . .
3.6
Annotation tests . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.6.1
Hypergeometric tests on annotations . . . . . . . . . . . . . .
3.6.2
Gene set enrichment analysis . . . . . . . . . . . . . . . . .
3.7
General plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.7.1
Histogram . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.7.2
MA plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.7.3
Scatter plot . . . . . . . . . . . . . . . . . . . . . . . . . . .

159

.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.

160
160
161
163
168
169
172
172
173
174
174
177
177
180
185
189
190
192
193
194
197
197
201
203
203
206
210
210
212
215

CHAPTER 3. EXPRESSION ANALYSIS

160

The CLC Genomics Workbench is able to analyze expression data produced on microarray
platforms and high-throughput sequencing platforms (also known as Next-Generation Sequencing
platforms).
Note that the calculation of expression levels based on the raw sequence data is described in
section 2.14.
The CLC Genomics Workbench provides tools for performing quality control of the data, transformation and normalization, statistical analysis to measure differential expression and annotationbased tests. A number of visualization tools such as volcano plots, MA plots, scatter plots, box
plots and heat maps are used to aid the interpretation of the results.
The various tools available are described in the sections listed below.

3.1

Experimental design

In order to make full use of the various tools for interpreting expression data, you need to know
the central concepts behind the way the data is organized in the CLC Genomics Workbench.
The first piece of data you are faced with is the sample. In the Workbench, a sample contains
the expression values from either one array or from sequencing data of one sample. Note that
the calculation of expression levels based on the raw sequence data is described in sections
2.14 and 2.15 .
See more below on how to get your expression data into the Workbench as samples (under
Supported array platforms).
In a sample, there is a number of features, usually genes, and their associated expression
levels.
To analyze differential expression, you need to tell the workbench how the samples are related.
This is done by setting up an experiment. An experiment is essentially a set of samples which are
grouped. By creating an experiment defining the relationship between the samples, it becomes
possible to do statistical analysis to investigate differential expression between the groups. The
Experiment is also used to accumulate calculations like t-tests and clustering because this
information is closely related to the grouping of the samples.

3.1.1

Supported array platforms

The workbench supports analysis of one-color expression arrays. These may be imported from
GEO soft sample- or series- file formats, or for Affymetrix arrays, tab-delimited pivot or metrics
files, or from Illumina expression files. Expression array data from other platforms may be
imported from tab, semi-colon or comma separated files containing the expression feature IDs
and levels in a tabular format (see see section ??).
The workbench assumes that expression values are given at the gene level, thus probe-level
analysis of e.g. Affymetrix GeneChips and import of Affymetrix CEL and CDF files is currently
not supported. However, the workbench allows import of txt files exported from R containing
processed Affymetrix CEL-file data (see see section ??).
Affymetrix NetAffx annotation files for expression GeneChips in csv format and Illumina annotation

CHAPTER 3. EXPRESSION ANALYSIS

161

files can also be imported. Also, you may import your own annotation data in tabular format see
see section ??).
See section ?? in the Appendix for detailed information about supported file formats.

3.1.2

Setting up an experiment

To set up an experiment:
Toolbox | Expression Analysis (

) | Set Up Experiment (

Select the samples that you wish to use by double-clicking or selecting and pressing the Add
( ) button (see figure 3.1).

Figure 3.1: Select the samples to use for setting up the experiment.
Note that we use "samples" as the general term for both microarray-based sets of expression
values and sequencing-based sets of expression values.
Clicking Next shows the dialog in figure 3.2.
Here you define the number of groups in the experiment. At the top you can select a two-group
experiment, and below you can select a multi-group experiment and define the number of groups.
Note that you can also specify if the samples are paired. Pairing is relevant if you have samples
from the same individual under different conditions, e.g. before and after treatment, or at times
0, 2 and 4 hours after treatment. In this case statistical analysis becomes more efficient if
effects of the individuals are taken into account, and comparisons are carried out not simply by
considering raw group means but by considering these corrected for effects of the individual. If
the Paired is selected, a paired rather than a standard t-test will be carried out for two group
comparisons. For multiple group comparisons a repeated measures rather than a standard
ANOVA will be used.
For RNA-Seq experiments, you can also choose which expression value to be used when setting

CHAPTER 3. EXPRESSION ANALYSIS

162

Figure 3.2: Defining the number of groups.

up the experiment. This value will then be used for all subsequence analyses.
Clicking Next shows the dialog in figure 3.3.

Figure 3.3: Naming the groups.

Depending on the number of groups selected in figure 3.2, you will see a list of groups with text
fields where you can enter an appropriate name for that group.
For multi-group experiments, if you find out that you have too many groups, click the Delete (
button. If you need more groups, simply click Add New Group.

Click Next when you have named the groups, and you will see figure 3.4.
This is where you define which group the individual sample belongs to. Simply select one or

CHAPTER 3. EXPRESSION ANALYSIS

163

Figure 3.4: Putting the samples into groups.

more samples (by clicking and dragging the mouse), right-click (Ctrl-click on Mac) and select the
appropriate group.
Note that the samples are sorted alphabetically based on their names.
If you have chosen Paired in figure 3.2, there will be an extra column where you define which
samples belong together. Just as when defining the group membership, you select one or more
samples, right-click in the pairing column and select a pair.
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.

3.1.3

Organization of the experiment table

The resulting experiment includes all the expression values and other information from the
samples (the values are copied - the original samples are not affected and can thus be deleted
with no effect on the experiment). In addition it includes a number of summaries of the values
across all, or a subset of, the samples for each feature. Which values are in included is described
in the sections below.
When you open it, it is shown in the experiment table (see figure 3.5).
For a general introduction to table features like sorting and filtering, see section ??.
Unlike other tables in CLC Genomics Workbench, the experiment table has a hierarchical grouping
of the columns. This is done to reflect the structure of the data in the experiment. The Side
Panel is divided into a number of groups corresponding to the structure of the table. These are
described below. Note that you can customize and save the settings of the Side Panel (see
section ??).
Whenever you perform analyses like normalization, transformation, statistical analysis etc, new
columns will be added to the experiment. You can at any time Export ( ) all the data in the
experiment in csv or Excel format or Copy ( ) the full table or parts of it.

CHAPTER 3. EXPRESSION ANALYSIS

164

Figure 3.5: Opening the experiment.

Column width
There are two options to specify the width of the columns and also the entire table:
Automatic. This will fit the entire table into the width of the view. This is useful if you only
have a few columns.
Manual. This will adjust the width of all columns evenly, and it will make the table as wide
as it needs to be to display all the columns. This is useful if you have many columns. In
this case there will be a scroll bar at the bottom, and you can manually adjust the width by
dragging the column separators.
Experiment level
The rest of the Side Panel is devoted to different levels of information on the values in the
experiment. The experiment part contains a number of columns that, for each feature ID, provide
summaries of the values across all the samples in the experiment (see figure 3.6).
Initially, it has one header for the whole Experiment:
Range (original values). The 'Range' column contains the difference between the highest
and the lowest expression value for the feature over all the samples. If a feature has the
value NaN in one or more of the samples the range value is NaN.

CHAPTER 3. EXPRESSION ANALYSIS

165

Figure 3.6: The initial view of the experiment level for a two-group experiment.
IQR (original values). The 'IQR' column contains the inter-quantile range of the values for a
feature across the samples, that is, the difference between the 75 %-ile value and the 25
%-ile value. For the IQR values, only the numeric values are considered when percentiles
are calculated (that is, NaN and +Inf or -Inf values are ignored), and if there are fewer than
four samples with numeric values for a feature, the IQR is set to be the difference between
the highest and lowest of these.
Difference (original values). For a two-group experiment the 'Difference' column contains
the difference between the mean of the expression values across the samples assigned to
group 2 and the mean of the expression values across the samples assigned to group 1.
Thus, if the mean expression level in group 2 is higher than that of group 1 the 'Difference'
is positive, and if it is lower the 'Difference' is negative. For experiments with more than
two groups the 'Difference' contains the difference between the maximum and minimum of
the mean expression values of the groups, multiplied by -1 if the group with the maximum
mean expression value occurs before the group with the minimum mean expression value
(with the ordering: group 1, group 2, ...).
Fold Change (original values). For a two-group experiment the 'Fold Change' tells you how
many times bigger the mean expression value in group 2 is relative to that of group 1. If
the mean expression value in group 2 is bigger than that in group 1 this value is the mean
expression value in group 2 divided by that in group 1. If the mean expression value in
group 2 is smaller than that in group 1 the fold change is the mean expression value in
group 1 divided by that in group 2 with a negative sign. Thus, if the mean expression levels
in group 1 and group 2 are 10 and 50 respectively, the fold change is 5, and if the and if the
mean expression levels in group 1 and group 2 are 50 and 10 respectively, the fold change
is -5. For experiments with more than two groups, the 'Fold Change' column contains the
ratio of the maximum of the mean expression values of the groups to the minimum of the
mean expression values of the groups, multiplied by -1 if the group with the maximum mean
expression value occurs before the group with the minimum mean expression value (with
the ordering: group 1, group 2, ...).
Thus, the sign of the values in the 'Difference' and 'Fold change' columns give the direction of
the trend across the groups, going from group 1 to group 2, etc.
If the samples used are Affymetrix GeneChips samples and have 'Present calls' there will also
be a 'Total present count' column containing the number of present calls for all samples.
The columns under the 'Experiment' header are useful for filtering purposes, e.g. you may wish
to ignore features that differ too little in expression levels to be confirmed e.g. by qPCR by

CHAPTER 3. EXPRESSION ANALYSIS

166

filtering on the values in the 'Difference', 'IQR' or 'Fold Change' columns or you may wish to
ignore features that do not differ at all by filtering on the 'Range' column.
If you have performed normalization or transformation (see sections 3.2.3 and 3.2.2, respectively), the IQR of the normalized and transformed values will also appear. Also, if you later
choose to transform or normalize your experiment, columns will be added for the transformed or
normalized values.
Note! It is very common to filter features on fold change values in expression analysis and fold
change values are also used in volcano plots, see section 3.4.4. There are different definitions
of 'Fold Change' in the literature. The definition that is used typically depends on the original
scale of the data that is analyzed. For data whose original scale is not the log scale the standard
definition is the ratio of the group means [Tusher et al., 2001]. This is the value you find in
the 'Fold Change' column of the experiment. However, for data whose original is the log scale,
the difference of the mean expression levels is sometimes referred to as the fold change [Guo
et al., 2006], and if you want to filter on fold change for these data you should filter on the
values in the 'Difference' column. Your data's original scale will e.g. be the log scale if you have
imported Affymetrix expression values which have been created by running the RMA algorithm on
the probe-intensities.
Analysis level
If you perform statistical analysis (see section 3.4), there will be a heading for each statistical
analysis performed. Under each of these headings you find columns holding relevant values for
the analysis (P-value, corrected P-value, test-statistic etc. - see more in section 3.4).
An example of a more elaborate analysis level is shown in figure 3.7.

Figure 3.7: Transformation, normalization and statistical analysis has been performed.

Annotation level
If your experiment is annotated (see section 3.1.4), the annotations will be listed in the
Annotation level group as shown in figure 3.8.

CHAPTER 3. EXPRESSION ANALYSIS

167

Figure 3.8: An annotated experiment.

In order to avoid too much detail and cluttering the table, only a few of the columns are shown
per default.
Note that if you wish a different set of annotations to be displayed each time you open an
experiment, you need to save the settings of the Side Panel (see section ??).
Group level
At the group level, you can show/hide entire groups (Heart and Diaphragm in figure 3.5). This
will show/hide everything under the group's header. Furthermore, you can show/hide group-level
information like the group means and present count within a group. If you have performed
normalization or transformation (see sections 3.2.3 and 3.2.2, respectively), the means of the
normalized and transformed values will also appear.
Sample level
In this part of the side panel, you can control which columns to be displayed for each sample.
Initially this is the all the columns in the samples.
If you have performed normalization or transformation (see sections 3.2.3 and 3.2.2, respectively), the normalized and transformed values will also appear.
An example is shown in figure 3.9.
Creating a sub-experiment from a selection
If you have identified a list of genes that you believe are differentially expressed, you can create a
subset of the experiment. (Note that the filtering and sorting may come in handy in this situation,
see section ??).
To create a sub-experiment, first select the relevant features (rows). If you have applied a filter
and wish to select all the visible features, press Ctrl + A ( + A on Mac). Next, press the Create
Experiment from Selection ( ) button at the bottom of the table (see figure 3.10).
This will create a new experiment that has the same information as the existing one but with less
features.

CHAPTER 3. EXPRESSION ANALYSIS

168

Figure 3.9: Sample level when transformation and normalization has been performed.

Figure 3.10: Create a subset of the experiment by clicking the button at the bottom of the
experiment table.
Downloading sequences from the experiment table
If your experiment is annotated, you will be able to download the GenBank sequence for features
which have a GenBank accession number in the 'Public identifier tag' annotation column. To do
this, select a number of features (rows) in the experiment and then click Download Sequence
( ) (see figure 3.11).

Figure 3.11: Select sequences and press the download button.

