Genetics and Molecular Biology, 29, 2, 294-307 (2006)

Copyright by the Brazilian Society of Genetics. Printed in Brazil

www.sbg.org.br

Review Article

Origin, evolution and genome distribution of microsatellites

Eder Jorge Oliveira, Juliano Gomes Pádua, Maria Imaculada Zucchi, Roland Vencovsky
and Maria Lúcia Carneiro Vieira
Universidade de São Paulo, Escola Superior de Agricultura ‘Luiz de Queiroz’, Departamento de Genética,
Piracicaba, SP, Brasil.

Abstract
Microsatellites, or simple sequence repeats (SSRs), have been the most widely applied class of molecular markers
used in genetic studies, with applications in many fields of genetics including genetic conservation, population genet-
ics, molecular breeding, and paternity testing. This range of applications is due to the fact that microsatellite markers
are co-dominant and multi-allelic, are highly reproducible, have high-resolution and are based on the polymerase
chain reaction (PCR). When first introduced, the development of microsatellite markers was expensive but now new
and efficient methods of repetitive sequence isolation have been reported, which have led to reduced costs and
microsatellite-technology has been increasingly applied to several species, including non-model organisms. The ad-
vent of microsatellite markers revolutionized the use of molecular markers but the development of biometric methods
for analyzing microsatellite data has not accompanied the progress in the application of these markers, with more ef-
fort being need to obtain information on the evolution of the repetitive sequences, which constitute microsatellites in
order to formulate models that fit the characteristics of such markers. Our review describes the genetic nature of
microsatellites, the mechanisms and models of mutation that control their evolution and aspects related to their gen-
esis, distribution and transferability between taxa. The implications of the use of microsatellites as a tool for estimat-
ing genetic parameters are also discussed.
Key words: microsatellites, molecular genetics, genetic structure of populations.
Received: November 23, 2004; Accepted: August 25, 2005.

Introduction Microsatellites, also known as simple sequence re-

During the twenty-first century, the protection of bio- peats (SSR) or short tandem repeats (STR), are non-coding
diversity is expected to be both crucial and continuing, with repetitive DNA regions composed of small motifs of 1 to 6
conservation genetics being of primary importance for nucleotides repeated in tandem, which are widespread in
avoiding the extinction of most endangered species along- both eukaryotic and prokaryotic genomes (Field and Wills,
side the ecological, political and economic aspects of bio- 1998; Tóth et al., 2000). Broadly used as genetic markers,
diversity protection. The application of molecular microsatellites have a particular attribute in that they suffer
techniques, including genome approaches, to conservation higher rates of mutation than the rest of the genome (Jarne
genetics has made possible the examination of the genetics and Lagoda, 1996). Microsatellites are classified according
of species in danger of extinction and genetic analysis has to the type of repeat sequence as perfect, imperfect, inter-
become widely used in conservation research. rupted or composite. In a perfect microsatellite the repeat
Traditional molecular markers have, in general, pro- sequence is not interrupted by any base not belonging to the
vided insufficient statistical power and accuracy for esti- motif (e.g. TATATATATATATATA) while in an imper-
mating genetic differences but the discovery of highly fect microsatellite there is a pair of bases between the re-
variable loci such as microsatellites means that the statisti- peated motifs that does not match the motif sequence (e.g.
cal power available for determining differentiation between TATATATACTATATA). In the case of an interrupted
species groups at risk of extinction is now often very high
microsatellite there is a small sequence within the repeated
(Hedrick, 2001 and references therein).
sequence that does not match the motif sequence (e.g.
TATATACGTGTATATATATA) while in a composite
Send correspondence to Maria Lúcia Carneiro Vieira, Universidade
microsatellite the sequence contains two adjacent distinc-
de São Paulo, Escola Superior de Agricultura “Luiz de Queiroz”,
Departamento de Genética, Caixa Postal 83, 13400-970 Pira- tive sequence-repeats (e.g. TATATATATAGTGTGTGT
cicaba, SP, Brazil. E-mail: [email protected]. GT).
Oliveira et al. 295

In the past few years, microsatellites have attracted with a different number of repeats, which means that micro-
the attention of researchers for a number of reasons, includ- satellite markers are very useful for discriminating different
ing their extensive use in the construction of genetic maps individuals. Assuming that m is the number of alleles in a
of several types of organisms (Knapik et al., 1998; Cregan population, the maximum number of different genotypes
et al., 1999), the association between the instability of the (NDG) will be m(m + 1)/2 and the number of possible het-
number of repeats and human genetic diseases (Mahadevan erozygous genotypes (NHG) will be m(m - 1)/2, e.g. if
et al., 1992; Stallings, 1994; O’Donnell and Warren, 2002), m = 48, NDG = 1,176 and NHG = 1,128. The high discrimi-
their practicability and ease of use in studies of population nating power of microsatellites is an important characteris-
genetics, and for genotyping and paternity analysis (Wright tic which justifies their use in population genetic studies
and Bentzen, 1994; Schlötterer, 2000). and forensic science.
Although originally designed for research in humans,
microsatellite analysis has become a powerful tool for re- Mutation Mechanisms
search on animals (Schlötterer et al., 1991) and plants
Although microsatellites have been extensively used
(Dayanandan et al., 1997; White and Powell, 1997; Stein-
in a considerable number of studies covering the most var-
kellner et al., 1997; Cipriani et al., 1999; Roa et al., 2000;
ied areas of genetics, the mutational dynamics of these
Collevatti et al., 2001). According to Heywood and Iriondo
genomic regions is still not well understood (Schlötterer,
(2003), microsatellite markers provide relevant informa-
2000), although it is known that the mutation rate of micro-
tion for identifying conservation units and for investigating
satellites is much higher than that of other parts of the ge-
the genetic processes that take place in populations such as
nome, ranging from 10-2 to 10-6 nucleotides per locus per
patterns of gene flow, generation of genetic neighborhoods
generation (Sia et al., 2000 and references therein).
and the incidence of genetic drift. Currently, microsatellite
Several mechanisms have been suggested to explain
markers are commonly employed for the analysis of plant
the high mutation rate of microsatellites, including errors
population genetic structure of both wild (Zucchi et al.,
during recombination, unequal crossing-over and polymer-
2002) and crop species (Pinto et al., 2003a, b) because of
ase slippage during DNA replication or repair (Strand et al.,
their co-dominant nature and high informativeness.
1993).
More recent research based on expressed sequence
In regard to the inclusion of errors during recombina-
tags (ESTs) suggest that the frequency of microsatellites in
tion, Levinson and Gutman (1987) found that strains of
plants is greater than was previously thought, with Mor-
Escherichia coli with or without a functional recombina-
gante et al. (2002) having found that the number of micro-
tion system had a similar mutation rate, suggesting that re-
satellites per Mb is about 1844 in Arabidopsis thaliana,
combination is not the predominant mechanism in the
2757 in rice, 2000 in soybean, 1470 in maize and 1796, in
generation of microsatellite variability.
wheat.
When unequal crossing-over occurs, there can be
Until a few years ago, microsatellites were thought to
drastic changes such as the loss or gain of a large number of
be selectively neutral markers and not affected by selective
repeats. This is because when microsatellite repetitive re-
pressures. However, it is now evident that the expansion of
gions are present, a hairpin (the dark region in Figure 1) can
the number of repeats may cause human diseases. For ex-
be formed during synapsis, which means that only parts,
ample, Huntington’s disease is caused by increases in the
usually unequal in length, of each chromosome will be ex-
length of a CAG motif repeat present in the huntingtin pro-
changed and one chromosome will receive a larger frag-
tein gene on human chromosome 4 (Moxon and Wills,
ment because of the larger number of microsatellite repeats
1999), and an increasing number of neurodegenerative dis-
exchanged, the homologues chromosome receiving a
orders have been related to expanded microsatellite repeats,
smaller number of repeats.
mainly in the tri-nucleotide class (Goldstein and Schlot-
During DNA replication or repair, DNA polymerase
terer, 1999; Cummings and Zoghbi, 2000; Everett and
slippage can occur in which one DNA strand temporarily
Wood, 2004). Quite interesting is the fact that micro-
dissociates from the other and rapidly rebinds in a different
satellites are preferentially associated with non-repetitive
position, leading to base-pairing errors and continued leng-
DNA in plant genomes i.e. they frequently occur within and
thening of the new strand and an increase in the number of
near genes (Morgante et al., 2002).
repeats (i.e. additions) in the allele if the error occurs on the
complementary strand or a decreased number of repeats
Genetic Features of Microsatellites (i.e. deletions) if the error occurs on the parent strand (Fig-
An homozygous microsatellite locus has the same ure 2).
number of repeats on both homologous chromosomes, High rates of slippage have been demonstrated but
whereas a heterozygous microsatellite locus has a different these appear to lead to only small changes in the number of
number of repeats for each allele e.g. one allele can contain repeats (Hentschel, 1982; Streisinger and Owen, 1985;
9 repeats and the other 10. However, at the same locus the Schlötterer and Tautz, 1992). Slippage can destabilize
population as a whole usually contains several alleles each microsatellites either because there is no effective repair
296 Microsatellites, a review

lation genetic parameters obtained from microsatellite data.

