Introduction To MATLAB and Simulink A Project Approach
Introduction To MATLAB and Simulink A Project Approach
The CD-ROM that accompanies this book may only be used on a single PC. This
license does not permit its use on the Internet or on a network (of any kind). By
purchasing or using this book/CD-ROM package(the “Work”), you agree that this
license grants permission to use the products contained herein, but does not give you
the right of ownership to any of the textual content in the book or ownership to any of
the information or products contained on the CD-ROM. Use of third party software
contained herein is limited to and subject to licensing terms for the respective
products, and permission must be obtained from the publisher or the owner of the
software in order to reproduce or network any portion of the textual material or
software (in any media) that is contained in the Work.
INFINITY SCIENCE PRESS LLC (“ISP” or “the Publisher”) and anyone involved in
the creation, writing or production of the accompanying algorithms, code, or
computer programs (“the software”) or any of the third party software contained on
the CD-ROM or any of the textual material in the book, cannot and do not warrant the
performance or results that might be obtained by using the software or contents of the
book. The authors, developers, and the publisher have used their best efforts to insure
the accuracy and functionality of the textual material and programs contained in this
package; we, however, make no warranty of any kind, express or implied, regarding
the performance of these contents or programs. The Work is sold “as is” without
warranty (except for defective materials used in manufacturing the disc or due to
faulty workmanship);
The authors, developers, and the publisher of any third party software, and anyone
involved in the composition, production, and manufacturing of this work will not be
liable for damages of any kind arising out of the use of (or the inability to use) the
algorithms, source code, computer programs, or textual material contained in this
publication. This includes, but is not limited to, loss of revenue or profit, or other
incidental, physical, or consequential damages arising out of the use of this Work.
The sole remedy in the event of a claim of any kind is expressly limited to replacement
of the book and/or the CD-ROM, and only at the discretion of the Publisher.
The use of “implied warranty” and certain “exclusions” vary from state to state, and
might not apply to the purchaser of this product.
INTRODUCTION TO
MATLAB® & SIMULINK
A Project Approach
Third Edition
O. BEUCHER
and
M. WEEKS
This publication, portions of it, or any accompanying software may not be reproduced in any way, stored in a retrieval
system of any type, or transmitted by any means or media, electronic or mechanical, including, but not limited to,
photocopy, recording, Internet postings or scanning, without prior permission in writing from the publisher.
O. Beucher and M. Weeks. Introduction to MATLAB & Simulink: A Project Approach, Third Edition.
ISBN: 978-1-934015-04-9
The publisher recognizes and respects all marks used by companies, manufacturers, and developers as a means to
distinguish their products. All brand names and product names mentioned in this book are trademarks or service marks
of their respective companies. Any omission or misuse (of any kind) of service marks or trademarks, etc. is not an
attempt to infringe on the property of others.
Beucher, Ottmar. Introduction to MATLAB & SIMULINK : a project approach / Ottmar Beucher and Michael Weeks.
— 3rd ed.
p. cm.
Includes bibliographical references and index.
ISBN 978-1-934015-04-9 (hardcover with cd-rom : alk. paper)
1. Engineering mathematics–Data processing. 2. Computer simulation–Computer programs.
3. MATLAB. 4. SIMULINK. I. Weeks, Michael. II. Title.
TA345.B4822 2007
620.001’51–dc22
2007010556
Printed in the United States of America
7 8 9 4 3 2 1
Our titles are available for adoption, license or bulk purchase by institutions, corporations, etc. For additional
information, please contact the Customer Service Dept. at 877-266-5796 (toll free).
Requests for replacement of a defective CD-ROM must be accompanied by the original disc, your mailing address,
telephone number, date of purchase and purchase price. Please state the nature of the problem, and send the information
to Infinity Science Press, 11 Leavitt Street, Hingham, MA 02043.
The sole obligation of Infinity Science Press to the purchaser is to replace the disc, based on defective materials or
faulty workmanship, but not based on the operation or functionality of the product.
CONTENTS
Preface xv
Chapter 1. Introduction to MATLAB 1
1.1 What is MATLAB? 1
1.2 Elementary MATLAB Constructs 3
1.2.1 MATLAB Variables 4
1.2.2 Arithmetic Operations 13
1.2.3 Logical and Relational Operations 21
1.2.4 Mathematical Functions 26
1.2.5 Graphical Functions 33
1.2.6 I/O Operations 50
1.2.7 Import Wizard 52
1.2.8 Special I/O Functions 52
1.2.9 The MATLAB Search Path 54
1.2.10 Elementary Matrix Manipulations 56
1.3 More Complicated Data Structures 64
1.3.1 Structures 64
1.3.2 Cell Arrays 72
1.3.3 Definition of Cell Arrays 73
1.3.4 Access to Cell Array Elements 77
1.4 The MATLAB Desktop 82
1.5 MATLAB Help 86
1.6 MATLAB Programming 88
1.6.1 MATLAB Procedures 88
1.6.2 MATLAB Functions 90
1.6.3 MATLAB Language Constructs 95
1.6.4 The Function eval 107
1.6.5 Function Handles 109
1.6.6 Solution of Differential Equations 113
v
vi CONTENTS
ix
x LIST OF FIGURES
3.1 Run times (seconds) for the original and improved “perm” functions 226
3.2 Run times (seconds) for the original “perm” function,
on two different computers 228
3.3 Run time comparisons (seconds) 240
xiii
PREFACE
T
his book is primarily intended for first semester engineering students who are
looking for an introduction to the MATLAB and Simulink environment ori-
ented toward the knowledge and requirements of beginning students. Thus,
only a few basic ideas from mathematics, in particular ordinary differential equa-
tions, programming, and physics are required to understand the contents of this
book. This knowledge is usually acquired in the first two or three semesters of a
technical engineering degree program.
Under these conditions, this book should also be of interest for practicing engi-
neers who are looking for a brief introduction to MATLAB and Simulink. In the case
of this book, engineers will have the knowledge required to understand it years after
they have finished their studies.
The MathWorks periodically updates MATLAB and Simulink software. See
Appendix C for information about R2007b, the release made in September, 2007.
The examples in this book are compatible with the new version.
The first chapter covers the basic principles of MATLAB. It explains the fundamental
concepts, how to handle the most important commands and operations, and the basics
of MATLAB as a programming language. This chapter, like Chapter 2, emphasizes
the numerical solution of ordinary differential equations. Beyond this, there are some
comments on the symbolics toolbox, which makes the core of the computer algebra
program MAPLE available to the MATLAB user and, thereby, enables symbolic
calculations in MATLAB.
Chapter 2 is an introduction to the use of Simulink. Here the emphasis is on the
solution of ordinary differential equations or systems of differential equations and,
with that, the simulation of dynamic systems. Particular attention is paid to the various
techniques for interaction between MATLAB and Simulink. Thus, for example, it is
shown how the execution of Simulink simulations can be automated in MATLAB.
xv
xvi PREFACE
as Simulink model files. The sound files generated in Chapter 3 are stored on the
CD-ROM under the folder sweep_data. It also contains images from the book.
Hence, the book is also suitable for self study.
There are many changes in the new working interface of MATLAB and Simulink.
And, naturally, the corresponding discussion has had to be modified. The most
important content changes are in the sections on cell arrays and function handles.
To be sure, cell arrays showed up in the earlier MATLAB versions, but these
data structures were not mentioned in the two earlier editions. In the meantime, I
have been persuaded to refer to this very flexible tool, even though dealing with these
data structures might still be difficult for the beginner. In many cases, however, cell
arrays cannot be avoided, so at least the essentials should be discussed thoroughly.
Function handles also showed up earlier. But the concept of calling is new. This
makes using the function feval superfluous and makes the call natural. This is also
discussed in a short section.
Other innovations have not been included, since they go beyond the scope of a
basic introduction.
All the new topics have again been supplemented with corresponding problems.
Thus, the number of problems (as ever, fully solved) now exceeds 100.
Chapter 3 is also a new addition, with in-depth programming projects.
PREFACE xvii
In sum, the third edition gives the reader has a fully-up-to-date introduction to
the current versions of MATLAB and Simulink.
REMARKS ON NOTATION
In this book, MATLAB code is generally set in typewriter font. The same holds
for MATLAB commands belonging to the built-in MATLAB environment, such as
the commands whos or the function ode23.
MATLAB commands based on the programs written by the authors are also set
in typewriter font, e.g., the command FInput.
Simulink systems belonging to the built-in environment, such as the parameters
of Simulink systems, are also generally set in typewriter font, e.g., the parameter
Amplitude of the Simulink block Sine Wave.
The names of Simulink systems provided by the author always begin with an
s_. This is of historical origin. Before MATLAB 5, MATLAB programs and Simulink
systems were m files. Since Simulink systems after MATLAB 5 have the ending *.mdl,
it was basically no longer necessary to distinguish them by putting an s_ in front. But,
a second indication of the difference cannot hurt, so this naming convention has been
retained.
Metanames, i.e., names in commands, which are to be replaced by the actual
name in calls, are set in <...> . The formulation help <command name> thus
means that on calling, the entry <command name> must be replaced by the actual
command about which help is being sought. Here the angle brackets do not have to
be entered.
The names of the accompanying programs are accentuated in typewriter
font in the text. There is, of course, much more extensive comment in the programs
than in the printed excerpts. This is particularly so for the solutions to the problems
which have been shortened for reasons of space.
In order to make it easier for the reader to find the programs in the text, an index
of the accompanying software is given at the end of the book.
ACKNOWLEDGMENTS
First of all, thanks to my colleagues Helmut Scherf and Josef Hoffmann for their
many comments and discussions on this topic.
I also thank the students in the Automotive Technology major in the Department
of Mechatronics, who served as “guinea pigs” in some of the one-week compact
courses that preceded the development of this book. Naturally, the (known and
xviii PREFACE
unknown) reactions of the students had a great influence on the development of this
book. I thank Dietmar Moritz, as a representative of them all, for some valuable
comments which have been directly incorporated into the book.
O.B., Lingenfeld and Karlsruhe, Germany, 2007
T
his chapter presents the fundamental properties and capabilities of
the computational and simulation tool MATLAB.
1
2 INTRODUCTION TO MATLAB & SIMULINK
1
All data structures (there are 15 different kinds of them) can usually be subsumed
under the concept of a “field” (array). Thus, MATLAB yields ARRLAB (ARRay
LABoratory). From this concept it follows that the numerical field and, therefore,
the classical matrix, is essentially just a special case.
INTRODUCTION TO MATLAB 3
Starting with the basic data structure of the numerical field, the most impor-
tant elementary constructs and operations of MATLAB (in the author’s
opinion) will be presented here. Initially, MATLAB will only be used
interactively. It will be shown how (numerical) calculations are carried out
interactively and how the results of these calculations can be represented
graphically and checked.
The elementary MATLAB operations can be divided roughly into five
classes:
Arithmetic operations
Logical operations
Mathematical functions
Graphical functions
I/O operations (data transfer)
2
This depends on the user’s settings. These settings can be specified in the menu
command File - Preferences.
4 INTRODUCTION TO MATLAB & SIMULINK
With this instruction, after a MATLAB prompt the number 2.45 (a num-
ber is a 1 × 1 matrix!) will be assigned to the variable x and can subsequently
be addressed under this variable name.
MATLAB responds to this definition with
x =
2.4500
and, in the interactive mode, confirms the input. An error message appears
if there are any errors of syntax.
Numbers are always represented by 4 digits after the decimal point
by default (format short). The default can be changed in the menu
command File - Preferences ... under the listing Command -
Window - Numeric Format. In most cases, however, the default
representation is the best choice.
The following commands define a row vector of length 3 and a 2 × 3
matrix. The response of MATLAB is also shown for each case:
>> vector = [1 5 -3]
vector =
1 5 -3
thematrix =
colvector =
2.0000
4.0000
3.0000
-1.0000
1.0000 - 4.0000i
If no variable name is set, MATLAB assigns the name ans (answer) to the
result, as the following example shows:
>> [2,3,4; 3,-1,0]
ans =
2 3 4
3 -1 0
The Workspace
All of the defined variables will be stored in the so-called workspace of MAT-
LAB. You can check the state of the workspace at any time. The command
who returns the names of the saved variables and the command whos pro-
vides additional, perhaps vital, information, such as the dimension of a matrix
or the memory allocation.
This command yields the following for the preceding examples:
>> who
>> whos
Name Size Bytes Class
3
This action toggles the docking function, and can be used to dock the window there
again.
4
The significance of the button is most easily understood by bringing the mouse
pointer over the button and holding it there for a moment. This opens up a text
window with the name of the button.
8 INTRODUCTION TO MATLAB & SIMULINK
yields
>> who
Reconstructing Commands
The commands that have been set previously are saved. In this way you
can conveniently repeat or modify a command. For this only the arrow
keys ↑ and ↓ have to be pressed. The earlier commands show up in the
MATLAB command window and can (if necessary, after modification) be
brought up again using the return key. For instance, the definition of the
recently erased matrix thematrix can be recovered and reconstructed in
this way.
In long MATLAB sessions this keying through earlier commands
becomes rather tedious. If you know the first letters of the command, you
can shorten the search. Thus, for example, to find the matrix thematrix
you need only type
>> them
and then press the arrow key ↑. Only commands beginning with them
will be searched for. If the beginning is unique, the command is found at
once.
Other convenient possibilities employing the so-called history-
mechanism are provided by the command-history window.
In Fig. 1.1 this command-history window (2) can be seen at the lower
left. In this window the commands set in the past are listed under the cor-
responding date of the MATLAB session. By scrolling, it is also very easy
to find commands from even further back. A double click on the command
is sufficient to activate it again. Some other application possibilities will be
discussed in Section 1.4.
The choice of command reconstruction capabilities ultimately depends
on the preference of the user and practical considerations.
thematrix =
thematrix =
or with
>> v = [1;2;3]
v =
1
2
3
thematrix =
If you want to delete the second column, then you must fill it with an empty
vector [ ]. The second column in the variable thematrix will then be
addressed in accordance with the conventional matrix indexing. Since the
row index is arbitrary in this case, it is indicated by the place holder : (colon).
This yields
>> thematrix(:,2) = []
thematrix =
3 2 1
4 -5 2
INTRODUCTION TO MATLAB 11
1 3 3
thematrix =
4 -5 2
1 3 3
Likewise, a row or column vector can be selected and another variable can
be assigned. Thus, with
>> firstrow = thematrix(1,:)
firstrow =
4 -5 2
largevector =
Columns 1 through 12
0 2 4 6 8 10 12 14 16 ...
Columns 13 through 24
24 26 28 30 etc.
12 INTRODUCTION TO MATLAB & SIMULINK
will let the output in the full command window be suspended when the user
ends the execution of the screen display by pressing a key. This function then
enables the further progress of the interactive MATLAB session. But it can
also be shut off again by entering
>> more off
as a command.
PROBLEMS
All the important constructs for defining MATLAB variables have now been
brought together in order to begin with the first problems on this subject.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 1
Define the following matrices or vectors according to MATLAB and
classify the corresponding variables:
1 0 0
M = 0 j 1 ,
j j + 1 −3
k = 2.75 ,
1
3
v =
−7 ,
−0,5
= 1 −5.5 −1.7 −1.5 3 −10.7 ,
w
y = 1 1.5 2 2.5 · · · 100.5 .
INTRODUCTION TO MATLAB 13
Problem 2
1. Expand the matrix M to a 6 × 6 matrix V of the form
M M
V= .
M M
2. Delete row 2 and column 3 from the matrix V (reduced matrix V23).
3. Create a new vector z4 from row 4 of the matrix V.
4. Modify the entry V(4, 2) in the matrix V to j + 5.
Problem 3
From the vector
r = j j + 1 j − 7 j+1 −3
construct a matrix N consisting of 6 columns where each contain r.
Problem 4
Check whether the row vector of Problem 3 can be joined onto the matrix N
that was constructed there.
Problem 5
Erase all variables from the workspace and reconstruct the matrix V of
Problem 2 using the saved commands and the ↑ and ↓ keys.
Carry out the same procedure once again with the aid of the command-
history window.
Problem 6
Fill row 5 of the matrix V of Problem 2 with zeroes using the array editor.
Problem 7
Open the file ExcelDatEx.xls of the accompanying software in Microsoft
Excel. Transfer the data contained in it to the array editor using the Windows
interface.
Next, delete the second column of the transferred data matrix in the
MATLAB command window and then copy it back into Excel via the
Windows interface.
Matrix Operations
Since the fundamental data structure of MATLAB is the matrix, these oper-
ations must, above all, be understood as matrix operations. This means that
the computational rules of matrix algebra are assumed, with all the associated
consequences.
Thus, for example, the product of two variables A and B is not defined
according to MATLAB if the underlying matrix product A · B is not defined;
that is, if the number of columns in A is not equal to the number of rows in B.
An exception to this rule occurs only if one of the variables is a 1 × 1
matrix, or scalar. Then the multiplication is interpreted as multiplication by
a scalar in accordance with the rules of linear algebra.
The following examples of MATLAB commands5 will make this clearer:
>> M = [1 2 3; 4 -1 2] % define 2x3-Matrix M
M =
1 2 3
4 -1 2
N =
1 2 -1
4 -1 1
2 0 1
V =
15 0 4
4 9 -3
5
Comments can be introduced after commands using the % symbol. Later on, this
will be very useful in writing MATLAB programs. The characters after % in a line
will be ignored by MATLAB.
INTRODUCTION TO MATLAB 15
Field Operations
Besides the matrix operations, in many cases there is a need for corre-
sponding arithmetic operations, which must be carried out term-by-term
(componentwise).
Operations that are to be understood as term-by-term, which are known
as field operations or array operations in MATLAB, must at the very least be
given a new notation as they might otherwise be confused with matrix oper-
ations. This is solved in MATLAB syntax by placing a period (.) before the
operator symbol. An * alone, therefore, always denotes matrix multiplication,
while a .* always denotes term-by-term multiplication (array multiplica-
tion). This leads to other rules about the dimensionality of the objects, as the
following example shows:
M =
1 2 3
4 -1 2
N =
1 -1 0
2 1 -1
ans =
1 -2 0
8 -1 -2
As you can see, the matrix product M*N is not defined this time.
Instead, the product is defined term-by-term. To each entry in M there is
a corresponding entry in N, with which the product can be formed.
Another common example is the squaring of the components of a vector:
>> vect = [ 1, -2, 3, -2, 0, 4]
vect =
1 -2 3 -2 0 4
ans =
1 4 9 4 0 16
In the first case MATLAB could again carry out a matrix operation. Squaring
a matrix, however, is only possible if the matrix is square (i.e., it has the same
numbers of columns and rows) which is not so here. But, the components
themselves can be squared in any case.
Division Operations
The division sign has special significance. In MATLAB we distinguish
between right division / and left division \.
The fact that there are two division operations is again a consequence of
the matrix algebra interpretation. Division of two matrices A and B (i.e., A/B)
is normally not defined. In the case of square matrices, the quotient can only
be interpreted meaningfully as X = A · B−1 if the inverse matrix B−1 exists.
If A−1 exists, then “left division” X = A\B is also meaningful, interpreted in
this case as X = A−1 · B.
MATLAB takes these two situations into account by defining left and
right division. Let us clarify this with a simple example involving two
INTRODUCTION TO MATLAB 17
invertable 2 × 2 matrices.
>> A = [2 1 ;1 1] % Matrix A
A =
2 1
1 1
B =
-1 1
1 1
Ainv =
1 -1
-1 2
Binv =
-0.5000 0.5000
0.5000 0.5000
X1 =
-0.5000 1.5000
0 1.0000
X2 =
-0.5000 1.5000
0 1.0000
18 INTRODUCTION TO MATLAB & SIMULINK
Y1 =
-2.0000 -0.0000
3.0000 1.0000
Y2 =
-2 0
3 1
The next example shows, however, that MATLAB goes one step further in
the interpretation of the division operations:
>> A = [2 1 ;1 1] % Matrix A
A =
2 1
1 1
b =
2
1
x =
1.0000
0.0000
ans =
2.0000
1.0000
SUMMARY
Table A.1 of Appendix 1 lists all the arithmetic operations and their execution
as matrix operations, each with an example.
Table A.2 again lists the arithmetic operations and their execution as field
operations.
N
TH E C
The MATLAB demonstration program aritdemo.m in the accompany-
D
O
PROBLEMS
Work through the following problems for practice with arithmetic operations.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 8
Start the MATLAB demonstration program aritdemo.m by calling the
command aritdemo in the MATLAB command window and work through
the program.
6
See the MATLAB 7 handbook.
20 INTRODUCTION TO MATLAB & SIMULINK
Problem 9
Calculate
Problem 10
Test left division A\b with the matrix
2 2
A=
1 1
and the vector
b = 2
1
and interpret the result.
Problem 11
with the matrix
Test right division b/A
2 2
A=
1 1
INTRODUCTION TO MATLAB 21
A =
1 -3
0 0
>> B=[0 5 ;0 1]
B =
0 5
0 1
>> res=A&B
res =
0 1
0 0
22 INTRODUCTION TO MATLAB & SIMULINK
The resulting matrix res only contains a single 1 (logically true), where the
corresponding components of the two matrices are both = 0 (logically true),
and is 0 (logically false) everywhere else.
The relational operators or comparison operators work in a similar fash-
ion. The following sequence checks which components of matrix A are greater
than the corresponding components of matrix B. The matrices from the
preceding example are used.
>> comp = A>B
comp =
1 0
0 0
The comparison matrix comp shows that only the first component of A is
greater than that of B.
It hardly needs to be pointed out that here, as with all field operators,
the dimensions of the matrices must be identical.
Other relational operators include ≥ and ≤ (in MATLAB syntax these
are <= and >=) and < , as well as == (equal) and ~= (unequal). Besides the
above mentioned logical AND, we have the logical operators logical OR (|),
logical negation (~), and exclusive OR xor.
Further information on this topic, as well as on the other operations and
functions, is available in MATLAB-help (Section 1.5). For comments relating
to this section, you can, for example, search for the keyword operators
under the menu command Help - MATLAB help. Alternatively, you can
enter help ops in the MATLAB command window. In both cases you
obtain a list of MATLAB operators that includes the logical and relational
operators, among others.
As an illustration of the capabilities of this operator class we give an
example that shows up in many simulations. The problem is to select each
component from a result vector which exceeds a particular value, say 2,
and form a vector out of them. This can be done with the following
sequence:
>> vect=[-2, 3, 0, 4, 5, 19, 22, 17, 1]
vect =
-2 3 0 4 5 19 22 17 1
INTRODUCTION TO MATLAB 23
>> compvect=2*ones(1, 9)
compvect =
2 2 2 2 2 2 2 2 2
>> comp=vect>compvect
comp =
0 1 0 1 1 1 1 1 0
>> res=vect(comp)
res =
3 4 5 19 22 17
comp =
0 1 0 1 1 1 1 1 0
>> whos
Name Size Bytes Class
shows that comp is a logical field (logical array) (i.e., a field of logical (truth)
values). The selection operation res=vect(comp) would lead to an error
message with a suitably occupied numerical field.
Logical fields do not only arise as a result of comparison operations. They
can also be defined directly in the following way:
logiField1 =
1 1 0 1 0 1
numField =
1 1 0 1 0 1
logiField2 =
1 1 0 1 0 1
>> whos
Name Size Bytes Class
The functions true and false can be used to define entire fields with
the logical value “true” or “false.” The call without an argument, as above,
produces exactly one logical value. Numerical arrays can also be converted
into logical arrays using the function logical.
As in the above example, components from numerical fields can be
selected very simply by means of indexing with logical arrays. Here is another
example of this, in which every other component is selected from a vector:
>> vect = [1; i; 2; 2+j; -1; -j; 0; i+1]
vect =
1.0000
0 + 1.0000i
2.0000
2.0000 + 1.0000i
-1.0000
0 - 1.0000i
0
1.0000 + 1.0000i
selct =
0 1 0 1 0 1 0 1
selection =
0 + 1.0000i
2.0000 + 1.0000i
0 - 1.0000i
1.0000 + 1.0000i
PROBLEMS
Work out the following problems to become familiar with logical and
relational operations.
NOTE Solutions to all problems can be found in Chapter 4.
26 INTRODUCTION TO MATLAB & SIMULINK
Problem 13
Test to see how the logical operations OR (|), negation (~), and exclusive OR
(xor) work on the matrices A and B of Section 1.2.3. If necessary, consult
MATLAB-help.
Interpret the result.
Problem 14
Test to see how the relational operations <=, >=, <, ==, and ~= operate on
the vectors
x = 1 −3 3 14 −10 12 and y = 12 6 0 −1 −10 2 .
If necessary, consult MATLAB-help.
Problem 15
Consider the matrix
1 2 3 4 10
−22 1 11 −12 4
C=
8
.
1 6 −11 5
18 1 11 6 4
Using relational operators set all the terms of this matrix, which are > 10 and
< −10 equal to 0.
Hint: First make the comparison and then use the results of this com-
parison in order to set the appropriate terms equal to 0 using suitable field
operations.
Problem 16
Consider the matrix
7 2 3 10
−2 −3 11 4
D=
8
.
1 6 5
18 1 11 4
Use logical fields to select the diagonal of this matrix and save it as a vector
diag.
t =
0 1 2 3 4 5
>> s=sin(t)
s =
The sine of the specified vector t is again a vector, specifically, the vector
The full significance of this technique will only become clear to the MATLAB
user in the course of extensive simulations. It should be kept in mind
that the above sequence replaces a programming loop. Thus, in the C++
programming language, the sequence would be implemented as follows:
double s[6];
for(i=0; i<6; i++)
s[i] = sin(i);
The advantage is not obvious in this little example, but the same technique
can produce very elegant solutions for large simulations in MATLAB.
At this point we cannot discuss all the elementary functions. An
overview of the available functions can be obtained by entering the com-
mand help elfun in the MATLAB command interface. This gives a
list of the names of the functions together with brief descriptions of each.
28 INTRODUCTION TO MATLAB & SIMULINK
>> X = 0.5;
>> ASIN(X)
??? Undefined command/function 'ASIN'.
each yield error messages, since in the first the variable X does not exist and
in the second the function ASIN is unknown.
A correct call looks like
>> x = 0.5;
>> asin(x)
ans =
0.5236
INTRODUCTION TO MATLAB 29
Besides the functions from the elfun group, the so-called special math-
ematical functions, which are listed using help specfun, are also of
interest. These, however, require a more profound mathematical knowl-
edge and will not be discussed further here. Problem 22 is recommended for
the interested reader.
Two more examples illustrate the manipulation of elementary functions
in MATLAB. First, the magnitude and phase, in radians and in degrees, of a
vector of complex numbers is to be determined. This problem is frequently
encountered in connection with the determination of the so-called transfer
function of linear systems.
>> cnum=[1+j, j, 2*j, 3+j, 2-2*j, -j]
cnum =
Columns 1 through 3
Columns 4 through 6
>> magn=abs(cnum)
magn =
>> phase=angle(cnum)
phase =
>> deg=angle(cnum)*360/(2*pi)
deg =
In the following example all the terms in a matrix (say, many series of mea-
surements of a voltage signal) are to be converted into decibels (dB). For a
30 INTRODUCTION TO MATLAB & SIMULINK
voltage signal U this means that the value must be converted into
20 · log10 (U)
so that:
>> meas=[25.5 16.3 18.0; ...
2.0 6.9 3.0; ...
0.05 4.9 1.1]
meas =
>> dBmeas=20*log10(meas)
dBmeas =
8
The periods (. . .) used to continue the command line are, of course, no longer
obligatory in this special case, since MATLAB 7 “takes note” that it is dealing with an
incomplete matrix definition as long as the closing bracket is not entered. In earlier
MATLAB versions these periods always had to be present. As before, the periods
(. . .) have to be inserted in order to break up a command line.
INTRODUCTION TO MATLAB 31
The calculation is carried out by the following MATLAB sequence, using the
elementary mathematical functions sqrt and atan:
>> points = [ 1 2; 4 3; 1 1; 4 0; 9 1]
points =
1 2
4 3
1 1
4 0
9 1
r =
2.2361
5.0000
1.4142
4.0000
9.0554
phi =
1.1071
0.6435
0.7854
0
0.1107
polarc =
2.2361 1.1071
5.0000 0.6435
1.4142 0.7854
4.0000 0
9.0554 0.1107
32 INTRODUCTION TO MATLAB & SIMULINK
Note the use of the : operator and the field operations used for calcu-
lating r and phi, which make it possible to perform the calculation on the
whole vector in a single stroke.
Finally, it should be noted that the preceding calculation could be
shortened using the following instructions:
>> points = [ 1 2; 4 3; 1 1; 4 0; 9 1]
points =
1 2
4 3
1 1
4 0
9 1
polarc =
2.2361 1.1071
5.0000 0.6435
1.4142 0.7854
4.0000 0
9.0554 0.1107
PROBLEMS
Work out the following problems for practice with the elementary mathe-
matical functions.