This will open a dialog where you specify where the sequences should be saved. You can learn
more about opening and viewing sequences in chapter ??. You can now use the downloaded
sequences for further analysis in the Workbench, e.g. performing BLAST searches and designing
primers for QPCR experiments.

3.1.4

Adding annotations to an experiment

Annotation files provide additional information about each feature. This information could be
which GO categories the protein belongs to, which pathways, various transcript and protein
identifiers etc. See section ?? for information about the different annotation file formats that are
supported CLC Genomics Workbench.
The annotation file can be imported into the Workbench and will get a special icon ( ). See an
overview of annotation formats supported by CLC Genomics Workbenchin section ??. In order to

CHAPTER 3. EXPRESSION ANALYSIS

169

associate an annotation file with an experiment, either select the annotation file when you set
up the experiment (see section 3.1.2), or click:
Toolbox | Expression Analysis (

) | Annotation Test | Add Annotations (

Select the experiment ( ) and the annotation file ( ) and click Finish. You will now be
able to see the annotations in the experiment as described in section 3.1.3. You can also
add annotations by pressing the Add Annotations ( ) button at the bottom of the table (see
figure 3.12).

Figure 3.12: Adding annotations by clicking the button at the bottom of the experiment table.
This will bring up a dialog where you can select the annotation file that you have imported
together with the experiment you wish to annotate. Click Next to specify settings as shown in
figure 3.13).

Figure 3.13: Choosing how to match annotations with samples.

In this dialog, you can specify how to match the annotations to the features in the sample. The
Workbench looks at the columns in the annotation file and lets you choose which column that
should be used for matching to the feature IDs in the experimental data (samples or experiment).
Usually the default is right, but for some annotation files, you need to use another column.
Some annotation files have leading zeros in the identifier which you can remove by checking the
Remove leading zeros box.
Note! Existing annotations on the experiment will be overwritten.

3.1.5

Scatter plot view of an experiment

At the bottom of the experiment table, you can switch between different views of the experiment
(see figure 3.14).

CHAPTER 3. EXPRESSION ANALYSIS

170

Figure 3.14: An experiment can be viewed in several ways.

One of the views is the Scatter Plot ( ). The scatter plot can be adjusted to show e.g. the
group means for two groups (see more about how to adjust this below).
An example of a scatter plot is shown in figure 3.15.

Figure 3.15: A scatter plot of group means for two groups (transformed expression values).
In the Side Panel to the left, there are a number of options to adjust this view. Under Graph
preferences, you can adjust the general properties of the scatter plot:
Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
Frame. Shows a frame around the graph.
Show legends. Shows the data legends.
Tick type. Determine whether tick lines should be shown outside or inside the frame.
Outside
Inside
Tick lines at. Choosing Major ticks will show a grid behind the graph.
None
Major ticks
Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min
and Max, and press Enter. This will update the view. If you wait a few seconds without
pressing Enter, the view will also be updated.

CHAPTER 3. EXPRESSION ANALYSIS

171

Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and
Max, and press Enter. This will update the view. If you wait a few seconds without pressing
Enter, the view will also be updated.
Draw x = y axis. This will draw a diagonal line across the plot. This line is shown per
default.
Line width
Thin
Medium
Wide
Line type
None
Line
Long dash
Short dash
Line color. Allows you to choose between many different colors. Click the color box to
select a color.
Below the general preferences, you find the Dot properties preferences, where you can adjust
coloring and appearance of the dots:
Dot type
None
Cross
Plus
Square
Diamond
Circle
Triangle
Reverse triangle
Dot
Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
Finally, the group at the bottom - Columns to compare - is where you choose the values to be
plotted. Per default for a two-group experiment, the group means are used.
Note that if you wish to use the same settings next time you open a scatter plot, you need to
save the settings of the Side Panel (see section ??).

CHAPTER 3. EXPRESSION ANALYSIS

172

Figure 3.16: An experiment can be viewed in several ways.

3.1.6

Cross-view selections

There are a number of different ways of looking at an experiment as shown in figure 3.16).
Beside the Experiment table ( ) which is the default view, the views are: Scatter plot ( ),
Volcano plot ( ) and the Heat map ( ). By pressing and holding the Ctrl ( on Mac) button
while you click one of the view buttons in figure 3.16, you can make a split view. This will make
it possible to see e.g. the experiment table in one view and the volcano plot in another view.
An example of such a split view is shown in figure 3.17.
Selections are shared between all these different views of an experiment. This means that if you
select a number of rows in the table, the corresponding dots in the scatter plot, volcano plot or
heatmap will also be selected. The selection can be made in any view, also the heat map, and
all other open views will reflect the selection.
A common use of the split views is where you have an experiment and have performed a statistical
analysis. You filter the experiment to identify all genes that have an FDR corrected p-value below
0.05 and a fold change for the test above say, 2. You can select all the rows in the experiment
table satisfying these filters by holding down the Cntrl button and clicking 'a'. If you have a split
view of the experiment and the volcano plot all points in the volcano plot corresponding to the
selected features will be red. Note that the volcano plot allows two sets of values in the columns
under the test you are considering to be displayed on the x-axis: the 'Fold change's and the
'Difference's. You control which to plot in the side panel. If you have filtered on 'Fold change' you
will typically want to choose 'Fold change' in the side panel. If you have filtered on 'Difference'
(e.g. because your original data is on the log scale, see the note on fold change in 3.1.3) you
typically want to choose 'Difference'.

3.2

Transformation and normalization

The original expression values often need to be transformed and/or normalized in order to
ensure that samples are comparable and assumptions on the data for analysis are met [Allison
et al., 2006]. These are essential requirements for carrying out a meaningful analysis. The raw
expression values often exhibit a strong dependency of the variance on the mean, and it may
be preferable to remove this by log-transforming the data. Furthermore, the sets of expression
values in the different samples in an experiment may exhibit systematic differences that are likely
due to differences in sample preparation and array processing, rather being the result of the
underlying biology. These noise effects should be removed before statistical analysis is carried
out.
When you perform transformation and normalization, the original expression values will be kept,
and the new values will be added. If you select an experiment ( ), the new values will be added
to the experiment (not the original samples). And likewise if you select a sample ( ( ) or ( )) in this case the new values will be added to the sample (the original values are still kept on the
sample).

CHAPTER 3. EXPRESSION ANALYSIS

173

Figure 3.17: A split view showing an experiment table at the top and a volcano plot at the bottom
(note that you need to perform statistical analysis to show a volcano plot, see section 3.4).

3.2.1

Selecting transformed and normalized values for analysis

A number of the tools in the Expression Analysis ( ) folder use expression levels. All of these
tools let you choose between Original, Transformed and Normalized expression values as shown
in figure 3.18.

Figure 3.18: Selecting which version of the expression values to analyze. In this case, the values
have not been normalized, so it is not possible to select normalized values.

CHAPTER 3. EXPRESSION ANALYSIS

174

In this case, the values have not been normalized, so it is not possible to select normalized
values.

3.2.2

Transformation

The CLC Genomics Workbench lets you transform expression values based on logarithm and
adding a constant:
Toolbox | Expression Analysis (
( )
Select a number of samples ( (

) or (

) | Transformation and Normalization | Transform

)) or an experiment (

) and click Next.

This will display a dialog as shown in figure 3.19.

Figure 3.19: Transforming expression values.

At the top, you can select which values to transform (see section 3.2.1).
Next, you can choose three kinds of transformation:
Logarithm transformation. Transformed expression values will be calculated by taking the
logarithm (of the specified type) of the values you have chosen to transform.
10.
2.
Natural logarithm.
Adding a constant. Transformed expression values will be calculated by adding the
specified constant to the values you have chosen to transform.
Square root transformation.
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.

3.2.3

Normalization

The CLC Genomics Workbench lets you normalize expression values.

To start the normalization:

CHAPTER 3. EXPRESSION ANALYSIS

Toolbox | Expression Analysis (
( )
Select a number of samples ( (

) or (

175
) | Transformation and Normalization | Normalize
)) or an experiment (

) and click Next.

This will display a dialog as shown in figure 3.20.

Figure 3.20: Choosing normalization method.

At the top, you can choose three kinds of normalization (for mathematical descriptions see
[Bolstad et al., 2003]):
Scaling. The sets of the expression values for the samples will be multiplied by a constant
so that the sets of normalized values for the samples have the same 'target' value (see
description of the Normalization value below).
Quantile. The empirical distributions of the sets of expression values for the samples are
used to calculate a common target distribution, which is used to calculate normalized sets
of expression values for the samples.
By totals. This option is intended to be used with count-based data, i.e. data from RNA-seq,
small RNA or expression profiling by tags. A sum is calculated for the expression values in
a sample. The transformed value are generated by dividing the input values by the sample
sum and multiplying by the factor (e.g. per '1,000,000').
Figures 3.21 and 3.22 show the effect on the distribution of expression values when using
scaling or quantile normalization, respectively.

Figure 3.21: Box plot after scaling normalization.

CHAPTER 3. EXPRESSION ANALYSIS

176

Figure 3.22: Box plot after quantile normalization.

At the bottom of the dialog in figure 3.20, you can select which values to normalize (see
section 3.2.1).
Clicking Next will display a dialog as shown in figure 3.23.

Figure 3.23: Normalization settings.

The following parameters can be set:
Normalization value. The type of value of the samples which you want to ensure are equal
for the normalized expression values
Mean.
Median.
Reference. The specific value that you want the normalized value to be after normalization.
Median mean.
Median median.
Use another sample.
Trimming percentage. Expression values that lie below the value of this percentile, or
above 100 minus the value of this percentile, in the empirical distribution of the expression
values in a sample will be excluded when calculating the normalization and reference
values.
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.

CHAPTER 3. EXPRESSION ANALYSIS

3.3

177

Quality control

The CLC Genomics Workbench includes a number of tools for quality control. These allow visual
inspection of the overall distributions, variability and similarity of the sets of expression values in
samples, and may be used to spot unwanted systematic differences between samples, outlying
samples and samples of poor quality, that you may want to exclude.

3.3.1

Creating box plots - analyzing distributions

In most cases you expect the majority of genes to behave similarly under the conditions
considered, and only a smaller proportion to behave differently. Thus, at an overall level you
would expect the distributions of the sets of expression values in samples in a study to be
similar. A boxplot provides a visual presentation of the distributions of expression values in
samples. For each sample the distribution of it's values is presented by a line representing a
center, a box representing the middle part, and whiskers representing the tails of the distribution.
Differences in the overall distributions of the samples in a study may indicate that normalization
is required before the samples are comparable. An atypical distribution for a single sample (or a
few samples), relative to the remaining samples in a study, could be due to imperfections in the
preparation and processing of the sample, and may lead you to reconsider using the sample(s).
To create a box plot:
Toolbox | Expression Analysis (
Select a number of samples ( (

) or (

) | Quality Control | Create Box Plot (

)) or an experiment (

) and click Next.

This will display a dialog as shown in figure 3.24.

Figure 3.24: Choosing values to analyze for the box plot.

Here you select which values to use in the box plot (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Viewing box plots
An example of a box plot of a two-group experiment with 12 samples is shown in figure 3.25.
Note that the boxes per default are colored according to their group relationship. At the bottom
you find the names of the samples, and the y-axis shows the expression values (note that sample

CHAPTER 3. EXPRESSION ANALYSIS

178

Figure 3.25: A box plot of 12 samples in a two-group experiment, colored by group.

names are not shown in figure 3.25).
Per default the box includes the IQR values (from the lower to the upper quartile), the median is
displayed as a line in the box, and the whiskers extend 1.5 times the height of the box.
In the Side Panel to the left, there is a number of options to adjust this view. Under Graph
preferences, you can adjust the general properties of the box plot (see figure 3.26).

Figure 3.26: Graph preferences for a box plot.

Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
Frame. Shows a frame around the graph.
Show legends. Shows the data legends.

CHAPTER 3. EXPRESSION ANALYSIS

179

Figure 3.27: Lines and dot preferences for a box plot.

Select sample or group. When you wish to adjust the properties below, first select an item
in this drop-down menu. That will apply the changes below to this item. If your plot is based
on an experiment, the drop-down menu includes both group names and sample names, as
well as an entry for selecting "All". If your plot is based on single elements, only sample
names will be visible. Note that there are sometimes "mixed states" when you select a
group where two of the samples e.g. have different colors. Selecting a new color in this
case will erase the differences.
Dot type
None
Cross
Plus
Square

CHAPTER 3. EXPRESSION ANALYSIS

180

Diamond
Circle
Triangle
Reverse triangle
Dot
Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
Note that if you wish to use the same settings next time you open a box plot, you need to save
the settings of the Side Panel (see section ??).
Interpreting the box plot
This section will show how to interpret a box plot through a few examples.
First, if you look at figure 3.28, you can see a box plot for an experiment with 5 groups and 27
samples.