Mutational models are used to derive the expected number of
alleles in a population from the observed heterozygosity and
also in the statistical analyses of genetic variation, but all
models have some disadvantages when applied to micro-
satellite data. In general, four models can be used.

Infinite alleles (IA) model

In this model, each mutation randomly creates a new
allele. Applying this model to microsatellite loci, mutations
alter the number of repeats. For example, an allele with 10
repeats is considered to be as closely related genetically to
an allele with 15 repeats as to one with 16 repeats, i.e. prox-
imity in terms of the number of repeats does not indicate a
greater phylogenetic relationship. This is Wright’s (1931)
classical model in which he uses F-statistics.

Stepwise mutation (SM) model

When a microsatellite locus mutates, it gains or loses
Figure 1 - Unequal crossing-over between homologous chromosomes.
Black and gray regions correspond to microsatellite repeat sequences. a repeat. This implies that two alleles differing by only one
motif are more related (i.e. share a more recent common an-
cestor) than alleles differing by several repeats. Slatkin
(1995) proposed a genetic differentiation measure (RST)
similar to Wright’s (1951) FST and Nei’s (1973) GST but
based on the SM model.
The SM model is usually preferred when estimating
relations between individuals and population structure, ex-
cept in the presence of homoplasy (i.e. when two alleles are
identical by state but not by descent). Homoplasy may seri-
ously influence population studies involving high mutation
rates and large population sizes together with strong allele
size constraints (Estoup et al., 2002). The model described
by Slatkin (1995) is based on traits with continuous distri-
bution, number of base pairs or number of repeats, and it
groups individuals according to the number of repeats.
Figure 2 - Slippage during DNA replication. Assume that in the original
DNA molecule there were 5 repeats of the motif, symbolized by a box. Two phase (TP) model
Slippage leads to the formation of new alleles with 6 and 4 repeats, de-
pending on the strand containing the polymerase error (Modified from
Di Rienzo et al. (1994) introduced this model as an
Goldsteind and Schlotterer, 1999). extension of the SM model for studies on microsatellites. It
states that most mutational events result in an increase or
decrease of one repeat unit, though infrequent alterations of
system for DNA loops or because of alterations in DNA a large number of repeats also occur.
polymerase or its cofactors that result in increased slippage
rates. Mutations in the genes of the DNA repair system sub- K-alleles (KA) model
stantially increase (up to 700 times) microsatellite instabil-
Crow and Kimura (1970) proposed the KA model in
ity in E. coli (Bichara et al., 2000), yeast (Strand et al.,
1970, which assumes that if there are exactly k possible al-
1993; Sia et al., 1997) and mammal cells (Kolodner and
leles in a given locus then the probability of a given allele
Marsischky, 1999) while mutations affecting the DNA
polymerase correction domain produce less drastic effects mutating into any other is µ/k - 1, where µ is the mutation
(Sia et al., 2000). rate.

Genesis of Microsatellites
Mutation Rates: The Theoretical Models
In yeasts, it seems that no minimum number of re-
An important question to be answered is which theo- peats is required for microsatellites to evolve (Pupko and
retical model should be applied to correctly determine popu- Graur, 1999). Rose and Falush (1998) compared the ex-
Oliveira et al. 297

pected and observed numbers of microsatellites in the yeast While such an association has been found to apply to
genome and found that long repeats are more common than a great number of organisms, a high density of transposable
would be expected by chance and attributed this to slip- elements does not always coincide with a high density of
page. A small number of repeats (fewer than 8 nucleotides, microsatellites (Lin et al., 1999). Therefore, retrotrans-
e.g. 2 tetranucleotides, 4 dinucleotides or 8 mononucleo- position as a generalized mechanism for microsatellite gen-
tides) is less common than would be expected by chance esis remains questionable.
events, which explains the fact that DNA polymerase slip- Ramsay et al. (1999) analyzed microsatellite flanking
page is rare. sequences in hops and showed that a high proportion of
A study on the origin of microsatellites concluded clones were homologous to known transposons. An associ-
that a minimum number of repeats (proto-microsatellite) is ation was found between the repetitive dispersed element
required before DNA polymerase slippage can extend the R173 and the transposons BARE-1, WIS2-1A and PREM1.
number of repeats (Rose and Falush, 1998, Messier et al. The microsatellites found in Ramsey’s study were of two
1996). It has been shown that in species that have primates types, those with single sequences in the flanking region
as their common ancestor (e.g. gorillas, chimpanzees and and those associated with retrotransposons and other repet-
humans) a GA mutation at the η-globin locus changed the itive dispersed elements. Three subtypes compose the sec-
sequence ATGTGTGT to ATGTATGT, thus creating a ond type: a) those positioned at terminal 3’ of the
microsatellite (ATGT)2 which evolved into (ATGT)4 in Af- transposon with a single sequence at the other terminal; b)
rican monkeys and (ATGT)5 in humans (Messier et al. those positioned at terminal 5’; and c) those in which the in-
1996). ternal sequence of the transposon is homologous in both
Zhu et al. (2000) conducted an elegant study on mu- flanking regions.
tated human genes and demonstrated that more than 70% of
all 2 to 4 nucleotide insertions resulted in 2 to 5 new re- Microsatellite Size Distribution in Genomic
peats, most of which are not extensions of pre-existing re- Sequences
peats but new microsatellites originating from random
The number of repeats is a crucial factor determining
sequences. This indicates that the types and processes that
the evolutionary dynamics of microsatellite DNA, and it is
lead to the expansion of microsatellite loci and polymor-
important to investigate which parameters influence the
phism also occur with few repeats.
length of repeats. Taking the simplest model of micro-
In humans, as compared to yeasts, a completely dif- satellite evolution, DNA slippage is a symmetrical process
ferent mechanism for generating microsatellites has been and, consequently, the number of repeats added is on aver-
deduced from the association of microsatellites with retro- age the same as the number removed.
transposons (Nadir et al., 1996). The authors speculated
Kruglyak et al. (1998) proposed a model for the size
that microsatellites rich in A-base were generated by the
distribution of microsatellites in genomic sequences that
extension of terminal 3’ of retrotranscripts, similarly to the
does not assume selection or mutation to be size-related
mRNA polyadenylation mechanism.
processes, infinite growth being prevented by the accumu-
According to Arcot et al. (1995), the Alu SINEs (in- lation of base substitutions at microsatellite loci. An impor-
terspersed nuclear elements) family is largely dispersed in tant aspect of this model is that it assumes a constant base
the primate genome, and is likely to contribute to the gene- substitution rate in which the slippage rate can be deter-
sis of microsatellites due to the presence of adenine-rich re- mined on the basis of the microsatellite length distribution
gions at the 3’ terminal and within the sequence. The in genomic sequences. This means that species with short
association between microsatellites and Alu elements can microsatellites (e.g. Drosophila melanogaster) should have
be explained in terms of three mechanisms: 1) the Alu ele- lower microsatellite mutation rates than species with longer
ment integrates into a pre-existing microsatellite, resulting microsatellites.
in repeats of the microsatellite flanking the element; 2) Alu We can test this theory by comparing the mutation
elements are integrated with mutations that are introduced rates of microsatellites with equal number of repeats. Given
in the primary transcript during reverse transcription, with that microsatellite loci are quite well conserved in different
the mutation acting as a nucleus for microsatellite genesis; species, it is possible to determine whether the number of
and 3) the accumulation of random mutations in the repeats diverges according to species. A comparison of
poly(A) tail of Alu elements, followed by the expansion of microsatellites from chimpanzees and humans showed that
this region by slippage or intra-allelic recombination to human microsatellites contain many more repeats (Amos et
produce microsatellites. Mechanism 1 assumes that micro- al., 1996; Cooper et al., 1998).
satellites are present a priori to the insertion of Alu ele-
ments, whereas mechanisms 2 and 3 are based on indirect
Genome Distribution
evidence suggesting that the internal adenine-rich region
and oligo(dA) 3’ terminal of the Alu elements are sources Microsatellites are not regularly distributed within a
for microsatellite genesis. single genome due to differences in their frequencies
298 Microsatellites, a review