Problem 17
Calculate the values of the signal (function)
Problem 18
Calculate the values of the signal (function)
s(t) = sin (2π 5.3t) sin (2π 5.3t)
for the time vector of Problem 17.
Problem 19
Round off the values of the vector
s(t) = 20 sin (2π 5.3t)
for the time vector of Problem 17, once up and once down. Find the cor-
responding MATLAB functions for this. For this, use the MATLAB help
mechanisms. If necessary, first consult Section 1.5.
Problem 20
Round the values of the vector
s(t) = 20 sin (2π5t)
to the nearest integer for the time vector of Problem 17 using a suitable
MATLAB function. Also, give the first 6 values of s(t) and the correspond-
ing rounded values in a matrix with two rows and interpret the somewhat
surprising result.
Problem 21
Calculate the base 2 and base 10 logarithms of the vector
b = (1024 1000 100 2 1)
using the appropriate elementary MATLAB functions.
Problem 22
Convert the cartesian coordinates from the above example (in variable
points) into polar coordinates using the special mathematical function
cart2pol. First, check on the syntax of this command by entering
help cart2pol in the command window.
Two-dimensional Plots
By far the most important and the most commonly used graphical func-
tion is the function plot. Entering help plot provides the following
information (excerpt):
>> help plot
MATLAB help (of which we present only part of the full display for rea-
sons of space) shows the basic capabilities of plot. Beyond that, there are
many other possibilities and options for plot. A discussion of this topic is
beyond the scope of this book. The interested reader can look at the book by
Marchand.9
As the help function shows, in principle, two vectors are required in
order to plot a graph. The first vector represents the vector of x values and
the second, the corresponding vector of y values. The vectors must, therefore,
have the same length. If this is not so, MATLAB produces an appropriate
error message unless x is a scalar (see help plot). This message shows
up in practice, even for experienced MATLAB users, but the error is easily
corrected.
Many functions can also be plotted simultaneously, either by writing the
x, y pairs one after the other in the parameter list or, when the same x vector
will always be used, by combining the y vectors into a corresponding matrix.
In addition, the form of the graphs in terms of the type of line and color
can be varied by using suitable parameters.
Our first example again uses the variables s and t from the example in
Section 1.2.4, and plots the result obtained there:
>> t = (0:1:5);
>> s = sin(t);
>> plot(t,s)
9
P. Marchand, Graphics and GUIs with MATLAB, CRC Press, 1999.
INTRODUCTION TO MATLAB 35
0.8
0.6
0.4
0.2
−0.2
−0.4
−0.6
−0.8
−1
0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5
You can see that the result is normally in the form of a polygonal sequence.
This often leads to erroneous interpretations of graphs, especially when the
abscissa values are far apart. Be careful. In addition, only numbers are placed
on the axes automatically. You have to put in grids, axis labels, and titles
yourself using the appropriate MATLAB commands.
The following commands generate the plot in Fig. 1.5. Here another line
style (circles) has been chosen and the color has been changed to magenta
(which cannot, of course, be shown here). (The default color in MATLAB is
blue.)
>> t=(0:1:5);
>> s=sin(t);
>> plot(t,s,'k*')
36 INTRODUCTION TO MATLAB & SIMULINK
0.8
0.6
0.4
0.2
−0.2
−0.4
−0.6
−0.8
−1
0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5
Here the variable t has to be repeated anew each time. The sine is plotted
with the above settings, a black (black) solid curve (-), while the cosine is
plotted in blue (blue) with a dashed curve (--), and the exponential function
is in magenta (magenta) with a dotted curve (.).
10
Note that the general form for a harmonic oscillation with frequency f , amplitude
A, and phase ϕ is f (t) = A sin (2π ft + ϕ).
INTRODUCTION TO MATLAB 37
1.5
0.5
−0.5
−1
−1.5
−2
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2
Besides these most frequently used plot functions, MATLAB also has
a number of other two-dimensional plot functions. In signal processing the
function stem is often used. It presents discrete signals in the form of a fence
plot. This function, however, is only suitable for sparse data sets, for otherwise
the lines come too close to one another and the small circles at the ends of
1.5
0.5
−0.5
−1
−1.5
−2
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2
FIGURE 1.7 x, y plot with multiple functions and different line colors and styles.
38 INTRODUCTION TO MATLAB & SIMULINK
1.5
0.5
−0.5
−1
−1.5
−2
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2
the lines can overlap in an unsightly manner. In these cases plot is more
intuitive. Fig. 1.8 shows the results of the following MATLAB sequence:
>> t=(0:0.05:2);
>> cosfct=2*cos(2*pi*t);
>> stem(t,cosfct)
>> box
for the cosine signal defined above. A suitable labelling of the axes and a
title line are also important for the documentation of graphs of this sort. In
addition, it is often also necessary to provide a grid for the graph in order
better to compare the values or to enlarge segments of a graph.
MATLAB, of course, has functions for this purpose. For the axis labels
there are xlabel, ylabel, and title, for the grid there is the function
grid, and for magnification there is the function zoom, which allows the
enlargement of a segment with the mouse, as well as the command axis,
INTRODUCTION TO MATLAB 39
1.5
0.5
−0.5
−1
−1.5
−2
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2
for which the x and y ranges must be specified explicitly. Labels can be
inserted inside the graph using the function text.
The graphs in Figs. 1.10 and 1.11 show the result of the following
MATLAB command sequence, in which the above capabilities are used:
>> t=(0:0.05:2);
>> cosfct=2*cos(2*pi*t);
>> plot(t,cosfct)
>> xlabel('time / s')
>> ylabel('Amplitude / V')
>> text (0.75,0,'\leftarrow zero crossing','FontSize',18)
>> title('A cosine voltage with frequency 1 Hz')
>> figure % open a new window !
>> plot(t,cosfct)
>> xlabel('time / s')
>> ylabel('Amplitude / V')
>> grid % set grid frame
>> axis([0, 0.5, 0, 2]) % detail within interval [0, 0.5],
% but only amplitudes within
% the interval [0, 2]
>> title('Detail of the cosine voltage with frequency 1 Hz')
40 INTRODUCTION TO MATLAB & SIMULINK
1.5
0.5
Amplitude / V
0 ← zero crossing
−0.5
−1
−1.5
−2
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2
time / s
We shall not discuss the other two-dimensional plot functions at this point.
The reader can find out more about these possibilities in the help menu or
in the book by Marchand11 and experiment with them.
1.8
1.6
1.4
1.2
Amplitude / V
0.8
0.6
0.4
0.2
0
0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 0.45 0.5
time / s
11
P. Marchand, Graphics and GUIs with MATLAB, CRC Press, 1999.
INTRODUCTION TO MATLAB 41
Graphical Processing
MATLAB 7 has extensive improvements in the user interface compared to its
predecessors (see Section 1.4). Thus, it offers some convenient possibilities
for the processing and export of graphics in the interactive mode. Since this
is of great importance for the documentation of MATLAB computations, we
shall discuss it briefly at this point.
The plot window of a MATLAB graphic as seen by the user has the form
shown in Fig. 1.12.
The essential functions for manipulation of graphics can be selected using
the so-called toolbar located below the pull-down menus. These functions
can, of course, also be reached through the pull-down menu itself. Besides
the conventional Windows icons for save, print, etc., in the left-hand third
of the toolbar, in the middle third of the toolbar you can see the magnifier
symbol, with which a graphic can be enlarged or shrunk, as well as a symbol
for rotating a graphic. The latter is especially practical for viewing three-
dimensional graphics (see the next subsection) and is very useful. The icons
in the right-hand third of the toolbar provide access to other useful functions,
such as the so-called data cursor, with which the (x, y) coordinates of a point
in the graph can be displayed by clicking on the given point. There is also a
button with which the graphics can be provided interactively with a legend.
The show plot tools icon on the far right extends the plot window to a
wider window with tools for graphical processing.
A detailed presentation of the possibilities at this point would go beyond
the scope of this introduction. Instead, we shall illustrate the functionality
with a small example.
If, for instance, you want to change the title label, select and click on
the title text with the plot editing arrow and make your change. Similarly, by
double clicking on the lines it is possible to change the line style. A double
click on the axes makes it possible to change the axis scale and other properties
of the axes. With a mouse click the plot window can be expanded at any time
into a configuration window where the desired settings can be chosen. All the
configuration possibilities can be obtained in a single view if, as mentioned
above, you press the show plot tools icon. Fig. 1.13 shows the plot
window when it is expanded in this way.
A selection of tools for manipulating a plot are also available. This is other-
wise context dependent. Thus, the property editor - axes window
is opened below when the intersection of the axes is clicked. If the function
graph is clicked, then this window will be replaced by the corresponding
property editor window.
Besides these, many more functions can be obtained through the menu
items insert and tools, which make it possible to modify the appearance
of a graphic afterward. This calls on the experimental playfulness of the
reader.
Given the innumerable possibilities offered by the plot window for chang-
ing graphics in MATLAB 7 in the interactive mode, the preceding discussion
of the plot commands may seem to be of somewhat dubious utility for this
purpose. In fact, processing plots with the tools in the plot window is simpler
and more intuitive. Moreover, no commands have to be learned in combi-
nation with their syntax. It has already been pointed out that MATLAB is a
programming language (see Section 1.6). If you want to prepare completed
INTRODUCTION TO MATLAB 43
graphics within a program, the above MATLAB commands provide the only
way to do it.
Finally, the important functionalities for graphics export from
MATLAB 7 should be mentioned at this point. In the plot window various
formats, such as encapsulated postscript, TIFF, portable network graph-
ics, etc., into which a graphic can be converted and saved, may be chosen
using the menu command File - Save as .... Of course, the graph-
ics can be exported into other applications via the Windows interface using
Edit - Copy figure command.
Three-dimensional Plots
Here again, we shall not discuss all the capabilities of MATLAB in detail. The
most important three-dimensional graphics functions are certainly mesh and
surfsurf for the representation of a three-dimensional mesh or surface-
mesh plot and contour for a contour plot. In the following example the
two-dimensional function
f (x, y) = sin (x2 + y2 )e−0.2·(x
2 +y2 )
44 INTRODUCTION TO MATLAB & SIMULINK
>> t=(0:0.1:5);
>> f=(t.^2).*exp(j*t).*(j.^t); % * and ^ are field operations.
>> subplot(211) % plot the top graph
>> plot(t,abs(f))
>> subplot(212) % plot the bottom graph
>> plot(t,angle(f))
25
20
15
10
0
0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5
−2
−4
0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5
FIGURE 1.17 A graph with two plots using the subplot command.
is meant, going from upper left to lower right. For example subplot(325)
signifies the fifth plot in an array of 3 × 2 graphs (for the next plot command).
Another possibility for multiple plots in a single window is overlay graphs
as shown in Figs. 1.6 and 1.7. Besides the ways described previously, multiple
graphs can be plotted on top of one another using the hold command. This
freezes the current graph so that the next graph is not plotted in its own
window, but in the same window. Here is an example:
>> t = (0:0.5:10);
>> sinfct = sin(2*pi*5*t);
>> cosfct = 2*cos(2*pi*3*t);
>> plot(t,sinfct)
>> hold
>> plot(t,cosfct)
Here, the current graph is always the graph whose plot window is “on top,”
and, therefore, the last one processed. Before using the hold command,
you have to make sure that the correct graph is being written over by clicking
the corresponding window.
48 INTRODUCTION TO MATLAB & SIMULINK
PROBLEMS
Work out the following problems to familiarize yourself with the plot
functions.
Problem 23
Figure out why the sequence
>> t=(0:0.01:2);
>> sinfct=sin(2*pi*5*t);
>> cosfct=2*cos(2*pi*3*t);
>> expfct=exp(-2*t);
>> plot(t,[sinfct, cosfct, expfct])
Problem 24
Enter the MATLAB command sequence
>> t=(0:0.5:10);
>> sinfct=sin(2*pi*5*t);
>> cosfct=2*cos(2*pi*3*t);
>> expfct=exp(-2*t);
>> plot(t,[sinfct; cosfct; expfct])
Problem 25
Experiment with the plot functions plot and stem using different dis-
cretization step sizes and different line styles.
Vary the line style and axis partition using the editor command in the
plot window.
Problem 26
Experiment with the plot functions semilogx, semilogy, and loglog,
in order to become acquainted with the different possibilities for displaying
logarithmic axes.
For this, use the frequency vector
ω = (0.01, 0.02, 0.03, 0.04, . . . , 5) rad/s,
INTRODUCTION TO MATLAB 49
12
The concept of “transfer function” is discussed in the pertinent literature. An
understanding of this concept is not essential for the problem under consideration.
50 INTRODUCTION TO MATLAB & SIMULINK
Problem 31
Plot the exponential functions
Label one of the plots in a suitable fashion and then try to save this plot in an
Microsoft Word file using the interface.
Problem 32
Calculate and plot the function
x2 + y2
the content of the work space (i.e., that which is indicated by whos)
will be saved in a binary file named wsbackup.mat (ending in .mat).
For this, the target directory is the work directory set in the menu entry
current directory (see item (5) in Fig. 1.1). This setting can obviously
be overwritten by explicitly specifying a directory in front of the file name.
INTRODUCTION TO MATLAB 51
Besides backup of the workspace, individual variables can also be saved. (See
below.)
In MATLAB 7 the binary format has been changed relative to the ear-
lier versions. Under certain conditions this makes the exchange of these
files with other MATLAB users difficult. In order to ensure down com-
patibility, an option (-V6) can be used in the save command in order to
save the file in an earlier binary format. The following instruction saves
the variables var1 and var2 in MATLAB 6 binary form in a file that
will be set up in a (explicitly specified) directory outside the Current
directory:
>> save 'C:\beucher\matlab7\thevars' var1 var2 -V6
and it then shows up there under the name thevarX (but not X) and is again
available.
As opposed to save and load, in the interactive mode the menu com-
mands File - Save workspace as ... and File - import
52 INTRODUCTION TO MATLAB & SIMULINK
data can be used. In the latter case the so-called import wizard, which
provides flexible data import possibilities, is opened.
Beyond that, functions for importing picture and audio information or for
formats of other applications, such as Microsoft Excel, are of special interest.
A complete survey of the functions can be obtained by entering
help iofun, help audiovideo, and help imagesci. These com-
mands list a whole series of MATLAB functions with which the import and
export of various file formats can be accomplished. A discussion of all of these
functions, some of which are very specialized, is beyond the scope of this book.
Let us consider two functions in order to familiarize ourselves with these
file interfaces. Below we shall consider in more detail the functions xlsread
and xlswrite for communication with Microsoft Excel.
The file ExcelDatEx.xls, which we have already used in Problem 7
in connection with the array editor contains an Excel sheet (“Table 1”) with
a numerical field (matrix). This is the simplest form of Excel file, which can
be processed by xlsread. If the file is in an access path for MATLAB (in
the simplest case, in the current directory), then this matrix can be
read into the MATLAB workspace using the instruction
>> ExcelMat = xlsread('ExcelDatEx')
ExcelMat =
3 1 2
4 0 -5
3 1 2
4 0 -5
3 1 2
...
and becomes available there under the assigned variable name (ExcelMat).
The following instructions can be used to convert a matrix into an Excel
file:
>> fromcol1 = ExcelMat(1:5,1)
fromcol1 =
3
4
3
4
3
MATLABPATH
C:\matlabR14\toolbox\matlab\ops
C:\matlabR14\toolbox\matlab\lang
C:\matlabR14\toolbox\matlab\elmat
...
INTRODUCTION TO MATLAB 55
C:\matlabR14\work
C:\beucher\Matlab7
C:\beucher\Book\Matlab\accompanyingsoftware
...
In the above (reduced display) example, the directories for the func-
tion groups of the already mentioned MATLAB operators (ops) or the
elementary mathematical functions elmat are listed.
The directories C:\beucher\... are ones that the author himself has
appended to the search path.
If you want to tie in a path, such as for the directory C:\beucher\
Matlab7, you can do it very rapidly with the following command:
>> path(path, 'C:\beucher\Matlab7');
Of course, a directory of this sort can also be appended very simply (and then
removed) by a menu command, in this case with File - Set path ....
MATLAB automatically finds all the m-files (commands, specific
MATLAB programs, Simulink systems) in the directories indicated by path.
If you write your own programs (see Section 1.6) it is recommended that
you set up your own work directory in the search path. Programs must not,
however, be put in any toolbox directory. During the next automatic update
of this toolbox, these will be lost unless they are otherwise saved.
PROBLEMS
Problem 33
Generate a vector and/or a matrix of real numbers with an editor and save
them under a file name.
Erase all the matrices in the work space using clear.
Then try to read in the file content using the load command and analyze
the content of the workspace.
Be sure to compare this with the following Problem 34.
56 INTRODUCTION TO MATLAB & SIMULINK
Problem 34
Generate an ASCII file with a column vector of complex numbers using a nor-
mal editor. Export this via the MATLAB command plane into the MATLAB
workspace. What do you find?
Problem 35
Generate a column vector with MATLAB from complex numbers. Save this
vector using save in binary format.
Next erase it in the workspace using the clear command and then
reload the file into the MATLAB workspace using load or the import wizard.
Compare the result with that of Problem 34.
Problem 36
Define the complex matrix
1 2 3
M = 1+j 6 0 .
3+j 0 −j
in the MATLAB workspace. Next, save this vector as a column vector in ASCII
format as a file named Mmatrix.txt using the function dlmwrite.
Consult MATLAB help (help dlmwrite) about using this function.
Problem 37
Using a suitable MATLAB function read in one of the *.wav files to be found
under C:\WINDOWS\MEDIA and display the corresponding audio signal
graphically. Make sure that the time axis is labeled with the correct times.
Next, multiply the signal by a factor of 10 and save it in *.wav format
under another name.
How do the comparative audio signals sound?
Problem 38
Solve Problem 37 again with “Microsoft Sound” (file WindowsXP-
Startup.wav) and a factor of 0.
Problem 39
Prepare a folder C:\mymatlab and arrange it so that you can use it as a
directory for MATLAB.
M =
0 0
0 0
>> N = ones(3,2)
N =
1 1
1 1
1 1
>> x1 = [1,2,3,4,5,6];
>> v=zeros(length(x1),1)
v =
0
0
0
0
0
0
The command eye is often useful for generating a unit matrix. Here is an
example:
>> E5 = eye(5)
E5 =
1 0 0 0 0
0 1 0 0 0
0 0 1 0 0
58 INTRODUCTION TO MATLAB & SIMULINK
0 0 0 1 0
0 0 0 0 1
The length of a vector and the size of a matrix can be determined automatically
using the commands length and size. This is of great importance, espe-
cially in programs. Next the length of the just defined vector x1 is determined
this way:
>> length(x1)
ans =
B =
1 0 0 0
0 0 0 0
0 1 0 0
0 0 1 0
0 0 0 1
rows =
columns =
Other commands for the generation of special matrices and special vari-
ables and constants are included in the commands listed in help elmat
for MATLAB. We leave it to the reader to explore these commands, but we
do not want to omit special mention of the command why.
INTRODUCTION TO MATLAB 59
x1 =
1
2
3
-1
4
5
x2 =
1
2
3
-1
4
5
M =
1 2
3 -2
-1 4
>> N = M'
60 INTRODUCTION TO MATLAB & SIMULINK
N =
1 3 -1
2 -2 4
1 3 −1
N= .
2 −2 4
In accordance with the rules of mathematics, complex matrix terms subjected
to the operator ' will be folded and their conjugates taken:
>> M = [i 2; 3 -j] % a 2x2 matrix with complex terms
M =
0 + 1.0000i 2.0000
3.0000 0 - 1.0000i
0 - 1.0000i 3.0000
2.0000 0 + 1.0000i
Thus,
j 2
M=
3 −j
yields
−j 3
N=
2 j
also.
If taking the conjugate of the terms is to be avoided, then the transposition
operator has to be redefined as a field operator:
>> K = M.'
INTRODUCTION TO MATLAB 61
K =
0 + 1.0000i 3.0000
2.0000 0 - 1.0000i
j 2
M=
3 −j
yields
j 3
K=
2 −j
as desired.
We have already learned about the : operator in Section 1.2.1 in connec-
tion with access to columns and rows in a matrix. The following application
of this operator, with which a column vector with the same terms can be
created from a matrix, is also very useful:
>> M = [1 2; 3 -2; -1 4] % a 3x2 matrix
M =
1 2
3 -2
-1 4
mVec =
1
3
-1
2
-2
4
In this way the columns of the matrix are organized one above the other.
The function repmat can be used to copy and duplicate matrix entries.
The instruction
>> N = repmat(M,2,2)
62 INTRODUCTION TO MATLAB & SIMULINK
N =
1 2 1 2
3 -2 3 -2
-1 4 -1 4
1 2 1 2
3 -2 3 -2
-1 4 -1 4
zVec =
0 3 -1 0 1 99
>> zVec(end) = [ ]
zVec =
0 3 -1 0 1
This technique can be used especially within programs (see Section 1.6)
when the size of a vector changes during execution of a program so that the
last index is not known explicitly during programming. A vector can also be
lengthened in this way, as the following instructions show:
yVec =
0 3 -1 0 1 99
yVec =
0 3 -1 0 1 99 -1 -2 -3
yVec =
0 3 -1 0 1 99 -1 -2 -3 100
PROBLEMS
Problem 40
Define the vector
r = j j + 1 j−7 j+1 −3
in MATLAB as a column and row vector.
Problem 41
Redo Problem 2, using the function repmat.
Problem 42
Using a suitable elementary matrix manipulation, generate a vector that has
ten points between 0 and 1 with equal relative distances between them on
a base-10 logarithmic scale. This means that the base-10 logarithms of the
generated numbers should be separated by equal distances.
Next, plot these points using loglog as a check.
What sort of graph should you see?
Problem 43
Generate the graphs in the three-dimensional plot example in Section 1.2.5
using the function meshgrid to create the grid pattern.
64 INTRODUCTION TO MATLAB & SIMULINK
Problem 44
In what way can you define the vector
in MATLAB?
Problem 45
Using a suitable elementary matrix manipulation, reverse the sequence of
terms in the vector of Problem 44; that is, create the vector
Problem 46
Consider the vector
It has already been explained in Section 1.1 that in the newer versions
of MATLAB, as in other higher programming languages, additional data
structures besides classical numerical matrices are available.
In the following sections we discuss so-called structures and cell arrays
in more detail.
These data structures are seldom called upon in the interactive mode.
On the other hand, in MATLAB programming they allow constructions (see
Section 1.6), which would be very intricate or entirely unrealizable using
numerical fields. Thus, the full value of these data structures will only become
clear to the reader after reading Section 1.6. In the following we shall just
discuss the basic aspects of these constructions in the interactive mode.
1.3.1 Structures
Structures are fields (arrays) by which different types of data can be combined
into a logical unit. Access to these data is obtained by names, rather than by
numerical indexing as in the case of matrices.
INTRODUCTION TO MATLAB 65
Definition of Structures
We illustrate this with an example. Suppose we want to combine certain
properties of a MATLAB graphic, such as
This listing includes numbers, numerical vectors, and strings. A listing of this
sort can, of course, no longer be represented by a matrix in MATLAB.
For this purpose, we define a structure Graphic in the following way:
>> Graphic.title = 'Example';
>> Graphic.xlabel = 'time / s';
>> Graphic.ylabel = 'voltage / V';
>> Graphic.num = 2;
>> Graphic.color = ['r', 'b'];
>> Graphic.grid = 1;
>> Graphic.xVals = [0,5];
>> Graphic.yVals = [-1,1];
>> whos
Name Size Bytes Class
Evidently, the above instructions have been used to define a single element
(1 × 1 array) Graphic, which contains the full information, as is shown by
a call of Graphic:
>> Graphic
Graphic =
title: 'Example'
xlabel: 'time / s'
ylabel: 'voltage / V'
66 INTRODUCTION TO MATLAB & SIMULINK
num: 2
color: 'rb'
grid: 1
xVals: [0 5]
yVals: [-1 1]
Graphicempty =
title: []
xlabel: []
ylabel: []
num: []
color: []
grid: []
xVals: []
yVals: []
Fields of structures (structure arrays) can also be set up. The following
instructions set up a 10 × 1 field of empty graphic structures:
>> Grfarray = repmat(Graphicempty, 10, 1)
Grfarray =
Thirdarray =
title: []
xlabel: []
ylabel: []
num: []
color: []
grid: []
xVals: []
yVals: []
>> whos
Name Size Bytes Class
Here you can see that indexing occurs as with numerical fields.
As noted above, the major significance of combining data into a structure
will first become clear to the reader in connection with programming of
MATLAB functions. The logical combination of individual data into a unit
makes programming easier, especially for extensive tasks involving enormous
programs, and makes the programs more readable. This applies particularly
to the transfer of parameters. Long, involved parameter lists can be shortened
by using structures and the programs can made more transparent for both
the programmer and the user (see the solution to Problem 58).
At this point we cannot, of course, pursue this aspect further. We con-
clude with a discussion of elementary operations, such as the definition of
structures and the operations for access to structure arrays (structure fields).
ttlString =
Example
68 INTRODUCTION TO MATLAB & SIMULINK
one can obtain access to the data field title of the structure Graphic and
assign the result to the variable ttlString.
In similar fashion a new value can be assigned to the data field:
>> Graphic.title = 'Another example'
Graphic =
The same could also be obtained using the MATLAB function setfield:
>> Graphic = setfield(Graphic, 'title', 'The next example')
Graphic =
ans =
num: []
color: []
grid: []
xVals: [0 10]
yVals: []
set up the data array title for the third structure in the array (field)
Grfarray as the string 'Third graphic' and the data field xVals
for the third structure of the array Grfarray on the interval (numerical
field) [0 10].
The next example concerns numerical indexing to a field component and
to a data field. The upper bound of the range of the graph is to be changed and
written into the corresponding structure. This can be done via the following
instruction:
>> Grfarray(3).xVals(2) = 25;
>> Grfarray(3)
ans =
The function deal is also of practical value for dealing with structure arrays.
A data field can be filled for all components of a structure array using this
function. The instruction
>> [Grfarray.xlabel] = deal('voltage / V');
>> Grfarray(1)
ans =
title: []
xlabel: 'voltage / V'
ylabel: []
num: []
color: []
grid: []
70 INTRODUCTION TO MATLAB & SIMULINK
xVals: []
yVals: []
>> Grfarray(7)
ans =
title: []
xlabel: 'voltage / V'
ylabel: []
num: []
color: []
grid: []
xVals: []
yVals: []
sets all the xlabel data fields in the structure array Grfarray to the string
'voltage / V'.
Modifying a Structure
A structure can be modified simply by removing fields or by appending fields.
Thus, for example,
>> Graphic = rmfield(Graphic, 'color')
Graphic =
causes the field color to be eliminated from the structure. We could, for
example, then replace it with a structure in which color and line style are
combined:
>> Style.color = 'rb';
>> Style.line = '-o';
>> Graphic.style = Style
INTRODUCTION TO MATLAB 71
Graphic =
Graphic =
This example also shows that structures, themselves, can be data fields of
structures. Likewise, as shown above, structures can, in turn, be combined
into arrays.
PROBLEMS
Problem 47
Modify the field yVals of the structure Graphic so that it has the value
[-2 0]. See if there are different ways of doing this.
Problem 48
Save the second line color that was saved in the style partial structure as a
variable of its own.
72 INTRODUCTION TO MATLAB & SIMULINK
Problem 49
Define a structure color with the data fields red, blue, and green.
Then define a 1 × 20 field of structures of this type and initialize the
red component with the value 'yes', the blue component with the value
'no', and the green component with the value [0,256,0].
Problem 50
Eliminate everywhere the data field blue from the structures of the structure
field defined in Problem 49 and set the value of green of the tenth structure
to [0,256,256].
Problem 51
An attempt to eliminate the entry blue in the structure field of Problem
49 in only the first field component fails. There is no operation or MATLAB
function that can do this.
Why is that?
13
Readers who do not feel confident enough, despite the basic preparation for MAT-
LAB in the first section of this book, can defer the following section until the concept
of cell arrays is discussed in Section 1.6.
INTRODUCTION TO MATLAB 73
measurement =
day: []
x: []
y: []
depth: []
temperature: []
measurementnumber: []
If you want to search in a program for the 25th measurement on the 3rd day,
corresponding search loops must be written (see Section 1.6.3), which search
the entire data record.
In this case it might be simpler to index with a two-dimensional field (e.g.,
meascampaign(3,25), in which the first component is the day and the
second, the series number of the measurement). The data cannot be written
in the form of a numerical field, even though they are numbers, because the
data records are of varying lengths.