Figure 3.28: Box plot for an experiment with 5 groups and 27 samples.
None of the samples stand out as having distributions that are atypical: the boxes and whiskers
ranges are about equally sized. The locations of the distributions however, differ some, and
indicate that normalization may be required. Figure 3.29 shows a box plot for the same experiment
after quantile normalization: the distributions have been brought into par.
In figure 3.30 a box plot for a two group experiment with 5 samples in each group is shown.
The distribution of values in the second sample from the left is quite different from those of other
samples, and could indicate that the sample should not be used.

3.3.2

Hierarchical clustering of samples

A hierarchical clustering of samples is a tree representation of their relative similarity. The tree
structure is generated by
1. letting each feature be a cluster

CHAPTER 3. EXPRESSION ANALYSIS

181

Figure 3.29: Box plot after quantile normalization.

Figure 3.30: Box plot for a two-group experiment with 5 samples.

2. calculating pairwise distances between all clusters
3. joining the two closest clusters into one new cluster
4. iterating 2-3 until there is only one cluster left (which will contain all samples).
The tree is drawn so that the distances between clusters are reflected by the lengths of the
branches in the tree. Thus, features with expression profiles that closely resemble each other
have short distances between them, those that are more different, are placed further apart.
(See [Eisen et al., 1998] for a classical example of application of a hierarchical clustering
algorithm in microarray analysis. The example is on features rather than samples).
To start the clustering:
Toolbox | Expression Analysis (
Samples ( )
Select a number of samples ( (

) or (

) | Quality Control | Hierarchical Clustering of

)) or an experiment (

) and click Next.

This will display a dialog as shown in figure 3.31. The hierarchical clustering algorithm requires
that you specify a distance measure and a cluster linkage. The similarity measure is used to
specify how distances between two samples should be calculated. The cluster distance metric
specifies how you want the distance between two clusters, each consisting of a number of
samples, to be calculated.
At the top, you can choose three kinds of Distance measures:

CHAPTER 3. EXPRESSION ANALYSIS

182

Figure 3.31: Parameters for hierarchical clustering of samples.

Euclidean distance. The ordinary distance between two points - the length of the segment
connecting them. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Euclidean
distance between u and v is
v
u n
uX
|u v| = t (ui vi )2 .
i=1

1 - Pearson correlation. The Pearson correlation coefficient between two elements

x = (x1 , x2 , ..., xn ) and y = (y1 , y2 , ..., yn ) is defined as
n

1 X xi x
yi y
(
)(
)
n1
sx
sy
i=1

where x/y is the average of values in x/y and sx /sy is the sample standard deviation of
these values. It takes a value [1, 1]. Highly correlated elements have a high absolute
value of the Pearson correlation, and elements whose values are un-informative about each
other have Pearson correlation 0. Using 1 |P earsoncorrelation| as distance measure
means that elements that are highly correlated will have a short distance between them,
and elements that have low correlation will be more distant from each other.
Manhattan distance. The Manhattan distance between two points is the distance measured
along axes at right angles. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the
Manhattan distance between u and v is
|u v| =

n
X

|ui vi |.

i=1

Next, you can select the cluster linkage to be used:

Single linkage. The distance between two clusters is computed as the distance between
the two closest elements in the two clusters.
Average linkage. The distance between two clusters is computed as the average distance
between objects from the first cluster and objects from the second cluster. The averaging
is performed over all pairs (x, y), where x is an object from the first cluster and y is an
object from the second cluster.

CHAPTER 3. EXPRESSION ANALYSIS

183

Complete linkage. The distance between two clusters is computed as the maximal objectto-object distance d(xi , yj ), where xi comes from the first cluster, and yj comes from the
second cluster. In other words, the distance between two clusters is computed as the
distance between the two farthest objects in the two clusters.
At the bottom, you can select which values to cluster (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Result of hierarchical clustering of samples
The result of a sample clustering is shown in figure 3.32.

Figure 3.32: Sample clustering.

If you have used an experiment ( ) as input, the clustering is added to the experiment and will
be saved when you save the experiment. It can be viewed by clicking the Show Heat Map ( )
button at the bottom of the view (see figure 3.33).

Figure 3.33: Showing the hierarchical clustering of an experiment.

If you have selected a number of samples ( (
that has to be saved separately.

) or (

)) as input, a new element will be created

Regardless of the input, the view of the clustering is the same. As you can see in figure 3.32,
there is a tree at the bottom of the view to visualize the clustering. The names of the samples
are listed at the top. The features are represented as horizontal lines, colored according to the
expression level. If you place the mouse on one of the lines, you will see the names of the
feature to the left. The features are sorted by their expression level in the first sample (in order
to cluster the features, see section 3.5.1).
Researchers often have a priori knowledge of which samples in a study should be similar (e.g.
samples from the same experimental condition) and which should be different (samples from
biological distinct conditions). Thus, researches have expectations about how they should cluster.
Samples that are placed unexpectedly in the hierarchical clustering tree may be samples that
have been wrongly allocated to a group, samples of unintended or unclean tissue composition

CHAPTER 3. EXPRESSION ANALYSIS

184

or samples for which the processing has gone wrong. Unexpectedly placed samples, of course,
could also be highly interesting samples.
There are a number of options to change the appearance of the heat map. At the top of the Side
Panel, you find the Heat map preference group (see figure 3.34).

Figure 3.34: Side Panel of heat map.

At the top, there is information about the heat map currently displayed. The information regards
type of clustering, expression value used together with distance and linkage information. If you
have performed more than one clustering, you can choose between the resulting heat maps in a
drop-down box (see figure 3.46).

Figure 3.35: When more than one clustering has been performed, there will be a list of heat maps
to choose from.
Note that if you perform an identical clustering, the existing heat map will simply be replaced.
Below this box, there is a number of settings for displaying the heat map.
Lock width to window. When you zoom in the heat map, you will per default only zoom in
on the vertical level. This is because the width of the heat map is locked to the window.
If you uncheck this option, you will zoom both vertically and horizontally. Since you always
have more features than samples, it is useful to lock the width since you then have all the
samples in view all the time.

CHAPTER 3. EXPRESSION ANALYSIS

185

Lock height to window. This is the corresponding option for the height. Note that if you
check both options, you will not be able to zoom at all, since both the width and the height
is fixed.
Lock headers and footers. This will ensure that you are always able to see the sample and
feature names and the trees when you zoom in.
Colors. The expression levels are visualized using a gradient color scheme, where the
right side color is used for high expression levels and the left side color is used for low
expression levels. You can change the coloring by clicking the box, and you can change the
relative coloring of the values by dragging the two knobs on the white slider above.
Below you find the Samples and Features groups. They contain options to show names
above/below and left/right, respectively. Furthermore, they contain options to show the tree
above/below or left/right, respectively. Note that for clustering of samples, you find the tree
options in the Samples group, and for clustering of features, you find the tree options in the
Features group. With the tree options, you can also control the Tree size, from tiny to very large,
and the option of showing the full tree, no matter how much space it will use.
Note that if you wish to use the same settings next time you open a heat map, you need to save
the settings of the Side Panel (see section ??).

3.3.3

Principal component analysis

A principal component analysis is a mathematical analysis that identifies and quantifies the
directions of variability in the data. For a set of samples, e.g. an experiment, this can be
done by finding the eigenvectors and eigenvalues of the covariance matrix of the samples.
The eigenvectors are orthogonal. The first principal component is the eigenvector with the
largest eigenvalue, and specifies the direction with the largest variability. The second principal
component is the eigenvector with the second largest eigenvalue, and specifies the direction
with the second largest variability. Similarly for the third, etc. The data can be projected onto
the space spanned by the eigenvectors. A plot of the data in the space spanned by the first and
second principal component will show a simplified version of the data with variability in other
directions than the two major directions of variability ignored.
To start the analysis:
Toolbox | Expression Analysis (
( )
Select a number of samples ( (

) or (

) | Quality Control | Principal Component Analysis

)) or an experiment (

) and click Next.

This will display a dialog as shown in figure 3.36.

In this dialog, you select the values to be used for the principal component analysis (see
section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Principal component analysis plot
This will create a principal component plot as shown in figure 3.37.

CHAPTER 3. EXPRESSION ANALYSIS

186

Figure 3.36: Selcting which values the principal component analysis should be based on.

Figure 3.37: A principal component analysis colored by group.

The plot shows the projection of the samples onto the two-dimensional space spanned by the
first and second principal component. (These are the orthogonal directions in which the data
exhibits the largest and second-largest variability).
The plot in figure 3.37 is based on a two-group experiment. The group relationships are indicated
by color. We expect the samples from within a group to exhibit less variability when compared,
than samples from different groups. Thus samples should cluster according to groups and this is
what we see. The PCA plot is thus helpful in identifying outlying samples and samples that have
been wrongly assigned to a group.
In the Side Panel to the left, there is a number of options to adjust the view. Under Graph
preferences, you can adjust the general properties of the plot.
Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
Frame. Shows a frame around the graph.

CHAPTER 3. EXPRESSION ANALYSIS

187

Show legends. Shows the data legends.

None
Line
Long dash
Short dash

Line color. Allows you to choose between many different colors. Click the color box to
select a color.
Below the general preferences, you find the Dot properties:
Select sample or group. When you wish to adjust the properties below, first select an item
in this drop-down menu. That will apply the changes below to this item. If your plot is based
on an experiment, the drop-down menu includes both group names and sample names, as
well as an entry for selecting "All". If your plot is based on single elements, only sample
names will be visible. Note that there are sometimes "mixed states" when you select a
group where two of the samples e.g. have different colors. Selecting a new color in this
case will erase the differences.
Dot type
None
Cross

CHAPTER 3. EXPRESSION ANALYSIS

188

Plus
Square
Diamond
Circle
Triangle
Reverse triangle
Dot
Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
Show name. This will show a label with the name of the sample next to the dot. Note that
the labels quickly get crowded, so that is why the names are not put on per default.
Note that if you wish to use the same settings next time you open a principal component plot,
you need to save the settings of the Side Panel (see section ??).
Scree plot
Besides the view shown in figure 3.37, the result of the principal component can also be viewed
as a scree plot by clicking the Show Scree Plot ( ) button at the bottom of the view. The
scree plot shows the proportion of variation in the data explained by the each of the principal
components. The first principal component explains about 99 percent of the variability.
In the Side Panel to the left, there is a number of options to adjust the view. Under Graph
preferences, you can adjust the general properties of the plot.
Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
Frame. Shows a frame around the graph.
Show legends. Shows the data legends.
Tick type. Determine whether tick lines should be shown outside or inside the frame.
Outside
Inside
Tick lines at. Choosing Major ticks will show a grid behind the graph.
None
Major ticks
Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min
and Max, and press Enter. This will update the view. If you wait a few seconds without
pressing Enter, the view will also be updated.
Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and
Max, and press Enter. This will update the view. If you wait a few seconds without pressing
Enter, the view will also be updated.

CHAPTER 3. EXPRESSION ANALYSIS

189

The Lines and plots below contains the following parameters:

Dot type
None
Cross
Plus
Square
Diamond
Circle
Triangle
Reverse triangle
Dot
Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
Line width
Thin
Medium
Wide
Line type
None
Line
Long dash
Short dash
Line color. Allows you to choose between many different colors. Click the color box to
select a color.
Note that the graph title and the axes titles can be edited simply by clicking them with the mouse.
These changes will be saved when you Save ( ) the graph - whereas the changes in the Side
Panel need to be saved explicitly (see section ??).

3.4

Statistical analysis - identifying differential expression

The CLC Genomics Workbench is designed to help you identify differential expression. You
have a choice of a number of standard statistical tests, that are suitable for different data
types and different types of experimental settings. There are two main categories of tests:
tests that assume that the data has Gaussian distributions and compare means (described in
section 3.4.1) and tests that compare proportions and assume that data consists of counts and
(described in section 3.4.2). To run the statistical analysis:
Toolbox | Expression Analysis (

) | Statistical Analysis | On Gaussian Data (

CHAPTER 3. EXPRESSION ANALYSIS

or Toolbox | Expression Analysis (

190
) | Statistical Analysis | On Proportions (

For both kinds of statistics you first select the experiment ( ) that you wish to use and click
Next (learn more about setting up experiments in section 3.1.2).
The first part of the explanation of how to proceed and perform the statistical analysis is divided
into two, depending on whether you are doing Gaussian-based tests or tests on proportions. The
last part has an explanation of the options regarding corrected p-values which applies to all tests.

3.4.1

Gaussian-based tests

The tests based on the Gaussian distribution essentially compare the mean expression level in
the experimental groups in the study, and evaluates the significance of the difference relative
to the variance (or 'spread') of the data within the groups. The details of the formula used for
calculating the test statistics vary according to the experimental setup and the assumptions you
make about the data (read more about this in the sections on t-test and ANOVA below). The
explanation of how to proceed is divided into two, depending on how many groups there are in
your experiment. First comes the explanation for t-tests which is the only analysis available for
two-group experimental setups (t-tests can also be used for pairwise comparison of groups in
multi-group experiments). Next comes an explanation of the ANOVA test which can be used for
multi-group experiments.
Note that the test statistics for the t-test and ANOVA analysis use the estimated group variances
in their denominators. If all expression values in a group are identical the estimated variance for
that group will be zero. If the estimated variances for both (or all) groups are zero the denominator
of the test statistic will be zero. The numerator's value depends on the difference of the group
means. If this is zero, the numerator is zero and the test statistic will be 0/0 which is NaN. If the
numerator is different from zero the test statistic will be + or - infinity, depending on which group
mean is bigger. If all values in all groups are identical the test statistic is set to zero.
T-tests
For experiments with two groups you can, among the Gaussian tests, only choose a T-test as
shown in figure 3.38.