within coding and non-coding sequences (Arcot et al., crease. Moreover, the 5’ UTR region shows a much higher
1995; Wilder and Hollocher, 2001) and the possible func- microsatellite frequency than other genomic fractions, and
tional roles of different repeats (Valle, 1993). The fre- this is due to the presence of di- and tri-nucleotides, princi-
quency of genomic microsatellites also varies per taxon, in pally AG/CT and AAG/CTT repeats. The difference in se-
terms of absolute numbers of microsatellite loci and prefer- lective pressure between the 3’ and 5’ UTR regions is
ential repeats (Hancock, 1999). In plants, the estimated fre- clearly due to the higher frequency of CT and CTT repeats
quency is 0.85% in Arabidopsis and 0.37% in Zea mays in comparison to AG and AAG at the 5’ end as compared to
while in fish it is 3.21% in Tetraodon nigroviridis and the 3’ end.
2.12% in Fugu rubripes (Crollius et al., 2000) and in Homo The contrasting frequency data for different genomes
sapiens chromosome 22 the microsatellite frequency is strongly suggests that microsatellite distribution is not
1.07% whereas in the whole Caernorhabditis elegans ge- merely a reflection of the base composition of the genome
nome it is only 0.21% (Tóth et al., 2000). but that the DNA repair system plays an important role in
According to Morgante et al. (2002), microsatellite determining microsatellite distribution in different species.
frequency differs amongst some plant species i.e. Tóth et al. (2000) reported that the total number of 1
Arabidopsis, maize, soybean, wheat and rice, and is high in to 6 repeat microsatellites varies depending on the taxo-
Arabidopsis and lower in species with comparatively larger nomic group concerned, ranging from 13,889 (approxi-
genomes such as maize and wheat. Morgante et al. (2002) mately 429 per Mb, excluding single-base repeats) in
point out that there is a significant positive linear relation- Rodentia, to 4,139 (154 per Mb) in Embryophyta, 3,004 (99
ship between microsatellite frequencies and the percentage per Mb) in Sacharomyces cerevisiae and 2,139 (88 per Mb)
of single copy DNA, suggesting that microsatellites should in Caernorhabditis elegans. Since 1 Mb corresponds to
be more frequent within single copy DNA than repetitive 2,000 non-overlapped clones with insert sizes of approxi-
DNA. The suggestion that microsatellite frequency is a mately 500 bp, 21.45% positive clones in rodents and 4.4%
function of the relative proportion of single copy DNA in C. elegans would be expected using traditional methods
rather than the size of the genome as a whole is interesting, for isolating microsatellites. However, when specific re-
although this contradicts studies affirming that microsa- peats are focused, the expected frequency of any tri- or
tellites are elements derived from repetitive sequences and tetra-nucleotide repeat is less than 1% of positive clones in
that an increase in microsatellite density is closely-related all taxa. Song et al. (2002) analyzed 4.5 Mb of the wheat
to an increase in genome size (Schlötterer and Harr, 2000). genome and estimated that the occurrence of tri-nucleotides
Due to the high microsatellite mutation rate it is to be with eight or more repeats was 3.0 x 104 for (TAA/ATT)n,
expected that coding regions have a low microsatellite den- 2.3 x 104 for (CTT/GAA)n, 1.2 x 104 for (CAA/GTT)n, 2.3 x
sity because if they do not these regions would be signifi- 103 for (CAT/GTA)n and 1.5 x 103 for (GGA/CCT)n.
cantly altered, possibly leading to loss of functionality. Lin et al. (1999) showed that there was a strong re-
Comparative studies (Tóth et al., 2000) in both coding and duction in the density of di-nucleotide microsatellites
non-coding regions of different species have confirmed this around the centromere of chromosome 2 of A. thaliana.
hypothesis by showing that only tri- and hexa-nucleotides This tendency was also found in Drosophila (Pardue et al.,
are to be found in excessive numbers over a wide range of 1987; Lowenhaupt et al., 1989). Interestingly, the under-
repeat unit sizes. In contrast, other types of repeats were representation of microsatellites in these genomic regions
much less frequent in coding regions than in non-coding re- with a high density of transposons contrasts with the associ-
gions. This means that selection against mutations that ation between microsatellites and the 3’ region of retro-
change the reading frame of a gene restrict the presence of transposons of humans (Nadir et al., 1996). If a causal
microsatellites in coding regions, while microsatellites correlation exists between microsatellite genesis and trans-
with repeats in multiples of three develop evenly in both re- poson insertion, a higher microsatellite density would be
gions (Metzgar et al., 2000). Obviously, this is related to expected in the centromere region.
the fact that RNA bases are read as triplets. Non-random microsatellite distribution can also be
detected on a more refined scale. Microsatellites that tend
The density of perfect and imperfect microsatellites
to form clusters, leading to non-random distribution in se-
in genomic regions and expressed sequence tags (ESTs) of
quences smaller than 15 kb (Bachtrog et al., 1999), being
Arabidopsis thaliana, Oryza sativa, Glycine max, Zea mays
found in D. melanogaster. Similarly, microsatellite cloning
and Triticum aestivum has been assessed by Metzgar et al.
frequently reveals more than one microsatellite sequence in
(2000) and confirmed by Morgante et al. (2002), both of
a clone and also indicates that the microsatellites are orga-
whom showed that different selective pressures seem to be
nized in clusters (Estoup et al., 1999).
acting on 5’ and 3’ untranslated regions (UTRs) and open
reading frames (ORFs) of transcription units. These authors
found that microsatellite frequency at the 3’ UTR region is
Functional Importance of Microsatellites
higher than that expected for the whole genome, with tri- Microsatellites can have either a neutral effect on the
and tetra-nucleotides contributing markedly to this in- genome or perform important functions in particular spe-
Oliveira et al. 299

cies. Some reports indicate that microsatellites are associ- satellite transferability amongst related species is allowed
ated with the regulation and/or functioning of genes, for by the homologous nature of the DNA sequence in micro-
example (CT)n motif microsatellites at the 5’ UTR region satellite flanking regions. However, as expected, the suc-
of certain Arabidopsis genes play a role in anti-sense tran- cessful amplification rate declines as genetic divergence
scription (Kashi and Soller, 1999 and references therein). between species increases (Primmer and Merilä, 2002).
Microsatellites are known to be related to pathogenic- It is worth noting that studies on both humans (Ru-
ity and genomic variability in microorganisms and many binsztein et al.; 1995; Morin et al., 1998) and birds
examples of microsatellites associated with the modulation (Ellegren et al., 1995) have shown that the degree of micro-
of microbial gene expression have been identified (Jackson satellite polymorphism is not transferable, i.e. high levels
et al., 1997; Field and Wills, 1998; Saunders et al., 1998). of polymorphism detected in one species may not be found
For instance, tetra-nucleotide repeats are present within the at the correspondent locus of another species after primers
ORFs in genes coding for Haemophilus influenzae lipo- have been transferred.
polysaccharides, with variation in repeat number influenc- In plants, conserved microsatellite loci have been ob-
ing protein production (Belkum, 1999). Repetitive micro- served across cultivars, subspecies and related species (Mé-
satellite-like sequences have also been found in a number tais et al., 2002). Zucchi et al. (2003) were successful in
of virulence genes in pathogens (Hood et al., 1996). transferring primers originally developed for Eucalyptus
The Adaptive Peaks Theory (Wright, 1931; 1932) and spp. (Brondani et al., 1998) to Eugenia dysenterica, both of
the fact that the frequency of a microsatellite allele repre- which are members of the same family but separated by a
sents a maximum local adaptive value for the population considerable phylogenetic distance. In this case, 3% micro-
suggests that the majority of mutations generating new al- satellite locus amplification was possible but about 30% of
leles result in gene variants of lower local adaptive value. the primers amplified non-specific PCR products, reveal-
A number of authors have suggested another function ing the occurrence of mutational events in the primer-
for microsatellites and show that di-nucleotide repeats can binding region.
act as recombination hot spots (Treco and Arnheim, 1986; Working with birds, Lillandt et al. (2002) were suc-
Wahls et al., 1990; Bailey et al., 1998). This microsatellite cessful in using primers originally developed for 18
function allows populations to recover genetic variation Corvidae species in Perisoreus infaustus, although some
lost through genetic drift and rapidly adjust to evolutionary primers that did not produce good quality amplified prod-
demands (Foster and Trimarchi, 1994; Rosenberg et al., ucts had to be redesigned in order to amplify the original lo-
1994). cus. This supports the hypothesis that transferability is not
There is strong evidence that microsatellites can be overly dependent on phylogenetic proximity. Micro-
found upstream of the promoter region and thus regulate satellite transferability is very advantageous when dealing
the expression of eukaryote genes. For instance, the regula- with birds because there is a low frequency of micro-
tion of several genes depends on the binding of GAGA satellites in avian genomes.
transcription factors to a small segment of the micro-
In felines, 18 primers developed for Panthera tigris
satellite composed of CT repeats present at the first intron
sumatrae showed total transferability to 11 species belong-
promoter of these genes (Biggin and Tjian, 1988; Gilmour
ing to three other feline genera, Felis, Acinonyx and
et al., 1989), GAGA binding appearing to activate tran-
Neofelis was also demonstrated (Williamson et al., 2002).
scription by removing nucleosomes from the promoter or
separating the gene from the position effect (O’Donnell et However, very low levels of transferability have been
al., 1994). reported in the amphibian genera Triturus (Garner et al.,
2003) and Rana (Primmer and Merillä, 2002), possibly due
Microsatellite Transferability to the fact that amphibians have a very large genome, twice
as big as mammals and four times that of birds. These two
Progress in the use of microsatellites has encountered studies not only show that phylogenetic proximity is a pre-
setbacks due to the high cost of developing specific prim- dominant factor in successful transfer but also that transfer-
ers. However, many studies have shown that primer pairs ability is probably affected by other factors such as the size
designed for one species can be used for other species of the and complexity of the genome concerned and whether or
same genus (Isagi and Suhandono, 1997; Cipriani et al., not the microsatellite belongs to a coding region.
1999) or even for different genera of the same family
(White and Powell, 1997; Roa et al., 2000; Zucchi et al., Plant Population Structure: The Genetic Power
2002), this microsatellite attribute being known as transfer-
of Microsatellites
ability or cross-species amplification.
Transferability can be a very important factor in facil- Compared with other classes of markers microsa-
itating the use of microsatellites because it reduces costs tellites are highly polymorphic, because of which they have
when working on taxa with low microsatellite frequencies been used not only to answer several questions related to
or from which microsatellites are difficult to isolate. Micro- plant population genetics, such as gene flow and paternity
300 Microsatellites, a review