This can, however, be done with cell arrays.
measurement =
256.9000 300.7000
74 INTRODUCTION TO MATLAB & SIMULINK
The desired logical combination can be realized easily using the following
instructions:
>> clear
>> measurements = {[256.9, 300.7], ...
[10, 27; 50, 16; 100, 5]}
measurements =
>> whos
Name Size Bytes Class
measurements =
[1x2 double]
measurements =
Here, the different significance of the two types of brackets, {} and (),
mentioned previously, should be kept in mind. According to the above
instructions, the cells in the cell arrays measurements will be indexed on
the left of the assignment using parentheses. This is a matter of the cell index-
ing noted above. On the right, the assignment will indicate by {} brackets
around the object to be saved that a cell array is being defined.
A definition that uses content indexing follows this syntax:
measurements =
[1x2 double]
measurements =
Now the cells of the cell array measurements are indexed on the left-
hand side of the instruction using curly brackets. In this way it is also
made clear that a cell array is being defined. On the right-hand side of the
assignment, the object to be stored is specified (without curly brackets or
parentheses).
The cell array measurements defined in this way can be visualized
graphically using the function cellplot. The instruction
>> cellplot(measurements)
This graphic shows the individual cells of the cell array in terms of their
field dimension, not their content. These can be shown in a single stroke
using the function celldisp:
>> celldisp(measurements)
measurements{1} =
256.9000 300.7000
measurements{2} =
10 27
50 16
100 5
We can now define the originally conceived cell array meascampaign using
cell arrays of the form measurements :
A field of this sort can be built using the instructions
meascampaign =
As you can see, in this example the first two measurements on day 1 will be
stored and then the 5th measurement on day 3. The fields in between will
be automatically created and filled with the empty field []. The individual
elements in the cells are evidently, in turn, cell arrays. Calling cellplot
>> cellplot(meascampaign)
position =
256.9000 300.7000
value =
10 27
50 16
100 5
cell1 =
[1x2 double]
cell2 =
[3x2 double]
cell indexing is used to gain access to the cells themselves (!), in order to store
them as cells (!) in the new cell arrays cell1 and cell2, as a glance at the
workspace shows:
>> whos
Name Size Bytes Class
meas1day1 =
ans =
position1day1 =
256.9000 300.7000
measpos1day1 =
10 27
50 16
100 5
meas3pos1day1 =
100 5
tempmeas3pos1day1 =
In order to understand what happens, let us take a look at the last instruc-
tion as an example. With meascampaign{1,1} the contents of the cell
80 INTRODUCTION TO MATLAB & SIMULINK
with the coordinates (1, 1) are reached. This is, again, a cell array, whose
second cell component is reached with {2}. This second cell component
contains, in turn, a 3 × 2 matrix. The second component in the third row of
this matrix is specified by (3,2), in the conventional indexing for numerical
fields.
measurements =
200 30
meascampaign =
the last measurement on the 5th day will erased; but this cannot be recognized
initially in the MATLAB answer since the whole cell array is returned. The
instruction
>> celldisp(meascampaign)
meascampaign{1,1}{1} =
256.9000 300.7000
INTRODUCTION TO MATLAB 81
meascampaign{1,1}{2} =
10 27
50 16
...
PROBLEMS
Problem 52
Change all the measured values to [-1,0] in the cell array meascampaign
in the cell with coordinates (3, 5).
Problem 53
Extend the cell array measurements by one cell in which the name of the
engineer who made the measurement is entered.
Then generate a 5 × 1 cell array weeklymeasurements. Fill each cell
with the cell array measurements. Then, for each day of the week enter
an (arbitrary) name in the prescribed location.
Problem 54
Make the following changes in the cell array weeklymeasurements
defined in Problem 53:
1. Change the name of the engineer who made the measurement on the
5th day to A. E. Neumann.
2. Add a measurement with the values 250,0 to the 1st day.
3. Save the data from the 3rd day in a separate cell array day3.
4. Using the function deal, whose syntax can be found under help, save
the measurements for all five days in separate variables, monday,
tuesday, wednesday, thursday, and friday.
command textscan can read formatted data from a text file opened with
the function fopen and arranges the results of the reading operation in a
cell array.
Familiarize yourself with the syntax of these functions and then work out
the following.
Problem 55
N
TH E C
Open the file sayings.txt in the accompanying software using fopen
D
O
and read the first seven strings, which are separated by spaces, using the
function textscan into a cell array sayings. Then close the file using
fclose. Next, display the result of this reading operation on the screen
using celldisp and cellplot.
With MATLAB 7 the MATLAB user interface has again undergone extensive
modernization, which really makes using this tool substantially easier to use,
both in the interactive mode and for developing programs (see Section 1.7).
In this section these capabilities will be elucidated further. Of course, we
cannot give the reader a complete overview of the manifold capabilities of
the desktop. That would go beyond the scope of this book.
Just a few of the basic principles will be discussed.
FIGURE 1.21 Shortcut toolbar with the self-defined shortcut “clear screen.”
Fig. 1.21 shows a segment of Fig. 1.1 with an icon integrated into the
shortcut toolbar for initiating the often-used MATLAB command clc, with
which the command window can be cleared.
Likewise, a fast way of selecting functionalities in the MATLAB interface
is to right-click the mouse on the available context menu in the corresponding
working window (context!).
Right-clicking the mouse then opens a context related pulldown menu
in which functions can be selected by left-clicking the mouse.
84 INTRODUCTION TO MATLAB & SIMULINK
Tab Completion
An interesting possibility for making MATLAB easier to use in the interac-
tive mode is the tab completion technique. Variable names, function names,
file names, and structures, as well as graphic handles, can be quickly and
efficiently created (in the command window) using the tab key on the PC
keyboard.
To do this, the functionality is first initiated by choosing the appro-
priate box in the menu File- Preferences ... under Command-
Window- Keyboard ....
Then, for example, you can type in the beginning of the function name
in the command window and press the tab key.
Fig. 1.23 shows the result of this operation after entering plo, the first
letters of many plot functions.
The desired function can be selected in the pulldown menu. This is
then entered in the command window. The prerequisite for operation of
this mechanism is, of course, that MATLAB can also find the corresponding
function or variable names (i.e., that these names are entered in the current
search path or in the current workspace).
INTRODUCTION TO MATLAB 85
From this point in time a record will be kept in ASCII format of the MATLAB
session in a file with this name. The file is created in the current directory.
86 INTRODUCTION TO MATLAB & SIMULINK
Configuration Capabilities
In Sections 1.2 and 1.2.1 it has already been pointed out that the interface
shown in Fig. 1.1 does not in the least have a unified structure.
In fact, the user has many options available for molding the appearance
of the interface according to his needs. The docking mechanism has already
been described in Section 1.2.1. With it, partial windows in the interface can
be docked and again be erased. Of course, the layout can also be varied by
pulling with the mouse. Color arrangement, font, and many other aspects
can be controlled via Preferences. Once the layout is changed, it can be
saved using the menu entry Desktop - Save layout ....
It is left to the reader to create a suitable appearance for the layout of
the MATLAB working interface.
The help command help has often been referred to in the preceding sec-
tions. If the name of a command, of a group of commands, or of an entire
toolbox is known, then the statement help <function\_name> can be
entered in the command window to display the desired information in the
command window.
This information can also be obtained by selecting the menu com-
mand help - MATLAB help and entering the corresponding command
or command group in the search window under the index or search
tab. This is especially useful when the precise name of the command is not
known, since the search function permits a search for keywords in the full
text of the MATLAB handbooks. At the same time, logical operations are
possible. Search terms can be joined by the conjunctions AND, OR, and NOT.
Fig. 1.24 shows the help window after entry of graphics AND axis
AND label NOT properties in the field search for: of the
search tab.
INTRODUCTION TO MATLAB 87
Also, in the case of a keyword search, there is, as usual, another possibility
in the form of a MATLAB command, which should not be omitted here. With
the command
>> lookfor 'xlabel'
TEXLABEL Produces the TeX format from a character string.
XLABEL X-axis label.
IMTEXT Place possibly multi-line text as xlabel.
XLABEL4AX Set the XLABEL on a specified axis.
WSETXLAB Plot xlabel.
WXLABEL X-axis label.
all the help texts of the MATLAB command that lie in the search path after
the keyword xlabel will be looked through. MATLAB functions can also
be found very rapidly without leaving the command window by using the
function lookfor.
88 INTRODUCTION TO MATLAB & SIMULINK
t=(0:0.01:2);
sinfct=sin(2*pi*5*t);
cosfct=2*cos(2*pi*3*t);
expfct=exp(-2*t);
plot(t,[sinfct; cosfct; expfct])
xlabel ('time / s')
ylabel('Amplitude')
title('three gorgeous signals')
With
>> fnExample
t=(0:0.01:2);
sinfct=sin(2*pi*f1*t);
cosfct=2*cos(2*pi*f2*t);
expfct=exp(-damp*t);
plot(t,[sinfct;cosfct; expfct])
xlabel ('time / s')
ylabel('Amplitude')
title('three gorgeous signals')
and save it under the name fnExample2.m. Function names and file
names must always be in agreement, since MATLAB searches for func-
tions in an m-file with the same name. In particular, keep in mind that
INTRODUCTION TO MATLAB 91
You can tell that the names in the parameter list are merely place holders
for the true values that will be set in the list when the function is called. The
14
The reader will surely have noticed that the function names of original MATLAB
commands in the help texts are always given in uppercase letters. This merely serves
as emphasis in the help text. The commands, themselves, must be set in lowercase,
as they are defined in that form.
92 INTRODUCTION TO MATLAB & SIMULINK
variables are thus only known and valid within the function core and while
the function is being executed. The variables are said to be local.
This is shown by calling whos after the function call.
Of course, variables rather than numbers can also be assigned to the
function, and if one is no longer interested in the calculated vectors, but only
in the graphic provided by the function for the case at hand, no return vector
is needed. This is shown in the following example:
>> clear
>> whos
>> frq1=6;
>> frq2=1;
>> dmpng=7;
>> fnExample2(frq1,frq2,dmpng);
>> whos
Name Size Bytes Class
As can be seen, the input parameters are now known (they were previously
defined in the workspace) and the return vector is saved in the variable ans,
which is customarily used as the return variable if no other has been specified.
Certainly, the parameters f1, f2, and damp are not known from the
source text for the function. These are, as already noted, place holders for
the actual delivered variables.
Of course, one should not be deceived by this example. The input
parameters are, as before, local.
The following example makes this clear:
function [sum] = fnExample3(a,b)
%
% function fnExample3
%
% call: [sum] = fnExample3(a,b)
%
% second example of a MATLAB function
%
% Calculates the sum of two vectors a and b,
INTRODUCTION TO MATLAB 93
thesum =
-1 4 8
>> whos
Name Size Bytes Class
>> v1
v1 =
1 2 3
>> v2
v2 =
-2 2 5
As we can see, the function fnExample3 calculates the sum of v1 and
v2 in good form. These are still not changed here, although within the
94 INTRODUCTION TO MATLAB & SIMULINK
program the place holder of v1 is squared term by term. This is also
done, but only with a local variable.15 The input parameters themselves are
protected.
In conclusion we should add that, as opposed to the script files, within
a function there is no access to variables in the workspace. This is also a
consequence of the concept of local variables. In addition, there is also no
call-by-reference mechanism, as in the C/C++ programming language;16 that
is, results cannot be returned in the parameter list, but only through the return
vector.
PROBLEMS
Work through the following problems in order to get practice with the
function concept.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 56
Change the function fnExample3 so that access to the result of the squaring
of the vector ..... is possible.
Problem 57
Change the function fnExample2 so that the colors for the graphical plots
can be given through the function and the signal can then also be plotted
accordingly.
Problem 58
Change the function fnExample2 so that the parameters of the function
can be passed on in the form of a parameter structure fctparams. The
structure fields should then contain the original parameters of the function
fnExample2.
Problem 59
Write down a MATLAB function that plots a circular disk with a specified
radius and returns the circumference and area of the disk as a result. Use the
command axis equal in order to make the axis partitions equal in length;
otherwise, the result is an egg.
15
Global parameters can also be defined in MATLAB, but we shall discuss them in
detail later in Chapter 2.
16
There it is realized through pointer variables or references.
INTRODUCTION TO MATLAB 95
The radius and filling color of the disk must be passed on as variables.
For simplicity, the center of the circle should always be set at the origin.
When plotting use the MATLAB function fill for filling polygonal
figures, while you approximate the circle to be drawn with a suitable polygon.
Think about how the points on a circle can be expressed mathematically and
choose suitable points on the circle so that the polygon resulting from joining
the points comes as close as possible to a circle.
Consult the help menu regarding the correct use of fill.
Control flow.
if - Conditionally execute statements.
else - IF statement condition.
elseif - IF statement condition.
end - Terminate scope of FOR, WHILE, SWITCH, TRY
and IF statements.
for - Repeat statements a specific number of times.
while - Repeat statements an indefinite number of times.
break - Terminate execution of WHILE or FOR loop.
continue - Pass control to the next iteration
of FOR or WHILE loop.
switch - Switch among several cases based on expression.
case - SWITCH statement case.
otherwise - Default SWITCH statement case.
try - Begin TRY block.
catch - Begin CATCH block.
return - Return to invoking function.
Argument handling.
...
nargin - Number of function input arguments.
nargout - Number of function output arguments.
varargin - Variable length input argument list.
varargout - Variable length output argument list.
...
Message display.
error - Display error message and abort function.
...
Interactive input.
...
pause - Wait for user response.
...
cmplxNumRe = real(cmplxNum);
cmplxNumIm = imag(cmplxNum);
if cmplxNumRe > 0
if cmplxNumIm >= 0 % first quadrant
radians = atan(cmplxNumIm/cmplxNumRe);
else % fourth quadrant
radians = atan(cmplxNumIm/cmplxNumRe) + 2*pi;
end;
elseif cmplxNumRe < 0 % second and third quadrants
radians = atan(cmplxNumIm/cmplxNumRe) + pi;
else % special case: real part = 0
if cmplxNumIm >= 0 % imaginary part positive
98 INTRODUCTION TO MATLAB & SIMULINK
radians = pi/2;
else % imaginary part negative
radians = 3*pi/2;
end;
end;
degrees = radians*180/pi;
As can be seen in this example, the word for must be followed by the
condition under which the instructions are to be repeated until the end of
the loop (indicated by the word end). This condition must cover a finite
number of cases. In most cases, as in the example, this will be the upper and
lower limits of an integral variable. The loop operation can, moreover, take
place in larger steps. Thus, for example, the instruction
for k=1:2:N
in the above example would cause the calculation to be done only on the odd
components.
In conclusion, it should be noted that the above program for MATLAB is
not at all typical. Many loops, including this one, can be performed more eas-
ily and more elegantly with vectorial constructions in MATLAB (see Problem
61). Of course, there are other situations in which a classical loop construct
cannot be avoided.
With the while-loop employed here, this program will run up to the end-
instruction belonging to the construction as long as the condition specified
102 INTRODUCTION TO MATLAB & SIMULINK
after while is true. In this case the condition is dat>=0. Before the first
run the condition must be evaluable, which in this case means that at least
one value must be read in and evaluated. In other programming languages a
do-while construction exists for these cases; in it the loops will run at least
once in every case. In MATLAB this kind of behavior has to be imitated by
specially evaluating the loop instructions in advance.
By the way, the above example can very easily mislead the beginner
into only writing functions for which the parameters are not input from the
parameter list but are read in interactively via the input-function to the
function. Use of this function is, however, rather untypical and for the most
part is just for test purposes; it creates a sense that, in general, a function of
this sort naturally would not be used within other programs. Thus, you would
be better off to put your energy into understanding the parameter-input
mechanism of MATLAB.
% 'l1norm', 'average',
% 'maxnorm', 'length'
%
% output parameter result calculated value
switch operation
otherwise
disp('Please enter "help multiFnVector"');
error('The input parameter is not allowed!');
end;
t=(0:0.01:2);
switch nargin
case 2
sinfct = sin(2*pi*f1*t);
cosfct = 2*cos(2*pi*f2*t);
plot(t,[sinfct; cosfct])
xlabel('time / s')
ylabel('Amplitude')
title('sine and cosine oscillations')
case 3
sinfct = sin(2*pi*f1*t);
cosfct = 2*cos(2*pi*f2*t);
expfct = exp(-damp*t);
plot(t,[sinfct; cosfct; expfct])
xlabel('time / s')
ylabel('Amplitude')
title('three gorgeous signals')
INTRODUCTION TO MATLAB 105
otherwise
msg = 'The function FSwitchIn must have 2';
msg = strcat(msg, ' or 3 input parameters!'):
error(msg);
end
if nargout < 3
msg = 'The function FSwitchIn should return a time';
msg = strcat(msg, 'vector and two sine signals!');
error(msg);
end
With the aid of nargin and nargout the function can determine the
number of parameters used in the call. In this example it has been used to
collect certain input combinations and, if necessary, set error messages.
With special cell arrays, varargin and varargout can, moreover, be
used to process input parameter lists and output parameter lists of variable
length. Here they should always be specified as the last arguments in the
definition of functions. When the functions are called, parameter lists of
arbitrary length can appear in this position. The interested reader is referred
to Problem 67 for a further discussion of this topic.
PROBLEMS
Work through the following problems for practice with MATLAB program-
ming constructs.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 60
Write a function using a loop construction, which selects the positive values
in a vector input to the function and returns these values assembled into an
output vector (see Section 1.2.3).
Problem 61
Write a function that calculates the standard scalar product of two vectors
(see Problem 9) using a for-loop.
This solution is not very elegant and is not typical of MATLAB. How
would a MATLAB programmer solve this problem?
Problem 62
Write the function FInput so that the negative number required to end the
input is not read into the output vector.
106 INTRODUCTION TO MATLAB & SIMULINK
Problem 63
Write a function that plots sin (x) between 0 and 2π in a specified color. The
color should be read as a parameter in the form 'red', 'blue', 'green',
and 'magenta'. The different cases for the color are to be distinguished
using a switch...case construct.
Problem 64 √
Using a while-loop, program the approximation for 2 based on Newton’s
method with the aid of the recursion relation
x2n + 2
xn+1 = , x0 = 2 . (1.3)
2 · xn
Problem 65
With a while-loop, write a MATLAB function that provides the quotient
of two whole numbers a and b along with the remainder.
For a = 10 and b = 3, for example, this function should yield the result
q = 3 with remainder r = 1. Thus, it should take place as follows: within the
while-loop b will be taken from a as long as possible without the remainder
being smaller than b. In the example given here this can obviously be done
three times and the remainder is 1.
There is no need to verify within the program that a and b are positive
whole numbers. When programming, assume that the program will only be
called with positive whole numbers.
Problem 66
Write a function that plots two sinusoidal oscillations. The frequencies of the
oscillations must be specified as a parameter. Likewise, the plotting range,
plot color, and a label for the function must be entered. To do this, the
structure Graphic in Section 1.3.1 should certainly be used.
Problem 67
Write a function that plots an arbitrary number of sinusoidal oscillations (over
the same time interval). Thus, the input parameter for the function should
include the vector for the (step size) time points, followed by the frequencies
of the oscillations. In defining this function use the cell array varargin for
inputting the variable list of frequencies. With help varargin ascertain
in what way the contents of the varargin lists can be accessed. Reread
Section 1.3.2 on cell arrays before doing this.
INTRODUCTION TO MATLAB 107
theCommands =
>> eval(theCommands)
Name Size Bytes Class
>> z
z =
for k=1:N
printcommand = ...
['fprintf(''%', digs,'.', psts, 'f\n'',', num2str(x(k)),')'];
eval(printcommand);
end
The call
shows that the vector x is obviously displayed correctly and, as desired, with
six places after the decimal point and a width of ten places.
The construction of the print command inside the function core certainly
merits comment. First, the syntax of the command fprintf requires that
the formats be given as a string. A normal call in the above example for the
k-th component of x would look like
fprintf('%10.6f\n',x(k))
PROBLEMS
Problem 68
Write a program that generates n random signals of length 10 using the
random generator function rand, stores these in variables, and then writes
these variables individually in ASCII format in text files. The number n of
signals should be specified as a parameter in the function. The name of the
files should be automatically generated using the number n.
As for using rand, consult MATLAB help.
Problem 69
With a bit more thought, the function FprintfEval.m can also be written
without using the function eval. Figure out how.
value =
0.9093
value =
0.9093
The handle FH_Sin is a pointer indicating the function code for sin. Thus,
this function will be executed when FH_Sin is called. It naturally leads to
the same result.
In the versions prior to MATLAB 7 the call had to be carried out with
the help of the function feval in the following form:
>> value = feval(FH_Sin, 2)
value =
0.9093
INTRODUCTION TO MATLAB 111
The function feval and this call convention are still supported in
MATLAB 7. Function feval should, however, no longer be used in self-
developed MATLAB programs in order to avoid later compatibility problems.
Thus, we shall not discuss this function further.
Instead, we shall proceed to the uses to be made of the transfer of a
function handle. This can be clarified by an example. To do this we first
examine the following source text for the function fnExample4:
function [integral] = fnExample4(a, b, F, N)
%
% Function fnExample4
%
% call: [int] = fnExample4(a, b, F, N)
%
% sample call: integ = fnExample4(2, 4, @tstfnct, 3)
%
% An example of manipulating function handles
%
% The present example calculates the integral of
% the function F, whose name is passed on as
% a function handle to fnExample4, over the limits [a,b].
% Simpson's rule is used to calculate the integral;
% for that the range of integration is partitioned
% into two times N intervals.
simpint =
-1.6662
PROBLEMS
Work through the following problems for practice with manipulating function
handles.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 70
Write a function with which you can calculate numerically the integral of a
given real function with two limits a and b using the trapezoid rule.
Modify fnExample4 to do this.
INTRODUCTION TO MATLAB 113
Problem 71
Write a function with which you can calculate numerically the integral of
a given real function with two limits a and b using Simpson’s rule and the
trapezoid rule, where, on one hand, you rely on a comparison of the functions
fnExample4.m and the solution from Problem 70 and, on the other, on the
MATLAB functions quad and trapz. This function should have no return
value, but all the results should be formatted with fprintf and displayed
on the screen.
...
The rest of this description deals with other options within this command.
These, however, are not relevant at the beginning.
The returned parameters for this function are the calculated time vector
T and the corresponding value matrix of the solution(s) Y.
As you can gather from this description, besides the initial conditions y0
and the interval ([t0 , tfinal ]) over which the solution is to be calculated, the
method ode23 must be supplied with one or a system of ordinary differential
equations in an m-file. The file name will, in turn, be passed on to the ode23
method as a function handle.
The procedure is similar for ode45 and the other methods.
We now illustrate this procedure with a (classical) example.
Mathematical Pendulum
We are interested in the solution of the differential equation for the so-called
mathematical pendulum,
g m
α̈(t) = − · sin (α(t)), g = 9.81 . (1.4)
l s2
Here, α(t) is the angle that the pendulum (of length l) forms at time t
relative to its equilibrium position (see Fig. 1.25).
Since we are dealing with a second order differential equation, its solution
requires two initial conditions,
α(0)
α (0) = , (1.5)
α̇(0)
which define the starting position (deflection) of the pendulum and its initial
velocity. These initial conditions are passed on to the integration method as
the vector for y0 .
INTRODUCTION TO MATLAB 115
1
α
Equilibrium position
%% Setting constants
%% Preliminary initialization
alphadot = [0;0];
α(0) α1 (0)
α (0) = = . (1.10)
α̇(0) α2 (0)
0.8
0.6
0.4
0.2
−0.2
−0.4
−0.6
−0.8
0 2 4 6 8 10 12 14 16 18 20
ans =
0 0.7854 0
0.0001 0.7854 -0.0001
0.0007 0.7854 -0.0005
0.0036 0.7854 -0.0025
0.0180 0.7853 -0.0125
0.0901 0.7826 -0.0624
0.2372 0.7659 -0.1634
0.4390 0.7193 -0.2976
0.6822 0.6283 -0.4470
0.9558 0.4857 -0.5894
...
ans =
0 0.7854 0
0.1000 0.7819 -0.0693
0.2000 0.7715 -0.1381
0.3000 0.7543 -0.2059
0.4000 0.7304 -0.2723
0.5000 0.6999 -0.3366
0.6000 0.6631 -0.3985
0.7000 0.6202 -0.4572
0.8000 0.5717 -0.5123
0.9000 0.5178 -0.5631
1.0000 0.4592 -0.6091
1.1000 0.3961 -0.6498
1.2000 0.3293 -0.6845
1.3000 0.2593 -0.7130
1.4000 0.1868 -0.7346
The step size (see the vector t) is now, as desired, uniform with a separation
of 0.1.
INTRODUCTION TO MATLAB 119
Another important comment touches on the fact that in this example the
parameters g and l required in the description function pendde are defined
with fixed values.
Thus, in the present version g and l can be varied only if the source text
of pendde is modified. This cannot, of course, be the answer if, for example,
the pendulum length is to be varied in the course of a multiple simulation.
Nevertheless, it is possible in principle to provide other parameters to
the definition functions for the differential equations. The interested reader
can turn to the related MATLAB documentation or the MATLAB help to
examine this question and, if necessary, for dealing with Problem 77.
RC Low-pass Filter
We conclude this section with another, somewhat simpler example.
Fig. 1.27 is a circuit diagram of an RC combination with a voltage source.
The voltage at the output of the system obeys the following first order,
linear differential equation:
d 1 1
u(t) = − u(t) + u1 (t) . (1.11)
dt RC RC
We solve this differential equation numerically using MATLAB’s ode23
function, first by representing the differential equation in a MATLAB
function named RCcomb as follows:
function [udot]= RCcomb(t,u)
%
% Function RCcomb
%
% call: [udot] = RCcomb(t,u)
%
% Example of the solution of differential equations
120 INTRODUCTION TO MATLAB & SIMULINK
R = 10000; % resistance R
C = 4.7*10e-6; % capacitance C
udot = 0; % preinitialization
then provide the solution shown in Fig. 1.28 in the time interval [0, 3] s. Here,
fixed values of 10 k and 4.7µF, which yield a time constant of τ = RC =
0.47 s, have been used.
This value can be read very nicely off the graph, since it is known that in
that time the response to a step function reaches (1 − e−1 ) times, or 63 % of
the height of the step (here 1).
INTRODUCTION TO MATLAB 121
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
0 0.5 1 1.5 2 2.5 3
FIGURE 1.28 Step function response of the RC combination for 10 k and 4.7 µF.
PROBLEMS
Work out the following problems for practice in solving differential equations
with MATLAB.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 72
Write a function with which the differential equation of the mathematical
pendulum in its linearized form,
g
α̈(t) = − · α(t) (1.12)
l
can be solved.
Modify pendde.m accordingly.
Then compare the two numerical solutions for large initial deflections.
Problem 73
Determine the solution of Eq. (1.11) for this RC combination with a voltage
source for different excitation functions (source voltages) u1 (t).
122 INTRODUCTION TO MATLAB & SIMULINK
Problem 74
Solve one of the examples of differential equations using the procedure
ode45 and compare this solution with that from ode23.
Problem 75
Solve the following differential equation for a growth process using MAT-
LAB:
Ṗ(t) = α(P(t))β with α = 2.2, β = 1.0015 . (1.13)
Problem 76
Use MATLAB to solve the differential equation for the so-called VZ1-
element (first-order delay element),
d 1 K
ν(t) + ν(t) = u(t) . (1.14)
dt T T
At the same time, make some reasonable assumptions about K and T, with
which you can propose a probability interpretation.
Problem 77
Solve the differential equation for the mathematical pendulum (Eq. 1.4) for
different pendulum lengths using MATLAB. It should be possible to transfer
the respective pendulum lengths by calling the solution algorithm (ode23).
In addition, after checking with MATLAB help, modify pendde.m in
a way such that other parameters can be passed on through the definition
function for the differential equation.
Problem 78
Solve the system of differential equations
ẏ1 (t) = − 2y1 (t) − y2 (t) y1 (0) = 1, (1.15)
ẏ2 (t) = 4y1 (t) − y2 (t) y2 (0) = 1 (1.16)
with the aid of MATLAB. Compare the solution with the exact solution, which
you can calculate by hand or by using the symbolics toolbox (see Section 1.8).
Problem 79
If only one return value is specified, the functions ode.. yield a structure
that contains all the necessary statements about the solution. This structure
can be processed by the function deval.
Familiarize yourself with the syntax of deval and solve Eq. (1.4) once
again using ode23. Next, evaluate the result using deval for equidistant
partition points separated by 0.01. Plot the solution using the return value of
deval.
INTRODUCTION TO MATLAB 123
The editor window (1) is useful for the input of the (program) text. Style,
font, and color can be set using Preferences.