Figure 3.38: Selecting a t-test.

There are different types of t-tests, depending on the assumption you make about the variances

CHAPTER 3. EXPRESSION ANALYSIS

191

in the groups. By selecting 'Homogeneous' (the default) calculations are done assuming that the
groups have equal variances. When 'In-homogeneous' is selected, this assumption is not made.
The t-test can also be chosen if you have a multi-group experiment. In this case you may choose
either to have t-tests produced for all pairs of groups (by clicking the 'All pairs' button) or to
have a t-test produced for each group compared to a specified reference group (by clicking the
'Against reference' button). In the last case you must specify which of the groups you want to
use as reference (the default is to use the group you specified as Group 1 when you set up the
experiment).
If a experiment with pairing was set up (see section 3.1.2) the Use pairing tick box is active. If
ticked, paired t-tests will be calculated, if not, the formula for the standard t-test will be used.
When a t-test is run on an experiment four columns will be added to the experiment table for
each pair of groups that are analyzed. The 'Difference' column contains the difference between
the mean of the expression values across the samples assigned to group 2 and the mean of the
expression values across the samples assigned to group 1. The 'Fold Change' column tells you
how many times bigger the mean expression value in group 2 is relative to that of group 1. If the
mean expression value in group 2 is bigger than that in group 1 this value is the mean expression
value in group 2 divided by that in group 1. If the mean expression value in group 2 is smaller
than that in group 1 the fold change is the mean expression value in group 1 divided by that in
group 2 with a negative sign. The 'Test statistic' column holds that value of the test statistic,
and the 'P-value' holds the two-sided p-value for the test. Up to two more columns may be added
if the options to calculate Bonferroni and FDR corrected p-values were chosen (see 3.4.3).
ANOVA
For experiments with more than two groups you can choose T-test as described above, or ANOVA
as shown in figure 3.39.

Figure 3.39: Selecting ANOVA.

The ANOVA method allows analysis of an experiment with one factor and a number of groups,
e.g. different types of tissues, or time points. In the analysis, the variance within groups is
compared to the variance between groups. You get a significant result (that is, a small ANOVA
p-value) if the difference you see between groups relative to that within groups, is larger than
what you would expect, if the data were really drawn from groups with equal means.
If an experiment with pairing was set up (see section 3.1.2) the Use pairing tick box is active. If

CHAPTER 3. EXPRESSION ANALYSIS

192

ticked, a repeated measures one-way ANOVA test will be calculated, if not, the formula for the
standard one-way ANOVA will be used.
When an ANOVA analysis is run on an experiment four columns will be added to the experiment
table for each pair of groups that are analyzed. The 'Max difference' column contains the
difference between the maximum and minimum of the mean expression values of the groups,
multiplied by -1 if the group with the maximum mean expression value occurs before the group
with the minimum mean expression value (with the ordering: group 1, group 2, ...). The 'Max fold
change' column contains the ratio of the maximum of the mean expression values of the groups
to the minimum of the mean expression values of the groups, multiplied by -1 if the group with the
maximum mean expression value occurs before the group with the minimum mean expression
value (with the ordering: group 1, group 2, ...). The 'Test statistic' column holds the value of the
test statistic, and the 'P-value' holds the two-sided p-value for the test. Up to two more columns
may be added if the options to calculate Bonferroni and FDR corrected p-values were chosen (see
3.4.3).

3.4.2

Tests on proportions

The proportions-based tests are applicable in situations where your data samples consists of
counts of a number of 'types' of data. This could e.g. be in a study where gene expression levels
are measured by RNA-Seq or tag profiling. Here the different 'types' could correspond to the
different 'genes' in a reference genome, and the counts could be the numbers of reads matching
each of these genes. The tests compare counts by considering the proportions that they make
up the total sum of counts in each sample. By comparing the expression levels at the level of
proportions rather than raw counts, the data is corrected for sample size.
There are two tests available for comparing proportions: the test of [Kal et al., 1999] and the
test of [Baggerly et al., 2003]. Both tests compare pairs of groups. If you have a multi-group
experiment (see section 3.1.2), you may choose either to have tests produced for all pairs of
groups (by clicking the 'All pairs' button) or to have a test produced for each group compared to
a specified reference group (by clicking the 'Against reference' button). In the last case you must
specify which of the groups you want to use as reference (the default is to use the group you
specified as Group 1 when you set up the experiment).
Note that the proportion-based tests use the total sample counts (that is, the sum over all
expression values). If one (or more) of the counts are NaN, the sum will be NaN and all the
test statistics will be NaN. As a consequence all p-values will also be NaN. You can avoid this
by filtering your experiment and creating a new experiment so that no NaN values are present,
before you apply the tests.
Kal et al.'s test (Z-test)
Kal et al.'s test [Kal et al., 1999] compares a single sample against another single sample,
and thus requires that each group in you experiment has only one sample. The test relies
on an approximation of the binomial distribution by the normal distribution [Kal et al., 1999].
Considering proportions rather than raw counts the test is also suitable in situations where the
sum of counts is different between the samples.
When Kal's test is run on an experiment four columns will be added to the experiment table for
each pair of groups that are analyzed. The 'Proportions difference' column contains the difference

CHAPTER 3. EXPRESSION ANALYSIS

193

between the proportion in group 2 and the proportion in group 1. The 'Fold Change' column
tells you how many times bigger the proportion in group 2 is relative to that of group 1. If the
proportion in group 2 is bigger than that in group 1 this value is the proportion in group 2 divided
by that in group 1. If the proportion in group 2 is smaller than that in group 1 the fold change
is the proportion in group 1 divided by that in group 2 with a negative sign. The 'Test statistic'
column holds that value of the test statistic, and the 'P-value' holds the two-sided p-value for
the test. Up to two more columns may be added if the options to calculate Bonferroni and FDR
corrected p-values were chosen (see 3.4.3).
Baggerley et al.'s test (Beta-binomial)
Baggerley et al.'s test [Baggerly et al., 2003] compares the proportions of counts in a group of
samples against those of another group of samples, and is suited to cases where replicates
are available in the groups. The samples are given different weights depending on their sizes
(total counts). The weights are obtained by assuming a Beta distribution on the proportions in a
group, and estimating these, along with the proportion of a binomial distribution, by the method
of moments. The result is a weighted t-type test statistic.
When Baggerley's test is run on an experiment four columns will be added to the experiment table
for each pair of groups that are analyzed. The 'Weighted proportions difference' column contains
the difference between the mean of the weighted proportions across the samples assigned to
group 2 and the mean of the weighted proportions across the samples assigned to group 1. The
'Fold Change' column tells you how many times bigger the mean of the weighted proportions in
group 2 is relative to that of group 1. If the mean of the weighted proportions in group 2 is bigger
than that in group 1 this value is the mean of the weighted proportions in group 2 divided by that
in group 1. If the mean of the weighted proportions in group 2 is smaller than that in group 1 the
fold change is the mean of the weighted proportions in group 1 divided by that in group 2 with a
negative sign. The 'Test statistic' column holds that value of the test statistic, and the 'P-value'
holds the two-sided p-value for the test. Up to two more columns may be added if the options to
calculate Bonferroni and FDR corrected p-values were chosen (see 3.4.3).

3.4.3

Corrected p-values

Clicking Next will display a dialog as shown in figure 3.40.

Figure 3.40: Additional settings for the statistical analysis.

CHAPTER 3. EXPRESSION ANALYSIS

194

At the top, you can select which values to analyze (see section 3.2.1).
Below you can select to add two kinds of corrected p-values to the analysis (in addition to the
standard p-value produced for the test statistic):
Bonferroni corrected.
FDR corrected.
Both are calculated from the original p-values, and aim in different ways to take into account the
issue of multiple testing [Dudoit et al., 2003]. The problem of multiple testing arises because
the original p-values are related to a single test: the p-value is the probability of observing a more
extreme value than that observed in the test carried out. If the p-value is 0.04, we would expect
an as extreme value as that observed in 4 out of 100 tests carried out among groups with no
difference in means. Popularly speaking, if we carry out 10000 tests and select the features with
original p-values below 0.05, we will expect about 0.05 times 10000 = 500 to be false positives.
The Bonferroni corrected p-values handle the multiple testing problem by controlling the 'familywise error rate': the probability of making at least one false positive call. They are calculated by
multiplying the original p-values by the number of tests performed. The probability of having at
least one false positive among the set of features with Bonferroni corrected p-values below 0.05,
is less than 5%. The Bonferroni correction is conservative: there may be many genes that are
differentially expressed among the genes with Bonferroni corrected p-values above 0.05, that will
be missed if this correction is applied.
Instead of controlling the family-wise error rate we can control the false discovery rate: FDR. The
false discovery rate is the proportion of false positives among all those declared positive. We
expect 5 % of the features with FDR corrected p-values below 0.05 to be false positive. There
are many methods for controlling the FDR - the method used in CLC Genomics Workbench is that
of [Benjamini and Hochberg, 1995].
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Note that if you have already performed statistical analysis on the same values, the existing one
will be overwritten.

3.4.4

Volcano plots - inspecting the result of the statistical analysis

The results of the statistical analysis are added to the experiment and can be shown in the
experiment table (see section 3.1.3). Typically columns containing the differences (or weighted
differences) of the mean group values and the fold changes (or weighted fold changes) of the
mean group values will be added along with a column of p-values. Also, columns with FDR or
Bonferroni corrected p-values will be added if these were calculated. This added information
allows features to be sorted and filtered to exclude the ones without sufficient proof of differential
expression (learn more in section ??).
If you want a more visual approach to the results of the statistical analysis, you can click the
Show Volcano Plot ( ) button at the bottom of the experiment table view. In the same way as the
scatter plot presented in section 3.1.5, the volcano plot is yet another view on the experiment.
Because it uses the p-values and mean differences produced by the statistical analysis, the plot
is only available once a statistical analysis has been performed on the experiment.

CHAPTER 3. EXPRESSION ANALYSIS

195

Figure 3.41: Volcano plot.

An example of a volcano plot is shown in figure 3.41.
The volcano plot shows the relationship between the p-values of a statistical test and the
magnitude of the difference in expression values of the samples in the groups. On the y-axis
the log10 p-values are plotted. For the x-axis you may choose between two sets of values by
choosing either 'Fold change' or 'Difference' in the volcano plot side panel's 'Values' part. If
you choose 'Fold change' the log of the values in the 'fold change' (or 'Weighted fold change')
column for the test will be displayed. If you choose 'Difference' the values in the 'Difference' (or
'Weighted difference') column will be used. Which values you wish to display will depend upon
the scale of you data (Read the note on fold change in section 3.1.3).
The larger the difference in expression of a feature, the more extreme it's point will lie on
the X-axis. The more significant the difference, the smaller the p-value and thus the higher
the log10 (p) value. Thus, points for features with highly significant differences will lie high
in the plot. Features of interest are typically those which change significantly and by a certain
magnitude. These are the points in the upper left and upper right hand parts of the volcano plot.
If you have performed different tests or you have an experiment with multiple groups you need to
specify for which test and which group comparison you want the volcano plot to be shown. You
do this in the 'Test' and 'Values' parts of the volcano plot side panel.
Options for the volcano plot are described in further detail when describing the Side Panel below.
If you place your mouse on one of the dots, a small text box will tell the name of the feature.
Note that you can zoom in and out on the plot (see section ??).
In the Side Panel to the right, there is a number of options to adjust the view of the volcano plot.
Under Graph preferences, you can adjust the general properties of the volcano plot
Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.

CHAPTER 3. EXPRESSION ANALYSIS

196

Frame. Shows a frame around the graph.

Show legends. Shows the data legends.
Tick type. Determine whether tick lines should be shown outside or inside the frame.
Outside
Inside
Tick lines at. Choosing Major ticks will show a grid behind the graph.
None
Major ticks
Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min
and Max, and press Enter. This will update the view. If you wait a few seconds without
pressing Enter, the view will also be updated.
Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and
Max, and press Enter. This will update the view. If you wait a few seconds without pressing
Enter, the view will also be updated.
Below the general preferences, you find the Dot properties, where you can adjust coloring and
appearance of the dots.
Dot type
None
Cross
Plus
Square
Diamond
Circle
Triangle
Reverse triangle
Dot
Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
At the very bottom, you find two groups for choosing which values to display:
Test. In this group, you can select which kind of test you want the volcano plot to be shown
for.
Values. Under Values, you can select which values to plot. If you have multi-group
experiments, you can select which groups to compare. You can also select whether to plot
Difference or Fold change on the x-axis. Read the note on fold change in section 3.1.3.
Note that if you wish to use the same settings next time you open a box plot, you need to save
the settings of the Side Panel (see section ??).