analysis (Wright and Bentzen, 1994), but also for the study size and migration rate for sampled populations without
of natural plant populations (Collevatti et al., 1999; Day- precise prior knowledge of mutation rates at each locus.
nandan et al., 1997).
When working with microsatellites and low migra-
Knowledge of the distribution of genetic variability tion rates, the F-statistic is sensitive to the mutation rate
between and within natural plant populations is essential to but, unlike the situation under a strict stepwise mutation
adopt competent strategies for ex situ and in situ germplasm model, under these conditions RST is independent of the mu-
conservation and microsatellites are extremely useful for tation rate and, due to its high associated variance, can be
estimating genetic population parameters as (i) population less accurate at reflecting population differentiation than
structure, (ii) parentage and paternity analysis and (iii) gene FST (Balloux and Lugon-Moulin, 2002). Moreover, RST will
flow, all of which will be discussed in more detail below. be deflated when the mutation pattern includes mutations
involving more than one repeat when the number of possi-
Genetic structure of populations ble allelic states is finite (Slatkin, 1995).
The most efficient measure to assess population The estimation and comparison of both F and R-sta-
structure is based on Wright’s F-statistics (1951), Wright’s tistic is especially relevant for critical comparison and care-
inbreeding coefficient (FST, also called θ) being particularly ful interpretation of data and may give the most valuable
useful for analysing microsatellite markers because it is information about the genetic structure of a population.
able to discriminate between alleles, especially that rare Collevatti et al. (2001) used microsatellite loci to investi-
ones, although FST produced using such markers can some- gate the population genetic structure of the endangered
times be overestimates of the true value. tropical tree Caryocar brasiliense and found that FST was
Microsatellite markers include loci with a large num- significant lower (0.07) than RST (0.29) over all loci. This
ber of alleles, but one question that should be asked is was due to the high and variable mutation rates of micro-
whether a large number of loci or a large number of alleles satellites that usually display high levels of within-po-
is more important in genetic assessment. Working on the pulation heterozygosity. Slatkin (1995) states that statistics
relationship between the allele number and the coefficient such as FST, which are based on an infinite allele model and
of variation of four genetic distances, Kalinowski (2002) consider alleles to be identical by descent, tend to underes-
used simulated data to show that highly polymorphic loci timate population differentiation and produce lower values
provided better estimates of genetic distance than less poly- than their corresponding RST values. In some cases, how-
morphic loci and that increased allele number was associ- ever, no significant differences have been found between
ated with a decrease in the coefficient of variation of each FST and RST values, examples being the assessment of ge-
of the four genetic distances studied. These results show netic structure in populations of Mesoamerican big-leaf
that there is no requirement to examine either highly poly- mahogany (Swietenia macrophylla, Meliaceae) carried out
morphic loci or large numbers of loci, the only requirement by Novick et al. (2003), which produced similar overall FST
being that a sufficient number of alleles is examined. (0.109) and RST (0.177) values, and the study of mahogany
However, the high mutation rate of microsatellites (S. macrophylla) by Lemes et al. (2003) in which the over-
can also invalidate many assumptions used in some con- all values of FST (0.097) and RST (0.147) were again quite
ventional population structure analysis because different close, a further example being the study of Bowen et al.
populations may share homoplasic alleles at frequencies (2005) with loggerhead turtle (Caretta caretta) that again
that depend on both the rate and the details of the mutation produced similar FST (0.002) and RST (< 0.001) values.
process (Estoup et al., 2002). When such effects are ig- Another important point regarding the use of micro-
nored the rate of gene flow or genetic introgression can be satellites for genetic analysis of populations has been raised
overestimated (Balloux et al. 2000). Slatkin (1995) devel- by Petit et al. (2005) who suggested that microsatellite loci
oped the RST statistic (also called , analogous to FST) to take with more repeats generally show higher mutation rates
into account the effects of mutation, but although RST per- (probably because DNA slippage increases in proportion to
forms better than FST in some circumstances it can also be the number of repeats). In addition, if genetic diversity de-
sensitive to details of the mutation process (Balloux and pends on mutation rate and mutation rate itself depends on
Goudet, 2002). the number of repeats subsequently there should be a rela-
Since mutation rate varies widely between loci within tionship between microsatellite genetic diversity and the
species (Di Rienzo et al. 1998) one advantage of loci with a mean number of repeats (MNR). Petit et al. (2005) pro-
high mutation rate is that genetic differentiation reaches posed using allele size and the polymorphism rate of
equilibrium faster, offering the possibility of obtaining esti- chloroplast microsatellite loci to standardize the level of di-
mates from larger and more widely spaced populations. versity when microsatellites differ in size and investigated
Using a microsatellite data set from Mauritian skinks, the relationship between the MNR and genetic variation as
Nichols and Freeman (2004) proposed a method for analyz- a prerequisite to comparative studies of genetic diversity.
ing genetic data to obtain separate estimates of population Their findings suggested that the greater allelic richness
Oliveira et al. 301