Cells represent an important innovation. Cells are sections that can open
with a comment line, which begin with two comment symbols (%%) and
extend to the next line, also beginning with (%%) or to the end of the file. If
the cursor is positioned in a cell, the cell will be highlighted in color (provided
the cell-mode is switched on in the Cell menu).
Cells are useful in program development. By using the menu command
in the Cell menu or using the icons in the cell toolbar (4), cells can be
specially executed (Evaluate Cell icons in front). In this way, individual
variables can be changed (either in the Edit fields in (4) or in the workspace),
and the operation of the code can be tested. In addition, cells simplify
the documentation of m-files (only scripts). Various formats for document-
ing an m-file can be chosen via the menu entry File - Publish to.
The cell definition lines (%%) will be taken over as headings in this
documentation.
INTRODUCTION TO MATLAB 125
It should be made clear here that cells are primarily intended for the
development of script files. Of course, cells can also be used in MATLAB
functions, but in that case all the variables employed must be defined in the
workspace during the development phase.
Besides the customary standard entries for windows editors, entries for
program development and debugging (Cell, Tools, Debug) can be found
in the menu list (3). The icons (5) can be used to divide the screen into several
work windows when more than one file is to be processed. The icons (6) for
selecting debugging functions will be discussed in the next section.
FIGURE 1.30 Editor-debugger with the pendde.m file open, a breakpoint and the
displayed variable content.
Of course, the values of the variables are not just displayed. The values
can also be changed for the runtime of the program, which is very useful for
testing.
In the command window the debug mode can be recognized by a
modified prompt,
K>>
It is best to change the variables at this point. Thus, for example, after the
stop at the breakpoint shown in Fig. 1.30 the components of the variables
alpha can be set to 0.5 and 0.1 using the command
K>> alpha = [0.5;0.1]
If the program is then run in the debug mode (see the menu entry Debug),
further calculations will use these values.
Of course, as we have already explained in Section 1.6.2, each function
has its own memory domain. Only those variables (see whos) that belong to
the so-called function stack of the function within which the program stops
are available. The memory domain can indeed be changed, as needed, in the
pull-down menu Stack (6).
Readers are urged to become familiar with the capabilities of the debug-
ger. This relatively small effort will be amply repaid if they want to develop
larger MATLAB programs.
INTRODUCTION TO MATLAB 127
Besides the debugger, there are other tools for supporting program
development: code checks with M-Lint and the profiler.
Extensive runtime analyses can be carried out with the profiler, but these
are clearly useful only to the advanced user. With the M-Lint program (in the
menu Tools - Check Code with M-Lint) a statement can be set in
which the programmer is informed, for example, about unused variables,
syntax errors, or other absurdities in the code. This can also be useful for the
beginner.
Linear Algebra.
...
eig - Eigenvalues and eigenvectors.
...
poly - Characteristic polynomial.
128 INTRODUCTION TO MATLAB & SIMULINK
Simplification.
simplify - Simplify.
...
subs - Symbolic substitution.
Solution of Equations.
solve - Symbolic solution of algebraic equations.
dsolve - Symbolic solution of differential equations.
...
...
Basic Operations.
sym - Create symbolic object.
syms - Short-cut for constructing symbolic objects.
pretty - Pretty print a symbolic expression. ...
...
for example, the symbols x, y, and v are established. A look at the workspace
confirms this:
>> whos
Name Size Bytes Class
v 1x1 126 sym object
x 1x1 126 sym object
y 1x1 126 sym object
Grand total is 6 elements using 378 bytes
with respect to y or v:
>> f = sin(x*y^2)*cos(v*x*y) % defining the function
f =
sin(x*y^2)*cos(v*x*y)
dfy =
2*cos(x*y^2)*x*y*cos(v*x*y)-sin(x*y^2)*sin(v*x*y)*v*x
dfv = -sin(x*y^2)*sin(v*x*y)*x*y
The interesting thing in this example is that the MATLAB function diff is
given twice, namely as an “ordinary” MATLAB function (see help diff)
and as an “overloaded” symbolic function (see help sym/diff). This tech-
nique makes it possible to use a natural name assignment, although at a price,
in that the user has to pay attention to exactly which of the functions is meant.
The preceding example reveals an important disadvantage of the sym-
bolics toolbox. In most cases, the output of results is very obscure and hard
to read. It is highly recommended that the command pretty be employed,
in order to make the output in the command window readable; for example,
>> f = sin(x*y^2)*cos(v*x*y);
>> pretty(f)
2
sin(x y ) cos(v x y)
>> dfy = diff(f,'y');
>> pretty(dfy)
2 2
2 cos(x y ) x y cos(v x y) - sin(x y ) sin(v x y) v x
2
-sin(x y ) sin(v x y) x y
130 INTRODUCTION TO MATLAB & SIMULINK
ans =
f := sin(x*y^2)*cos(v*x*y)
df =
-sin(x*y^2)*y^4*cos(v*x*y)-2*cos(x*y^2)*y^3*sin(v*x*y)*v
-sin(x*y^2)*cos(v*x*y)*v^2*y^2
df =
-sin(x*y^2)*y^4*cos(v*x*y)-2*cos(x*y^2)*y^3*sin(v*x*y)*v
-sin(x*y^2)*cos(v*x*y)*v^2*y^2
2 4 2 3
-sin(x y ) y cos(v x y) - 2 cos(x y ) y sin(v x y) v
2 2 2
- sin(x y ) cos(v x y) v y
FIGURE 1.31 Rectified sine wave and the RMS equivalent voltage.
This figure shows a rectified sine wave of period T = 2π s and the RMS
voltage associated with it.
In order to calculate this using MATLAB, we enter the following
MATLAB sequence:
>> T = 2*pi; % set the period
>> t=(0:0.5:2*pi); % subdivide the time interval
132 INTRODUCTION TO MATLAB & SIMULINK
Here, we obtain the following approximation of the RMS value using a numer-
ical integration technique (the trapezoid rule with the MATLAB function
trapz):
Ueff =
0.7050
The errors associated with this approximation and, thereby, those associated
with the discrete partitioning of the time interval, must now be calculated.
In this simple example the RMS value can, in fact, be calculated exactly,
once the capabilities of the symbolic toolbox are employed. Here, the solution
looks like this:
>> T = 2*pi; % set the period
>> t=(0:0.5:2*pi); % subdivide the time interval (but
% this time only for the plot)
>> f=sqrt(sin(t).^2); % Define the rectified sine wave
% (for the plot)
>> syms x P % Define symbolic quantities
% (not t and T; otherwise time vector
% and period T would be overwritten)
>> F = sqrt(sin(x)^2); % Define signal symbolically
% Integrate the integral SYMBOLICALLY
% with respect to x over [0,P]
% (This is the EXACT value of
% the integral)
>> UeI = int( (1/P)*F^2,x,0,P)
UeI =
1/2*(-cos(P)*sin(P)+P)/P
Ueff =
0.7071
Now the exact value of Ueff can be calculated numerically. The exact value
is, in general, always √1 for a sinusoidal oscillation of amplitude 1. This is
2
completely independent of the period.
In the above example, you can also see the numerical errors in the approx-
imation with trapz, which originate in the excessively coarse subdivision
(here 0.5) of the range of integration.
In general, symbolic conversions of this type are often advantageous,
especially for calculating derivatives (see Problem 83) or for solving simple
differential equations.
PROBLEMS
Work through the following problems involving the symbolic toolbox. Before-
hand, make a precise study with help ... of the syntax of the symbolic
functions that you might use.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 80
Integrate the function
g(x) = sin (5x − 2) (1.17)
twice symbolically (generation of antiderivatives).
Problem 81
Determine the 3rd order Taylor expansion term for the function g(x) about
the expansion point x0 = 1.
Problem 82
Solve the differential equation
ẏ = xy2 (1.18)
Problem 83
Plot the function from Problem 80 along with its first and second derivatives
over the interval [0, 10] superimposed in the same plot window in different
colors.
Problem 84
For readers with knowledge of MAPLE and the complete version: Inte-
grate the function from Problem 80 twice symbolically (generation of
antiderivatives), employing the functionality of MAPLE.
Chapter 2 INTRODUCTION
TO SIMULINK
S
imulink is a tool for simulating dynamic systems with a graphical
interface specially developed for this purpose. Within the MATLAB
environment, Simulink is a MATLAB toolbox that differs from the
other toolboxes, both in this special interface and in the special “program-
ming technique” associated with it. There is a further difference, in that the
source code of the Simulink system is not open, but this is of no concern for
our purposes. The goal of this chapter is to introduce simple manipulations
with Simulink and to clarify the interaction of Simulink with MATLAB.
135
136 INTRODUCTION TO MATLAB & SIMULINK
are essentially looking for nothing more than the solution of the differential
equation underlying the system.
It is also possible to convert a differential equation into a block diagram
and to solve the differential equation numerically with Simulink. Simulink is,
therefore, a numerical differential equation solver.
Section 2.1 shows how to use Simulink for this purpose.
The Simulink program is started with the command simulink or the com-
mand open_system('simulink.mdl') in the MATLAB command
window. In the first case, a so-called Block Library Browser (see Fig. 2.2) is
opened. This displays the available blocks in the Simulink library in the form
of a list or in the form of icons in the customary mode of Windows Explorer
or other modern compilers.
The block library is organized into functional groups, for example for
the production of signals (functions), as Sources, or blocks of functions for
nonlinear operations, as Nonlinear.
In the second case, that is on calling open_system ('simulink.
mdl'), a window appears in which the symbols for the different classes of
blocks of functions are only displayed in the form of icons.
Of course, it is a matter of taste which form of opening you choose
for Simulink. In the following we prefer the first solution, since it is easier
to input the command simulink. Once a list entry or icon is selected, a
window section opens up in the Simulink Library Browser with the
function symbols contained in the function library. Clicking on Sources,
for example, opens up the window shown in the background in Fig. 2.2,
INTRODUCTION TO SIMULINK 137
FIGURE 2.2 Simulink library browser (foreground) and the opened Simulink function
library Sources (background).
138 INTRODUCTION TO MATLAB & SIMULINK
FIGURE 2.3 The Simulink system s_test1 after insertion of the Sine Wave-Block.
INTRODUCTION TO SIMULINK 139
FIGURE 2.4 The Simulink system s_test1 after insertion of the Sine Wave-Block
and the Integrator-Block.
The reader should not be bothered by the entry 1s in the integrator block.
This relates to the Laplace transform of the integration. Most of the linear
function blocks are characterized by the Laplace transform or Z-transform
(the discrete counterpart of the Laplace transform). Here we will not dwell
on these transforms, since in this introduction we basically only need the
integrator block.
We now extend the test system s_test1 so that the sine signal and
its integral can be seen in a single window. To do this we first choose a
140 INTRODUCTION TO MATLAB & SIMULINK
Multiplexer block1 Mux from the Signal Routing library and add it to
the system, and choose the block Scope from the Sinks library. The source
signal and the integrator output are finally connected by mouse movements
to two inputs of the multiplexer and the output of the latter, to the input
of the Scope block. When connecting “around a corner,” as with the signal
passing from the source signal to the multiplexer, the mouse button has to
be released twice along the way. Note also that a connection to a signal path
(here between the source and integrator) is only correct if a small rectangular
point appears at the crossing point.
The (almost) ready system can be seen in Fig. 2.5.
1
Its task is to combine multiple signals into a single vector-valued signal.
INTRODUCTION TO SIMULINK 141
FIGURE 2.6 The parameter window for the Simulink block Mux.
The number of inputs for the multiplexer can be freely specified there
in the entry under Number of inputs.
The Display option parameter is also of interest. Here, the graphi-
cal representation of the multiplexer can be changed. The representation set
there, bar, shows the multiplexer as a thick line, which is especially suitable
for many inputs. With only two inputs, as in our case, it may be better to set
signals, for in this case the input ports of the block, after enlargement
of the symbol with the mouse, will be supplied with the names of the sig-
nals (See the comments on labeling the signal arrows below), which greatly
increases the clarity, especially for large simulation systems.
We parametrize the sine signal in similar fashion. Double-clicking its
block opens up the window shown in Fig. 2.7.
142 INTRODUCTION TO MATLAB & SIMULINK
FIGURE 2.7 The parameter window for the Simulink block Sine Wave (Source
signal).
Here, we can set the amplitude, frequency (in rad/s), and phase. We
leave the parameter Sample time at 0 since we want to carry out a (quasi-)
continuous simulation. It should only be changed if we perform an explicitly
discrete (in time) simulation. In that case we would have to enter a sample
time in this space.
INTRODUCTION TO SIMULINK 143
FIGURE 2.8 Display window for the Simulink block Scope with an open Parameters
window.
144 INTRODUCTION TO MATLAB & SIMULINK
directly as a MATLAB variable is very interesting. Fig. 2.8 shows how the
scope signal can be saved in standard MATLAB matrix format2 as the variable
S_test1_signals.
Unfortunately, this option (Array) is not the default. Thus, you should
remember at this point to convert to the matrix format if you want to use this
capability for data export to the MATLAB workspace. Also, the check mark
next to Limit data points to last: should always be removed,
since otherwise only the last part (here just the last 5000 points) would be
displayed in long simulations.
In other respects, the display of the signal in Scope is set up after the sim-
ulation using the toolbar buttons. The reader should simply check these out
once. The Scope should be opened up right away, anyhow, for, unlike in
earlier versions of Simulink, the graphics are not opened up automatically
after the simulation.
The last bit of polish is provided by the labeling mentioned above.
Double-clicking in the model window yields a blinking cursor. Here, free text
can be typed into a display label and can be modified according to taste using
the menu entry Format - Font. In this way the system can be supplied
with a title and production date.
The labeling of signal arrows is also very useful. Double-clicking on one
of these arrows makes it possible to give this signal a name. These names
move with the arrow even if it or an associated block is shifted. Names of
inputs to blocks, like that for Mux, which are linked to signal names will be
automatically changed along with it. If necessary, the block must be enlarged
or moved in order for this change to work.
Likewise, the labeling of the system with plot instructions is very useful
for later output of the results via MATLAB. This makes it easier to use the
system later, since these specifications can just be brought into the MATLAB
command window using the cut-paste mechanism.
Fig. 2.9 shows the result of our efforts, the system s_test1.mdl ready
to go.
The parametrization of the blocks is thereby complete and if we now
quickly save our system with File - Save, we no longer have to worry if
the operating system suddenly crashes.
2
In MATLAB 7 and Simulink 6, as noted in Chapter 1, other data structures that
go beyond the matrix format are possible. We recommend using the matrix format
unless compelling reasons indicate the contrary.
INTRODUCTION TO SIMULINK 145
more profound discussion of the procedures would go well beyond the scope
of this MATLAB-Simulink introduction, for the most modern mathematical
procedures are brought into use. At the beginning we only need a few meth-
ods ode23, ode45, and ode3 which are based on the familiar Runge-Kutta
method, which we are already somewhat acquainted from Chapter 1. You
can consider the other procedures after you have enough experience with
simulations and come upon problems that require their use.
The class of Variable-step procedures work with a built-in step size
control; that is, they change the step size of the numerical solution procedure
in accordance with the dynamic behavior of the solution. If the solution varies
little, then the step size is automatically set larger, while if the solution varies
a lot, it is iterated with smaller step sizes. How much these step sizes are
able to vary and with what tolerance can be controlled using the parameters
Step size and tolerance. To go into more detail here would take us
too far. The default values are sufficient for most cases.
If you select the Fixed-step procedure class, you’ll see that the menu
for the step width changes. Now the desired (and thence, fixed) step size
can be specified for the procedure. The other settings should initially be left
unchanged.
INTRODUCTION TO SIMULINK 147
shows that three vectors are saved as columns. One of the columns,
the first, is the time vector (vector of the reference points for the solu-
tions). In the present case the time vector is also supplied to the
MATLAB workspace as the variable t, since the option Time was
selected in the Configuration Parameters window under Data
Import/Export - Save to Workspace.
>> plot(S_test1_signals(:,1), ...
[S_test1_signals(:,2),S_test1_signals(:,3)])
>> title('Result of s_test1 with ode3')
>> xlabel('Time /s')
>> ylabel('Function value')
>> grid
The result can also be produced with labels in MATLAB (Fig. 2.12).
INTRODUCTION TO SIMULINK 149
FIGURE 2.12 The result of the sample simulation after processing by MATLAB.
PROBLEMS
Problem 85
Try out the test system s_test1 with different simulation step sizes and
using step size control.
Compare, in particular, the calculation time for a step size of 0.00001,
once using ode3 directly with this step size and again using ode23 with
conversion of the answer to a step size of 0.00001. Interpret the results.
Problem 86
Think about why the result of the simulation of the test system s_test1
displays the solution of the differential equation (initial value problem )
ẏ(t) = x(t) , y(0) = 0 . (2.1)
Which of the signals is x(t) and which is y(t)?
Problem 87
Design a Simulink test system s_soldiff for the differentiator block
Derivative. For this it is best to modify the system s_test1.
150 INTRODUCTION TO MATLAB & SIMULINK
using Simulink and with the aid of the Integrator block and set up a
Simulink system of this sort.
Compare the resulting numerical solution with the exact solution.
A Simple Example
To warm up, we begin with a simple second order initial value problem. We
shall solve the differential equation
Basically, here we should note that when a new topic or a new con-
cept is being introduced, setting up simple examples is a reasonable strategy.
This is especially true when becoming familiar with new software. The idea
for solving Eq. (2.3) with Simulink is the following: by systematic integra-
tion of the derivative of the desired solution with the Simulink integrator,
one obtains the solution. Suppose for a moment that ÿ(t) is already known;
then the solution y(t) can be calculated using the integrator chain shown in
Fig. 2.13.
INTRODUCTION TO SIMULINK 151
FIGURE 2.15 The parameter window for the Simulink system of Fig. 2.14.
INTRODUCTION TO SIMULINK 153
FIGURE 2.16 The Simulink system s_logde for solving a logistic differential equation.
A fixed step size of 1 (the unit of time) yields the solution shown in
Fig. 2.17.
This agrees well with the theoretical solution
γ 1 τ
P(t) = , C= − , (2.6)
τ + γ Ce−γ t P(0) γ
for the chosen value of γ and τ . It is interesting to point out here that the
simulation is considerably faster with automatic step size control. Of course,
for a correct interpretation of the result the internally generated time vector
must also be saved.
Here x(t) represents the deviation from the equilibrium position at time t.
In gases or liquids and for rapid motion of masses, it is found definitively,
however, that the force owing to friction on an object is generally not pro-
portional to the velocity ẋ(t), as in Eq. (2.7), but is proportional to the square
of the velocity (newtonian friction).
This leads to the following differential equation:
The equation is split into two because the reversal of the direction of the
velocity has to be taken into account. The sign in front of ẋ(t) is lost when the
velocity is squared, and this sign indication has to be restored.
Eq. (2.8) can be rewritten using the so-called sign function,
1 for y ≥ 0 ,
sgn(y) :=
−1 for y < 0
INTRODUCTION TO SIMULINK 155
as follows:
mẍ(t) + b · sgn(ẋ)ẋ2 (t) + cx(t) = 0 . (2.10)
1
b = cw A (2.11)
2
1 kg kg
b= · 63.6943 · 10−4 · 1.29 m2 3 = 0.00411 .
2 m m
Here, we set a value of 0.1552 N/mm for the spring constant, which
corresponds to 155.2 N/m. This yields the following differential equation:
Let us review the physical units once again at this point. The terms in
kg·m
Eq. (2.12) are forces. All the units must, therefore, reduce to N = s2 .
In the first term, the units of the 0.5 are kg and those of the second derivative
of the displacement x(t) with respect to time are sm2 ; in the second term b
kg 2
is in units of m and ẋ2 (t) is in units of ms2 . sgn(ẋ) is dimensionless. In the
third term, c is in units of N/m and x(t) is in units of m. All three terms are,
therefore, in units of N.
Now we can proceed in good conscience to setting up a numerical
solution with Simulink.
Since we are dealing with a second order equation, we require two inte-
grators which, subject to the initial conditions represented in the initialization
of the integrators, integrate ẍ(t) to obtain the solution x(t). As initial conditions
we take a displacement of x(0) = 1 m and an initial velocity of ẋ(0) = 0 m/s.
We feed the (negative) sum of x(t) and ẋ2 (t) with the coefficients given in
Eq. (2.12) and the nonlinearity sgn(ẋ) back into the first integrator.
This yields the Simulink system s_denon shown in Fig. 2.19.
In order to be able to display the solution with step size control
activated in MATLAB, besides directing the solution into a scope sink,
we direct it into a MATLAB sink, which will store the solution in a
vector DEsolution. In order to have the time reference, we desig-
nate the parameter time in the entry Data Import/Export under
Simulation Configuration Parameters. The default name t for
the time vector can be changed at will. In both cases, you have to make sure
to set array for the prescribed places as the save format, so that the results
appear as matrices and vectors in the workspace.
3
It is fated that the physical units must be brought into a form in which SI units are
finally used. Otherwise, there is a danger of using incorrect numerical values, such
as when mm and then later m is used in the calculations.
INTRODUCTION TO SIMULINK 157
The solution for the set parameters and initial values is displayed in
Fig. 2.20. It was calculated using the ode45 procedure with step size con-
trol activated (parameters:Initial Step Size = auto, Max Step
Size = 10, tolerances = 1e-3)) over the time interval [0, 10].
PROBLEMS
Work through the following problems to practice the techniques for numer-
ically solving differential equations with Simulink.
NOTE Solutions to all problems can be found in Chapter 4.
Problem 89
Model the mechanical oscillator problem with a hemisphere instead of a
steel plate and water as the medium instead of air. The drag coefficient cw
varies for a hemisphere depending on whether its flat or round side lies in
the direction of the motion. For the flat side, it is cw = 1.2 and for the round
side, cw = 0.4. Take this into account in a modified Simulink system where
you distinguish the two cases using a switch-Blocks block.
Problem 90
Design and test a Simulink system for solving Eq. (1.4) for the mathematical
pendulum.
158 INTRODUCTION TO MATLAB & SIMULINK
Problem 91
Design and test a Simulink system for solving the initial value problem
Compare the result with the exact solution. Next, incorporate the capabil-
ity of simulating a perturbation function (i.e., an inhomogeneity, with the
right-hand side = 0) into the Simulink system. Try out the system with the
perturbation function e−t .
Problem 92
Solve the initial value problem
Problem 93
Solve the system of differential equations
ẏ1 (t) = −3y1 (t) − 2y2 (t) , y1 (0) = 1 , (2.15)
ẏ2 (t) = 4y1 (t) + 2y2 (t) , y2 (0) = 1 (2.16)
with a suitable Simulink system. Compare the solution with the exact solution,
which you can calculate by hand or with the aid of the symbolics toolbox.
in Fig. 2.21.
160 INTRODUCTION TO MATLAB & SIMULINK
You can see that the whole feedback branch of Fig. 2.16, consisting of
two Gain blocks, a summation block, and a multiplication block, has been
assembled into a single block.
When using the Fcn block it should be kept in mind that the input signal
for the block is always called u, regardless of how it may be denoted in the
system. The input signal can be a scalar or vector quantity. If multiple signals
have to be fed into an Fcn block, then they can (and must) be combined
beforehand into a vector signal using a Mux block. With vector input signals,
the components are addressed by indexing (u(1), u(2), ...) within
the block. The output signal is always a scalar quantity.
FIGURE 2.22 Selecting the blocks that will be assembled into a subsystem.
Fig. 2.16 as a formula and stuffing it into an Fcn block, as we did in Fig. 2.21,
it could actually be viewed as a partial system, which can be represented4 as
an independent Simulink block with an input and an output.
To do this you first select the system blocks that are to be combined into
a subsystem. This can be done most easily by drawing a box with the mouse
or, if the blocks do not lie in a rectangle, by clicking with the shift key pressed.
Fig. 2.22 shows this for the system s_logde.
Here, it should be kept in mind that besides the blocks, the signal lines
have to be selected,5 especially those for the in- and output signals.
After this selection, you choose the menu entry Edit - Create
subsystem and get the system shown in Fig. 2.23.
You can see that the marked blocks have been replaced by a single block
with an input and output. Its “insides” can be viewed by double-clicking on
the newly created block (Fig. 2.24). Depending on the Simulink settings,6
this will open up a separate model window or display the subsystem in the
same window.
4
Of course, this would not normally be done for such a simple problem. The pre-
viously proposed solutions are preferable. This example serves only to illustrate the
procedure for constructing subsystems.
5
The sink blocks are initially uncoupled in s_logde.mdl, since otherwise three
lines would be interpreted as an input signal during subsystem construction.
6
See the MathWorks Simulink 6 Handbook, 2004.
162 INTRODUCTION TO MATLAB & SIMULINK
FIGURE 2.23 The system s_logde after creation of the subsystem (file s_Logde3.m).
You can see that two new blocks have been added to the combined blocks.
These are the blocks In1 and Out1 from the block library’s Sources and
Sinks, respectively. The input and output are correspondingly connected
to the created Simulink subsystem by means of these blocks.
The system s_Logde3 is now fully functional and can be executed.
Parameters can be changed inside the subsystem by opening the parameter
windows of the blocks as usual.
Starting up the so-called model browser with the menu command
View - Model Browser Options - Model Browser displays the
hierarchical structure of the system as shown in Fig. 2.25.
The left panel shows a model-tree (which is, of course, very small here)
that exhibits the partial systems of which the whole system is composed.
FIGURE 2.25 The system s_Logde3 with the model browser activated.
With this resource it is very easy to find your way in complicated, nested
systems.
As an alternative to the above procedure, a subsystem can also be
constructed by selecting the block Subsystem from the block library
Ports&Subsystems and displaying it in a model window. Double clicking
on this block opens a model window in which the partial system can be made
available.
Finally, it should be mentioned that the self-created blocks can be
equipped with extended functionality by means of so-called masking. Thus,
the blocks can, for example, be provided with a pictogram or, more impor-
tantly, the blocks can be set up with their own parameter window, which
can forward the parameters on to the underlying blocks. In that way it is no
longer necessary to open the subsystems in order to modify parameters.
Afterward, the self-provided blocks can be assembled into their own
block libraries. These block libraries can then be used like the original
Simulink block libraries.
164 INTRODUCTION TO MATLAB & SIMULINK
PROBLEMS
Problem 94
Simplify the Simulink system shown in Fig. 2.19 for solving Eq. (2.12) for
nonlinear oscillations using an Fcn block.
Problem 95
Design a Simulink system which solves the linear system of differential
equations (2.15) using Fcn blocks.
Problem 96
Design a Simulink system that simplifies the system shown in Fig. 2.19 using
a partial system for the blocks contained in the feedback branch.
variable (e.g., t or time) in the parameter block for the system under the
entry Data Import/Export - Save to workspace. Only certain
variables can be returned via Save to workspace; the first of these is the
internally generated time vector. We won’t discuss the other, likewise inter-
nally generated variables that can be returned here. The interested reader
is referred to the handbook.7 We have already dealt with the possibility
of passing results on to MATLAB via the Scope block in our discussion
of parametrizing the scope in Section 2.2.2. But, the parameters of the
simulation parameter window, themselves, must not be numbers.
These values can also be defined within MATLAB as variable quantities.
Let us now clarify these procedures with the aid of the solution of Eq. (2.10)
from Section 2.3.
As variables for the experiment we choose the plate radius r and the
density of the material in which the steel plate moves. The spring and,
thereby, the spring constant are the same (i.e., we set c = 155.2 N/m). All
the other quantities are derived from these. In addition, the simulation time,
as well as the step size parameter (Fixed step size) should also be
variable.
The most elegant solution for this problem is to write a MATLAB function,
which has the variable parameters as functional parameters and calculates the
quantities to be supplied to Simulink. After that, we only need to enter the
variable quantities in the modified Simulink system s_denon and to start the
simulation. The MATLAB function denonpm for defining the parameters
looks like this:
function [m, b, c, tstep, stime]= denonpm(r, rho, sz, tm)
%
% Function denonpm
%
% call: [m, b, c, tstep, stime]= denonpm(r, rho, sz, tm)
%
% MATLAB function for parametrizing the Simulink system
% s_denon2.mdl for solving the nonlinear differential
% equation for a single mass oscillator
%
% Input data: r Plate radius cm
% rho Density in g/cm3
% tm Simulation end time
% sz Step size for simulation
7
See the MathWorks Simulink 6 Handbook, 2004.
166 INTRODUCTION TO MATLAB & SIMULINK
tstep = sz;
stime = tm;
c = 155.2; % N/m
h = 1; % cm
% Calculation of m and b
A call with the parameters from Section 2.3, for example, then yields:
>> [m, b, c, tstep, stime]= denonpm(4.5027, 1.29/1000, 0.001, 10)
m =
0.5000
b =
0.0041
c =
155.2000
tstep =
1.0000e-003
INTRODUCTION TO SIMULINK 167
stime =
10
The modified Simulink system, which we save under the name s_denon2,
can be seen in Fig. 2.26.