CHAPTER 3. EXPRESSION ANALYSIS

3.5

197

Feature clustering

Feature clustering is used to identify and cluster together features with similar expression
patterns over samples (or experimental groups). Features that cluster together may be involved
in the same biological process or be co-regulated. Also, by examining annotations of genes within
a cluster, one may learn about the underlying biological processes involved in the experiment
studied.

3.5.1

Hierarchical clustering of features

A hierarchical clustering of features is a tree presentation of the similarity in expression profiles

of the features over a set of samples (or groups). The tree structure is generated by
1. letting each feature be a cluster
2. calculating pairwise distances between all clusters
3. joining the two closest clusters into one new cluster
4. iterating 2-3 until there is only one cluster left (which will contain all samples).
The tree is drawn so that the distances between clusters are reflected by the lengths of the
branches in the tree. Thus, features with expression profiles that closely resemble each other
have short distances between them, those that are more different, are placed further apart.
To start the clustering of features:
Toolbox | Expression Analysis (
Features ( )
Select at least two samples ( (

) or (

) | Feature Clustering | Hierarchical Clustering of

)) or an experiment (

Note! If your data contains many features, the clustering will take very long time and could make
your computer unresponsive. It is recommended to perform this analysis on a subset of the data
(which also makes it easier to make sense of the clustering. Typically, you will want to filter away
the features that are thought to represent only noise, e.g. those with mostly low values, or with
little difference between the samples). See how to create a sub-experiment in section 3.1.3.
Clicking Next will display a dialog as shown in figure 3.42. The hierarchical clustering algorithm
requires that you specify a distance measure and a cluster linkage. The distance measure is used
specify how distances between two features should be calculated. The cluster linkage specifies
how you want the distance between two clusters, each consisting of a number of features, to be
calculated.
At the top, you can choose three kinds of Distance measures:
Euclidean distance. The ordinary distance between two points - the length of the segment
connecting them. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the Euclidean
distance between u and v is
v
u n
uX
|u v| = t (ui vi )2 .
i=1

CHAPTER 3. EXPRESSION ANALYSIS

198

Figure 3.42: Parameters for hierarchical clustering of features.

1 - Pearson correlation. The Pearson correlation coefficient between two elements
x = (x1 , x2 , ..., xn ) and y = (y1 , y2 , ..., yn ) is defined as
n

yi y
1 X xi x
)(
)
(
n1
sx
sy
i=1

Next, you can select different ways to calculate distances between clusters. The possible cluster
linkage to use are:
Single linkage. The distance between two clusters is computed as the distance between
the two closest elements in the two clusters.
Average linkage. The distance between two clusters is computed as the average distance
between objects from the first cluster and objects from the second cluster. The averaging
is performed over all pairs (x, y), where x is an object from the first cluster and y is an
object from the second cluster.
Complete linkage. The distance between two clusters is computed as the maximal objectto-object distance d(xi , yj ), where xi comes from the first cluster, and yj comes from the
second cluster. In other words, the distance between two clusters is computed as the
distance between the two farthest objects in the two clusters.
At the bottom, you can select which values to cluster (see section 3.2.1). Click Next if you wish
to adjust how to handle the results (see section ??). If not, click Finish.

CHAPTER 3. EXPRESSION ANALYSIS

199

Result of hierarchical clustering of features

The result of a feature clustering is shown in figure 3.43.

Figure 3.43: Hierarchical clustering of features.

Figure 3.44: Showing the hierarchical clustering of an experiment.

If you have selected a number of samples ( (
that has to be saved separately.

) or (

)) as input, a new element will be created

Regardless of the input, a hierarchical tree view with associated heatmap is produced (figure
3.43). In the heatmap each row corresponds to a feature and each column to a sample. The
color in the i'th row and j'th column reflects the expression level of feature i in sample j (the
color scale can be set in the side panel). The order of the rows in the heatmap are determined by
the hierarchical clustering. If you place the mouse on one of the rows, you will see the name of
the corresponding feature to the left. The order of the columns (that is, samples) is determined
by their input order or (if defined) experimental grouping. The names of the samples are listed at
the top of the heatmap and the samples are organized into groups.
There are a number of options to change the appearance of the heat map. At the top of the Side
Panel, you find the Heat map preference group (see figure 3.45).
At the top, there is information about the heat map currently displayed. The information regards
type of clustering, expression value used together with distance and linkage information. If you
have performed more than one clustering, you can choose between the resulting heat maps in a
drop-down box (see figure 3.46).

CHAPTER 3. EXPRESSION ANALYSIS

200

Figure 3.45: Side Panel of heat map.

Figure 3.46: When more than one clustering has been performed, there will be a list of heat maps
to choose from.
Note that if you perform an identical clustering, the existing heat map will simply be replaced.
Below this box, there is a number of settings for displaying the heat map.
Lock width to window. When you zoom in the heat map, you will per default only zoom in
on the vertical level. This is because the width of the heat map is locked to the window.
If you uncheck this option, you will zoom both vertically and horizontally. Since you always
have more features than samples, it is useful to lock the width since you then have all the
samples in view all the time.
Lock height to window. This is the corresponding option for the height. Note that if you
check both options, you will not be able to zoom at all, since both the width and the height
is fixed.
Lock headers and footers. This will ensure that you are always able to see the sample and
feature names and the trees when you zoom in.
Colors. The expression levels are visualized using a gradient color scheme, where the
right side color is used for high expression levels and the left side color is used for low
expression levels. You can change the coloring by clicking the box, and you can change the
relative coloring of the values by dragging the two knobs on the white slider above.

CHAPTER 3. EXPRESSION ANALYSIS

201

Below you find the Samples and Features groups. They contain options to show names
above/below and left/right, respectively. Furthermore, they contain options to show the tree
above/below or left/right, respectively. Note that for clustering of samples, you find the tree
options in the Samples group, and for clustering of features, you find the tree options in the
Features group. With the tree options, you can also control the Tree size, from tiny to very large,
and the option of showing the full tree, no matter how much space it will use.
Note that if you wish to use the same settings next time you open a heat map, you need to save
the settings of the Side Panel (see section ??).

3.5.2

K-means/medoids clustering

In a k-means or medoids clustering, features are clustered into k separate clusters. The
procedures seek to find an assignment of features to clusters, for which the distances between
features within the cluster is small, while distances between clusters are large.
Toolbox | Expression Analysis (
tering ( )
Select at least two samples ( (

) or (

) | Feature Clustering | K-means/medoids Clus)) or an experiment (

Note! If your data contains many features, the clustering will take very long time and could make
your computer unresponsive. It is recommended to perform this analysis on a subset of the data
(which also makes it easier to make sense of the clustering). See how to create a sub-experiment
in section 3.1.3.
Clicking Next will display a dialog as shown in figure 3.47.

Figure 3.47: Parameters for k-means/medoids clustering.

The parameters are:
Algorithm. You can choose between two clustering methods:
K-means. K-means clustering assigns each point to the cluster whose center is
nearest. The center/centroid of a cluster is defined as the average of all points
in the cluster. If a data set has three dimensions and the cluster has two points
X = (x1 , x2 , x3 ) and Y = (y1 , y2 , y3 ), then the centroid Z becomes Z = (z1 , z2 , z3 ),
where zi = (xi + yi )/2 for i = 1, 2, 3. The algorithm attempts to minimize the

CHAPTER 3. EXPRESSION ANALYSIS

202

intra-cluster variance defined by:

V =

k X
X

(xj i )2

i=1 xj Si

where there are k clusters Si , i = 1, 2, . . . , k and i is the centroid of all points xj Si .

The detailed algorithm can be found in [Lloyd, 1982].
K-medoids. K-medoids clustering is computed using the PAM-algorithm (PAM is short
for Partitioning Around Medoids). It chooses datapoints as centers in contrast to the
K-means algorithm. The PAM-algorithm is based on the search for k representatives
(called medoids) among all elements of the dataset. When having found k representatives k clusters are now generated by assigning each element to its nearest medoid.
The algorithm first looks for a good initial set of medoids (the BUILD phase). Then it
finds a local minimum for the objective function:
V =

k X
X

(xj ci )2

i=1 xj Si

where there are k clusters Si , i = 1, 2, . . . , k and ci is the medoid of Si . This solution

implies that there is no single switch of an object with a medoid that will decrease the
objective (this is called the SWAP phase). The PAM-agorithm is described in [Kaufman
and Rousseeuw, 1990].
Number of partitions. The number of partitions to cluster features into.
Distance metric. The metric to compute distance between data points.
Euclidean distance. The ordinary distance between two elements - the length of the
segment connecting them. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ), then the
Euclidean distance between u and v is
v
u n
uX
|u v| = t (ui vi )2 .
i=1

Manhattan distance. The Manhattan distance between two elements is the distance
measured along axes at right angles. If u = (u1 , u2 , . . . , un ) and v = (v1 , v2 , . . . , vn ),
then the Manhattan distance between u and v is
n
X
|u v| =
|ui vi |.
i=1

Subtract mean value. For each gene, subtract the mean gene expression value over all
input samples.
Clicking Next will display a dialog as shown in figure 3.48.
At the top, you can choose the Level to use. Choosing 'sample values' means that distances will
be calculated using all the individual values of the samples. When 'group means' are chosen,
distances are calculated using the group means.
At the bottom, you can select which values to cluster (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.

CHAPTER 3. EXPRESSION ANALYSIS

203

Figure 3.48: Parameters for k-means/medoids clustering.

Viewing the result of k-means/medoids clustering
The result of the clustering is a number of graphs. The number depends on the number of
partitions chosen (figure 3.47) - there is one graph per cluster. Using drag and drop as explained
in section ??, you can arrange the views to see more than one graph at the time.
Figure 3.49 shows an example where four clusters have been arranged side-by-side.
The samples used are from a time-series experiment, and you can see that the expression levels
for each cluster have a distinct pattern. The two clusters at the bottom have falling and rising
expression levels, respectively, and the two clusters at the top both fall at the beginning but then
rise again (the one to the right starts to rise earlier that the other one).
Having inspected the graphs, you may wish to take a closer look at the features represented in
each cluster. In the experiment table, the clustering has added an extra column with the name
of the cluster that the feature belongs to. In this way you can filter the table to see only features
from a specific cluster. This also means that you can select the feature of this cluster in a
volcano or scatter plot as described in section 3.1.6.

3.6

Annotation tests

The annotation tests are tools for detecting significant patterns among features (e.g. genes) of
experiments, based on their annotations. This may help in interpreting the analysis of the large
numbers of features in an experiment in a biological context. Which biological context, depends
on which annotation you choose to examine, and could e.g. be biological process, molecular
function or pathway as specified by the Gene Ontology or KEGG. The annotation testing tools of
course require that the features in the experiment you want to analyze are annotated. Learn how
to annotate an experiment in section 3.1.4.

3.6.1

Hypergeometric tests on annotations

The first approach to using annotations to extract biological information is the hypergeometric
annotation test. This test measures the extend to which the annotation categories of features in
a smaller gene list, 'A', are over or under-represented relative to those of the features in larger
gene list 'B', of which 'A' is a sub-list. Gene list B is often the features of the full experiment,
possibly with features which are thought to represent only noise, filtered away. Gene list A is

CHAPTER 3. EXPRESSION ANALYSIS

204

Figure 3.49: Four clusters created by k-means/medoids clustering.

a sub-experiment of the full experiment where most features have been filtered away and only
those that seem of interest are kept. Typically gene list A will consist of a list of candidate
differentially expressed genes. This could be the gene list obtained after carrying out a statistical
analysis on the experiment, and keeping only features with FDR corrected p-values <0.05 and
a fold change which is larger than 2 in absolute value. The hyper geometric test procedure
implemented is similar to the unconditional GOstats test of [Falcon and Gentleman, 2007].
Toolbox | Expression Analysis (
Annotations ( )

) | Annotation Test | Hypergeometric Tests on

This will show a dialog where you can select the two experiments - the larger experiment, e.g. the
original experiment including the full list of features - and a sub-experiment (see how to create a
sub-experiment in section 3.1.3).
Click Next. This will display the dialog shown in figure 3.50.
At the top, you select which annotation to use for testing. You can select from all the annotations
available on the experiment, but it is of course only a few that are biologically relevant. Once you
have selected an annotation, you will see the number of features carrying this annotation below.

CHAPTER 3. EXPRESSION ANALYSIS

205

Figure 3.50: Parameters for performing a hypergeometric test on annotations

Annotations are typically given at the gene level. Often a gene is represented by more than one
feature in an experiment. If this is not taken into account it may lead to a biased result. The
standard way to deal with this is to reduce the set of features considered, so that each gene is
represented only once. In the next step, Remove duplicates, you can choose how you want this
to be done:
Using gene identifier.
Keep feature with:
Highest IQR. The feature with the highest interquartile range (IQR) is kept.
Highest value. The feature with the highest expression value is kept.
First you specify which annotation you want to use as gene identifier. Once you have selected this,
you will see the number of features carrying this annotation below. Next you specify which feature
you want to keep for each gene. This may be either the feature with the highest inter-quartile
range or the highest value.
At the bottom, you can select which values to analyze (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Result of hypergeometric tests on annotations
The result of performing hypergeometric tests on annotations using GO biological process is
shown in figure 3.51.
The table shows the following information:
Category. This is the identifier for the category.
Description. This is the description belonging to the category. Both of these are simply
extracted from the annotations.
Full set. The number of features in the original experiment (not the subset) with this
category. (Note that this is after removal of duplicates).