found in some species remains significant after controlling eral genomes and are generally used in conjunction with the
for the number of repeats. PCR. The fact that microsatellite studies employ PCR is the
main reason why geneticists in general prefer microsatellite
Parentage and paternity analysis markers as opposed to restriction fragment length polymor-
Plant paternity analysis and gene flow studies have phic (RFLP) markers, which although codominant are not
often employed microsatellite markers because unlike PCR-based. In general, only 30-40 microsatellite loci are
allozyme loci, which do not have sufficient variability to needed to provide a satisfactory estimate of relationship
determine parentage by exclusion (Chakraborty et al., (Blouin, 2003).
1988), each microsatellite locus has many relatively rare al- The reason why it is best to use codominant markers
leles and in most case an individual can be excluded from to estimate relationship coefficients is the need to discrimi-
paternity using only a few loci (Dow and Ashley, 1996; nate between alleles since, in heterozygous diploids, once
Dow et al. 1995). we know two alleles at a specific locus it is possible to cal-
Chase et al. (1996) used four microsatellite loci and culate its complete allelic and genotypic composition. Such
six allozyme loci to estimate paternity exclusion in considerations indicate that microsatellite markers are the
Pithecellobium (Mimosoideae) and found that not only most informative marker for calculating relationship coef-
were microsatellite loci powerful tools for the analysis of ficients. Several papers discussing how relationship coeffi-
population structures but also provide a means for accu- cients can be produced using molecular markers have been
rately examining both gene flow and paternity, two impor- published (Queller and Goodnight, 1989; Li et al., 1993;
tant parameters in conservation biology. Lynch and Ritland, 1999; Wang, 2002), all of which have
Concerning relationship coefficients, a problem arose concluded that a large number of markers and individuals
when the term coefficient de parenté (proposed by Malécot, must be used and that this is particularly important when
1948) was translated as coefficient of relationship (f) that maximum likelihood estimators are employed (Ritland,
had already been used by Wright (1922). Thus coefficient 1996). A good example of the use of a large number of
de parenté is variously known as kinship (Malécot, 1948), microsatellite markers is the study of Bowers et al. (1999)
parentage (Kempthorne, 1957) and coancestry (Falconer, who used 32 microsatellites loci to detect the relationships
1960). between 300 grape cultivars, the results showing that most
Kinship is usually calculated either by genetic meth- cultivars originated from only a single pair of Pinot and
ods, which employ molecular markers to estimate related- Gouais blanc parents that were widespread in northeastern
ness based on a quantitative measure of kinship or by France during the middle ages.
genealogical methods that employ qualitative pedigree data Another important point is that the markers used for
based on relationships such as full sibs, half sibs, father and calculating relationships must be independent because if
son, etc. they are not the precision of the estimates will be low
Bernardo et al. (1996) used relationship coefficients (Thompson and Meagher, 1998), this is the reason why all
to construct a mean genetic relation matrix for use with a relationship models need to incorporate data from inde-
best linear unbiased prediction (BLUP) model to calculate pendent loci. Since microsatellites are able to distinguish
combination capabilities and additive and dominant genetic between alleles, they are the most powerful molecular tool
values. Using this methodology it is possible to select geno- for relationship analyses such as paternity testing that re-
types controlling the relationship level (an inverse measure quire a high level of precision. This type of analysis has a
associated with the effective population size; Souza and fundamental role in plant genetics, because it can provide
Sorrels, 1989) and to specify the minimum genetic distance the information necessary to detect the parent of a specific
for varietal protection (Hunter, 1989) in light of the fact that individual in a population. To exclude a random individual
when a population is submitted to strong selection variabil- from paternity, paternity analysis uses exclusion-proba-
ity can be lost. bility techniques (Weir, 1996) which depend on the allele
Molecular markers were not widely available until frequencies for that locus but not on the genotypes.
the 1980s, before which relationship coefficients were esti- Due to its forensic importance, much paternity testing
mated using pedigree data but this type of data suffers from research has been carried out on humans but is equally ap-
the disadvantage that it requires large amounts of historical plicable to plants. In human paternity testing, the condi-
information that is rare for plants and generally unavailable tional probability that a specific man is not the father given
for natural populations. the joint probabilities of mother-child combinations is
Allozymes are not the best markers for estimation re- given by the following equation:
lationship because of their restricted ability for sampling 1
the genome as a whole, the most effective marker for this Q = å Pu (1- Pu ) 2 - å å PU2 PV2 ( 4 - 3PU - 3PV )
u 2 U V ¹U
type of estimation being microsatellites as they are codo-
minant and hypervariable (and therefore able to distinguish where P is the allelic frequency, U is the u-th allele and V
between closely-related individuals), are abundant in sev- the v-th allele and Q is the overall probability of exclusion.
302 Microsatellites, a review

It is easy to understand that as more alleles are identified the Wright’s infinite-alleles model (see Slatkin, 1995), which
importance of a particular locus increases, analogous to the assumes migration-drift equilibrium among all popula-
increase in exclusion probabilities as the number of loci tions. Estimates of gene flow based on the analysis of ge-
used is increased. When several independent loci are in- netic structure of populations can be obtained using the FST
volved and Ql is the exclusion probability for locus l the statistic. Gene flow estimated by this method is known as
overall probability of exclusion (Q) is given by Weir (1996) apparent gene flow because it assumes that the genetic
as: structure of the population fits an island model in which
there is equilibrium between migration and genetic drift.
Q = 1- Õ (1- Ql ) Under this assumption FST is a function of the number of
l
As recommended by the Combined DNA Index Sys- migrants per generation, Nm, where N is the population
tem (CODIS), human paternity tests use 13 microsatellite size and m is the proportion of migrants per generation,
loci to give a Q value of 1 x 10-4 (Chakraborty et al., 1999) the relationship between FST and Nm being:
but if less loci are used then the Q value will be higher (i.e. 1æ 1 ö
more towards 1, indicating a lower value of exclusion), Nm = çç - 1÷÷
4 è FST ø
with, for example, two microsatellite loci with 10 alleles of
equal frequency will give a Q value of 0.96. Estimated Nm values for tropical species are gener-
Gene flow ally higher than 1.0 (Ciampi, 1999; Lemes et al., 2003),
with Wright (1951) stating that when Nm is higher than 1.0
As pointed out by Avise (1994), loss of genetic vari- or when there is one or more individual migrant per genera-
ability is the central topic in conservation genetics because tion the effect of migration is sufficient to oppose the drift
small populations (especially of allogamous species) oc- effect. This simple method for estimating gene flow has
curring in fragmented areas can suffer from inbreeding de- been used widely in conservation studies.The estimated
pression leading to the loss of heterozygosity, genetic gene flow based on FST for some tropical species is given in
diversity and adaptivity. Table 1 where it can be seen that the values ranged from
Gene flow is fundamental for the maintenance of 0.75 to 5, although special care should be taken in interpret-
metapopulations because it allows genetic diversity to be ing these estimates because, as previously stated, gene flow
maintained by acting directly on the population structure estimates based on FST may not be reliable. However, it is
and against random genetic drift. Thus gene flow results in interesting to note that E. dysenterica population showed
homogenization of allelic frequencies and exactly the op- the lowest gene flow (Nm = 0.75 migrants per generation)
posite effect to genetic drift which tends to make popula- and it is probably in serious risk, while for C. langsdorf the
tions genetically more heterogeneous. Gene flow can be situation is less drastic because the estimated flow of mi-
quantified indirectly using FST estimates, the number of pri- grants was 5 per generation.
vate alleles, space autocorrelation and coalescence or di- Gaggiotti et al. (1999) conducted simulation studies
rectly using morphological markers and paternity analysis. in which they compared two procedures for estimating
In plants, paternity analysis is the most widely-used method gene flow (Nm) based on microsatellite data. These authors
for estimating direct gene flow and by analyzing several compared Nm values obtained using Wright’s FST statistic
loci estimates can be made of the probability of an individ- which is defined on the basis of the variance of gene fre-
ual plant being the most probable male parent of a specific quencies with RST values (Slatkin, 1995) which is estimate
offspring among all possible male plants in a particular from the variance of the length of the allele, the underlying
population. Once the male parent is identified, the pattern genetic model assuming stepwise mutations and constraints
of pollen movement can be determined, although the appli- in the range of allelic size classes. The results of these simu-
cability of this methodology is limited to small populations. lations suggested that the use of microsatellite loci can lead
In population genetics, the most usual procedure used to serious overestimation of Nm especially when popula-
to quantify gene flow between populations is based on tion sizes are large (N > 5,000) and the range of constraints

Table 1 - Microsatellite FST, RST and gene flow estimates calculated for populations of some tropical species. Note that NmA was based on FST while NmB
was calculated from RST.

Species FST NmA RST NmB Reference

Swietenia macrophylla 0.097 2.327 0.147 1.450 Lemes et al. (2003)
Caryocar brasilliense 0.070 3.572 0.290 0.612 Collevatti et al. (2001)
Copaifera langsdorfi 0.050 5.00 0.031 7.810 Ciampi (1999)
Anopheles arabiensis 0.069 3.372 0.025 9.750 Donnelly et al. (2004)
Eugenia dysenterica 0.250 0.750 0.267 0.687 Zucchi et al. (2003)
Oliveira et al. 303