FIGURE 2.26 The Simulink system s_denon2 for solving Eq. (2.12) with common
parameters from the MATLAB workspace.
FIGURE 2.27 The configuration parameters window for Simulink system s_denon2.
[T,X,Y] = SIM('model',TIMESPAN,OPTIONS,UT)
...
...
All other parameters should be set via the Simulink parameter window.
The parameter 'system' is, as noted above, the name of the Simulink
system to be executed (this is a string, so it has to be enclosed in ''). For
example, if the system from Fig. 2.26 is to be simulated, then 's_denon2'
is entered.
The parameter vector [starttime, endtime] marks the start and
end times for the simulation. The return vector [t,x,y] appears in exactly
the same sequence in the Simulink parameter window under the entryData
Import/Export - Save to workspace. As mentioned above, out-
put ports have to be provided in the Simulink system for the parameter y.
The output port appears under the name Out1 in the block library Sinks.
Each output signal must pass into a port of this type (see Section 2.4). A
column is set up in y for each port.
Before we proceed to the proposed iteration scheme, let us illustrate the
call for a Simulink system from MATLAB with an example:
>> [t,x,y] = sim ('s_denon', [0, 10]);
In this call, all the parameters up to the start and end time points for the
simulation remain unchanged from their settings in the parameter window
for the system s_denon when last used; in the present case, we used the
ode45 procedure with the default tolerances for the step size control.
INTRODUCTION TO SIMULINK 171
The time vector and (via MATLAB sinks) the solution DEsolution are
returned. It is interesting that the vector y is empty. This happens because
no output port is available.
8
As noted above, with multiple ports there is an output matrix.
172 INTRODUCTION TO MATLAB & SIMULINK
Examples:
set_param('vdp','Solver','ode15s','StopTime','3000')
set_param('vdp/Mu','Gain','1000')
....
INTRODUCTION TO SIMULINK 173
The function set_param can thus define anew from outside certain
parameters of a system whose name appears as a first parameter. A charac-
teristic of this function is that only strings (text) serve as parameters. Thus,
in particular, besides the names of the block parameters (e.g., 'gain'), the
new value '1000' is passed on as a string, making it necessary to convert
the parameters into text in advance.
Once the syntax of the function set_param has been clarified thus far,
the question remains of where the parameter names of a Simulink system
come from. The simplest way to get the parameters of a block is to drag the
mouse pointer over the block. As noted above, a window then opens up (with
a bit of a delay) in which the important parameters and their current values
are displayed. But this method only yields a few of the parameters of the
entire system.
A more precise view into the world of the parameters of the Simulink
system is possible with the function get_param.
With the command
FactorcPars =
for example, you can discover which of the so-called dialog parameters the
block has. These are the parameters that can be set in the parametrizing
window of the block, in the present case the gain block Factorc of the
Simulink system s_denon3.
The parameters are returned in a structure whose name entry is identical
with the name of the parameter. The values of the parameters can likewise
be obtained with get_param. Thus, the call
currentGain =
155.2
shows, for example, that the parameter Gain of the block named Factorc
is currently set at the value 155.2.
174 INTRODUCTION TO MATLAB & SIMULINK
With
>> Integrator1Pars = ...
get_param('s_denon3/Integrator1','DialogParameters')
Integrator1Pars =
...
InitialCondition: [1x1 struct]
...
and
>> currentInCon = ...
get_param('s_denon3/Integrator1','InitialCondition')
currentInCon =
>> SystemParams =
If the parameter names have been obtained in this way, then, as we have
already explained, they can be changed from outside using the MATLAB
command set_param. The two examples of parameters, for example, can
be redefined as follows:
>> set_param('s_denon3/Factorc','Gain','200');
>> set_param('s_denon3/Integrator1','InitialCondition','1');
It should be pointed out once again that with the set_param command
(as with the get_param) the parameters all have to be set in apostrophes,
since they must be strings.
INTRODUCTION TO SIMULINK 175
After these calls, the parameters are also changed visually in the system
s_denon3, as you can easily see.
The system can then, as indicated above, be run through a new simul-
ation with
>> [t,x,y] = sim ('s_denon3', [0, 10]);
h = 1; % cm (fixed thickness)
a0 = num2str(anfs(1));
set_param('s_denon3/Integrator1','InitialCondition',a0);
a1 = num2str(anfs(2));
set_param('s_denon3/Integrator2','InitialCondition',a1);
stepsize = num2str(step);
set_param('s_denon3','FixedStep',stepsize);
Y = [ ];
iterations = length(r);
INTRODUCTION TO SIMULINK 177
for i=1:iterations
% Set the block parameters with set_param
% for each new iteration.
reciprocalmass = num2str(1/M(i));
set_param('s_denon3/invm','Gain',reciprocalmass);
b = num2str(B(i));
set_param('s_denon3/Factorb','Gain',b);
c = num2str(Fc);
set_param('s_denon3/Factorc','Gain',c);
[t,x,y] = sim('s_denon3', [0,tm]);
Y = [Y,y];
end;
[0, 5] seconds, for three different plate radii (3, 20, 60 cm). All the other
parameters should remain fixed.
In accordance with the definition of the function denonit, we have
to store the variation in the plate radius as a vector of length 3 and call the
function accordingly.
This can be done in MATLAB with the following instruction:
>> r=[3.0, 20.0, 60.0]; % radius vector
>> rho=1.29*1000/1000000; % rho is the same each time
>> Fc=155.2; % c is the same each time
FIGURE 2.29 Results of the iterated execution of the simulation system s_deno3 using
denonit for three different plate radii.
INTRODUCTION TO SIMULINK 179
PROBLEMS
Problem 97
Call the Simulink system s_Pendul (in the accompanying software), which
simulates a mathematical pendulum, from MATLAB with a pendulum length
of 5 m and then with 8 m.
Problem 98
N
TH E C
Write a MATLAB function that can run simulations of the Simulink system
D
O
Problem 99
Change the function denonit so that simulations with different spring
constants can be run9 as well as with different radii.
9
Hint: use two nested for-loops.
180 INTRODUCTION TO MATLAB & SIMULINK
Problem 100
Define a Simulink system which generates sine functions using the sine gen-
erator block Sine Wave. Then write a MATLAB function that can call this
system repeatedly while allowing you to vary the frequency.
Problem 101
Design a Simulink system for solving the differential equation
FIGURE 2.30 The lookup table block from the lookup tables block set with the
block parameter window for lookup table.
U/V 0 2 4 6 8 9 10 11 12 12.3
−I/mA 562.5 537.5 512.5 487.5 462.5 450 437.5 400 275 0
182 INTRODUCTION TO MATLAB & SIMULINK
1
I= U. (2.18)
R
INTRODUCTION TO SIMULINK 183
FIGURE 2.32 The Simulink system s_charc with a Lookup Table for determining
the operating point of a solar cell.
This is a notice that an algebraic loop has been found in the system. The
subsequent call of
>> [voltage, current]
8.2653 459.1837
power =
3.7953e+003
Naturally, one might now get the idea of using the system to search for the
value of the resistance corresponding to power matching, (i.e., for which the
maximum power can be extracted).
As a final, and intimidating, example for this chapter, we show how this
can be accomplished. The idea is to replace the constant R in the system
s_charc with a function that runs through “all” R from 0 to a certain
limit, say 100 . In each iteration step the intersection of the characteristic
curve and the load line for this resistance, as well as the associated power, are
calculated. We then only have to find the maximum of the vector power and
the associated resistance. This, of course, we will again do with MATLAB.
10
Note that U is in V and I is in mA.
INTRODUCTION TO SIMULINK 185
FIGURE 2.33 The Simulink system s_charc2 with a Lookup Table for determining
the optimum operating point of a solar cell.
pmax =
4.4010e+003
indx =
54
>> Ri(indx)
ans =
27
PROBLEMS
Problem 103
Consider the following characteristic curve:
0√ for x < 0 ,
k(x) = x for x ∈ [0, 4] , (2.21)
2 for x > 4 .
Develop a Simulink system that drives this characteristic curve with a sine
wave signal and analyze the output signal. Experiment with various ampli-
tudes of the sinusoidal input.
Problem 104
Consider the following “family of characteristic curves”:
Using the Lookup Table (2D) block design a Simulink system, which
reads out the values at the points (x, x) with x ∈ [−1, 1] from the family of
characteristic curves. In doing this, manipulate the family of characteristic
curves with a suitably set From Workspace block.
Compare the considerations involved in setting the characteristic
family block Lookup Table (2D) with the three-dimensional plots in
Section 1.2.5.
Chapter 3 PROJECTS
Notice the space between the two words; it is actually part of the
greeting string. We could have put the space before “Jane,” or even
inserted a space string between the two, as shown below.
>> greeting = 'Hello';
>> name = 'Jane';
>> disp([greeting, ' ', name])
Hello Jane
189
190 INTRODUCTION TO MATLAB & SIMULINK
Why did the two words run together? The answer lies in the documen-
tation for strcat; it removes trailing spaces. Compare the two commands
below.
>> disp(strcat('Hello ', 'Jane'))
HelloJane
>> disp(strcat('Hello', ' Jane'))
Hello Jane
Notice that the first command removed the space after “Hello,” so that
the words ran together. The second one has the space preceding “Jane,” so
it was not removed. We will examine the difference between strcat and
the square brackets once more. This time we use the square brackets with
two strings, with a space at the end of the first string, then try it again with a
space at the beginning of the second string.
>> disp(['Hello ', 'Jane'])
Hello Jane
>> disp(['Hello', ' Jane'])
Hello Jane
ans =
Steve
Next, we put the result of the input function into a variable. Then we
can combine the name with a greeting, like we did previously. However, this
time we will use the sprintf function, to specify how the name should be
preceded and followed by text. The special characters %s are used to tell the
sprintf function where to insert the string name into the greeting string.
These characters do not appear in the final string; the sprintf function
replaces them with the parameter string. Finally, we display the greeting.
>> name = input('What is your name? ', 's');
What is your name? Steve
>> greeting = sprintf('Hello %s, how are you?', name);
>> disp(greeting);
Hello Steve, how are you?
We can put several variables into a string like this by using %s several
times in the first parameter to sprintf, then following it with a string for
each place. This also works with other data, like characters, integers, and
floating-point values.
Suppose that we want to interact with the user. Perhaps we want some infor-
mation, a choice among several choices. MATLAB supports a menu function,
192 INTRODUCTION TO MATLAB & SIMULINK
which opens a window and displays a graphical menu to the user. The user
then uses the mouse to click on one of the choices, and the menu function
returns the number of the choice.
Below we have a simple example of the menu command. It has four
parameters; the first gives a name to the menu, which could be a statement
like “Please select an item.” The other three items are the choices that will
appear to the user. Since there are three of them in this example, there will
be three buttons available to the user. When the user clicks on one of the
buttons, the window will close, and the function returns the button number.
The window that pops up should look like the one shown in Fig. 3.1,
though the window manager on your computer may give it a slightly different
appearance.
choice =
Here, we see that the second option, “beef,” was selected by the user. Of
course, we need to remember which number corresponds with which option.
That is, whatever we want our program to do after the selection, we need to
make sure we do the appropriate action.
But what if the user does not make a valid choice? The window appears
with the standard buttons that all windows have: close, minimize, and maxi-
mize. A user could click on one of these. The minimize and maximize buttons
do not get rid of the window, so we will not worry about these. The user could
drag the window to a different spot, too. But the close button does get rid of
the window; in this case, MATLAB returns a value of zero for the option.
PROJECTS 193
It is possible that the menu will appear as text in the command window, if
graphics are not available. Here is what happens when connected via secure
shell (“ssh”) to a remote computer that has MATLAB software. (This example
will not work for you unless you have an account on the remote machine.)
While it is possible to allow windows to appear from the remote computer,
we do not do that here.
mweeks@remote:~$ matlab
Warning: Unable to open display , MATLAB is starting without
a display.
You will not be able to display graphics on the screen.
Warning:
MATLAB is starting without a display, using internal event
queue.
You will not be able to display graphics on the screen.
< M A T L A B >
Copyright 1984-2006 The MathWorks, Inc.
Version 7.2.0.294 (R2006a)
January 27, 2006
1) fish
2) beef
3) eggplant
choice =
2
194 INTRODUCTION TO MATLAB & SIMULINK
>> exit
mweeks@remote:~$
As a side note, this could have been fixed by passing the -Y parameter
to the ssh command, as seen below.
localHost:~> ssh -Y remote.machine.gsu.edu
This would have allowed X Window forwarding, so the window would have
appeared as normal. Though generated on the remote machine, it would
have been displayed on the local one. X Window software must be running
on both machines, however. Also note that the ssh command is not part
of MATLAB, though secure shell software does exist for all major computer
platforms.
N
TH E C
We close this section with an example, located on the CD-ROM under
D
O
switch choice
case 1
disp('You chose to have the fish.');
case 2
disp('You chose to have beef today.');
case 3
disp('You chose the eggplant dish.');
otherwise % default
disp('Looks like you closed the menu.');
end
You may notice that the first line is the same as what we have used before. The
switch statement provides a regular way of dealing with several possibilities
for the same variable. We could have used a series of if statements instead,
but this way appears less cluttered.
The switch statement matches the variable choice to one of several
values. We could have specified what to do with case 0, but we take care
of that at the end, with the catch-all otherwise.
When you run this program, the menu pops up in a window. After
you select one of the choices, the window disappears and one of the four
messages appears in the command window according to which button you
clicked.
PROJECTS 195
Reading and writing files can be a bit tricky. We need to know what we are
reading or writing, to know how to interpret the data. In other words, the
computer does not automatically know what the data represents in a file.
The basic unit is the byte, an 8 bit value. Each bit can be either a 0 or 1,
giving us 256 possible byte values. The character data type is closely related
to the byte, though there are variations on the character type. We will use
the 'uchar', or unsigned character type.
We have to tell the computer which file we want to use, as we do with the
filename variable. We could do without that variable, and simply put
the string as the first parameter of the fopen command. But this way makes
the program more readable. The fopen command opens the file that we
name, given the way that we want to open it. Here we simply want to write
a file, so we use the 'w' string to specify this. We could have several files
open at the same time, so the computer assigns each a file handle, a number
indicating to the computer which file we mean. The result of the fopen
command will be a file handle, stored in the variable myfile. By the way,
the file handle could be negative, indicating a problem. We should check the
value, and quit if there is a problem.
if (myfile < 0)
error(sprintf('Problem opening the file "%s".', filename));
return
end
name, since we could work with several files at once. It may even indicate
the problem to the user, such as if the file name contains a sub-directory that
we do not have permission to write.
Next, we will create some example data. We want to be sure that we
can write and read every possible character. Since there are only 256 total,
the following code presents a quick way to do so. We will actually write each
value twice, to be sure that none of the characters cause a problem.
str = [0:255, 0:255];
The first line is exactly the same, so we read the same file that we created
above. Did you see the slight difference in the second line? We open this file
with 'r' in single quotes, indicating that we want to read it. This small detail
carries much importance; if we had used 'w' again, the computer would
have started making a new file with the same name. This would effectively
destroy the old file.
As before, we next check to make sure the fopen command worked. It
could fail for a variety of reasons, such as if we got the file’s name wrong. Or
perhaps if there is no disk in the drive.
if (myfile == -1)
error(sprintf('Problem opening the file "%s".', filename));
return
end
The values passed to the fread command include the file handle, the
number of values to read, and the data type. We again use the uchar data
type to read 8 bit values. The command returns both the data to us, as well as
the number of values that were read. You may expect the number of values
read to always be equal to the number requested, but we could request more
data than the file contains. Also, we should note that commands to read or
write data in a file do so sequentially. That is, the computer keeps track of
how much data we have read, or how much we have written. When we read
or write more, the computer uses that information to get or put the data in
the correct spot. It does not matter to the computer if we read all 512 bytes
at once, or read 256 then the next 256, or even if we were to read them one
value at a time.
We could have used the fscanf command instead, as below. The
'%c' indicates that the computer should read and return the data as
characters.
[mybuffer, chars_read] = fscanf(myfile, '%c', 512);
We would not want to use both here, though, since we only have 512 bytes
in this particular file.
198 INTRODUCTION TO MATLAB & SIMULINK
Finally, we close the file. Compare this code to that used to close the file
that we wrote. You should see that the lines are identical.
if (fclose(myfile) == -1)
error(sprintf('Problem closing the file "%s".', filename));
end
Again, we check for error and let the user know if the file close operation
encountered a problem.
Now we examine the data, and verify that we were able to write and read
all values successfully. Notice how we created the data in variable str in the
file writing code, but used a different variable name, mybuffer, in the file
reading code. We will run both programs, then compute the error between
these two variables.
>> write_test
>> read_test
>> error = sum(abs(str - mybuffer))
??? Error using ==> minus
Matrix dimensions must agree.
ans =
1 512
>> size(mybuffer)
ans =
512 1
Well, that explains the problem. Variable str has 1 row and 512 columns,
while variable mybuffer has 512 rows and 1 column. The fread command
returned mybuffer in this way. We can still compare the two, by using
the .' operation, which performs the transpose.
>> error = sum(abs(str - mybuffer.'))
error =
0
PROJECTS 199
When we use the transpose as above, we align the two variables by changing
mybuffer to have 1 row and 512 columns. We find the difference between
each value using subtraction. Then we perform the absolute value on the
result, and sum it all together. For example, if there were subtraction results
of 1 followed by −1, they would add to 0 and make us think that there were
no differences. Thus, we use abs so that errors cannot cancel each other out.
With the sum of all differences between str and mybuffer.' adding
to zero, we conclude that the two variables contain exactly the same data.
If you are so inclined, you can examine the contents of both variables after
running the code.
N
TH E C
If you want to experiment with the code mentioned in this section, we provide
D
O
3.4 SORTING
MATLAB provides some sorting functions, but there are times when we may
need our own. Suppose that we have a list of numbers, and we want to sort
them in ascending order. But what if we need to remember their original
indices? This could happen when the indices are used for other data, like
the key from a database table. Perhaps the index corresponds to a name in
another set of data.
Consider the following data.
x = [23, 95, 61, 49, 89, 76, 46, 12];
We could use the built-in sort function, but this is of limited value to our
application.
>> disp(sort(x))
12 23 46 49 61 76 89 95
If we want to link the numbers returned from the sort back to our indices,
we have to match them by looking through the original data. Instead, we
will combine the numbers to sort with the indices, as two rows of the same
matrix. We could put the indices in the top row; this does not really matter
at this point.
x = [23, 95, 61, 49, 89, 76, 46, 12;
1, 2, 3, 4, 5, 6, 7, 8];
Now to sort the x values, we define a value n, then see how the x(n)
value compares to the value next to it. In the following instance, we compare
200 INTRODUCTION TO MATLAB & SIMULINK
When we run the above code, we will swap several values of x. It brings us
a step closer to the solution, but we are not done yet. To see why, we only
need to examine x.
>> x
x =
23 61 49 89 76 46 12 95
1 3 4 5 6 7 8 2
PROJECTS 201
We see that the value 95 has “bubbled up” to the right-most position in
our list. This sorting technique gets the name “bubble sort” from this phe-
nomenon. We can imagine why the code moves 95 all the way to the right;
whenever we compare a value to the maximum value of the list, we will
move that maximum value to the right. On the next loop iteration, the
maximum value will appear in its new location, and again be moved to the
right.
The bubble sort does not sort very efficiently, and there are many faster
algorithms. But the bubble sort has an advantage of being easy to under-
stand. We can improve this sort by noticing that the maximum value of the
list always ends up at the right after one pass of this code. Now if we con-
sider the x values, except for the right-most one, as a new list, then the
next highest number will be moved to the right end. We do not need to
compare it to the maximum value from the previous run, since we already
know they are correctly ordered. For example, after a single pass of the
code above, the 95 occupies the right-most spot. So we run the code again,
not considering that spot, and see that the 89 moves to the second right-
most spot. We can continue this process until we have completely sorted the
list.
To complete this example, we need to modify the code above to stop
earlier than the length of x, except for the first pass. Also, we need another
loop around the above code so that we repeat it until we are done. The code
below combines both of these ideas. We set a new variable called x_end to
range from the length of our data x, down to the value 2.
ans =
12 23 46 49 61 76 89 95
8 1 7 4 3 6 5 2
It looks like everything in row 1 was sorted correctly. Remember that row 2
contains the original indices, so we expect that they will be in a strange order.
Before we conclude that this code works, let’s try a worst case example.
>> x2 = [99, 88, 77, 66, 55, 44, 33, 22;
1, 2, 3, 4, 5, 6, 7, 8];
>> sort_with_index(x2)
ans =
22 33 44 55 66 77 88 99
8 7 6 5 4 3 2 1
Here we have the data (row 1) already sorted, only in reverse order. This
means that every comparison results in a swap. We see that the function
results in all values switched around. Since it works for the worst case example,
we can conclude that it achieves its goal.
This project comes from biology research. We have an image, in this case one
of Caenorhabditis elegans (C. elegans) worms, taken with a video microscope.
The video microscope takes 30 frames per second, at 10-times magnification.
Each frame is saved as a “.tiff” file. Ultimately, we want to track the movement
of the worms from frame to frame, but for the moment we concentrate on
just one image at a time.
Neurons within the C. elegans worms are made fluorescent, so that we
can readily see where they are. The fluorescent areas of interest show up as
white circles. These circles typically are close together, like peas in a pod.
But when several groups appear on the same image, the software treats them
as one group, leading to poor information. Refer to Fig. 3.2, that shows an
example of how these worms may appear. For clarity, we show an idealized,
reversed image. A human observer quickly sees two worms on the figure, but
having the computer make this distinction requires a complex algorithm. At
this stage of research, we simply want to select a sub-image when more than
one worm appears in the frame.
PROJECTS 203
We could guess what file name to save the file as, such as automatically
appending _subim before the file extension. Also, we can usually figure out
the file’s type by looking at the extension. But we will use these three lines
to get started; we can always refine the program later.
Next, we read the image data and show it to the screen.
[image_data] = imread(file_to_read, file_type);
figure(1);
imshow(image_data);
The first command above loads the file (image data) with the imread com-
mand. Then we create figure number 1 if it does not yet exist. MATLAB will
create the figure automatically if we do not issue this command, but it also
indicates that we want to use figure number 1. We may run this program,
with multiple figures, more than once. Finally, we display the image with the
imshow command.
Once we show the image, we let the user select two corner points to
define a sub-image. We need to let the user know that we expect input, so we
204 INTRODUCTION TO MATLAB & SIMULINK
use the title command to convey this information. After that, the ginput
command puts a cross-hair over the image, and returns the coordinates of
wherever the mouse happens to be when the user clicks the button.
title('Select the upper left corner of the area of interest');
[x1, y1] = ginput(1);
title('Select the lower right corner of the area of interest');
[x2, y2] = ginput(1);
title(file_to_read);
Notice that we repeat the commands, to get two corner points from the user.
We keep track of them as (x1, y1) and (x2, y2), respectively. The final
title command changes the text on the image to the file name. We change
that text to let the user know that we do not expect more input, at least
not now.
Now that we know the dimensions of the area of interest, we use the
corner points to define the sub-image. We use the round function since the
coordinates may not be whole numbers, and we need them to be integers to
work as indices. The code below handles this.
x1 = round(x1);
y1 = round(y1);
x2 = round(x2);
y2 = round(y2);
[MAXROW, MAXCOL, DEPTH] = size(image_data);
sub_image = image_data(y1:y2, x1:x2, 1:DEPTH);
figure(2); imshow(sub_image);
Here, we also use the imshow command to let the user see the sub-image
that he selected. The size function gives us the lengths of each dimension
of image_data, which we need to know now to determine the “depth” of
the image. Images typically have a depth of 1 or 3, depending on whether it
is grayscale or color.
Next, we plan to store this sub-image. We use this opportunity to show a
menu, like the earlier project. Create the question to pose with the sprintf
command, then show it as a menu with “yes” and “no” as the two options.
question = sprintf('Write sub-image (fig 2) to file "%s" ?', ...
file_to_save_as);
option = menu(question, 'Yes', 'No');
This way, the user can choose not to store the sub-image, in case a point was
accidentally selected, or if the sub-image just does not look right. Of course,
we need to act upon the user’s choice. Below, we check the response. If
PROJECTS 205
the user clicked on the “Yes” button, then we use the imwrite command
to store the sub-image data. Also, we print an informative message to the
screen. Otherwise, we print a message indicating that we did not write the
image.
if (option == 1)
imwrite(sub_image, file_to_save_as, file_type);
disp(sprintf('Yes - sub-image written to file "%s".',...
file_to_save_as));
else
disp('No - the sub image was not written.');
end
Did you notice the default? That is, suppose the user does not choose either
menu option, but instead clicks the “close window” icon on the menu. In that
case, the result for variable option will be 0. The code interprets all values
of option, besides 1, to be “No,” so the sub-image will not be saved.
After finishing the program, we need to test it out. Watching people try
this program, it was evident that some do not read the directions! Rather
than fault the user, we can make our program more tolerant. The user will
select two points representing a rectangle, and we should accept these two
points as long as they are on the image. First, let’s perform a check to make
sure that the points are on the image. We will do this now for just one corner
coordinate, though we need to repeat the checks for all of them.
After we find the size of the image (in the first line above), we see if our x1
coordinate is off of the image. This could happen if the user positions the
mouse on the figure’s border. We print a warning message in that case, and
pick a default value closest to the coordinate. For example, when the user
clicks the mouse button to the left of the image, the code above responds
as if the first column were chosen. You may notice that the first line in this
206 INTRODUCTION TO MATLAB & SIMULINK
code segment was already included in previous code. We put it here now for
clarity. In the final program, we only need to include it once.
Next, we should check the points to make sure they are in the right order,
and re-arrange them as needed. There are four corners in a rectangle, and
our user could select any two, in any order. But if the user selects two points
on the same horizontal or vertical line, then we have a rectangle with zero
size. We will catch this problem later. For now we can ignore this possibility
and focus on two corner points diagonally across from each other. Either the
diagonal line between corner points goes from the lower left to upper right,
or it goes from the upper left to the lower right. The user could select either
corner point first, resulting in four possibilities. Let’s examine some specifics.
Suppose that the user clicks points (10, 15) and (2, 4), corresponding to
an upper left to lower right diagonal. Remember that the ginput command
returns (x, y) coordinates. They do specify column and row of the pixel value
under the cursor, when rounded. Therefore, the desired sub-matrix has rows
from 4 to 15 and columns from 2 to 10. It does not matter what order the
user chooses these points.
Now suppose the user clicks on the points (1, 40) then (35, 8). This
corresponds to a diagonal from the lower left to upper right. The image
showing function (imshow) has the point (1,1) in the upper left corner of
the image, and that the row coordinate increases as we go down along the
left, while the column coordinate increases as we go across to the right. Thus,
the sub-matrix of the image, for the above points, would be from (1:35, 8:40).
Notice that we want the same sub-matrix, even if the user clicks point (35, 8)
first.
Fig. 3.3 shows the four possibilities for corner points. We see that we
always define our rectangle from the minimum x (and y) values to the maxi-
mum x (and y) values, regardless of which points are selected or what order.
We see from these examples that we always form a rectangle with the ranges
from the lowest to highest value, regardless of which point the user selects
first, or whether the diagonal rises to the left or to the right.
The simple programming solution checks to make sure that x1 is smaller
than x2, and switches them when they are not. Then we repeat the same
check for y1 and y2 values.
(max(x1, x2),
max(y1, y2))
(max(x1, x2),
max(y1, y2))
Notice the temp variable, used to momentarily remember x1’s value. Your
first impulse may be to write x1 = x2 followed by x2 = x1, but this means
that the computer overwrites x1’s value with x2, and both variables end up
with the same value.
What if, after all the checks we perform, the sub-image has no size? The
code below handles this.
[rows, cols, depth] = size(sub_image);
if (~((rows>=1) && (cols>=1) && (depth>=1)))
disp('Sorry - image has no size!');
return
end
Actually, we should not need this check. Even if the user clicks on the exact
same point twice, the resulting sub-image should be at least one pixel in each
dimension. In this case, we let the user write an image of a single pixel if he
wants.
Now the program should be ready to use. We get corner points from
the user, and round these values to correspond to rows and columns in the
image data. We check to see that the chosen points are on the image, and
give default values when they are not. When the corner points are given in
208 INTRODUCTION TO MATLAB & SIMULINK
a different order than what we asked, we sort the coordinates to make them
usable. We also check to make sure the selected sub-image has a non-zero
size. When we have a valid sub-image after all of this, then we allow the user
to save the sub-image to a new file.
