Scribd Logo
Upload

Welcome to Scribd!

  • 185 views

    Triplet Code1

    Uploaded by

    api-247243068

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd

    Triplet Code1

    Uploaded by

    api-247243068
    185 views21 pages

    Original Title

    triplet code1

    Copyright

    © Attribution Non-Commercial (BY-NC)

    Available Formats

    PPT, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    185 views21 pages

    Triplet Code1

    Uploaded by

    api-247243068

    Copyright:

    Attribution Non-Commercial (BY-NC)
    Download as PPT, PDF, TXT or read online from Scribd
    Download as ppt, pdf, or txt
    of 21

    1. To define a gene 2. To explain how genes code for proteins 3. http://www.youtube.com/watch ?

    v=rW8NKvQQ8P4

    Q: A: A sugar, a phosphate and an organic base Q: A: Condensation reactions Q: A: Pyrimidine bases Q: A: Hydrogen bonds Q: A: Adenine and thymine Q: A: Three bonds Q: A: Complimentary bases Q: A: Double nitrogen rings

    Q:What is DNA made of A: A sugar, a phosphate and an organic base Q: How are they combined? A: Condensation reactions Q:Thymine and cytosine are examples of these A: Pyrimidine bases Q:These join the two strands of DNA A: Hydrogen bonds Q: Full names of A and T A: Adenine and thymine Q:Guanine and cytosine are held together by..? A: Three bonds Q: The way we describe the pairing of bases A: Complimentary bases Q: The purines (Guanine and Adenine) have what structure? A: Double nitrogen rings

    Consider the following two statements Genes carry the instructions for inherited characteristics.

    Cells have different characteristics because they make different types of proteins.

    What is the connection between genes and proteins?


    Genes contain the instructions for making proteins.

    Genes are specific sequences of bases along the DNA molecule. This specific sequence determines a sequence of amino acids.

    The sequence of amino acids determines what protein or polypeptide is made.


    Each gene makes (codes for) a different protein or polypeptide.

    Proteins are long molecules made from chemical units called amino acids.

    protein molecule
    What happens if amino acids are combined in a different order?

    amino acid

    Different combinations of amino acids make different proteins.

    Genes are made of DNA. Proteins are made of amino acids.


    Each amino acid is coded for by its own special sequence of three bases called a triplet:

    triplet

    amino acid

    3 DNA bases code for each amino acid. Scientists worked this out as follows: There are only 20 a.a. in proteins Each a.a. must have its own sequence (code) of bases on the DNA There are 4 different bases (A,T,G,C) If one base coded for each different a.a., there would only be 4 different a.as. If two bases coded for an a.a., there would only be 16 possible a.as. Three bases would give 64 different codes, enough to produce 20 different a.as.

    The sequence of three bases is called the triplet code There are 21 amino acids There are 64 possible codes Some a.as have more than one possible code. The genetic code is degenerate there is redundancy

    During protein synthesis, the DNA triplet code is transcribed into a messenger RNA molecule as a complementary sequence of nucleotides in which uracil is substituted for thymine. The mRNA is translated into tRNA.
    ATTCCGGGCATTCCCATACGGCCCTATGTACTA
    codon codon codon 1 2 3

    TRANSCRIPTION

    UAAGGCCCGUAAGGGUAUGCCGGGAUACAUGAU messenger RNA code


    codon codon codon 1 2 3

    TRANSLATION

    AUUCCGGGCAUUCCCAUACGGCCCUAUGUACUA tRNA code The order of the codons on tRNA specifies the type, number and sequence of amino acids to be formed into a polypeptide during translation

    Transcription of DNA

    11 of 36

    Boardworks Ltd 2009

    Translation

    12 of 36

    Boardworks Ltd 2009

    The order of bases and therefore triplets in a gene determines the sequence of amino acids.

    The amino acids join together to form a protein molecule.

    One gene contains the sequence of bases for one protein.


    Why is the sequence of bases in DNA called the genetic code?

    The genetic code is the order of the DNA bases which determines the sequence of amino acids in a protein.

    How many triplets code for a protein of 20 amino acids?

    1 amino acid = 1 triplet 20 amino acids = 20 triplets

    How many bases code for a protein of 20 amino acids?

    3 bases = 1 amino acid = the triplet code Codon = the three bases coding for an amino acid Some amino acids have only one triplet codon. Most have between two and six possible codons.

    The code is: Universal it is the same in all organisms Non-overlapping each base in the DNA is only used once. Degenerate (most amino acids have more than one code)

    Task
    Extracting Kiwi DNA Follow the instructions

    The triplet code is always read in one specific direction along the DNA strand

    The start of a gene sequence (and protein) is always the same triplet code ATG this codes for methionine. There is only one codon for methionine. This amino acid is removed from the final protein.

    There are three triplet codons which do not code for any amino acids. These are stop codons and mark the end of a gene (and the protein). TAA, TAG, TGA are the three stop codons in DNA. There are sequences which do not code for any amino acid (junk DNA) or INTRONS

    1.

    A section of DNA has the following sequence of bases: TACGCTCCGCTGTAC a) How many amino acids does it code for? b) Two of the amino acids coded for will be the same which two? c) It is possible that this sequence may code for many different amino acids, or many copies of the same amino acid. Using your knowledge of the genetic code, explain how this can happen.

    Answers
    1.5 2.First and last

    3.Because some amino acids have many different codes ( up to six) while others have just one

    You might also like