are high. For large population sample sizes (ns = 50) when The authors would like to thank Ricardo V. Cesar for
many microsatellite loci (nl = 20) were present RST per- his kind contribution in the proofreading of this review.
formed better than FST while when sample sizes were mod-
erate or small (ns = 10) and the number of loci was low References
(nl = 20) FST performed better than RST in estimating Nm.
Amos W, Sawcer SJ, Feakes RW and Rubinsztein DC (1996)
These results highlight the fact that when micro- Microsatellites show mutational bias and heterozygote in-
satellites are used in interpopulation diversity and gene stability. Nature Genetics 13:390-391.
flow studies of natural populations there is no standard bio- Arcot SS, Wang Z, Weber JL, Deininger L and Batzer MA (1995)
metric estimation procedure adequate for all situations and Alu repeats: A source for the genesis of primate micro-
procedures should be chosen according the characteristics satellites. Genomics 29:136-144.
Avise J (1994) Molecular Markers, Natural History and Evolu-
of the data.
tion. Chapman & Hall, New York, 511 pp.
Bachtrog D, Weiss S, Zangerl B, Brem G and Schlötterer C (1999)
Effective population size Distribution of dinucleotide microsatellites in the
Gene diversity or expected heterozygosis (h) (Weir, Drosophila melanogaster genome. Molecular Biology and
Evolution 16:602-610.
1996) is an important parameter in studies on the genetic
Bailey AD, Pavelitz T and Weiner AM (1998) The microsatellite
structure of populations. At an intrapopulation level h is sequence (CT)n x (GA)n promotes stable chromosomal inte-
defined on a locus basis as being h = 1- å p u2 , where pu is gration of large tandem arrays of functional human U2 small
the frequency of the uth allele at that locus. For estimation, nuclear RNA genes. Molecular and Cell Biology 18:2226-
an average value is generally obtained. It can be shown 2271.
that the expression cited above can also be written as Balloux F and Goudet J (2002) Statistical properties of population
h = 1- 1/ m - ms 2p , for a locus with m alleles where s 2p is differentiation estimators under stepwise mutation in a finite
the variance of the allelic frequencies of the locus. The h island model. Molecular Ecology 11:771-783.
parameter is therefore higher for loci with many alleles Balloux F and Lugon-Moulin N (2002) The estimation of popula-
and for which s 2p is small. A favorable aspect for studying tion differentiation with microsatellite markers. Molecular
Ecology 11:155-165.
the molecular diversity of populations is provided when
Balloux F, Lugon-Moulin N and Hausser J (2000) Estimating
microsatellite markers are used because a large number of gene flow across hybrid zones: How reliable are microsa-
alleles is generally detected. For example, the potential tellites? Acta Theriologica 45:93-101.
range of h for a locus with three alleles, is 0 to 0.67 and for Belkum A Van (1999) Short sequence repeats in microbial patho-
a locus with 10 alleles is 0 to 0.9 and consequently there is genesis and evolution. Cellular and Molecular Life Sciences
greater sensitivity in detecting diversity when 56:729-734.
microsatellite markers are used in comparison to other Bernardo R, Murigneux A and Karaman Z (1996) Marker-based
markers. This favorable aspect is also observed when pop- estimates of identity by descent and alikeness in state among
ulations are subdivided and total diversity is split into maize inbreds. Theoretical and Applied Genetics 93:262-
components between and within subpopulations, as pro- 267.
Bichara M, Pinet I, Schumacher S and Fuchs R (2000) Mecha-
posed by Nei (1973).
nisms of dinucleotide repeat instability in Escherichia coli.
In investigations involving several natural subpopu- Genetics 154:533-542.
lations belonging to a metapopulation, the use of micro- Biggin MD and Tjian R (1988) Transcription factors that activate
satellite markers results in a considerably higher number of the ultrabithorax promoter in developmentally staged ex-
exclusive or private alleles, which is very important for es- tracts. Cell 53:699-711.
timating the degree of isolation of the subpopulations. Blouin MS (2003) DNA-based methods for pedigree reconstruc-
However, when dealing with parameters such as the effec- tion and kinship analysis in natural populations. Trends in
Ecology and Evolution 18:503-511.
tive populations size (Ne) that are used for measuring the
Bowers J, Boursiquot JM, This P, Chu K, Johansson H and
drift of gene frequencies due to sampling occurred preced-
Meredith C (1999) Historical genetics: The parentage of
ing generations it is questionable if microsatellite markers Chardonnay, Gamay, and other wine grapes of northeastern
are adequate. In this case Vencovsky and Crossa (2003) France. Science 285:1562-1565.
have shown that Wright’s F statistics (e.g. FST and FIT) are Bowen BW, Bass AL, Soares L and Toonen RJ (2005) Conserva-
fundamental for estimating the effective populations size of tion implications of complex population structure: Lessons
samples. A random model is required because interpopu- from the loggerhead turtle (Caretta caretta). Molecular Eco-
lation diversity in a given generation is a consequence of logy 14:2389-2402.
drift alone, when microsatellite mutation rates are high a Brondani RV, Brondani C, Tarchini R and Grattapaglia D (1998)
random model is no longer applicable and estimates will be Development, characterization and mapping of micro-
satellite markers in Eucalyptus grandis and E. urophylla.
biased.
Theoretical and Applied Genetics 97:816-827.
Chakraborty R, Meagher TR and Smouse PE (1988) Parentage
Acknowledgments analysis with genetic-markers in natural-populations. 1. The
304 Microsatellites, a review

expected proportion of offspring with unambiguous pater- sity in the recently separated sibling species of the Anophe-
nity. Genetics 118:527-536. les gambiae complex. Heredity 92:61-68.
Chakraborty R, Stivers DN, Su B, Zhong YX and Budowle B Dow BD, Ashley MV and Howe HF (1995) Isolation and charac-
(1999) The utility of short tandem repeat loci beyond human terization of highly variable (GA/CT)n microsatellites in the
identification: Implications for development of new DNA bur oak, Quercus macrocarpa. Theoretical and Applied Ge-
typing systems. Electrophoresis 20:1682-1696. netics 91:137-141.
Ciampi AY (1999) Desenvolvimento e utilização de marcadores Dow BD and Ashley MV (1996). Microsatellite analysis of seed
microsatélites, AFLP e seqüenciamento de cpDNA, no estu- dispersal and sapling parentage in bur oak, Quercus macro-
do da estrutura genética e parentesco em populações de carpa. Molecular Ecology 5:615-627.
copaíba (Copaifera langsdorffii) em matas de galeria no Ellegren H, Primmer CR and Sheldon B (1995) Microsatellite
cerrado. PhD Thesis, Universidade Estadual Paulista ‘Júlio evolution: Directionality or bias in locus selection? Nature
de Mesquita Filho’, Botucatu, 204 pp. Genetics 11:60-62.
Cipriani G, Lot G, Huang WG, Matarazzo MT, Peterlunger E and Estoup A, Cornuet JM, Rousset F and Guyomard R (1999) Juxta-
Testolin R (1999) AC/GT and AG/CT microsatellite repeats posed microsatellite systems as diagnostic markers for
in peach [Prunus persica (L) Batsch]: Isolation, characteri- admixture: Theoretical aspects. Molecular Biology and
sation and cross species amplification in Prunus. Theoreti- Evolution 16:898-908.
cal and Applied Genetics 99:65-72. Estoup A, Jarne P and Cornuet JM (2002) Homoplasy and muta-
Collevatti RG, Brondani RV and Grattapaglia D (1999) Develop- tion model at microsatellite loci and their consequences for
ment and characterization of microsatellite markers for ge- population genetics analysis. Molecular Ecology 11:1591-
netic analysis of a Brazilian endangered tree species 1604.
Caryocar brasiliense. Heredity 83:748-756. Everett CM and Wood NW (2004) Trinucleotide repeats and
Collevatti RG, Grattapaglia D and Hay JD (2001) Population ge- neurodegenerative disease. Brain 127:2385-2405.
netic structure of the endangered tropical tree species Falconer DS (1960) Introduction to Quantitative Genetics. The
Caryocar brasiliense, based on variability at microsatellite Ronald Press, New York, 365 pp.
loci. Molecular Ecology 10:349-356. Field D and Wills C (1998) Long polymorphic microsatellites in
Cooper G, Rubinsztein DC and Amos W (1998) Ascertainment simple organisms. Proceeding of the Royal Society of Lon-
bias cannot entirely account for human microsatellites being don, Series B: Biological Sciences 263:209-215.
longer than their chimpanzee homologues. Human Molecu- Foster L and Trimarchi JM (1994) Adaptive reversion of a
lar Genetics 7:1425-1429. frameshift mutation in Escherichia coli by simple base dele-
Cregan B, Mudge J, Fickus EW, Marek LF, Danesh D, Denny R, tions in homopolymeric runs. Science 265:407-409.
Shoemaker RC, Matthews BF, Jarvik T and Young ND Gaggiotti OE, Lange O, Rassmann K and Gliddon C (1999) A
(1999) Targeted isolation of simple sequence repeat markers comparison of two indirect methods for estimating average
through the use of bacterial artificial chromosomes. Theo- levels of gene flow using microsatellite data. Molecular
retical and Applied Genetics 98:919-928. Ecology 8:1513-1520.
Crollius HR, Jaillon O, Dasilva C, Ozouf Costaz C, Fizames C, Garner TWJ, Angelone S and Pearman B (2003) Genetic deple-
Fischer C, Bouneau L, Billault A, Quetier F, Saurin W, tion in Swiss populations of Rana latastei: Conservation im-
Bernot A and Weissenbach J (2000) Characterization and plications. Biological Conservation 114:371-376.
repeat analysis of the compact genome of the freshwater Gilmour DS, Thomas GH and Elgin SC (1989) Drosophila nu-
pufferfish Tetraodon nigroviridis. Genome Research clear proteins bind to regions of alternating C and T residues
10:939-949. in gene promoters. Science 245:1487-1490.
Crow J and Kimura M (1970) An Introduction to Population Ge- Goldstein DB and Schlotterer C (1999) Microsatellites: Evolution
netics Theory. Burgess Publishing Company, Minneapolis, and Applications. Oxford University Press, New York,
591 pp. 343 pp.
Cummings CJ and Zoghbi HY (2000) Trinucleotide repeats: Me- Hancock JM (1999) Microsatellites and other simple sequences:
chanisms and pathophysiology. Annual Review of Geno- Genomic context and mutational mechanisms. In: Goldstein
mics and Human Genetics 1:281-328. DB and Schlötterer C (eds) Microsatellites: Evolution and
Dayanandan S, Bawa KS and Kesseli R (1997) Conservation of Applications. Oxford University Press, New York, p 1-9.
microsatellites among tropical tree (Leguminosae). Ameri- Hedrick W (2001) Conservation genetics: Where are we now?
can Journal of Botany 84:1658-1663. Trends in Ecology and Evolution 16:629-636.
Di Rienzo A, Donnelly P, Toomajian C, Sisk B, Hill A, Petzl-Erle Hentschel CC (1982) Homocopolymer sequences in the spacer of
ML, Haines GH and Barch DH (1998) Heterogeneity of a sea urchin histone gene repeat are sensitive to S1 nuclease.
microsatellite mutations within and between loci, and impli- Nature 295:714-716.
cations for human demographic histories. Genetics Heywood VH and Iriondo JM (2003) Plant conservation: Old
148:1269-1284. problems, new perspectives. Biological Conservation
Di Rienzo A, Peterson AC, Garza JC, Valdes AM, Slatkin M and 113:321-335.
Freimer NB (1994) Mutational processes of simple se- Hood DW, Deadman ME, Jennings M, Bisercic M, Fleischmann
quence repeat loci in human populations. Proceeding of Na- RD, Venter JC and Moxon ER (1996) DNA repeats identify
tional Academy of Sciences 91:3166-3170. novel virulence genes in Haemophilus influenzae. Proceed-
Donnelly MJ, Pinto J, Girod R, Besansky NJ and Lehmann T ings of the National Academy of Sciences 93:11121-11125.
(2004) Revisiting the role of introgression vs. shared ances- Hunter BR (1989) ASTA approach on minimum distance. In:
tral polymorphisms as key processes shaping genetic diver- Wilkinson D (ed) Proceedings Annual Corn and Sorghum
Oliveira et al. 305