Now that we have a working program, we can change it to a function. To
do this, we add a function line to the top of the program that specifies the
variables for inputs and outputs.
function sub_image = ...
copy2subimage(file_to_read, file_to_save_as, file_type)
This has the effect of making our program an abstract tool; the inputs for
it are clearly specified, as are the outputs. Any variables that it creates will
be cleared from the user’s workspace when the function finishes. Also, any
variable with the same name as one in the function will be preserved.
We have one more detail to address: the output variable should have a
default value, in case the function returns early. This is good programming
practice, so we set variable sub_image to a null matrix at the beginning.
Under normal circumstances, it will not be returned to the user.
sub_image = [];
N
TH E C
The program that encompasses all of these points is copy2subimage.m,
D
O
each image. Instead, we should automate the process by having the computer
generate a set of file names.
Here, we generate ten file names. We break up the file name into three
parts, the first part that remains the same for each file name, that we call
root, followed by the number, followed by the file extension in a variable
named ext. We put these together with the sprintf command, then dis-
play the results. Of course, we could call another function with the generated
variable file_name, such as the copy2subimage function.
root = 'file';
ext = '.tif';
for num = 1:10
file_name = sprintf('%s%d%s', root, num, ext);
disp(file_name);
end
This confirms that we generate successive file names, based on the number.
Now, what if we want to generate a second file name, to hold the sub-image
data? We can alter the line that assigns variable file_name to a string, such
as the following.
file_name =
file10_subimage.tif
Notice that we added text to the format string. We could have also created
another string variable to go between num and ext, or we could have simply
altered string ext by prepending characters.
210 INTRODUCTION TO MATLAB & SIMULINK
People who work with audio use frequency plots to analyze sound. In this
project, we will look at sound data in terms of frequencies.
N
TH E C
First, we will load an example sound file (available on the accompanying
D
O
The wavread function returns the sound data (in the two-dimensional
array x), followed by the sampling frequency and the number of bits. We
need the sampling frequency (fs) to know how fast to play the sound back.
The sound data typically has two channels, one for each stereo speaker, which
is why x is two-dimensional.
Once we have the sound data, we can listen to it.
sound(x, fs, b);
1
Thanks to Laurel Haislip for playing the violin for this sound sample.
PROJECTS 211
The final command above, axis tight, makes the plot look a bit better.
Try the code above without that line, then add it to see the difference. When
we run this code, we get the spectrum as seen in Fig. 3.4.
N
TH E C
The CD-ROM includes a copy of this code in the file make_music_
D
O
freqs.m.
5500
5000
4500
4000
3500
3000
2500
2000
1500
1000
500
However, viewing the frequency data for the whole signal has limited
value. We might be able to say that a particular note was played, but we
have no idea when it occurred. A nice improvement would be to view the
frequency information a little bit at a time. To accomplish this, we will break
the sound data into blocks, then convert it to frequency information and
display it.
First, we choose a suitable block size. We create the variable
blocksize, and give it a value of 8820. By inspecting the values returned
by the wavread command above, we know that the sampling rate fs equals
44100 samples per second. Our block size 8820 is exactly one fifth of that,
212 INTRODUCTION TO MATLAB & SIMULINK
so we will examine five blocks per second. You could use a larger or smaller
value, depending on your preference.
We define our range next. We need to know where it starts and where it
ends. We store this information in start_index and end_index, respec-
tively. For the moment, we use values of 1 and blocksize, though these
values will be updated as we progress through the data. Finally, we define
range based on these index variables.
start_index = 1;
end_index = blocksize;
range = start_index:end_index;
Later, we will put the definition for range within a loop, so that the program
updates the range every loop iteration.
Based on the range, we will find the frequency information. This means
that we perform the fft on a subset of x, which contains the sound data.
Actually, x contains two channels’ worth of sound data, but we will ignore
the second channel.
X = fft(x(range,1));
The command above finds the frequency information for one block of x’s data.
You may notice that we use the same letter for both the time domain data and
the frequency domain data. MATLAB supports this common convention by
distinguishing between upper- and lowercase variable names.
With frequency information, we get two pieces of data: a magnitude and
a phase angle. The magnitude indicates the relative strength of the particular
frequency, while the phase angle gives timing information that we need to
correctly reconstruct the signal. MATLAB provides the function angle to
return to phase angle from a complex number. If this is unfamiliar to you,
consider that a complex number specifies a real and an imaginary coordinate,
much like the x and y coordinates on a two-dimensional plane. Just as we
can convert the Cartesian (x and y) coordinates to polar coordinates, we can
do the same with a complex number. Polar coordinates specify a distance
from the origin and a rotation angle. If a person stands at some starting point,
facing east, and takes 3 steps forward then turns left and takes 4 steps to the
north, he arrives at the same spot as if he were to turn 53.1 degrees counter
clockwise and take 5 steps forward. Fig. 3.5 shows this idea, and the code
below verifies this example.
>> p = 3+4j;
>> disp(abs(p))
5
PROJECTS 213
Destination
North
5
4
o
53.1
FIGURE 3.5 Walking 3 units east and 4 units north reaches the same destination as
turning 53.1 degrees and walking 5 units.
In the first example, we display the result from the comparison of 5 greater
than or equal to 10, and see that it is zero (false). The second example show
that comparing 12 greater than or equal to 10 returns one (true). Now we
use these results with slightly more involved examples.
>> disp((5 >= 10) * 123)
0
The first comparison returns a zero, and multiplying it by 123 still gives us
zero. The second comparison, since it returns a one, gives us 123 after the
multiplication. The variable zeros_ones uses this idea for the entire list of
magnitudes. Like the number 123 in the above examples, the phase angles
either appear as zero, or whatever value they have.
Fig. 3.6 shows a typical spectral plot, with the magnitudes on top, and
the phase angles on the bottom. You can see how most of the phase angles are
shown as zero, so that the ones with significant corresponding magnitudes
stand out.
After we plot both the magnitudes and phase angles, we invoke the
pause command to give the system a chance to respond. Our program will
halt for a very small amount of time (0.001 seconds), which allows other
programs to run. Though the figure will have changed, the computer may
not show the change on the screen. With the pause, the computer will update
the screen.
pause(0.001);
800
600
Magnitude
400
200
0
0 0.5 1 1.5 2
Frequency (Hz) x 10
4
2
Phase (radians)
−1
−2
−3
0 0.5 1 1.5 2
Frequency (Hz) x 10
4
%
% Show the frequencies present in a sound clip,
% for a bit at a time.
%
blocksize = 8820;
% Read the sound file
[x, fs, b] = wavread('violin.wav');
range = start_index:end_index;
half = 1:ceil(length(range)/2);
% Find the fast Fourier transform of x,
% for 1 channel only.
X = fft(x(range,1));
% Create a array of 0's and 1's,
% based on the magnitude of X.
% We use it below to multiply the phase
% angles, so that frequencies with tiny
% amplitudes do not show a non-zero phase angle.
zeros_ones = (abs(X(half)) >= 10);
% sound(x(range), fs);
% include a pause so that figure is updated
pause(0.001);
3.7 PERMUTATIONS
matrix_row_1 =
1 2
218 INTRODUCTION TO MATLAB & SIMULINK
Now we will define the new number to add, as well as variables to keep
track of the number of rows and columns.
>> value = 3;
>> [maxrow, maxcol] = size(matrix);
Now we can insert the new value into the row that we have. The first and
last positions will be handled separately.
>> k = 1;
>> while (k+1 <= maxcol)
disp([matrix_row_1(1:k), value, matrix_row_1(k+1:maxcol)]);
k = k + 1;
end
1 3 2
Here, it only generated one new row, but only because there are a small
number of columns. Now, we put this together with the code generating the
first and last lines, and we get the result below.
>> k = 1;
>> while (k+1 <= maxcol)
disp([matrix_row_1(1:k), value, matrix_row_1(k+1:maxcol)]);
k = k + 1;
end
1 3 2
We see that we have the three new rows when given the row {1, 2} and value 3.
To finish this example, we need to repeat this for every other row. In this
case, that just means the second row, but we will keep the code general.
% initial conditions
matrix = [1, 2; 2, 1];
value = 3;
1 3 2
220 INTRODUCTION TO MATLAB & SIMULINK
1 2 3
3 2 1
2 3 1
2 1 3
We can verify that all six permutations appear in the output. To finalize
the program, we will get rid of the disp statements, and instead store the
new permutations in a matrix we will call possible. The syntax is to set
possible(n, :) equal to the new array. For example, the first new row
would be as the code shows below.
>> possible(1, :) = [value, matrix_row];
We will call the variable used for the row number possible_row. We have
to be careful how we use it; we do not want to overwrite a row that we already
stored. Therefore, we will increment this variable before using it. Below, we
have the code listing, saved as the function perm.m.
%
% perm.m
%
% Given an matrix like [1, 2], [2, 1], and a value 3,
% return a matrix of all possible permutations, i.e.
% [1, 2, 3], [1, 3, 2], [2, 1, 3], [2, 3, 1],
% [3, 1, 2], [3, 2, 1];
%
% usage:
% possible = perm(value, matrix);
%
% e.g. mypossible = perm(3, [1, 2; 2, 1])
mypossible =
3 1 2
1 3 2
1 2 3
3 2 1
2 3 1
2 1 3
Of course, we can (and should) verify that this code works for larger
values. In the code below, we verify that the number of rows returned matches
our expectations. It also demonstrates how we might use this function to
generate all permutations for a given N.
ans =
24 4
ans =
120 5
Let’s formalize that last idea. Suppose we want to generate all possible
solutions for the traveling salesman problem, which can be expressed as all
permutations of the numbers 1 through 6. The code below utilizes our perm
function, to generate a matrix M that contains each permutation.
n = 6; % total values
M = [1]; % initialize our permutation matrix
% Add a new value, one at a time.
for k=2:n
M = perm(k, M);
end
By running the code above, we see that the permutation matrix M ends
up with 720 rows, like we expect.
As with many programming problems, there is more than one way to solve
this problem. For example, we might start with a row of all the values {1, 2,
3, . . . , N}, and generate new rows by switching values, e.g., {2, 1, 3, . . . , N}.
We face similar difficulties as we did above, in that we have to echo the
switches throughout the rest of the row, as well as throughout each new row.
But we could make this work.
Another option is to ignore some of the possible solutions by imple-
menting rules that should focus on the best possibilities. We call such
rules heuristics. For example, suppose that the solution corresponding to
{2, 1, 3, 4, . . . , N} is worse than any solution that begins with {1, 2, . . .}. Per-
haps we can ignore all permutations that start with {2, 1, . . .} as a result. While
this could give us a “good enough” solution, we will not know for sure if it
is the best one. It will just be the best one that we found. The point is that
PROJECTS 223
there are other ways of thinking about a problem, which generate different
solutions.
We saw how to create a matrix of permutations. The solution works well for
small numbers. But as the number of permutations gets larger, the function
becomes much slower. For eight columns, the function takes about five
minutes to run. For nine columns, it takes over seven and a half hours!
Clearly, the function could be better.
There are two issues here. One is that it may be possible to find a faster
way to compute the permutations matrix. The second issue is the nature of
the problem itself; as the size grows, the time grows enormously.
resource. Thus, the program must request a fixed amount. With virtual mem-
ory, the computer acts as if it has more memory (RAM) than it really does. It
will write sections of memory to the hard drive, until those sections are needed
again. While this greatly increases flexibility, it also drags down performance,
since accessing the hard drive takes much longer than accessing RAM.
The computer may even move things around to make room, a process
called garbage collection. This colorful name comes from the idea of col-
lecting memory that programs have used and disposed of, and it shows the
attitude of the not-so-distant past. The term “recycling” better describes the
process. The garbage collection process can happen at any (unpredictable)
time, which impacts performance.
To summarize, dynamic memory allocation provides a convenience to the
programmer, but at a potential performance hit. Our permutation function
asks for more and more memory as it runs. We can overcome this issue by
figuring out how much memory we will need up front, and requesting it.
The perm.m function works by building on a smaller permutation
matrix. Even if the smaller matrix only has one value, we still use it to make
the new matrix. The new matrix will have one additional column, so we can
easily find the new matrix’s width. To find the height, we have to know a bit
more about our problem. In this case, the number of rows returned will be
the factorial of the number of columns.
We can find the size of the current matrix, which we call matrix, with
the following command.
[numRows, numCols] = size(matrix);
All we need to do is add these two lines to our perm function! This new
function is shown below. We will call it perm1.m, until we are satisfied that
it works as expected.
%
% perm1.m
PROJECTS 225
%
% Given an matrix like [1, 2], [2, 1], and a value 3,
% return a matrix of all possible permutations, i.e.
% [1, 2, 3], [1, 3, 2], [2, 1, 3], [2, 3, 1],
% [3, 1, 2], [3, 2, 1]
%
% usage:
% possible = perm1(value, matrix);
%
% e.g. mypossible = perm1(3, [1, 2; 2, 1])
possible_row = possible_row + 1;
possible(possible_row, :) = [matrix_row, value];
end
Table 3.1 summarizes the results. We should ignore the results before six
columns, since the run times are so small. Examining columns seven through
nine shows that the new version of perm provides a drastic improvement:
over three seconds compared to about an eighth of a second; over five min-
utes compared to less than one second; and well over seven hours to about
six and a half seconds. Clearly, adding the two lines that allocate memory has
a great benefit.
TABLE 3.1 Run times (seconds) for the original and improved “perm” functions.
2 3 4 5 6 7 8 9
original (perm) 0.0100 0.0200 0 0 0.1000 3.2600 309.8900 27214
improved (perm1) 0 0 0 0 0.0500 0.1300 0.7300 6.4900
PROJECTS 227
actual (clock) time. The actual time includes time spent by the computer on
other tasks.
To show this, we can re-run the original perm function and track the
elapsed time in three different ways.
start_time = cputime; % get start time
t1 = clock;
tic
After this, we call the perm function in a for loop, to build a permutation
matrix with 8 columns. Next, we measure the times again, as the code below.
elapsed_time = cputime - start_time; % find difference in times
t2 = clock;
toc
To get the time difference between our two clock readings, t1 and t2, we
use the etime function: etime(t2, t1). Running this experiment on a
G4 based Apple iBook (laptop), other programs were used at the same time to
tax the CPU, including Firefox, DashBoard, Quicktime, and iTunes. In other
words, the CPU had to simultaneously provide services for web browsing, a
chess game, showing a movie clip, and playing music, all while running the
MATLAB code. It does this by spending a little bit of time with each task,
then switching to the next one. The results are 491.7 seconds for the elapsed
time with tic and toc, 363.1 seconds for the cputime measurement, and
491.7 seconds for the difference in the clock readings. As expected, the time
taken by these other tasks prevented MATLAB from having the CPU’s full
attention. While over 8 minutes went by, the CPU only spent about 6 minutes
on the perm function.
You may have noticed that the run time in the above experiment differs
from the time seen in Table 3.1. For Table 3.2, the data were collected from
two different, though similar, machines. Both are Apple computers with
G4 PowerPC processors, one a desktop and the other a laptop model. The
desktop computer was also used for Table 3.1. Since the machines are not
identical, this is one explanation. Another possibility is that the readings are
extremes; every time the experiment runs, the run time is different. This can
result from the system not being in the exact same state. For example, it could
be that more memory is available during one of the runs, so the operating
system responds to the request more quickly.
Running the same program repeatedly on two different computers shows
us what results are typical. Table 3.2 shows the run times for the original pro-
gram on two different computers. The average time for the laptop computer
228 INTRODUCTION TO MATLAB & SIMULINK
TABLE 3.2 Run times (seconds) for the original “perm” function, on two different
computers.
Run number
1 2 3 4 5 6 7 8 9 10 Average
Laptop 363 425 426 347 351 350 350 351 349 350 366
Desktop 318 317 305 302 306 307 306 305 306 307 308
is 366 seconds, while the desktop computer averages 308 seconds for the
same task. We can safely conclude that the laptop computer is slower for this
task than the desktop one.
N = 100;
The number of years for the permutation program to run is 3 × 10140 . Sur-
prised? Actually, even a “low” value like N = 20 would take over seven and a
half years to run. Running the program for another “low” value like N = 27
takes longer than our universe is known to have existed, using an estimate of
20 billion years. Knowledge of such problems helps us avoid trying to solve
them with a direct “brute force” method. Instead, we would turn to a trick
to reduce the problem complexity: a heuristic.
This project demonstrates reading a file. We will open a file, search for
a string, and display lines that match. If you are familiar with Unix, you
probably are reminded of the handy grep utility. In fact, if you are using
MATLAB on a Unix-based computer, you can execute a shell command with
the exclamation point. The following code shows the results of using the
grep utility, under MATLAB, on an Apple Macintosh (using OS X).
>> !grep zeros perm1.m
possible = zeros(factorial(numCols+1), numCols+1);
>> !grep zeros perm.m
>>
The first parameter, zeros specifies the text to find. The second param-
eter says that we want to search the file perm1.m. As you can see, the system
responds with every line from the perm1.m program that contains the text
zeros. In this case, it only appears once. When we use the same command a
second time on file perm.m, we do not find any occurrences. We will develop
a similar utility, but in MATLAB code.
We can view the file contents under MATLAB with the type command,
as demonstrated below. (This works on all platforms.)
>> type testme.sh
#!/bin/sh
Now we can execute this shell script, from MATLAB. Note that we need
a Unix OS for this example to work.
>> !testme.sh
Hi there.
As you can see, MATLAB ran another program and told us the results.
Often, programmers use shell scripts to get data, or transform data from one
file to another. It would be possible to invoke a shell script with MATLAB, as
above, then have MATLAB read and process any resulting files. For example,
we could have a simple shell script to grep all occurrences of a certain file
name in a web-page access log, and write the results to another file. Then we
could open and read that file with MATLAB, to count and plot the number
of web-page requests per hour.
contains genetic sequence data available to the public. This genetic infor-
mation consists of a sequence of the bases A, C, G and T, that comprise
genes. We will use a sequence of random data, shown in Fig. 3.7, though
real data can be obtained from the Internet. This data appears in the file
“DNA_example.txt.”
When dealing with such data, we should be able to have the computer
scan for sequences of interest. For example, suppose that we want to know
how many times, and where, the sequence CAT appears?
PROJECTS 231
TTCCCAAGGCCCTGATGAGGAACAATAAGGCCATTCGAGC
GTGTTATAGGTCCCGAATGAAACCATACCATCGCCGAGGA
TTGCATACACTTCTCGGGGGGGGGTTCGACTGAGCTCACT
TGGTAAGACATGATTTTCCGGTTCTCAGGGTTGTTGGTCG
AAAAACTCATAGGGCACCGTCGAACGCTACGTATTATTTT
AGTCGGATTGCGGCTACACCTTCAAGGTGCAGTTTCCGAA
AGAAGCCGTAAAATAGCAGGTCGTGTGCGATATGAACTTA
TGAGCAAAATATCGTAACACATTAGACAACAATCGAAATT
ATGTCCCACATAACGTGACAACGATTGTAACGTGGTTGGT
TCTGCGCTCAGGAGATAAGACCAACTTAGTGTGGCTCAGT
ACACTCCCGGTTCGAGCTTCTGAACAACTCCCTAGCCCTT
TCTAACCCTCCGGACCTTTGGGAACGCTCAGGAATCAAGG
AGCACATGTGTCTAGGCCAGTAAATATGTAACCCCCTGTA
GCCAGCTTCCCTCCTCTACTGAGAGTCGGTAGTCGGCCTA
ACGTCACTCCTCAGCCTTGTTCAGTAACAGTCGACCCCAT
First, let’s make a simple draft of the program we want. We can simply
specify the search text and file name with string assignments. Next, read-
ing the file and checking for error can be accomplished with the fopen
command, followed by error and return if that command fails. To read
characters from the file, we can either use the fscanf or fread com-
mands. We will use fscanf, though it is possible to make it work with
either command. Once we have some file data, we can compare it to our
search text. MATLAB allows a simple == comparison for strings or matrices,
assuming that they are the same size. To read more characters, we use the
232 INTRODUCTION TO MATLAB & SIMULINK
same function that we used in step 3. The number of characters read will be
returned, and we can check to see if the number read matches the number
we requested. If not, we know we have reached the end of the file. Finally,
we will close the file with the fclose command.
% matgrep1.m
% Scan a file for pattern matching
% First attempt - just scan a file for text
%
% initialize variables
locations = [];
total_chars_read = 0;
num = 1; % index for results
a =
We see that the pattern is located at several locations in the file. The
last one (598) shows that the function returns the very last match as well. To
double-check our results, we can load the example file into a text editor and
have it tell us where it finds the pattern. Doing so reveals that the numbers
above match the pattern’s positions within the file.
It is always a good idea to test our functions for a variety of data, to ensure
robustness in them. We will try the function again, but on a special file called
“test.bin,” a binary file with every possible byte value listed twice. Some
byte values cause problems during file read operations. For example, the
byte value corresponding to the decimal number 26 represents an end-of-file
marker to some systems. Other systems might interpret a byte value of zero
234 INTRODUCTION TO MATLAB & SIMULINK
b =
98 354
We see that our function finds the pattern abc twice, showing that our
function reads everything as desired.
Among the differences between the two programs, the new one needs
additional variables to keep track of the locations within the buffer. First, we
will compare our search string to a small part of the buffer, since the buffer
will be much larger by comparison. We need to know where in the buffer we
are, so we make a start index. Think of scanning a page for a phrase; you
might run your finger along the text as you scan it with your eyes, to keep your
place. The start index serves this purpose. We will also use a stop index,
essentially start plus the length of search string. We also need a variable
for the position of the find with relation to the file. That is, suppose we read
100 characters every time, and locate a match starting at the fifth character
of the buffer. Would that be the fifth character of the file, or the 105th, or
205th? We use the variable position to keep track of this.
For the new program we must consider how we know when to stop.
Instead of stopping when the file read function returns no new data, we will
make it a bit more complex with a flag (done) to indicate this. Before, we
would read from the file during every loop iteration. Now we will only read
the file as needed, and update our flag when we do. In other words, we give
the flag a false value, and set it to true when we try to read more data
but none is returned. It signals when we are done, and we process it when
we are ready.
In the original version, we just compared the buffer to the search string.
Now that the buffer is much larger than the search string, we have to compare
it with a sub-part of the buffer. But there is a potential problem in that we
need to make sure the buffer has enough data left. Suppose we have a buffer
of 100 characters, and a search string of 10. We might be tempted to use the
comparison below.
if (mybuffer(start : start+length(pattern)-1) == pattern)
In fact, we do use something like this, but we have to be careful. For example,
when start has a value of 92, then we want to compare the search string
to the buffer’s contents in the range 92:101. As MATLAB will be quick to
point out, the “index exceeds matrix dimensions.” To avoid this problem, we
must make sure that the stop value does not exceed the buffer’s size. When
it does exceed the buffer, we need to read more from the file. This can be
tricky, since we must keep the original data that we have not yet examined,
while moving it over to give space for new data. You will notice that algorithm
step 5 becomes more complex.
Below we present the updated version, that reads a buffer at a time. The
reader may want to compare algorithm steps 1, 4, and 5 to the original version
of the code.
236 INTRODUCTION TO MATLAB & SIMULINK
% matgrep2.m
% Scan a file for pattern matching
% Second draft - read a block of data,
% and scan a file for text
%
% initialize variables
locations = [];
total_chars_read = 0;
num = 1; % index for results
position = 1;
% position is the location of the start character, in the file.
% This is similar to start, below, except that
% start will be reset when we read from file.
start = 1; % Where to start the comparison
% Where to stop the comparison
stop = start+length(pattern)-1;
filename = "DNA_big.txt"
Elapsed time is 45.633932 seconds.
>> tic; b = matgrep2('CATTGA', 'DNA_big.txt'); toc
pattern = "CATTGA"
filename = "DNA_big.txt"
Elapsed time is 22.784429 seconds.
As we see from the two time measurements, the buffered version runs in
about half the time as the original! But before we celebrate, are we sure that
both functions work?
With the original version, we could verify that it found text within a
file reliably by loading the test file into an editor, and scanning it ourselves.
Below, we will simply compare the results from the original and buffered
versions.
>> sum(abs(a-b))
ans =
Had the results (a and b) been different, we would have had a non-zero sum
above. We can rest assured that both functions are correct.
Running the functions on the large data file, for different search strings,
produces similar results. Table 3.3 shows a few different runs with the original
and buffered functions. You may notice that it actually takes longer to find
shorter strings within the file. These run times can vary, depending on other
factors such as what other software the computer runs simultaneously. But
the shorter search strings mean that it will be found significantly more times.
When it comes to speed, there are other factors to consider. For example,
changing the buffer size will have an effect on the run-time. Of course, the
computer that you use will likely have different run times than what we saw
in Table 3.3. It is possible that hardware improvements, such as a disk cache,
could greatly improve the run time. Also, be aware that other searching
algorithms do exist, with possibly a better performance.
index
search original buffered
pattern (matgrep1) (matgrep2)
CGA 49.5 26.0
GTT 49.0 26.1
CATTGA 45.6 22.8
GTACGT 45.5 22.6
GTACGTTT 45.7 22.7
CGAGTTAA 44.9 22.7
Suppose that our buffer is 10 characters long, and our search string has
six letters. We first compare the search string to the first six characters of the
buffer. Then we compare it to the next six characters, starting at position 2.
Next, we compare it to the six characters including and after position 3, then
the six starting at position 4, then the six starting at position 5. But after this,
we have a problem; we want to compare it to the six characters starting at
position 6, but there are only five characters in the buffer between 6 and 10:
buffer(6), buffer(7), buffer(8), buffer(9), and buffer(10). We do not have data
at buffer(11), since position 11 is beyond the buffer limits. We need to read
more data from the file, but we want to preserve the data in buffer(6:10).
We can get rid of buffer(1:5), though, so we will move buffer(6:10) to
buffer(1:5), then read data from the file and store it at buffer positions 6
through 10. This makes for some tedious programming; it would be easy to
have a bug. Therefore, we will check to make sure the transition happens
smoothly.
First, load the matgrep2.m program into the MATLAB editor, and
highlight the fscanf line after algorithm step 5, then select the Debug
drop-down menu, then choose Set/Clear Breakpoint. For clarity, the
line appears below.
[new_chars, chars_read] = fscanf(myfile, '%c', ...
When selected for a breakpoint, the MATLAB editor will show a red dot
on the left, next to the line number. This line precedes the tricky part where
PROJECTS 241
we move the buffer’s contents around, so we can check it line by line. Now
we will call the function from the command window.
>> a = matgrep2('CAT', 'DNA_example.txt');
pattern = "CAT"
filename = "DNA_example.txt"
K>>
MATLAB stops execution of the function, and gives us the debug prompt.
First, we will check out a few variables.
K>> start
start =
510
We see that the value for start is almost as large as the buffer size.
Since we use that value as an index into the buffer, it means that we have
examined most of the buffer’s contents. Even though our search string (CAT)
has only three letters, we have only enough data left in the buffer to do one
final comparison. At this point, the function reads another chunk of data. In
fact, the function could actually wait one more iteration before reading more
data, by changing the line:
if (stop < length(mybuffer))
ans =
AAC
We will look for that pattern shortly, to make sure it gets copied to the
beginning of the buffer. Now we issue the dbstep command, to proceed
by one more line.
K>> dbstep
89 mybuffer = [ mybuffer(start:length(mybuffer)), new_chars ];
The next line will move the data from the end of the buffer to the beginning,
and append the next chunk of data (stored in the array new_chars). Next,
242 INTRODUCTION TO MATLAB & SIMULINK
let’s see how much data was read. The length of the array new_chars will
indicate this. While we are at it, we will examine the first 10 characters of the
buffer, then “step” though the function by another line. This means that the
line above that re-assigns mybuffer will take effect.
K>> length(new_chars)
ans =
89
K>> mybuffer(1:10)
ans =
TTCCCAAGGC
K>> dbstep
90 total_chars_read = total_chars_read + chars_read;
Now we can re-examine the first 10 characters of the buffer. We should see
the data left over from the first file read, followed by the data of the next
file read.
K>> mybuffer(1:10)
ans =
AACCCCCTGT
We see here that the buffer has new contents, as we expect. Also, we see
the previous data AAC start the buffer, as it should. Can we also verify that
the rest of this data shown comes from the data read? We simply need to
compare the buffer contents from above with the first seven characters of
the new_chars variable.
K>> new_chars(1:7)
ans =
CCCCTGT
We visually inspect the data here to conclude that it is the same. We can
continue on with the function, using the dbcont command.
PROJECTS 243
K>> dbcont
87 [new_chars, chars_read] = fscanf(myfile, '%c', ...
K>> dbcont
>>
As the function call completed, MATLAB left debug mode and returned us
to the familiar prompt.