CHAPTER 3. EXPRESSION ANALYSIS

206

Figure 3.51: The result of testing on GO biological process.

In subset. The number of features in the the subset with this category. (Note that this is
after removal of duplicates).
Expected in subset. The number of features we would have expected to find with this
annotation category in the subset, if the subset was a random draw from the full set.
Observed - expected. 'In subset' - 'Expected in subset'
p-value. The tail probability of the hyper geometric distribution This is the value used for
sorting the table.
Categories with small p-values are categories that are over or under-represented on the features
in the subset relative to the full set.

3.6.2

Gene set enrichment analysis

When carrying out a hypergeometric test on annotations you typically compare the annotations of
the genes in a subset containing 'the significantly differentially expressed genes' to those of the
total set of genes in the experiment. Which, and how many, genes are included in the subset is
somewhat arbitrary - using a larger or smaller p-value cut-off will result in including more or less.
Also, the magnitudes of differential expression of the genes is not considered.
The Gene Set Enrichment Analysis (GSEA) does NOT take a sublist of differentially expressed
genes and compare it to the full list - it takes a single gene list (a single experiment). The
idea behind GSEA is to consider a measure of association between the genes and phenotype
of interest (e.g. test statistic for differential expression) and rank the genes according to this
measure of association. A test is then carried out for each annotation category, for whether the
ranks of the genes in the category are evenly spread throughout the ranked list, or tend to occur
at the top or bottom of the list.
The GSEA test implemented here is that of [Tian et al., 2005]. The test implicitly calculates and
uses a standard t-test statistic for two-group experiments, and ANOVA statistic for multiple group
experiments for each feature, as measures of association. For each category, the test statistics
for the features in than category are summed and a category based test statistic is calculated

CHAPTER 3. EXPRESSION ANALYSIS

207

as this sum divided by the square root of the number of features in the category. Note that if a
feature has the value NaN in one of the samples, the t-test statistic for the feature will be NaN.
Consequently, the combined statistic for each of the categories in which the feature is included
will be NaN. Thus, it is advisable to filter out any feature that has a NaN value before applying
GSEA.
The p-values for the GSEA test statistics are calculated by permutation: The original test statistics
for the features are permuted and new test statistics are calculated for each category, based on
the permuted feature test statistics. This is done the number of times specified by the user in
the wizard. For each category, the lower and upper tail probabilities are calculated by comparing
the original category test statistics to the distribution of the permutation-based test statistics for
that category. The lower and higher tail probabilities are the number of these that are lower and
higher, respectively, than the observed value, divided by the number of permutations.
As the p-values are based on permutations you may some times see results where category x's
test statistic is lower than that of category y and the categories are of equal size, but where the
lower tail probability of category x is higher than that of category y. This is due to imprecision
in the estimations of the tail probabilities from the permutations. The higher the number of
permutations, the more stable the estimation.
You may run a GSEA on a full experiment, or on a sub-experiment where you have filtered away
features that you think are un-informative and represent only noise. Typically you will remove
features that are constant across samples (those for which the value in the 'Range' column is
zero' --- these will have a t-test statistic of zero) and/or those for which the inter-quantile range is
small. As the GSEA algorithm calculates and ranks genes on p-values from a test of differential
expression, it will generally not make sense to filter the experiment on p-values produced in an
analysis if differential expression, prior to running GSEA on it.
Toolbox | Expression Analysis (
(GSEA) ( )

) | Annotation Test | Gene Set Enrichment Analysis

Select an experiment and click Next.

Click Next. This will display the dialog shown in figure 3.52.
At the top, you select which annotation to use for testing. You can select from all the annotations
available on the experiment, but it is of course only a few that are biologically relevant. Once you
have selected an annotation, you will see the number of features carrying this annotation below.
In addition, you can set a filter: Minimum size required. Only categories with more genes (i.e.
features) than the specified number will be considered. Excluding categories with small numbers
of genes may lead to more robust results.
Annotations are typically given at the gene level. Often a gene is represented by more than one
feature in an experiment. If this is not taken into account it may lead to a biased result. The
standard way to deal with this is to reduce the set of features considered, so that each gene is
represented only once. Check the Remove duplicates check box to reduce the feature set, and
you can choose how you want this to be done:
Using gene identifier.
Keep feature with:
Highest IQR. The feature with the highest interquartile range (IQR) is kept.

CHAPTER 3. EXPRESSION ANALYSIS

208

Figure 3.52: Gene set enrichment analysis on GO biological process

Highest value. The feature with the highest expression value is kept.
First you specify which annotation you want to use as gene identifier. Once you have selected this,
you will see the number of features carrying this annotation below. Next you specify which feature
you want to keep for each gene. This may be either the feature with the highest inter-quartile
range or the highest value.
Clicking Next will display the dialog shown in figure 3.53.

Figure 3.53: Gene set enrichment analsysis parameters.

At the top, you can select which values to analyze (see section 3.2.1).
Below, you can set the Permutations for p-value calculation. For the GSEA test a p-value is

CHAPTER 3. EXPRESSION ANALYSIS

209

calculated by permutation: p permuted data sets are generated, each consisting of the original
features, but with the test statistics permuted. The GSEA test is run on each of the permuted
data sets. The test statistic is calculated on the original data, and the resulting value is compared
to the distribution of the values obtained for the permuted data sets. The permutation based
p-value is the number of permutation based test statistics above (or below) the value of the
test statistic for the original data, divided by the number of permuted data sets. For reliable
permutation-based p-value calculation a large number of permutations is required (100 is the
default).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Result of gene set enrichment analysis
The result of performing gene set enrichment analysis using GO biological process is shown in
figure 3.54.

Figure 3.54: The result of gene set enrichment analysis on GO biological process.
The table shows the following information:
Category. This is the identifier for the category.
Description. This is the description belonging to the category. Both of these are simply
extracted from the annotations.
Size. The number of features with this category. (Note that this is after removal of
duplicates).
Test statistic. This is the GSEA test statistic.
Lower tail. This is the mass in the permutation based p-value distribution below the value
of the test statistic.
Upper tail. This is the mass in the permutation based p-value distribution above the value
of the test statistic.
A small lower (or upper) tail p-value for an annotation category is an indication that features in
this category viewed as a whole are perturbed among the groups in the experiment considered.

CHAPTER 3. EXPRESSION ANALYSIS

3.7

210

General plots

The last folder in the Expression Analysis ( ) folder in the Toolbox is General Plots. Here you
find three general plots that may be useful at various point of your analysis work flow. The plots
are explained in detail below.

3.7.1

Histogram

A histogram shows a distribution of a set of values. Histograms are often used for examining
and comparing distributions, e.g. of expression values of different samples, in the quality control
step of an analysis. You can create a histogram showing the distribution of expression value for
a sample:
Toolbox | Expression Analysis (

) | General Plots | Create Histogram (

Select a number of samples ( ( ) or ( )). When you have selected more than one sample, a
histogram will be created for each one. Clicking Next will display a dialog as shown in figure 3.55.

Figure 3.55: Selcting which values the histogram should be based on.
In this dialog, you select the values to be used for creating the histogram (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
Viewing histograms
The resulting histogram is shown in a figure 3.56
The histogram shows the expression value on the x axis (in the case of figure 3.56 the transformed
expression values) and the counts of these values on the y axis.
In the Side Panel to the left, there is a number of options to adjust the view. Under Graph
preferences, you can adjust the general properties of the plot.
Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
Frame. Shows a frame around the graph.
Show legends. Shows the data legends.

CHAPTER 3. EXPRESSION ANALYSIS

211

Figure 3.56: Histogram showing the distribution of transformed expression values.

Tick type. Determine whether tick lines should be shown outside or inside the frame.
Outside
Inside
Tick lines at. Choosing Major ticks will show a grid behind the graph.
None
Major ticks
Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min
and Max, and press Enter. This will update the view. If you wait a few seconds without
pressing Enter, the view will also be updated.
Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and
Max, and press Enter. This will update the view. If you wait a few seconds without pressing
Enter, the view will also be updated.
Break points. Determines where the bars in the histogram should be:
Sturges method. This is the default. The number of bars is calculated from the range
of values by Sturges formula [Sturges, 1926].
Equi-distanced bars. This will show bars from Start to End and with a width of Sep.
Number of bars. This will simply create a number of bars starting at the lowest value
and ending at the highest value.
Below the graph preferences, you find Line color. Allows you to choose between many different
colors. Click the color box to select a color.
Note that if you wish to use the same settings next time you open a principal component plot,
you need to save the settings of the Side Panel (see section ??).
Besides the histogram view itself, the histogram can also be shown in a table, summarizing key
properties of the expression values. An example is shown in figure 3.57.

CHAPTER 3. EXPRESSION ANALYSIS

212

Figure 3.57: Table view of a histogram.

The table lists the following properties:
Number +Inf values
Number -Inf values
Number NaN values
Number values used
Total number of values

3.7.2

MA plot

The MA plot is a scatter rotated by 45 . For two samples of expression values it plots for each
gene the difference in expression against the mean expression level. MA plots are often used for
quality control, in particular, to assess whether normalization and/or transformation is required.
You can create an MA plot comparing two samples:
Toolbox | Expression Analysis (
Select two samples ( (

) or (

) | General Plots | Create MA Plot (

)). Clicking Next will display a dialog as shown in figure 3.58.

Figure 3.58: Selcting which values the MA plot should be based on.
In this dialog, you select the values to be used for creating the MA plot (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.

CHAPTER 3. EXPRESSION ANALYSIS

213

Viewing MA plots
The resulting plot is shown in a figure 3.59.

Figure 3.59: MA plot based on original expression values.

The X axis shows the mean expression level of a feature on the two samples and the Y axis
shows the difference in expression levels for a feature on the two samples. From the plot shown
in figure 3.59 it is clear that the variance increases with the mean. With an MA plot like this, you
will often choose to transform the expression values (see section 3.2.2).
Figure 3.60 shows the same two samples where the MA plot has been created using log2
transformed values.

Figure 3.60: MA plot based on transformed expression values.

The much more symmetric and even spread indicates that the dependance of the variance on
the mean is not as strong as it was before transformation.
In the Side Panel to the left, there is a number of options to adjust the view. Under Graph
preferences, you can adjust the general properties of the plot.
Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
Frame. Shows a frame around the graph.

CHAPTER 3. EXPRESSION ANALYSIS

214

Show legends. Shows the data legends.

None
Line
Long dash
Short dash

Line color. Allows you to choose between many different colors. Click the color box to
select a color.
Line width
Thin
Medium
Wide
Line type
None
Line
Long dash
Short dash
Line color. Allows you to choose between many different colors. Click the color box to
select a color.

CHAPTER 3. EXPRESSION ANALYSIS

215

Below the general preferences, you find the Dot properties preferences, where you can adjust
coloring and appearance of the dots:
Dot type
None
Cross
Plus
Square
Diamond
Circle
Triangle
Reverse triangle
Dot
Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
Note that if you wish to use the same settings next time you open a scatter plot, you need to
save the settings of the Side Panel (see section ??).

3.7.3

Scatter plot

As described in section 3.1.5, an experiment can be viewed as a scatter plot. However, you can
also create a "stand-alone" scatter plot of two samples:
Toolbox | Expression Analysis (
Select two samples ( (

) or (

) | General Plots | Create Scatter Plot (

)). Clicking Next will display a dialog as shown in figure 3.61.

Figure 3.61: Selcting which values the scatter plot should be based on.
In this dialog, you select the values to be used for creating the scatter plot (see section 3.2.1).
Click Next if you wish to adjust how to handle the results (see section ??). If not, click Finish.
For more information about the scatter plot view and how to interpret it, please see section 3.1.5.