Industry Research Conference, 44:193-195. American Seed peat in the 38 untranslated region of the gene. Science
Trade Association, Washington. 255:1253-1258.
Isagi Y and Suhandono S (1997) PCR primers amplifying micro- Malécot G (1948) Les Mathematiques de L’Herédité. Masson,
satellite loci of Quercus myrsinifolia Blume and their con- Paris, 63 pp.
servation between oak species. Molecular Ecology Messier W, Li SH and Stewart CB (1996) The birth of micro-
6:897-899. satellites. Nature 381:483.
Jackson PJ, Walthers EA, Kalif AS, Richmond KL, Adair DM, Métais I, Hamon B, Jalouzot R and Peltier D (2002) Structure and
Hill KK, Kuske CR, Andersen GL, Wilson KH, Hughjones level of genetic diversity in various bean types evidenced
ME and Keim P (1997) Characterization of the variable with microsatellite markers isolated from a genomic en-
number tandem repeats in VITA from different Bacillus riched library. Theoretical and Applied Genetics 104:1346-
anthracis isolates. Applied Environment Microbiology 1352.
63:1400-1405. Metzgar M, Bytof J and Wills C (2000) Selection against
Jarne P and Lagoda PJL (1996) Microsatellites, from molecules to frameshift mutations limits microsatellite expansion in cod-
populations and back. Trends in Ecology and Evolution ing DNA. Genome Research 10:72-80.
11:424-429. Morgante M, Hanafey M and Powell W (2002) Microsatellites are
Kalinowski ST (2002) How many alleles per locus should be used preferentially associated with nonrepetitive DNA in plant
to estimate genetic distances? Heredity 88:62-65. genomes. Nature Genetics 30:194-200.
Kashi Y and Soller M (1999) Functional roles of microsatellites Morin PA, Mahboubi P, Wedel S and Rogers J (1998) Rapid
and minisatellites. In: Goldstein DB and Schlötterer C (eds) screening and comparison of human microsatellite markers
Microsatellites: Evolution and Applications. Oxford Uni- in baboons: Allele size is conserved, but allele number is
versity Press, New York, pp 10-23. not. Genomics 53:12-20.
Kempthorne O (1957) An Introduction to Genetic Statistics. Wil- Moxon R and Willis C (1999) DNA microsatellites: Agents of
ley, New York, 545 pp. evolution? Scientific American 280:94-99.
Nadir E, Margalit H, Gallily T and Bensasson SA (1996) Micro-
Knapik EW, Goodman A, Ekker M, Chevrette M, Delgado J,
satellite spreading in the human genome: Evolutionary
Neuhauss S, Shimoda N, Driever W, Fishman MC and Jacob
mechanisms and structural implications. Proceedings of the
HJ (1998) A microsatellite genetic linkage map for zebrafish
National Academy of Sciences 93:6470-6475.
(Danio rerio). Nature Genetics 18:338-343.
Nei, M (1973) Analysis of genetic diversity in subdivided popula-
Kolodner RD and Marsischky GT (1999) Eukaryotic DNA mis-
tions. Proceedings of the National Academy of Sciences
match repair. Current Opinion Genetics 9:89-96.
70:3321-3323.
Kruglyak S, Durret RT, Schug M and Aquadro CF (1998) Equilib- Nichols RA and Freeman KLN (2004) Using molecular markers
rium distributions of microsatellite repeat length resulting with high mutation rates to obtain estimates of relative popu-
from a balance between slippage events and point mutations. lation size and to distinguish the effects of gene flow and
Proceeding of National Academy of Sciences 95:10774- mutation: A demonstration using data from endemic Mauri-
10778. tian skinks. Molecular Ecology 13:775-787.
Lemes MR, Gribel R, Proctor J and Grattapaglia D (2003) Popula- Novick RR, Dick CW, Lemes MR, Navarro C, Caccone A and
tion genetic structure of mahogany (Swietenia macrophylla Bermingham E (2003) Genetic structure of Mesoamerican
King, Meliaceae) across the Brazilian Amazon, based on populations of big-leaf mahogany (Swietenia macrophylla)
variation at microsatellite loci: Implications for conserva- inferred from microsatellite analysis. Molecular Ecology
tion. Molecular Ecology 12:2875-2883. 12:2885-2893.
Levinson G and Gutman GA (1987) Slippedstrand mispairing: A O’Donnell KH, Chen CT and Wensink C (1994) Insulating DNA
major mechanism for DNA sequence evolution. Molecular directs ubiquitous transcription of the Drosophila
and Biology Evolution 4:203-221. melanogaster alpha1 tubulin gene. Molecular and Cell Biol-
Lin X, Kaul S, Rounsley S, Shea T, Benito MI, Town CD, Fujii ogy 14:6398-6408.
CY, Mason T, Bowman CL, Barnstead M, Feldblyum TV, O’Donnell WT and Warren ST (2002) A decade of molecular
Buell CR, Ketchum KA, Lee J, Ronning CM, Koo HL, Mof- studies of fragile X syndrome. Neurosciences 25:315-338.
fat KS, Cronin LA, Shen M, Pai G, Van Aken S, Umayam L, Pardue ML, Lowenhaupt K, Rich A and Nordheim A (1987)
Tallon LJ, Gill JE and Venter JC (1999) Sequence and anal- (dCdA)n(dGdT)n sequences have evolutionarily conserved
ysis of chromosome 2 of the plant Arabidopsis thaliana. Na- chromosomal locations in Drosophila with implications for
ture 402:761-768. roles in chromosome structure and function. Embo Journal
Lowenhaupt K, Rich A and Pardue ML (1989) Nonrandom distri- 6:1781-1789.
bution of long mono and dinucleotide repeats in Drosophila Petit RJ, Deguilloux MF, Chat J, Grivet D, Garnier-Géré P and
chromosomes: Correlations with dosage compensation, Vendramin GG (2005) Standardizing for microsatellite
heterochromatin, and recombination. Molecular and Cell length in comparisons of genetic diversity. Molecular Ecol-
Biology 9:1173-1182. ogy 14:885-890.
Lynch M and Ritland K (1999) Estimation of pairwise relatedness Pinto LR, Vieira MLC, Souza Jr CL and Souza AP (2003a) Recip-
with molecular markers. Genetics 152:1753-1766. rocal recurrent selection effects on the genetic structure of
Mahadevan M, Tsilfidis C, Sabourin L, Shutler G, Amemiya C, tropical maize populations assessed at microsatellite loci.
Jansen G, Neville C, Narang M, Barcelo J, O’Hoy K, Le- Genetics and Molecular Biology 26:355-364.
blond S, Earle Macdonald J, De Jong J and Wieringa B Pinto LR, Vieira, MLC, Souza Jr CL and Souza AP (2003b) Ge-
(1992) Myotonic dystrophy mutation: An unstable CTG re- netic-diversity assessed by microsatellites in tropical maize
306 Microsatellites, a review