But we had to issue the dbcont command twice. It stopped again, once
we hit the line with the breakpoint. But why did the function execute that
line again? The function reads the file for a new chunk of data every time it
runs out of data. It gives up only when the number of characters read is zero.
The second read brought in 89 characters, even though we asked for over
500. The function does not distinguish between successful reads, as long as
it reads at least one character.
Are you still not convinced? One fault of the tests above is that the
test data often repeats. How can we be sure that the C characters at the
boundary between the first and second file read were not accidentally over-
written? We will perform a quick check, by using a different data file, called
“DNA_example2.txt.” We make the new file by copying the old one, but
with one exception. Using a separate file editor, we change the data starting
at location 510 to be the alphabet, backwards. Let’s test this out.
>> a = matgrep2('CAT', 'DNA_example2.txt');
pattern = "CAT"
filename = "DNA_example2.txt"
K>> dbstep
89 mybuffer = [ mybuffer(start:length(mybuffer)), new_chars ];
With the original breakpoint in place, we step through to the next line. Now
when we examine the last of the current buffer, we see the backwards alpha-
betic characters. We see the sequence continue in the beginning of the data
from the file read. For comparison, we also show the old contents of the
beginning of the buffer.
K>> disp(mybuffer(start: length(mybuffer)))
ZYX
K>> disp(new_chars(1:7))
WVUTSRQ
K>> disp(mybuffer(1:10))
TTCCCAAGGC
Now we take a step, which will execute the buffer re-assignment. Then we
check the beginning of the buffer.
244 INTRODUCTION TO MATLAB & SIMULINK
K>> dbstep
90 total_chars_read = total_chars_read + chars_read;
K>> disp(mybuffer(1:10))
ZYXWVUTSRQ
As we can readily verify, the old data and the new data are seamlessly put
together in the new buffer.
else
str(n) = 'T';
end
end
From the code above, we can take each value of gene(n) (0, 1, 2, or 3)
and set str(n) accordingly to A, C, G, or T. It is simple and straight-forward,
and this approach works for a variety of programming languages. While this
will do the job, there are other ways. For example, we could use a switch
statement instead, though this is more a matter of personal preference. But
below we accomplish the same task, using the power of MATLAB.
letters = 'ACGT';
str = letters(gene+1);
We do not have to specify the file name separately, as shown above, but this
way makes it easy to change. Variable myfile identifies the file for later
commands. We could have several files open at the same time, so we use the
file identifiers to keep track of them. File operations sometimes fail, so we
should check to see that the call to fopen worked. MATLAB returns a −1
value for the file identifier in that case.
% Check for an error
if (myfile == -1)
error(sprintf('Problem opening the file "%s".', filename));
return
end
246 INTRODUCTION TO MATLAB & SIMULINK
Next, we write the data to the file. Again, we check for error. The fwrite
function returns the number of characters written. If the number written
does not match the number we tried to write, then we know it encountered a
problem. For example, if there is not enough disk space left to hold the file,
then we will have such an error.
% Write the data
num_written = fwrite(myfile, str, 'char');
if (num_written < length(str))
error(sprintf('Not all data was written to file "%s".', ...
filename));
end
Finally, we need to close the file, telling the operating system that we are
finished with the file for now. Again, we check the return value of the function,
in case a problem exists.
% Now close the file
if (fclose(myfile) == -1)
error(sprintf('Problem closing the file "%s".', filename));
end
With the file written, we end this program. Below appears the program,
as a whole.
% make_data.m
%
% Create a random sequence of genomic data, and
% write it to a file.
%
if (myfile == -1)
error(sprintf('Problem opening the file "%s".', ...
filename));
return
end
With the file search and data generating programs, we have seen how to
include file input and output with MATLAB programs.
We need the bits_per_sample when we store the sound data (i.e., with
the wavwrite command).
Now we set up other variables for this particular signal. We use 2600 Hz
as our example frequency, and plan for the sound to last for two seconds.
frequency = 2600; % Hz
number_of_seconds = 2;
Now we create the sound data. Variable t specifies the time, or duration
of the sound.
t = 0:(1/sampling_rate):number_of_seconds;
data = 0.9*cos(2*pi*frequency*t);
It may not be very pleasant, but we have sound! We can save it to a file with
the wavwrite command, to create 2600Hz.wav.
wavwrite(data, sampling_rate, bits_per_sample, '2600Hz.wav');
Notice that we did not specify how loud the audio should be. With .wav
files, the sound samples should be greater than −1 and less than +1, which
explains why we multiply the cosine function with a constant 0.9. Yes, we
could use 0.99 or some other constant instead, as desired. We have some
control over the loudness in that the larger values’ magnitudes, the louder it
will sound. For example, if we play a song where the minimum and maximum
values are, say, −0.5 and +0.5, it would not sound as loud as the range from
−0.9 and +0.9, the minimum and maximum that we use above. Of course,
the listener has control over how loud something sounds, and can always turn
the volume up or down.
If you play the sound and listen carefully, you should hear it equally
well from either the left or right speaker. The sound function does that for
us. But we can create a two-channel signal by giving our variable data two
columns. We will split the data into two channels, playing the frequency in
one channel only, then switch it to the other. The next few lines may look a bit
PROJECTS 249
Now we can assign the first half of the data to channel one.
data2(first_half, 1) = data(first_half);
Before we go further, let’s check out some things about the new variable,
data2.
>> size(data2)
ans =
44101 1
This new variable contains even less information than the original data
variable. Let’s examine its contents, or at least the first few values.
>> data2(1:10,:)
ans =
0.9000
0.8390
0.6641
0.3991
0.0800
-0.2499
-0.5460
-0.7680
-0.8858
-0.8834
These values are typical; they are in the range of (−1,+1), like we expect.
The first value would have been 1, had we not scaled it to 0.9.
Next we put the second half of data in channel two.
data2(second_half, 2) = data(second_half);
250 INTRODUCTION TO MATLAB & SIMULINK
The second line does a bit more than the first. Since we specify data for a
second dimension, MATLAB fills in the blanks with zeroes. To see this, we
re-examine the size.
>> size(data2)
ans =
88201 2
Matrix data2 does not contain twice as much data; it contains four times as
much! We doubled the length, but we also doubled the width. Now let’s see
the first few values again.
>> data2(1:10,:)
ans =
0.9000 0
0.8390 0
0.6641 0
0.3991 0
0.0800 0
-0.2499 0
-0.5460 0
-0.7680 0
-0.8858 0
-0.8834 0
The values in column 1 match what we saw above. Column 2 contains zeros
for the corresponding locations. That is, a speaker playing channel 2 will be
silent for these values. Later on, channel 1’s speaker will be silent. We verify
this by examining some values of data2 well into the second half.
>> data2(60000:60010, 1:2)
ans =
0 -0.5561
0 -0.7746
0 -0.8879
0 -0.8809
0 -0.7543
0 -0.5254
0 -0.2252
PROJECTS 251
0 0.1055
0 0.4220
0 0.6811
0 0.8479
As we see, channel 1 contains zeros while channel 2 has data from the
frequency of interest.
Now we can test the two channels. Play the sound in variable data2 like
we did above.
sound(data2, sampling_rate);
Listening carefully, you will hear the tone on one speaker, then the other.
We next create a sweep of frequencies, where we gradually increase
frequencies over time. Since CDs use a sampling rate of 44,100 samples per
second, the maximum frequency is 22,050 Hz. At the other end of the scale,
humans typically do not hear frequencies lower than 20 Hz. Thus, we want
to have a sweep of frequencies from 20 Hz to around 20 kHz.
A typical stereo speaker looks like the drawing in Fig. 3.8. We see that
several speakers comprise what we would call one of (the two) speakers. The
reason why we have several speaker cones instead of just one has to do with
their responses; the largest one (woofer) does a good job of faithfully repro-
ducing low frequency sounds, while the smallest one (tweeter) reproduces
high frequency sounds well. For the car stereo, we suspect that one of these
cones does not perform well, perhaps due to a loose connection or damage.
By sweeping through the audible frequencies, we should be able to notice a
silence, and narrow down exactly which speaker has the problem.
Listening to the sweep signal, we hear that the frequency increases over
time. It sounds like a slide-whistle. If you have a good ear for frequencies,
you may even notice that it sounds higher pitched than it should, at the end.
The code above has a bug; it actually generates frequencies between 2000
Hz and 4000 Hz, and we will discuss the reason why shortly.
But for now, we focus our attention on making a function to provide
sweep data. The code above consistently gives us a sweep of twice the spec-
ified bandwidth, so we can fix it by setting the stop frequency to be half the
requested bandwidth. For example, with a start frequency of 2000 Hz and a
stop frequency of 3000 Hz, the bandwidth is 3000 − 2000 = 1000 Hz. So we
create a “real” stop frequency of 2000 + 1000/2 Hz.
We need to do a few things to finalize code that generates frequency
sweeps. First, we should “abstract out” the code above. In other words, we
should turn that code into a function, where we pass a few parameters, and
have it return the sweep signal.
Which variables do we need for this function? We will want to generalize
the function, so that we can use any start and stop frequencies. Also, we
need to know the number of seconds. That way we can indirectly control
how quickly we go from one frequency to another. We do not need to pass
variable t, since we can calculate it within the function. But we do need
to know the sampling rate. Variables increment and frequencies can
be calculated from the parameters we have already mentioned, as can the
output data sweep. It is a good idea to comment out the sound command.
Once we are satisfied that the code works, we will use it over and over again.
Playing each sweep will cause the function to slow down considerably, and
PROJECTS 253
the user can always call the sound function himself when desired. We can
be helpful by leaving it in the program as one of the header comments, so
the user will see it as part of the help.
We make a subtle change on the size of variables t and frequencies,
effectively shortening them by one element. This has no dramatic effect, but
it does make the arrays exactly in intervals of seconds. For example, if we
have 44100 samples per second, it makes sense to have 44100 samples after
one second. Since we start at 0 seconds, we have 44101 samples when we
stop at 1 second, so we will stop it one sample earlier.
The freq_sweep function appears below.
% freq_sweep.m
%
% Generate a frequency sweep, a signal where the frequency
% gradually gets larger.
%
% Usage:
% sweep = freq_sweep(start_freq, stop_freq, ...
% number_of_seconds, sampling_rate)
%
% Example:
% [sweep] = freq_sweep(2000, 3000, 10, 44100);
% sound(sweep, 44100);
%
% simulated time
t = 0:(1/sampling_rate):number_of_seconds-(1/sampling_rate);
254 INTRODUCTION TO MATLAB & SIMULINK
As expected, we hear a frequency sweep from 2000 Hz to 3000 Hz. But how
can we be sure that these are the frequencies generated? Examining the
spectrum will answer that question. The following lines show the frequency
plot that we see in Fig. 3.9, with frequencies (x-axis) versus amplitude (y-axis).
SW = fft(sweep);
half = 1:round(length(SW)/2);
plot(half*sampling_rate/length(SW), abs(SW(half)), 'k')
axis tight
Briefly, the code above converts the time-domain data to the frequency
domain. The theory behind this code is beyond the scope of this text. For
more information about how these lines work, consult a book on digital signal
processing.2
The graph in Fig. 3.9 shows that we have mostly zero amplitude, except
for a narrow band. Since the x-axis has a scale of 104 , point 0.4 along the
bottom corresponds to 4000 Hz. Careful examination reveals that we have
frequencies between 2000 and 3000 Hz.
2200
2000
1800
1600
1400
1200
1000
800
600
400
200
We produce a sweep function, but one with whole numbers all the frequen-
cies. This step between frequencies means that the frequency function is not
linear. It results in an interesting sound, with a more complicated spectrum.
We can see the spectrum with the code below.
SW2 = fft(sweep2);
half = 1:round(length(SW2)/2);
plot(half,abs(SW2(half)),'b')
256 INTRODUCTION TO MATLAB & SIMULINK
This spectrum shows frequency content spread out over all frequencies,
instead of neatly confined to a small area.
Our model of the frequencies shows that the above line can be written
in the following, equivalent, fashion.
bandwidth = (stop_freq - start_freq);
sweep2 = 0.9*cos(2*pi*start_freq*t + ...
2*pi*bandwidth/(number_of_seconds)*t.^2);
To show that the two signals sweep and sweep2 are equivalent, we can
calculate the maximum difference between the two.
>> disp(max(abs(sweep - sweep2)))
1.2113e-11
PROJECTS 257
We see that there is no difference between any two points of these arrays in
the first 10 digits of precision.
The length(t) represents the total length of the signal, the
duration of the signal multiplied by the number of points per sec-
ond. We can think of a new variable n as ranging equivalently from
0:number_of_seconds * sampling_rate −1, with increments of 1.
So range n is the same as t, except that values in n are whole numbers. In
n
other words, t = sampling_rate .
n = 0:number_of_seconds*sampling_rate -1;
Our frequencies range from the given start frequency to the stop frequency.
We create the variable frequencies to gradually go from one to the other,
based on value of increment. The number of elements in frequencies
should match the number of elements in t (or n). Our increment vari-
able adds a tiny bit to the start frequency to get the second element of
frequencies. Then it adds a tiny bit more to get the third value of
frequencies. Each value in the array takes the previous value and adds
the small increment to it. In this way, each value depends not only on the
previous value, but on every value before it. We could use the above range
n to find an equivalent set of frequencies.
g(n+1) = start_freq + n*increment;
To verify that the arrays g and frequencies are the same, we can see the
maximum difference between them.
>> max(abs(g-frequencies))
ans =
4.5475e-13
We know the initial conditions: that the increment is zero at f (0) and that
θ (0) = start_freq. Solving the integral gives us:
t2
θ(t) = 2π start_freq t + 2π increment .
2
The point is that the increment should only be half as much as what we might
expect, due to the t2 /2 term that follows it. Now, we can substitute in θ(t)
above into MATLAB code. First, we recall the example values to use.
sampling_rate = 44100;
start_freq = 2000;
stop_freq = 3000;
number_of_seconds = 2;
bandwidth = stop_freq - start_freq;
Now we calculate the time variable t and the sweep, using θ(t) from above.
t = 0:(1/sampling_rate):number_of_seconds-(1/sampling_rate);
sweep = 0.9*cos(2*pi*start_freq*t + ...
2*pi*bandwidth/(2*number_of_seconds)*t.^2);
When we use this version of the code, we find the frequency plot to be
the same as what we saw in Fig. 3.9. In other words, we might prefer the
code that creates the range frequencies, due to clarity or efficiency, but
it has the same effect as the code above. Either way, we see the need for the
division by 2 from the above analysis.
PROJECTS 259
N
TH E C
So what was the outcome of the test? To create a CD of sweep sounds,
D
O
Given each starting frequency, we create a sweep ending at the next starting
frequency. For example, the first sweep will be from 20 Hz to 100 Hz.
Notice how the difference between frequencies gets larger as the frequencies
increase. Humans cannot distinguish high frequencies from each other very
well. We take advantage of this fact to limit the length of the test signals for
high frequencies.
We use the freq_sweep function to find a frequency sweep between
two frequencies. The array myranges holds these frequencies, we simply
need to indicate which one (and its neighbor). Suppose that we choose vari-
able n, not to be confused with the n from the last section, to indicate the
current starting frequency. Since we will repeat these steps for each starting
frequency, n can be defined as the index to a loop. Then we make the call,
as shown below.
sweep = 0.9*freq_sweep(myranges(n), myranges(n+1), ...
number_of_seconds, sampling_rate);
The code above shows the spectrum, along with a descriptive title.
Now we create the file name. Assume that the variables n and channel_
number are already defined. As noted, we use n as an index to run through
all starting frequency values in myranges. But we want to do that twice,
once for each channel. So channel_number will be another loop index.
To use it in a file’s name, the sprintf command combines it with text.
channel = sprintf('ch%d', channel_number);
filename = sprintf('%s_sweep%d.wav', channel, n);
disp(sprintf('Writing file "%s".', filename));
The last line shows us the created file name. You may want to try those
three lines out yourself, with example values for n and channel_number.
For instance, MATLAB displays the following line when n equals 4 and
channel_number equals 2.
Writing file "ch2_sweep4.wav".
When we have data for channel 1, we still need to provide data for the
second channel. Since we want channel 2 to be silent, we use the zeros
command to set all values to 0. We can use the following function call to
make a column of zeros for that channel.
zeros(length(sweep), 1)
For stereo sound, we need a column for each channel. The code below creates
a matrix with two columns; the sweep data in the first column, and zeros in
the second column.
[sweep.', zeros(length(sweep), 1)]
Now we can write the stereo data to a file with the wavwrite command.
wavwrite([sweep.', zeros(length(sweep), 1)], ...
sampling_rate, 16, filename);
This will write a .wav file with our data. Before executing that line, we should
check the channel number. If we are working on channel 2, we need a similar
line with the sweep and zeros switched. So we put the code above in an
if statement, with a similar line in the else block to take care of the second
channel.
The program create_sweep_files.m incorporates the above tasks.
You can use it to create the same data files as used below.
Once the files are created, we can import them into a program supplied
with the computer’s operating system, and burn an audio CD. For example,
Apple’s iTunes can create audio CDs, but most operating systems will ask the
PROJECTS 261
measurements revealed that the woofer and tweeter were responsible for the
sounds heard. In other words, the passenger’s side mid-range speaker was
not functioning. This was further confirmed by setting the stereo’s balance to
be all on channel 2. Tracks 1 through 20 were not audible under this setting,
just as we would expect.
Examining the speaker did not reveal any obvious damage, and the con-
nections looked to be good. However, the speaker connects to the stereo in
an inaccessible area of the dashboard, and one of these connections could be
the problem. The mid-range speaker did not vibrate under the sweep signals,
and the sound measured above the speaker was the same as sound measured
above the dashboard on the other side of the tweeter. In other words, the
tweeter provided sound while the mid-range speaker did not. Therefore,
the conclusion is that the passenger’s mid-range speaker does not work, and
should be replaced or at least reconnected.
and
5 = m × 4 + b.
Since we have two equations with two variables, we know we can solve for
these variables and find the slope m and the y-axis intercept b. From the first
equation, we get b = 2 − m. Then, we substitute 2 − m for the b value of the
second equation. This gives us
5 = m × 4 + 2 − m.
5−2=m×4−m
3 = m × (4 − 1)
3 = m × (3)
3
m= =1
3
Now we can use either of the line equations and substitute our slope, m with
the value one. Let’s use the first equation.
2=1×1+b
2=1+b
2−1=b
b=1
Now we can use our slope and y-axis intercept with the line equation,
y = 1 × x + 1.
y−1
x= .
1
Naturally, we do not need to divide by 1, but the term in the above equation
reminds us that the equation as a function of y has a division by the slope.
So if we have either the x or the y coordinate from a point on this line, we
can find the other. To get points on the line segment between the two given
points, we already know the range of x or y coordinates to use. We simply
264 INTRODUCTION TO MATLAB & SIMULINK
form an array using the given y coordinates as the start and end points, and
calculate the corresponding x values according to the line equation.
In MATLAB, we can create an array with y1:y2. This has a problem
since it assumes that y1 is less than y2. Instead, we will compare the two
values and make a step size of either 1 or −1 between them. For example,
2:1:5 generates the array 2, 3, 4, 5. As another example, consider
5:-1:2 that generates the array 5, 4, 3, 2. The order does not matter,
as long as we have a correct step size.
The code below will find the x values when given the y values.
>> y = 2:5
y =
2 3 4 5
>> x = (y-1)/1
x =
1 2 3 4
Here, the x and y values happen to be integers. For our purposes, we want
to make sure that they are integers since we will use them to index an image.
We will do this using the round function.
Another thing to consider is whether we should find x values based on
the y values, or the other way around. Actually, it depends on the line. For a
diagonal line with equal rise and run, it does not matter which one we use.
In that case, we will generate the same number of points with either set of
values. But consider a line that passes through the points (0,0) and (100,2).
If we use the y values to define a range, it would be 0, 1, 2. Plugging these
into the line equation gives us the corresponding x values, but only adds one
point. In other words, we would specify this line segment with three pixels
instead of 101. A better solution for this example would be to use the x values
to generate y values. How do we know when to use the x values to generate
points, and when to use the y values? We want to generate the most points
that we can, so we check for the values with the largest range.
taking into account the issues presented above. We start with a function
definition.
function [newx, newy] = ...
points_on_line(point1x, point1y, point2x, point2y)
The inputs are two sets of coordinates, specifying two points. Based on
these points, it finds the slope and the y-intercept. A first attempt appears
below.
slope = (point2y - point1y)/(point2x - point1x);
b = point1y - slope*point1x;
But before defining the slope, we should check the difference between the
two x coordinates. A difference of zero indicates a vertical line, and will pro-
duce an infinite slope. But the calculation involves a divide by zero. MATLAB
handles these fairly well, advising us of the divide by zero, and assigning Inf
to the value of slope. However, we can avoid the warning that division
using a zero denominator generates by simply giving the slope a very large
value. Assuming that the coordinates will be relatively small, this will work
fine. The if statement below checks the denominator, and makes the slope
a very large value instead of infinite, when needed.
if (point2x - point1x ~= 0)
slope = (point2y - point1y)/(point2x - point1x);
else
slope = 100000000;
end
b = point1y - slope*point1x;
Notice that the indentation reminds us that this line of code belongs to the first
if statement. With the range based on the y coordinates, we can generate
the x coordinates that go with them.
newx = round((newy - b)/slope);
You may recognize that the command above uses a modified version of the
line formula to determine the x coordinates. After this, the function returns
the new points. The else block follows, with similar code for generating y
coordinates from a range of x values.
N
TH E C
The function points_on_line.m, on the CD-ROM, finds the points on
D
O
a line segment between two given points. The inputs are two sets of point
coordinates, four values in total. Based on these points, it checks for divide
by zero, and finds the slope and the y-intercept. Then it decides on the
increment (or decrement), creates the list of x (or y) coordinates, and finds
the other coordinates. Finally, it returns the points as two sets: an array of x
coordinates and an array of y coordinates.
Below, we test this function. First, we try something easy that we can
readily verify.
>> [x_list, y_list] = points_on_line(3, 4, 8, 9)
x_list =
3 4 5 6 7 8
y_list =
4 5 6 7 8 9
The x values range from 3 to 8, while the y values range from 4 to 9. Since this
line segment is a diagonal with a rise and run of one each, all points happen
to be integers. You can verify this with graph paper; drawing a line segment
between these points means that the line passes through the intersection
of the grid lines on the graph. We see from the example above that we get
all points between (3, 4) and (8, 9). Now let’s try something a bit more
complex.
>> [x_list, y_list] = points_on_line(0, 0, 2, 4)
PROJECTS 267
x_list =
0 1 1 2 2
y_list =
0 1 2 3 4
We see in this example that we get five points. But suppose that we just got
lucky this time; we try it once more, switching the x and y coordinates for the
second point.
>> [x_list, y_list] = points_on_line(0, 0, 4, 2)
x_list =
0 1 2 3 4
y_list =
0 1 1 2 2
Here, we have the same set of points as before, only with the x and y coor-
dinates reversed. This demonstrates that we get the maximum number of
points along the line, as desired.
We include the imshow command in the above code. The image is not
yet interesting, but it gives us something to look at. Second, we choose
268 INTRODUCTION TO MATLAB & SIMULINK
some example end points, and find the coordinates in between them using
points_on_line, defined above.
[x_list, y_list] = points_on_line(68, 66, 431, 440);
Third, we replace the values in our matrix with values that will stand out. We
reshow the image after we place the points.
for k = 1:length(x_list)
testimage(y_list(k), x_list(k)) = 0;
end
imshow(testimage);
Running the code above, you should see a black line on a white background.
Now let’s try a more complex example. After drawing the line above,
we can add a vertical one, a horizontal one, and a diagonal one at about a
right angle. These lines are interesting because they include extremes of an
infinite slope, and a zero slope. First, we draw a vertical line.
[x_list, y_list] = points_on_line(250, 67, 250, 410);
for k = 1:length(x_list)
testimage(y_list(k), x_list(k)) = 0;
end
imshow(testimage);
N
TH E C
Fig. 3.10 shows the results of our tests. We see all four lines. They do not
D
O
meet in the center, since we did not ask for them to do that. As an exercise,
what values could you give to the points_on_line function to have all
four lines intersect at one point? If you want to experiment, the program
drawinglines.m on the CD-ROM contains the code from above.
PROJECTS 269
Now that we can draw a line on an image, let’s take a step closer to drawing
a three-dimensional cube by drawing an outline of it. To make this more
challenging, we let the sides have colored tiles arranged in a 3 × 3 grid.
We need to know how to dimension it. We cannot make all of the squares
the same size, since this does not take perspective into account. When draw-
ing a scene, such as making a painting for an art class, objects are scaled in
size depending on their distances. That is, imagine that you are painting what
you see as you look down a street. If a car is right in front, you would paint it
rather large. If a car by the same make and model is parked one block down
the street, you might paint it only one-quarter the size. This is what we mean
by perspective. Given the perspective of the user, some blocks of the cube
are larger because they are closer. How can we get a good idea what these
dimensions should be?
N
TH E C
We can start by taking a digital picture of a cube, such as the cube made
D
O
1
Trademark by Seven Towns Limited.
270 INTRODUCTION TO MATLAB & SIMULINK
image, and select a point by left-clicking the mouse. The commands below
show the image, then allows the user to select a point on it. We can repeat the
second line as many times as necessary, since it returns a pair of coordinates
for a point each time.
imshow('cube1.jpg')
figure(1); [x1, y1] = ginput(1)
The dimensions of the cube (700 × 700) may seem arbitrary, but they come
from the cube1.jpg picture. Originally, this picture was much larger, but it
was cropped to get rid of as much of the background as possible. The variable
flip controls how the cube will appear. We will want to show all sides of the
cube, but can only see three at a time. The flip value lets us choose which
sides we see. For the moment, only values 0 and 1 matter. Either the frame
will appear as in the original image, or rotated so that the bottom face shows.
Next, we create the default background. We could use the zeros func-
tion to create a black background, but for now we will use 255*ones that
will create values of 255 for each pixel. This makes the whole image white.
im2 = 255*ones(MaxRow, MaxCol, 3);
Above we see the command to create a new image, called im2. Notice that
we use a value of 3 for the third dimension. This image will appear in color,
instead of grayscale. So the third dimension holds values for red, green, and
blue components. We explain this more thoroughly later.
As mentioned above, we could pick the points based on the ginput
command from the original picture. Below we have the point information,
PROJECTS 271
adjusted to look good, for the top face. We keep the x and y coordinates in
separate arrays.
y1 = [ 15, 38, 38, 73, ...
69, 73, 108, 107, ...
107, 108, 149, 155, ...
149, 205, 205, 271];
This command finds the points on the line created by points (1, 1) and (7, 7)
that corresponds to the top-left edge. Now we can draw the line. Since we
have a white background, we will draw black lines.
for k=1:length(newy1)
im2(newy1(k), newx1(k), :) = 0;
im2(newy1(k)+1, newx1(k)+1, :) = 0;
end
The for loop allows us to put all points from the line segment on the image.
We assign values of the image array, im2, to be zero for all three colors.
This will appear as black, and we do it point by point. You may notice that
the assignment happens twice, the second time using coordinates that are
incremented by 1. This second assignment makes the line look well defined,
much like how you might move a pen back and forth to mark a line on paper.
With a line definition of only a single pixel width, the line may not appear or
may only partially appear, due to the software that controls how the image
looks on screen. Doubling the width helps the line stand out.
272 INTRODUCTION TO MATLAB & SIMULINK
N
TH E C
To finish drawing the outline of the top, we simply apply the code above for
D
O
each line segment. This means four line segments that go diagonally from
bottom left to top right, and four more diagonally from the top left to the
bottom right. After we have the top completed, we next turn our attention to
the left side, then the right side. The idea remains the same; we simply apply
the points_on_line data to the image data. See the draw_frame.m
program, supplied on the CD-ROM. It generates the image seen in Fig. 3.11.
As expected, the figure shows a frame outline of the cube. Shortly, we will
see how we can fill in the frame.
Here, we drew a line, then repeated it over and over again using the
points that we obtained from a digital picture. It may not be clear where the
vertex points come from, but they appear on a later figure. From Fig. 3.11,
we observe a few things. First and foremost, the image looks like a cube! We
were able to capture the perspective of a three-dimensional cube. On close
inspection, you can see that the corner where the three sides meet appears
larger than the other corners, as if it were closer to us. Also, the lines that
define the left-most and right-most edges appear to go straight down, though
they actually are not parallel with the axes that MATLAB includes on the
figure. It looks symmetrical, which it should; the vertex points on the right
were calculated from those on the left half of the image.
PROJECTS 273
Next, we turn our focus to filling in the diamond shapes shown in the
frame.