Bibliography
[Akmaev and Wang, 2004] Akmaev, V. R. and Wang, C. J. (2004). Correction of sequence-based
artifacts in serial analysis of gene expression. Bioinformatics, 20(8):1254--1263.
[Allison et al., 2006] Allison, D., Cui, X., Page, G., and Sabripour, M. (2006). Microarray data
analysis: from disarray to consolidation and consensus. NATURE REVIEWS GENETICS, 7(1):55.
[Altshuler et al., 2000] Altshuler, D., Pollara, V. J., Cowles, C. R., Etten, W. J. V., Baldwin, J.,
Linton, L., and Lander, E. S. (2000). An snp map of the human genome generated by reduced
representation shotgun sequencing. Nature, 407(6803):513--516.
[Baggerly et al., 2003] Baggerly, K., Deng, L., Morris, J., and Aldaz, C. (2003). Differential expression in SAGE: accounting for normal between-library variation. Bioinformatics,
19(12):1477--1483.
[Benjamini and Hochberg, 1995] Benjamini, Y. and Hochberg, Y. (1995). Controlling the false
discovery rate: a practical and powerful approach to multiple testing. JOURNAL-ROYAL
STATISTICAL SOCIETY SERIES B, 57:289--289.
[Bolstad et al., 2003] Bolstad, B., Irizarry, R., Astrand, M., and Speed, T. (2003). A comparison
of normalization methods for high density oligonucleotide array data based on variance and
bias. Bioinformatics, 19(2):185--193.
[Brockman et al., 2008] Brockman, W., Alvarez, P., Young, S., Garber, M., Giannoukos, G., Lee,
W. L., Russ, C., Lander, E. S., Nusbaum, C., and Jaffe, D. B. (2008). Quality scores and snp
detection in sequencing-by-synthesis systems. Genome Res, 18(5):763--770.
[Creighton et al., 2009] Creighton, C. J., Reid, J. G., and Gunaratne, P. H. (2009). Expression
profiling of micrornas by deep sequencing. Brief Bioinform, 10(5):490--497.
[Cronn et al., 2008] Cronn, R., Liston, A., Parks, M., Gernandt, D. S., Shen, R., and Mockler,
T. (2008). Multiplex sequencing of plant chloroplast genomes using solexa sequencing-bysynthesis technology. Nucleic Acids Res, 36(19):e122.
[Dudoit et al., 2003] Dudoit, S., Shaffer, J., and Boldrick, J. (2003). Multiple Hypothesis Testing
in Microarray Experiments. STATISTICAL SCIENCE, 18(1):71--103.
[Eisen et al., 1998] Eisen, M., Spellman, P., Brown, P., and Botstein, D. (1998). Cluster analysis
and display of genome-wide expression patterns. Proceedings of the National Academy of
Sciences, 95(25):14863--14868.
[Falcon and Gentleman, 2007] Falcon, S. and Gentleman, R. (2007). Using GOstats to test gene
lists for GO term association. Bioinformatics, 23(2):257.
216

BIBLIOGRAPHY

217

[Gnerre et al., 2011] Gnerre, S., Maccallum, I., Przybylski, D., Ribeiro, F. J., Burton, J. N.,
Walker, B. J., Sharpe, T., Hall, G., Shea, T. P., Sykes, S., Berlin, A. M., Aird, D., Costello,
M., Daza, R., Williams, L., Nicol, R., Gnirke, A., Nusbaum, C., Lander, E. S., and Jaffe,
D. B. (2011). High-quality draft assemblies of mammalian genomes from massively parallel
sequence data. Proceedings of the National Academy of Sciences of the United States of
America, 108(4):1513--8.
[Guo et al., 2006] Guo, L., Lobenhofer, E. K., Wang, C., Shippy, R., Harris, S. C., Zhang, L., Mei,
N., Chen, T., Herman, D., Goodsaid, F. M., Hurban, P., Phillips, K. L., Xu, J., Deng, X., Sun,
Y. A., Tong, W., Dragan, Y. P., and Shi, L. (2006). Rat toxicogenomic study reveals analytical
consistency across microarray platforms. Nat Biotechnol, 24(9):1162--1169.
[Ji et al., 2008] Ji, H., Jiang, H., Ma, W., Johnson, D., Myers, R., and Wong, W. (2008). An
integrated software system for analyzing ChIP-chip and ChIP-seq data. Nature Biotechnology,
26(11):1293--1300.
[Kal et al., 1999] Kal, A. J., van Zonneveld, A. J., Benes, V., van den Berg, M., Koerkamp, M. G.,
Albermann, K., Strack, N., Ruijter, J. M., Richter, A., Dujon, B., Ansorge, W., and Tabak,
H. F. (1999). Dynamics of gene expression revealed by comparison of serial analysis of gene
expression transcript profiles from yeast grown on two different carbon sources. Mol Biol Cell,
10(6):1859--1872.
[Kaufman and Rousseeuw, 1990] Kaufman, L. and Rousseeuw, P. (1990). Finding groups in
data. an introduction to cluster analysis. Wiley Series in Probability and Mathematical Statistics.
Applied Probability and Statistics, New York: Wiley, 1990.
[Li et al., 2010] Li, R., Zhu, H., Ruan, J., Qian, W., Fang, X., Shi, Z., Li, Y., Li, S., Shan, G.,
Kristiansen, K., Li, S., Yang, H., Wang, J., and Wang, J. (2010). De novo assembly of human
genomes with massively parallel short read sequencing. Genome research, 20(2):265--72.
[Lloyd, 1982] Lloyd, S. (1982). Least squares quantization in PCM. Information Theory, IEEE
Transactions on, 28(2):129--137.
[Maeda et al., 2008] Maeda, N., Nishiyori, H., Nakamura, M., Kawazu, C., Murata, M., Sano,
H., Hayashida, K., Fukuda, S., Tagami, M., Hasegawa, A., Murakami, K., Schroder, K., Irvine,
K., Hume, D., Hayashizaki, Y., Carninci, P., and Suzuki, H. (2008). Development of a dna
barcode tagging method for monitoring dynamic changes in gene expression by using an ultra
high-throughput sequencer. Biotechniques, 45(1):95--97.
[Meyer et al., 2007] Meyer, M., Stenzel, U., Myles, S., Prfer, K., and Hofreiter, M. (2007).
Targeted high-throughput sequencing of tagged nucleic acid samples. Nucleic Acids Res,
35(15):e97.
[Morin et al., 2008] Morin, R. D., O'Connor, M. D., Griffith, M., Kuchenbauer, F., Delaney, A.,
Prabhu, A.-L., Zhao, Y., McDonald, H., Zeng, T., Hirst, M., Eaves, C. J., and Marra, M. A.
(2008). Application of massively parallel sequencing to microrna profiling and discovery in
human embryonic stem cells. Genome Res, 18(4):610--621.
[Mortazavi et al., 2008] Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., and Wold,
B. (2008). Mapping and quantifying mammalian transcriptomes by rna-seq. Nat Methods,
5(7):621--628.

BIBLIOGRAPHY

218

[Nielsen, 2007] Nielsen, K. L., editor (2007). Serial Analysis of Gene Expression (SAGE): Methods
and Protocols, volume 387 of Methods in Molecular Biology. Humana Press.
[Parkhomchuk et al., 2009] Parkhomchuk, D., Borodina, T., Amstislavskiy, V., Banaru, M.,
Hallen, L., Krobitsch, S., Lehrach, H., and Soldatov, A. (2009). Transcriptome analysis by
strand-specific sequencing of complementary dna. Nucleic Acids Res, 37(18):e123.
[Smith and Waterman, 1981] Smith, T. F. and Waterman, M. S. (1981). Identification of common
molecular subsequences. J Mol Biol, 147(1):195--197.
[Stark et al., 2010] Stark, M. S., Tyagi, S., Nancarrow, D. J., Boyle, G. M., Cook, A. L., Whiteman,
D. C., Parsons, P. G., Schmidt, C., Sturm, R. A., and Hayward, N. K. (2010). Characterization
of the melanoma mirnaome by deep sequencing. PLoS One, 5(3):e9685.
[Sturges, 1926] Sturges, H. A. (1926). The choice of a class interval. Journal of the American
Statistical Association, 21:65--66.
['t Hoen et al., 2008] 't Hoen, P. A. C., Ariyurek, Y., Thygesen, H. H., Vreugdenhil, E., Vossen, R.
H. A. M., de Menezes, R. X., Boer, J. M., van Ommen, G.-J. B., and den Dunnen, J. T. (2008).
Deep sequencing-based expression analysis shows major advances in robustness, resolution
and inter-lab portability over five microarray platforms. Nucleic Acids Res, 36(21):e141.
[Tian et al., 2005] Tian, L., Greenberg, S., Kong, S., Altschuler, J., Kohane, I., and Park,
P. (2005). Discovering statistically significant pathways in expression profiling studies.
Proceedings of the National Academy of Sciences, 102(38):13544--13549.
[Tusher et al., 2001] Tusher, V. G., Tibshirani, R., and Chu, G. (2001). Significance analysis of
microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A, 98(9):5116-5121.
[Wyman et al., 2009] Wyman, S. K., Parkin, R. K., Mitchell, P. S., Fritz, B. R., O'Briant, K.,
Godwin, A. K., Urban, N., Drescher, C. W., Knudsen, B. S., and Tewari, M. (2009). Repertoire
of micrornas in epithelial ovarian cancer as determined by next generation sequencing of small
rna cdna libraries. PLoS One, 4(4):e5311.
[Zerbino and Birney, 2008] Zerbino, D. R. and Birney, E. (2008). Velvet: algorithms for de novo
short read assembly using de Bruijn graphs. Genome Res, 18(5):821--829.
[Zerbino et al., 2009] Zerbino, D. R., McEwen, G. K., Margulies, E. H., and Birney, E. (2009).
Pebble and rock band: heuristic resolution of repeats and scaffolding in the velvet short-read
de novo assembler. PloS one, 4(12):e8407.

Part I

Index

219

Index
Consensus sequence
extract, 75
open, 75
Adapter trimmming, 38
Consensus sequence, extract, 89
Affymetrix arrays, 160
Consensus sequence, open, 68
Annotate tag experiment, 139
Contig
Annotation level, 166
BLAST, 90
Annotation tests, 203
Count
Gene set enrichment analysis (GSEA), 206
small RNAs, 142
GSEA, 206
tag profiling, 132
Hypergeometric test, 203
Coverage, definition of, 70
Annotations
Create virtual tag list, 135
add to experiment, 168
csfasta, file format, 15
expression analysis, 168
De novo, assembly, 46
Array platforms, 160
de-multiplexing, 27
Assemble
Digital gene expression(DGE), 116
de novo, 46
tag-based, 131
report, 74
DIP
to reference sequence, 60
detect, 103
BAM format, 23
DIP detection, 103
BED, import of, 25
Directional RNA-Seq, 120
Bibliography, 218
Distance measure, 181
BLAST
ELAND, import of, 25
contig, 90
Epigenomics, ChIP sequencing, 108
sequencing data, assembled, 90
Experiment
Box plot, 177
set up, 161
Broken pairs, find mates, 92
Experiment, 160
CASAVA1.8, paired data, 12
Expression analysis, 160
ChIP sequencing, 108
Extract
Chromatin immunoprecipitation, see ChIP separt of a mapping, 90
quencing
Extract and count small RNAs, 142
Cluster linkage
Extract and count tags, 132
Average linkage, 182
Extract consensus sequences, from mapping
Complete linkage, 182
table, 75
Single linkage, 182
FASTQ, file format, 11
Color space
Feature clustering, 197
Digital gene expression, 120
K-means clustering, 201
RNA sequencing, 120
K-medoids clustering, 201
tag profiling, 132
Feature, for expression analysis, 160
Complete Genomics data, 22
mapping
extract from selection, 90

220

INDEX

221

Mixed data, 94
mRNA sequencing
Gapped/ungapped alignment, 63
by tag, 131
Gene expression, 160
Multi-group experiment, 161
Gene expression, sequencing-based, 116
Multiple testing
Gene expression, sequencing-by tag, 131
Benjamini-Hochberg corrected p-values, 193
GOstats, see Hypergeometric tests on annotaBenjamini-Hochberg FDR, 193
tions
Bonferroni, 193
Groups, define, 161
Correction of p-values, 193
FDR, 193
Heat map
Multiplexing, 27
clustering of features, 199
by name, 27
clustering of samples, 183
Hierarchical clustering
N50, 69
of features, 197
Non-coding RNA analysis, 142
of samples, 180
Non-perfect matches, 83
Histogram, 210
Non-specific matches, 67, 83
Distributions, 210
Normalization, 174
Hypergeometric tests on annotations, 203
Quantile normlization, 174
File name, sort sequences based on, 27

Import
High-throughput sequencing data, 8
Next-Generation Sequencing data, 8
NGS data, 8
K-means clustering, 201
K-medoids clsutering, 201
Linker trimming, 38
MA plot, 212
Map
to coding regions, 61
Map reads to reference
masking, 61
select reference sequences, 60
Mapping
report, 69
short reads, 63
Mapping reads to a reference sequence, 60
Mapping table, 75
Mappings
merge, 94
Mask, reference sequence, 61
Match weight, 157
Mates, locate from broken pairs, 92
Merge mapping results, 94
Microarray analysis, 160
Microarray platforms, 160
microRNA analysis, 142

Scaling, 174
Open
consensus sequence, 68
Paired data, 8, 17, 19, 22
Paired distance graph, 83
Paired reads
combined with single reads, 94
Paired samples, expression analysis, 161
Paired status, 23
Partitioning around medoids (PAM), see K-medoids
clustering
PCA, 185
Peak finding, ChIP sequencing, 108
Principal component analysis, 185
Scree plot, 188
QC, 177
QSEQ,file format, 11
Quality control
MA plot, 212
Quality of trace, 36
Quality score of trace, 36
Read mapping, 60
Reference assembly, 60
References, 218
Repeat masking, 61
Report
of assembly, 74