populations submitted to a high-intensity reciprocal recur- Souza E and Sorrells ME (1989) Pedigree analysis of north-
rent selection. Euphytica 134:277-286. american oat cultivars released from 1951 to 1985. Crop Sci-
Primmer CR and Merilä J (2000) A low rate of cross-species ence 29:595-601.
microsatellite amplification success in Ranid frogs. Conser- Stallings RL (1994) Distribution of trinucleotide microsatellites
vation Genetics 3:445-449. in different categories of mammalian genomic sequence:
Pupko T and Graur D (1999) Evolution of microsatellites in the Implication for human genetic diseases. Genomics 21:116-
yeast Saccharomyces cerevisiae: Role of length and number 121.
of repeated units. Journal of Molecular Evolution 48:313- Steinkellner H, Lexer C, Turetschek E and Glossl J (1997) Con-
316. servation of (GA)(n) microsatellite loci between Quercus
Queller DC and Goodnight KF (1989) Estimation of genetic relat- species. Molecular Ecology 6:1189-1194.
edness using allozyme data. Evolution 43:258-275. Strand M, Prolla TA, Liskay RM and Petes TD (1993) Desta-
Ramsay L, Macaulay M, Cardle L, Morgante M, Ivanissevich SD, bilization of tracts of simple repetitive DNA in yeast by mu-
Maestri E, Powell W and Waugh R (1999) Intimate associa- tations affecting DNA mismatch repair. Nature
tion of microsatellite repeats with retrotransposons and other 365:274-276.
dispersed repetitive elements in barley. The Plant Journal Streisinger G and Owen JE (1985) Mechanisms of spontaneous
17:415-425. and induced frameshift mutation in bacteriophage T4. Ge-
Ritland K (1996) Estimators for pairwise relatedness and individ- netics 109:633-659.
ual inbreeding coefficients. Genetical Research 67:175-185. Thompson EA and Meagher TR (1998) Genetic linkage in the es-
timation of pairwise relationship. Theoretical and Applied
Roa AC, Chavarriaga-Aguirre P, Duque MC, Maya MM, Bonier-
Genetics 97:857-864.
bale MW, Iglesias C and Tohme J (2000) Cross species am-
plification of cassava (Manihot esculenta) (Euphorbiaceae) Tóth G, Gáspari Z and Jurka J (2000) Microsatellites in different
microsatellites: Allelic polymorphism and degree of rela- eukaryotic genomes: Survey and analysis. Genome Re-
tionship American Journal of Botany 87:1647-1655. search 10:967-981.
Rose O and Falush D (1998) A threshold size for microsatellite Treco D and Arnheim N (1986) The evolutionarily conserved re-
expansion. Molecular Biology and Evolution 15:613-615. petitive sequence d(TG.AC)n promotes reciprocal exchange
and generates unusual recombinant tetrads during yeast mei-
Rosenberg SM, Longerich S, Gee P and Harris RS (1994) Adap-
osis. Molecular and Cell Biology 6:3934-3947.
tive mutation by deletions in small mononucleotide repeats.
Vencovsky R and Crossa J (2003) Measurements of representa-
Science 265:405-407.
tiveness used in genetic resources conservation and plant
Rubinsztein DC, Amos W, Leggo J, Goodburn S, Jain S, Li SH, breeding. Crop Science 43:1912-1921.
Margolis RL, Ross CA and Fergusonsmith MA (1995)
Wahls W, Wallace LJ and Moore D (1990) The Z-DNA motif
Microsatellite evolution - Evidence for directionality and
d(TG)30 promotes reception of information during gene
variation in rate between species. Nature Genetics 10:337-
conversion events while stimulating homologous recombi-
343.
nation in human cells in culture. Molecular and Cell Biology
Saunders NJ, Peden JF, Hood DW and Moxon ER (1998) Simple 10:785-793.
sequence repeats in the Helicobacter pylori genome. Molec-
Weir BS (1996) Genetic Data Analysis II. Sinauer, Sunderland,
ular Microbiology 27:1091-1098.
445 pp.
Schlötterer C (2000) Evolutionary dynamics of microsatellite White G and Powell W (1997) Isolation and characterization of
DNA. Chromossoma 109:365-371. microsatellite loci in Swietenia humilis (Meliaceae): An en-
Schlötterer C, Amos B and Tautz D (1991) Conservation of poly- dangered tropical hardwood species. Molecular Ecology
morphic simple sequence loci in cetacean species. Nature 6:851-860.
354:63-65. Wilder J and Hollocher H (2001) Mobile elements and the genesis
Schlotterer C and Harr B (2000) Drosophila virilis has long and of microsatellites in dipterans. Molecular Biology and Evo-
highly polymorphic microsatellites. Molecular Biology and lution 18:384-392.
Evolution 17:1641-1646. Williamson JE, Huebinger RM, Sommer JA, Louis EE and Barber
Schlötterer C and Tautz D (1992) Slippage synthesis of simple se- RC (2002) Development and cross species amplification of
quence DNA. Nucleic Acids Research 20:211-215. 18 microsatellite markers in the Sumatran tiger (Panthera
Sia EA, Kokoska RJ, Dominska M, Greenwell P and Petes TD tigris sumatrae). Molecular Ecology Notes 2:110-112.
(1997) Microsatellite instability in yeast: Dependence on re- Wright S (1922) Coefficients of inbreeding and relationship.
peat unit size and DNA mismatch repair genes. Molecular American Naturalist 56:330-338.
and Cellular Biology 17:2851-2858. Wright S (1931) Evolution in Mendelian populations. Genetics
Sia EA, Butler CA, Dominska M, Greenwell P, Fox TD, and Petes 16:97-159.
TD (2000). Analysis of microsatellite mutations in the mito- Wright S (1932) The roles of mutation, inbreeding, crossbreeding,
chondrial DNA of Saccharomyces cerevisiae. Proceedings and selection in evolution. Proceedings of the Sixth Interna-
of the National Academy of Sciences 97:250-255. tional Congress on Genetics 1:356-366.
Slatkin M (1995) A measure of population subdivision based on Wright S (1951) The genetical structure of populations. Annual
microsatellite allele frequencies. Genetics 139:457-462. Eugenics 15:323-354.
Song QJ, Fickus EW and Cregan PB (2002) Characterization of Wright JM and Bentzen P (1994) Microsatellites: Genetic mark-
trinucleotide SSR motifs in wheat. Theoretical and Applied ers of the future. Reviews in Fish Biology and Fisheries
Genetics 104:286-293. 4:384-388.
Oliveira et al. 307

Zhu Y, Strassmann JE and Queller DC (2000) Insertions, substitu- from Eucalyptus spp. to Eugenia dysenterica (Myrtaceae
tions, and the origin of microsatellites. Genetics Research family). Molecular Ecology Notes 2:512-514.
76:227-236. Zucchi MI, Brondani RV, Pinheiro, JB, Coelho ASG, Chaves LJ
Zucchi MI, Brondani RV, Pinheiro JB, Brondani C and Ven- and Vencovsky R (2003) Genetic structure and gene flow in
covsky R (2002) Transferability of microsatellite markers Eugenia dysenterica DC in the Brazilian cerrado utilizing
SSR markers. Genetics and Molecular Biology 26:449-458.

Associate Editor: Everaldo Gonçalves de Barros