INDEX
RNA-Seq analysis, 116
RPKM,definition, 130
SAGE
tag-based mRNA sequencing, 131
SageScreen, tag profiling by, 132
SAM format, 23
Sample, for expression analysis, 160
SCARF, file format, 11
Scatter plot, 215
Scree plot, 188
Short reads, mapping, 63
Single paired reads, 83
Small RNA analysis, 142
Small RNAs
extract and count, 142
trim, 142
SNP
detect, 94
SNP detection, 94
Sort sequences by name, 27
Statistical analysis, 189
ANOVA, 189
Corrected of p-values, 193
Paired t-test, 189
Repeated measures ANOVA, 189
t-test, 189
Volcano plot, 194
Subcontig, extract part of a mapping, 90
Tag profiling, 131
annotate tag experiment, 139
create virtual tag list, 135
Tags
extract and count, 132
Trace data
quality, 36
Transcriptome analysis, 160
Transcriptome sequencing, 116
tag-based, 131
Transcriptomics, 116
tag-based, 131
Transformation, 174
Trim, 36
small RNAs, 142
Two-color arrays, 160
Two-group experiment, 161
UniVec, trimming, 36

222
Vector contamination, find automatically, 36
Virtual tag list
create, 135
how to annotate, 139
Volcano plot, 194

Shap
100% (1)
Shap
214 pages
Iso 21294 2017
No ratings yet
Iso 21294 2017
9 pages
Dokumen - Pub - Research Topics in Graph Theory and Its Applications 1527535339 9781527535336
No ratings yet
Dokumen - Pub - Research Topics in Graph Theory and Its Applications 1527535339 9781527535336
310 pages
Iso 2631 1 1997
No ratings yet
Iso 2631 1 1997
13 pages
Chips 3
No ratings yet
Chips 3
28 pages
Tutorial
No ratings yet
Tutorial
165 pages
Manuale Italiano Lightroom
0% (1)
Manuale Italiano Lightroom
191 pages
Workshop Programming: Operating Instructions
No ratings yet
Workshop Programming: Operating Instructions
90 pages
Oil in Water Analysis: ISO 9377-2 / 9377-2 MOD
No ratings yet
Oil in Water Analysis: ISO 9377-2 / 9377-2 MOD
5 pages
6000i User Manual Rev D PDF
No ratings yet
6000i User Manual Rev D PDF
184 pages
Self Healing Robots
75% (4)
Self Healing Robots
25 pages
ILAC G12-2000 Guidelines For The Requirements For The Competence of Reference Materials Producers
100% (2)
ILAC G12-2000 Guidelines For The Requirements For The Competence of Reference Materials Producers
47 pages
FlowMaster D80
No ratings yet
FlowMaster D80
162 pages
Collaborative Statistics Supplemental Course Materials
No ratings yet
Collaborative Statistics Supplemental Course Materials
106 pages
Ion of Chromatographic Selectivity - 1986
100% (1)
Ion of Chromatographic Selectivity - 1986
363 pages
Iso 7870-4-2011
No ratings yet
Iso 7870-4-2011
70 pages
(Ebook) Six Sigma Quality Improvement with Minitab by G. Robin Henderson ISBN 9780470741740, 0470741740 - The ebook in PDF format is available for download
100% (2)
(Ebook) Six Sigma Quality Improvement with Minitab by G. Robin Henderson ISBN 9780470741740, 0470741740 - The ebook in PDF format is available for download
54 pages
Fdident
No ratings yet
Fdident
232 pages
Capability Indices For Unilateral Tolerances
No ratings yet
Capability Indices For Unilateral Tolerances
16 pages
ISO 22119_2011_ed1_en_45035_2_cpdf
No ratings yet
ISO 22119_2011_ed1_en_45035_2_cpdf
20 pages
Skript Control Systems II V1
No ratings yet
Skript Control Systems II V1
248 pages
MSA Type II - Gage Repeatability & Reproducibility Linearity and Stability
No ratings yet
MSA Type II - Gage Repeatability & Reproducibility Linearity and Stability
1 page
Internet Connected Low Cost Healthcare Devices For Telemedicine in Rural India
No ratings yet
Internet Connected Low Cost Healthcare Devices For Telemedicine in Rural India
91 pages
hailo_model_zoo_v2.14.0
No ratings yet
hailo_model_zoo_v2.14.0
100 pages
Understanding Variation With Shewart Charts
No ratings yet
Understanding Variation With Shewart Charts
48 pages
SOP No. 10 Recommended Standard Operating Procedure For Calibration of Rigid Rules
No ratings yet
SOP No. 10 Recommended Standard Operating Procedure For Calibration of Rigid Rules
9 pages
Half Subcarrier Shift
100% (1)
Half Subcarrier Shift
104 pages
Capitulo 4 Variables Aleatorias Multidimensionales Del Libro Estadistica Actuarial Teoria y Aplicaciones PDF
No ratings yet
Capitulo 4 Variables Aleatorias Multidimensionales Del Libro Estadistica Actuarial Teoria y Aplicaciones PDF
20 pages
Iso 19662 2018
No ratings yet
Iso 19662 2018
11 pages
Pipette Calibration Resource Guide en Sartorius PDF Data
No ratings yet
Pipette Calibration Resource Guide en Sartorius PDF Data
14 pages
E 1252 - 98 Rteyntitotg
No ratings yet
E 1252 - 98 Rteyntitotg
13 pages
SAS IML User Guide PDF
No ratings yet
SAS IML User Guide PDF
1,108 pages
Cinema Craft Encoder SP Guide PDF
100% (1)
Cinema Craft Encoder SP Guide PDF
92 pages
Call 3220
No ratings yet
Call 3220
456 pages
Castagliola - 2005 - Capability Indices Dedicated To The Two Quality Characteristics Case
No ratings yet
Castagliola - 2005 - Capability Indices Dedicated To The Two Quality Characteristics Case
21 pages
Learning Gravostyle'98: A Training Manual
No ratings yet
Learning Gravostyle'98: A Training Manual
19 pages
Balanza Sartorius
No ratings yet
Balanza Sartorius
49 pages
Sir Galahad User Manual G525M050 v1-3
No ratings yet
Sir Galahad User Manual G525M050 v1-3
49 pages
Muhammad-Asif Process Capability
No ratings yet
Muhammad-Asif Process Capability
29 pages
Phase Shifting Interferometry - NB
No ratings yet
Phase Shifting Interferometry - NB
35 pages
Introduction To Computational Fluid Dynamics
No ratings yet
Introduction To Computational Fluid Dynamics
21 pages
CP CPK - PP PPK
No ratings yet
CP CPK - PP PPK
8 pages
00703055
No ratings yet
00703055
5 pages
Ismaykim1 PDF
No ratings yet
Ismaykim1 PDF
522 pages
JUNO-DS 88-76-61 ParamGuide Eng01 W
No ratings yet
JUNO-DS 88-76-61 ParamGuide Eng01 W
88 pages
ARI 126 (2017) 256-262 Practical Implementation of ISO 11929 2010 - de Felice, P., Jerome, S., & Petrucci, A.
No ratings yet
ARI 126 (2017) 256-262 Practical Implementation of ISO 11929 2010 - de Felice, P., Jerome, S., & Petrucci, A.
21 pages
PH Meter EA940
No ratings yet
PH Meter EA940
13 pages
BiodiversityR PDF
No ratings yet
BiodiversityR PDF
128 pages
Download full Theory of Statistical Inference 1st Edition Anthony Almudevar ebook all chapters
100% (3)
Download full Theory of Statistical Inference 1st Edition Anthony Almudevar ebook all chapters
40 pages
HAMMER V8i User's Guide
100% (1)
HAMMER V8i User's Guide
1,238 pages
UV WinLab Release Notes
No ratings yet
UV WinLab Release Notes
34 pages
Method 207 Ammonia in Air Emission
No ratings yet
Method 207 Ammonia in Air Emission
49 pages
LB124 Scint User Manual - EN
No ratings yet
LB124 Scint User Manual - EN
100 pages
Appleman D. - Dan Appleman's Developing Activex Components With Visual Basic 5.0 (1997)
No ratings yet
Appleman D. - Dan Appleman's Developing Activex Components With Visual Basic 5.0 (1997)
547 pages
MA100 MT Course Pack 2020-21
No ratings yet
MA100 MT Course Pack 2020-21
222 pages
Chemical Analysis Uncertainty
No ratings yet
Chemical Analysis Uncertainty
25 pages
Mpeg-2 Basics
100% (1)
Mpeg-2 Basics
17 pages
CLC Sequence Viewer: User Manual
No ratings yet
CLC Sequence Viewer: User Manual
178 pages
CLC Genomics Workbench User Manual
No ratings yet
CLC Genomics Workbench User Manual
776 pages
GDB Tool
No ratings yet
GDB Tool
378 pages
Differential Analysis of Count Data - The Deseq2 Package: Michael Love, Simon Anders, Wolfgang Huber
No ratings yet
Differential Analysis of Count Data - The Deseq2 Package: Michael Love, Simon Anders, Wolfgang Huber
33 pages
Anand Madhav
No ratings yet
Anand Madhav
1 page
M Project
No ratings yet
M Project
11 pages
Department of Education: Proposal To Conduct District Workshop of The Digitization of Learning Resources
No ratings yet
Department of Education: Proposal To Conduct District Workshop of The Digitization of Learning Resources
6 pages
Invitation to Computer Science 7th Edition Schneider Test Bank pdf download
100% (2)
Invitation to Computer Science 7th Edition Schneider Test Bank pdf download
36 pages
(Tutorial) Easy Multiboot Environment With Grub4Dos Brigs Lab's
No ratings yet
(Tutorial) Easy Multiboot Environment With Grub4Dos Brigs Lab's
7 pages
Youtube: Jump To Navigationjump To Search
No ratings yet
Youtube: Jump To Navigationjump To Search
6 pages
Atari Catalog
No ratings yet
Atari Catalog
32 pages
Cs3591 Cn Unit 1 Notes (1)
No ratings yet
Cs3591 Cn Unit 1 Notes (1)
37 pages
6820-02-UPRVUNL-PM-Equipment Master Review Log - CHD-I - V1.0
No ratings yet
6820-02-UPRVUNL-PM-Equipment Master Review Log - CHD-I - V1.0
5 pages
Analisis Peningkatan Kualitas Jaringan Wlan Pada Bank Mandiri Area Palembang Sudirman Dengan Menggunakan Metode Per Connection Queue
No ratings yet
Analisis Peningkatan Kualitas Jaringan Wlan Pada Bank Mandiri Area Palembang Sudirman Dengan Menggunakan Metode Per Connection Queue
7 pages
Xeno Laser
No ratings yet
Xeno Laser
24 pages
Log 2024-3-20 10 35 11
No ratings yet
Log 2024-3-20 10 35 11
114 pages
Configuring MSVC2019 in Code::Blocks
No ratings yet
Configuring MSVC2019 in Code::Blocks
14 pages
Software As A Solution For Dummies, Oracle Edition
No ratings yet
Software As A Solution For Dummies, Oracle Edition
58 pages
Network by EasyChair-Preprint-1882
No ratings yet
Network by EasyChair-Preprint-1882
9 pages
7171 Buena
No ratings yet
7171 Buena
41 pages
ManualPX 80 Disc Stack Centrifuge PDF
No ratings yet
ManualPX 80 Disc Stack Centrifuge PDF
78 pages
Two Pass Assembler Algorithm
No ratings yet
Two Pass Assembler Algorithm
2 pages
TUT FPIPE Foran Marine
No ratings yet
TUT FPIPE Foran Marine
130 pages
SAP HANA EIM Administration Guide en
No ratings yet
SAP HANA EIM Administration Guide en
338 pages
GDPR Data Protection Audit
80% (10)
GDPR Data Protection Audit
23 pages
Msi Katana GF66 20240122 2010
No ratings yet
Msi Katana GF66 20240122 2010
8 pages
Software Language Engineering 6th International Conference SLE 2013 Indianapolis IN USA October 26 28 2013 Proceedings 1st Edition Don Batory
100% (7)
Software Language Engineering 6th International Conference SLE 2013 Indianapolis IN USA October 26 28 2013 Proceedings 1st Edition Don Batory
62 pages
Chapter 8-Controlling Information Systems: IT Processes True/False
No ratings yet
Chapter 8-Controlling Information Systems: IT Processes True/False
6 pages
Exam Program 2023 Sple (Accountancy)
No ratings yet
Exam Program 2023 Sple (Accountancy)
2 pages
A New Bridge Management System Based On Spatial Database and Open Source GIS
No ratings yet
A New Bridge Management System Based On Spatial Database and Open Source GIS
14 pages
Data Structure Interview Questions (2021) - Javatpoint
No ratings yet
Data Structure Interview Questions (2021) - Javatpoint
16 pages
Smart Car Parking Ijariie9204
No ratings yet
Smart Car Parking Ijariie9204
4 pages
I/A Series A Hardware Model P92 Workstation: Windows XP Professional Operating System
No ratings yet
I/A Series A Hardware Model P92 Workstation: Windows XP Professional Operating System
4 pages