The problem comes about when we try to generalize this. A square viewed
from an angle does not appear as a square, but as a diamond. Consider a
simple diamond shape: 1 pixel across the top, 3 pixels on the next row, then 5
pixels, then 3, then 1 again. To faithfully create this shape, we need to change
some rows of pixels between a range of columns, but the number of columns
will vary from row to row. Thus, we cannot do a simple fill like the one above.
The best we could do is something like the following.
myimage(100, 70) = 255;
myimage(101, 69:71) = 255;
myimage(102, 68:72) = 255;
myimage(103, 69:71) = 255;
myimage(104, 70) = 255;
Changing this for larger diamonds will be quite a task. Instead, we need a
better way to specify the shape, with a function to do the fill for us. The idea
will be the same, however. For each row of the diamond, we set each column
within a range to the fill value. The range will depend on the outline of the
diamond; that is, we will not require that the diamond have a perfectly square
shape. In fact, we will let most any shape defined by four corner points to be
filled, for our purpose here.
Our diamond fill function will need a few pieces of information. First,
we should specify an image (matrix) on which to draw the diamond shape.
Also, we need the fill value to use. This will make our function flexible, and
ultimately we will be able to draw a diamond of any color. Finally, we require
a list of four corner points, to specify the diamond.
Since we are defining our requirements at this stage, we can call the
parameters anything we like. We will use the following line to name the
274 INTRODUCTION TO MATLAB & SIMULINK
Still, the user may find this confusing. We can further help by checking the
number of rows and columns, and returning with an error if they do not meet
our expectations.
[fp_rows, fp_cols] = size(fourpoints);
if ((fp_rows ~= 4) || (fp_cols ~= 2))
str1 = 'fill_diamond expects four points,';
str = strcat(str1, ' given as a 4x2 matrix.');
error(str);
return
end
The first line above finds the dimensions of variable fourpoints. Then we
compare the number of rows and columns to 4 and 2, respectively, using the
“not equal to” comparison, “~=” in MATLAB syntax. If either condition is
not met, we print the error message and return.
Once we know that the dimensions are correct, we split the points into
coordinates, according to the column. We call these coordinates x and y.
x = fourpoints(:,1).';
y = fourpoints(:,2).';
Yes, we could have made it work with the original fourpoints variable
only, though this way should be more readable.
We might assume that the user will call our function with the four points
in order from top to bottom. However, it makes for a user-friendly function if
we allow the points to be in any order. We can sort them within the function.
The top and bottom points are easy enough to discern. We simply choose
the points with the minimum and maximum y coordinate, respectively, then
swap these values (both x and y coordinates) with the first and fourth points.
Next, we need to decide which of the remaining coordinates correspond to
PROJECTS 275
the diamond’s left and right points. We define the left corner point as the
one with the minimum x value.
[value, index] = min(x(2:3));
The variable index tells us what we really need, except for one slight prob-
lem. The selection x(2:3) forms a sub-array with two values, and when
we locate the minimum value it will have an index relative to this sub-array.
Thus, index will always have a value of 1 or 2, when we want it to tell us the
index for x. We solve this by adding one to the index.
index = index + 1;
Now we need to take the value corresponding to index and swap it with
the second values for x and y. Rather than first do the test to see if we
need to make the swap, we will simply process it. The swap for the x values
appears below.
tempx = x(2);
x(2) = x(index);
x(index) = tempx;
When no swap needs to be made, we will still execute these lines. Imagine
what happens when index has a value of 2: we assign its value to a temporary
variable, then assign x(2) to itself, then assign it to itself again. This takes a
bit of time, but does not cause a problem.
In a similar fashion, we swap the y values.
tempy = y(2);
y(2) = y(index);
y(index) = tempy;
We use the same idea as before, simply changing the variable names.
For a given row, what columns should have their pixels filled? To answer
this, consider the information that we have so far. The user specified a dia-
mond shape, with four points defining the top, left, right, and bottom corners.
The top and left corners form a line segment on the left side, as do the left and
bottom corners. Refer to Fig. 3.12, which shows the four line segments that
we interested in: top-left (connecting points 1 and 2, labeled segment 12),
top-right (13), bottom-left (24), and bottom-right (34).
N
TH E C
Given two points that specify a line, we need to know the column (y coor-
D
O
dinate) to complete a point on the line, given the row (x coordinate). For
normal cases, we just use the line equation. We also need to have some han-
dling of extreme cases, such as when the x coordinate does not exist on the
276 INTRODUCTION TO MATLAB & SIMULINK
top
1
12 13
left 2 3 right
24 34
4
bottom
sense to find the y coordinate when x has the value 3. We call our function
col_on_line.m, available on the CD-ROM. For balance, we also include
a program called row_on_line.m. As the name suggests, it returns the row
when given the column and two points defining a line. Below, we show how
an example call to the col_on_line function works. In this case, it finds
the line connecting points 1 and 2, then plugs in row to find the matching
column.
% given the row, find the column on line 1:2
col1 = col_on_line(row, x(1), y(1), x(2), y(2));
We will repeat the above call for the other lines, as shown below.
col2 = col_on_line(row, x(1), y(1), x(3), y(3));
col3 = col_on_line(row, x(4), y(4), x(2), y(2));
col4 = col_on_line(row, x(4), y(4), x(3), y(3));
By inspection, you should be able to tell that col2 goes with line 13, that
col3 goes with line 24, and col4 goes with line 34. Notice that the order
of the points does not matter, that we can list either point 4 or point 3 first.
We want to draw a horizontal line across the diamond shape, but as we see
in Fig. 3.12, there are two lines on either side that define our boundary. We
do not know when to stop using line segment 12 and switch to line segment
24 to get our left-most column. Therefore, we will get columns from both
line segments, then choose the right-most one of them. Fig. 3.13 shows why
we choose the right-most point of the two. In this figure, we see line segments
12 and 24 extended to the left. If we pick an arbitrary y coordinate, we see
the two possibilities, shown by the circle outlines. Obviously, the right-most
(maximum) one occurs on the diamond shape, so we choose it.
left_col = max(col1, col3);
right_col = min(col2, col4);
PROJECTS 277
FIGURE 3.13 The lines on the left give us two possibilities for a column coordinate.
Similarly, we choose the left-most (minimum) of the two possibilities for the
right column.
Now that we have the appropriate columns, we can fill the image for
that row.
myimage(row, left_col:right_col) = fill_value;
Notice how much the above line compares to the original rectangle fill.
There are only a few details left to consider. First, we want the row to
vary from the top-most row (y(1)) to the bottom-most row (y(4)). We
create a loop, as below.
for row = y(1):y(4)
% find columns
% choose correct ones
% fill the line
end
Inside this loop, we place the commands for finding the columns, choosing
the correct ones, and filling the line. We saw these commands above, now
we copy them into place.
We also must consider a detail about image colors. So far, we have only
considered grayscale images. When we work with color images, we have three
values for the color. We need to check for this case and alter all three color
values, which appear as the third dimension of the image data. For example,
instead of a fill being a single command:
myimage(row, left_col:right_col) = fill_value;
we would do a fill as three commands, one for each color, as shown below.
myimage(row, left_col:right_col, 1) = fill_value(1);
myimage(row, left_col:right_col, 2) = fill_value(2);
myimage(row, left_col:right_col, 3) = fill_value(3);
To decide which of the two possibilities our function should do, we can
examine the third output from the size function, and act accordingly.
278 INTRODUCTION TO MATLAB & SIMULINK
N
TH E C
Program fill_diamond.m (on the CD-ROM) allows us to fill a diamond
D
O
When we run the test code above, we get the image as seen in Fig. 3.14.
Here, we have chosen a black diamond shape on a white background. See if
you can alter this to make a white diamond on a black background.
Finally, we should note that the fill_diamond function does not work
for rectangles. When we need to fill a rectangular area, we should use the
code presented at the beginning of this section. Below, we have an example
of this.
myimage = 255*ones(128, 128);
myimage(100:120, 50:90) = 0;
imshow(myimage)
The code above generates the black rectangle on a white background, as seen
in Fig. 3.15.
Once we can fill a diamond shape, we can put many diamonds together to
make our overall image. All that we do here is repeat the diamond drawing
command for each set of defining points. Looking at the vertices of the frame
PROJECTS 279
in Fig. 3.11, we can see the defining points for the nine diamonds on each of
the three faces. We also need to know what color to make each diamond. Up
to this point, we have not dealt with the internal representation of the cube,
but we address this now.
There are different ways that we could represent a cube with three rows
and three columns of colors on each face. We will use a straight-forward
approach that should be simple. Each face will be represented as a 3 ×
3 grid of colors. The advantage here is that we can store each face as a
matrix according to the color in the middle, and combine all six faces into a
3 × 3 × 6 matrix. The disadvantage is that we must remember explicitly how
the squares on different faces are related. That is, if we turn the cube to see
a new face, the program must know how the new face should appear: which
edge is closest to the viewer, and which row or column corresponds to it?
If we are drawing a physical object, the computer has no idea of connec-
tions. Suppose that we alter the corner where the three sides meet, perhaps
blending the three colors. We would have to change three matrices, and it
would not be obvious which entries would be altered. That is, we define that
corner point by element (3,3) of the top side, element (1,3) of the left side,
and element (1,1) of the right side. We must keep track of the relationships
ourselves.
You may have once mixed paints in an art class. If you take primary
colors and mix them, like equal amounts yellow and red paint, you get
another color (orange). By adding more yellow, you get a brighter orange.
For us, we specify the red, green, and blue components, the primary col-
ors for a computer display, to make the desired color. The colors matrix,
encodes this color information. We define the first seven colors as follows. The
actual definition lists more (16) different colors, but these are enough to get
started.
The colors are chosen according to how they appear. For example, if you
draw a rectangle on an image with 255 for the first color (red component),
90 for the second color (green component), and 40 for the third color (blue
component), then the rectangle should appear as orange. These values are a
280 INTRODUCTION TO MATLAB & SIMULINK
matter of personal preference; you could alter them to make a brighter green
or a deeper blue color.
White will correspond to the first face, then yellow, orange, etc. This
order is arbitrary, but we must be consistent whatever order we use. To
make this work, we assign each color name a value. This way, we can refer to
yellow as the variable yellow, instead of the less natural designation 2.
white = 1;
yellow = 2;
orange = 3;
blue = 4;
green = 5;
red = 6;
black = 7;
There are actually more colors defined in the cube.m file, but these are
enough to convey the idea.
N
TH E C
Next, we populate each of the faces with colors. This can be a bit tedious,
D
O
depending on how we want it to look. Here, we use the same simple state as
in the paper cube photograph from the CD-ROM.
The red face provides a nice example. Red and orange faces are oriented
such that the cube is resting on the white face. The top row corresponds to
the squares bordering the green side. Note that the orientation is an arbitrary
choice, but a choice that we must make. For other sides, we orient them and
number the squares on their faces differently. The green face may be visible
when the orange and red faces can be seen. We will number the green face’s
squares with the bottom row bordering the orange face, and the third column
bordering the red face.
For the yellow and blue faces, we orient them such that the cube rests on
the green face, which would be the case when we flip the cube around. The
top rows correspond to the squares bordering with the white side. For the
white side, we number the squares as we did the green side, with the bottom
row bordering the blue face, and the third column bordering the yellow
face.
To hold all of this information, we create a three-dimensional matrix.
Each face has three rows and three columns, and there are six faces total. So
PROJECTS 281
With our example cube, each face has a different color in the center square,
with white squares around it.
Showing the cube involves a few steps, ones that we have already seen.
First, we create a blank image along with variables that we need, like image
dimensions.
MaxRow = 700;
MaxCol = 700;
im2 = 255*ones(MaxRow, MaxCol, 3);
Next, we specify the vertex points for our cube, just as we did to draw the
frame. We also specify the left side and the right side. Since we already
showed the top face’s points, we include the left side vertices below. These
go with whatever face will appear on the lower-left.
y2 = [y1(7), y1(11), y1(14), y1(16), ...
249, 297, 356, 427, ...
376, 431, 496, 572, ...
471, 533, 601, 682];
So far, we are not doing any different from drawing the frame. We might
be tempted to draw the lines next, but they will need to appear over top of
the squares. Drawing them now means that they will be covered up by the
colors. Therefore, we fill in the colors next. In the code below, we have an
example square being colored. Since the square appears to us at an angle, we
use the fill_diamond function.
leftface = orange;
The first parameter gives the current image; when the function call ends,
the updated image will be returned and stored in the same matrix. The
second parameter looks difficult, but it specifies a color. To understand it,
282 INTRODUCTION TO MATLAB & SIMULINK
we examine it in one more level of detail. Variable mycube holds the state
of the cube, containing information about what colors go where. Which face
appears on the left depends on what sides we want to view, so we set up a
variable leftface to keep track of this. Remember that orange simply
holds a number, 3 in this case. Thus, mycube(1,1, leftface) returns
the element in row 1, column 1, on the orange side. That value will simply
be a number between 1 and 6, indicating the color. For the values that we
used, this maps to 3, the color for orange. After resolving this, we have the
code colors(3,:), which gives us all columns on row 3 of the colors
matrix, which in turn specifies the red, green, and blue component to make
the desired color. The other parameter to the fill_diamond function
specifies the four points that define the diamond shape. We repeat the call
to fill_diamond over and over again, until we have drawn all 27 of the
squares.
Next, we draw the lines. First, we find the points on the line, then we
draw each point on the image.
[newx1, newy1] = points_on_line(x2(1), y2(1), x2(4), y2(4));
for k=1:length(newy1)
im2(newy1(k), newx1(k), :) = 0;
im2(newy1(k)+1, newx1(k)+1, :) = 0;
end
Color value 0 corresponds to black. As before, we actually draw two lines side
by side to make them stand out. We need to repeat this for each line that we
used in the frame drawing function. Finally, we show the image.
image(uint8(im2));
The conversion to uint8 turns the color values of type double into the
8-bit values that the image function expects.
We can show the whole cube by repeating the above code, as needed.
However, we can only show three sides at a time, just as we can only view
three sides of a real cube at a time. The next section covers how we can view
other sides of the cube besides the default three sides.
Holding a cube, we can only see three sides at a time. When we change
our orientation, we view another three sides. With a physical cube, we
simply turn it over in hand. With a virtual cube, we need to specify different
PROJECTS 283
sides to view. We will not worry about animation or gradually changing the
view.
The trick here is to have a default view, then change it depending on the
desired view. We will always show three faces, but where we locate the faces
may be different. Consider the top face from the mesh cube in Fig. 3.11. We
want to keep the perspective, where the bottom corner appears closer to the
observer than the other corners. Imagine rotating the whole frame around
the point where all three faces meet, until the top face becomes a bottom
face. This is how the cube should look when flipped. While the concept is
easy, no simple option exists to do this.
As with most programming problems, there are multiple ways to solve
this. We could possibly subtract the coordinates of the corner where all three
faces meet from all x and y coordinates, to make that point an origin. Then we
could transform each point to polar coordinates, add 180 degrees to the angle,
then transform back and add the corner points’ original values. Actually, if
we did this, we would find that some points exist outside the matrix. That
is, rotating around point (339, 271) means that other points would have
negative coordinates, since this point does not align with the center of the
frame. Some points would have negative coordinates, which is no problem
for a graph in general, but this does not work when the coordinates map to
matrix indices. In short, we would need to correct the coordinates by adding a
constant.
However, we will take a different route that involves fewer calculations.
We treat each visible side separately. For the top side, rotate it around a point
and figuratively slide it down the image to a new location. The other sides
will be rotated and adjusted in a similar way. In other words, we will draw
the “left face” on the lower left when the flip variable has an even value, but
put it in the upper right otherwise.
To clarify this, see Fig. 3.16. It shows how we number the vertex points
from top to bottom and left to right. In the figure, we have numbers for the
faces to make them non-location specific.
Now when we take the flip into account, we keep the shapes of each face.
Face 1 appears on the bottom, while Face 2 goes from the lower left to the
upper right. Face 3 goes from the lower right to upper left. Fig. 3.17 shows
this. Try to envision the frame of each face rotating and sliding from one
position (Fig. 3.16) to another (Fig. 3.17). One advantage of this approach is
that the points remain in the same relation to each other. Drawing the line
between points 5 and 8 on the first frame still must be done on the flipped
frame. Another, more important, advantage is that all point coordinates
can be easily rotated. In other words, we do simple operations (additions,
284 INTRODUCTION TO MATLAB & SIMULINK
1
2 3
4 6
5
100 7 10
1 8 Face 1 9
11 4
13
12
2 14 15 3
200
3 2
5 16
6 8
300 4 1
7
7
9 6
400 12
10 Face 2 8 Face 3
5 11
11
500
13 16
10
12
14 15
600 9
15 14
16 13
700
100 200 300 400 500 600 700
FIGURE 3.17 Frame showing the vertex points on each face, flipped.
PROJECTS 285
subtractions, and re-arranging values) to map the points on the original frame
to their respective locations on the flipped frame.
You may have noticed that some of the lines overlap. For example, the
line segment from points 7 and 16 on Face 1, with the original orientation,
will be the same as the line segment from points 1 and 4 on Face 2. To
see this, examine Fig. 3.16, and imagine that the three faces are brought
together until they line up. While this does not take much processing time,
we can eliminate the extra line drawing by enclosing the code to draw the
three bordering lines within an if statement. As you can see from the flipped
version, we have three other, different lines that will overlap. These can be
drawn as needed with an else clause. The pseudo-code below shows this
for one example.
if we have a flip,
draw a line between Face 3's points 1 to 4
else
draw a line between Face 3's points 13 to 16
end
One of those two lines will be overlapped, depending on the flip value.
Now that we have a basic idea about how the points are laid out, and
how the code draws lines between them, we can get to how, specifically, we
move the faces around. For Face 1, we need to do two things: reverse the
order of the points and move them to a new location. The diamond shape
made by points 1, 2, 3, and 5 on Face 1 has the farthest distance from the
observer, and appears the smallest. When we flip the shape around, though,
the diamond made by points 12, 14, 15, and 16 is the farthest away (smallest).
We can exchange the first points with the last points with a command like
the following.
points = points(length(points): -1: 1);
This command reverses the order of the points in the array points.
Fig. 3.18 shows how the points on Face 1 will appear after the flip. Envi-
sioning what happens to the points as a whole can be easier by considering
a single point. In this figure, we see how the values for point 2’s coordinates
become point 15’s coordinates after the flip. We use point 16 as a fixed point,
and rotate the other points around it. First, we find the distance (subtrac-
tion) between point 16 and our example, point 2, and store the distance as
dx and dy. Whatever the distance might be along the x-axis, we want to copy
on the other side of the y-axis. In other words, however much point 2 is “to
the left” of point 16, we want to make the new value that much “to the right.”
286 INTRODUCTION TO MATLAB & SIMULINK
1
2
dx
dy
1 16
dy
dx
15
Adding the dx value to point 16 achieves this aim. The only thing left to do is
reverse the order of the new values, just as we did with the variable points
above. This specifies the new x coordinate; the y coordinate can be found in
a similar fashion, except for one small issue. We do not actually want Face 1
rotated in place around point 16, as Fig. 3.18 might suggest. We need to have
room on our image for the other two faces, so it makes sense to slide the
new version of Face 1 along the y-axis. Thus, we simply add a constant to the
new y-coordinate before reversing the new points. The code segment below
shows how to do this.
dx = x1(16) - x1;
dy = y1(16) - y1;
y1 = dy(length(dy):-1:1) + y1(16) + 158;
x1 = dx(length(dx):-1:1) + x1(16);
For the other two faces, we perform a similar rotation. For Face 2, we
want to figuratively spin it 180 degrees around point 4, the equivalent to
point 16 on the first face. After such a rotation, point 16 would be the highest
point on Face 2, followed by point 15, etc. We renumber the points as we
did above to make these points 1, 2, etc.
You may observe that the shape for Face 2 does not dramatically change;
it looks as if we could just slide the face to the upper right. That approach
creates a problem, though, since we lose the perspective. The diamond shape
defined by points 3, 4, 7, and 8 on Face 2 makes the largest such shape on
this face. It would look odd to the viewer for the largest square to also be
the furthest away. It should be apparent why we need to take the rotation
approach to keep the illusion of distance to the viewer.
N
TH E C
With these considerations, we can show a full-color, three-dimensional cube
D
O
3.17 EPILOGUE
S
olutions to the problems formulated in this book are given in this
chapter. Readers should work out these problems on a computer
as they read the book. Most of the solutions are also given in the
form of MATLAB m-files or Simulink systems in the software accompa-
nying this book. The names of the appropriate m- or mdl-files are given
with each solution. An indication of which call is to be used for the solu-
tions in MATLAB can (in the case of m-files) be read out by entering help
<Filemame_without_ending>. The relevant comments for Simulink
systems appear in the system window.
You should make sure that the installed MATLAB search path (see
Section 1.2.9) contains the folder with the files from the accompanying
software.
M = [ 1 0 0;...
0 j 1;...
j j+1 -3]
k = 2.75
289
290 INTRODUCTION TO MATLAB & SIMULINK
y = (1:0.5:100.5)
M = [ 1 0 0;...
0 j 1;...
j j+1 -3];
V = [M M; M M]
The solutions for parts (2) to (4) of this problem are as follows:
% Erasing row 2 and column 3 of V
% and saving as V23
V23 = V; % Save V, otherwise the matrix
V23(2,:) = []; % would be erased by these operations
V23(:,3) = [];
z4 = [1 2 3 4 5 6];
V(4,:) = z4;
SOLUTIONS TO THE PROBLEMS 291
V(4,2) = j+5
V =
Columns 1 through 3
1.0000 0 0
0 0 + 1.0000i 1.0000
0 + 1.0000i 1.0000 + 1.0000i -3.0000
1.0000 5.0000 + 1.0000i 3.0000
0 0 + 1.0000i 1.0000
0 + 1.0000i 1.0000 + 1.0000i -3.0000
Columns 4 through 6
1.0000 0 0
0 0 + 1.0000i 1.0000
0 + 1.0000i 1.0000 + 1.0000i -3.0000
4.0000 5.0000 6.0000
0 0 + 1.0000i 1.0000
0 + 1.0000i 1.0000 + 1.0000i -3.0000
The command
z4 = [1 2 3 4 5 6];
292 INTRODUCTION TO MATLAB & SIMULINK
is sufficient for the reconstruction and the command will again be executed
in the command window.
Solution to Problem 6 (file: none)
If it is not already open, open up the workspace browser and enter a check
mark in the Desktop menu next to Workspace. Then double-click on the
symbol for V. In that way you get the Array Editor window shown in Fig. 4.1.
FIGURE 4.1 The Array Editor with the matrix V before filling row 5 with zeroes.
SOLUTIONS TO THE PROBLEMS 293
V =
Columns 1 through 3
1.0000 0 0
0 0 + 1.0000i 1.0000
0 + 1.0000i 1.0000 + 1.0000i -3.0000
1.0000 5.0000 + 1.0000i 3.0000
0 0 0
0 + 1.0000i 1.0000 + 1.0000i -3.0000
Columns 4 through 6
1.0000 0 0
0 0 + 1.0000i 1.0000
0 + 1.0000i 1.0000 + 1.0000i -3.0000
4.0000 5.0000 6.0000
0 0 0
0 + 1.0000i 1.0000 + 1.0000i -3.0000
>> whos
Name Size Bytes Class
n
x, y = xk · y k .
k=1
x = [1 2 1/2 -3 -1];
skp1 = x*y
The solutions for parts (2) and (3) of this problem look like:
% The product of the matrices A and B
A*B
A unit matrix can also be defined using the MATLAB command eye. All that
has to be specified is the size of the matrix; in the above case, this would be
E3 = eye(3);
A = [ 2 2;...
1 1];
b = [2; 1];
x = A\b
x =
NaN
NaN
A = [ 2 2;...
1 1];
b= [2 1];
x = b/A
x =
Inf -Inf
must be interpreted as bA
b/A −1 . The reaction of MATLAB is explained as
in the preceding solution. The values Inf (∞) and -Inf (−∞) are assigned
to the result vector.
Solution to Problem 12 (file: none)
The matrix M can be inverted using left division by the unit matrix:
>> M = [1 1 1 ; 1 0 1; -1 0 0];
>> Minv = M\eye(3)
Minv =
0 0 -1
1 -1 0
0 1 1
A = [1 -3 ;0 0];
B = [0 5 ;0 1];
% Determine logical OR
resOr = A|B;
resOr =
1 1
0 1
Only the (2, 1) term is equal to 0 (logically false) for the two matrices A and B.
For all the other terms, there is at least one number that is interpreted as
logically true. Thus, the result of the OR for these terms is always 1 (true).
% Determine the logical negation of A
NegA = ~A;
NegB = ~B;
NegA =
0 0
1 1
>> NegB
NegB =
1 0
1 0
A term that is = 0 (true) is converted into 0 (false) and a term that is 0 (false)
is converted into 1 (true).
% Determine xor of A and B
resXor = xor(A,B);
The result is
>> resXor
resXor =
298 INTRODUCTION TO MATLAB & SIMULINK
1 0
0 1
The result is 1 if the numbers in a given term of A and B are different when
interpreted as logical values, otherwise the result is 0.
Solution to Problem 14 (file: solrelops.m)
The MATLAB instructions
% Define the vectors x and y
x = [1 -3 3 14 -10 12];
y = [12 6 0 -1 -10 2];
resultLess = x<y;
resultLessEq = x<=y;
resultGreaterEq = x>=y;
resultEq = x==y;
resultNotEq = x~=y;
1 1 0 0 0 0
>> resultLessEq
resultLessEq =
1 1 0 0 1 0
>> resultGreaterEq
resultGreaterEq =
0 0 1 1 1 1
SOLUTIONS TO THE PROBLEMS 299
>> resultEq
resultEq =
0 0 0 0 1 0
>> resultNotEq
resultNotEq =
1 1 1 1 0 1
U = -10*ones(4,5);
O = 10*ones(4,5);
P = X&Y;
First, two matrices with the same dimensions as C are defined whose
terms are only −10 or 10. Then C is compared with these matrices. The
matrix P contains a 1 if the terms of C lie within these limits, otherwise a 0.
result = C.*P
300 INTRODUCTION TO MATLAB & SIMULINK
C =
1 2 3 4 10
-22 1 11 -12 4
8 1 6 -11 5
18 1 11 6 4
result =
1 2 3 4 10
0 1 0 0 4
8 1 6 0 5
0 1 0 6 4
in the present case. Of course, matrices (arrays) that are connected by rela-
tional operators have the same dimensions, although a connection with a
number is an exception. In that case, the number is, as desired, connected
with every component of the field.
E = [ 1 0 0 0; ...
0 1 0 0; ...
0 0 1 0; ...
0 0 0 1];
Elog = logical(E)
theDiag = D(Elog)
>> soldiagselect
D =
7 2 3 10
-2 -3 11 4
8 1 6 5
18 1 11 4
Elog =
1 0 0 0
0 1 0 0
0 0 1 0
0 0 0 1
theDiag =
7
-3
302 INTRODUCTION TO MATLAB & SIMULINK
6
4
>> whos
Name Size Bytes Class
The concluding call of whos again shows that Elog is a logical field.
Solution to Problem 17 (file: solfuncdef1.m)
% Define time vector
t=(0:0.1:10);
s = sin(2*pi*5*t).*cos(2*pi*3*t) + exp(-0.1*t)
t = (0:0.1:10);
s = sin(2*pi*5.3*t).*sin(2*pi*5.3*t)
s2 = sin(2*pi*5.3*t).^2
Note that, here as well, multiplication and the taking of a power (squaring)
are meant to be done term-by-term, and must accordingly be treated as field
operations.
Solution to Problem 19 (file: solround1.m)
% Define the time vector
t = (0:0.1:10);
s = 20*sin(2*pi*5.3*t);
s2infty = ceil(s)
s2zero = fix(s)
The rounding functions ceil, fix, round, and floor can be used to
round numbers off to integers in different ways. These functions differ only
in the direction of rounding. For example, 1.25 rounds down (toward 0) to 1
and up (toward ∞) to 2, but −1.25 rounds toward 0 to -1 and toward ∞ also
to −1.
Here is the result of the above calculations in MATLAB for the first six
values:
>> s(1:6)
ans =
Columns 1 through 5
Column 6
-16.1803
>> s2infty(1:6)
ans =
0 -3 8 -10 14 -16
>> s2zero(1:6)
ans =
0 -3 7 -10 13 -16
s = 20*sin(2*pi*5*t);
s2round = round(s);
[s(1:6); s2round(1:6)]
ans =
1.0e-013 *
All the values of s(t) have evidently been rounded toward 0. A more precise
look at the first row shows that the values of s all are on the order of 10−13
(i.e., very close to 0). If the theoretically expected values are examined more
1
closely, we find that the sine of all multiples of 0.1 = 10 is
1
s k = 20 sin (2π5k/10) = 20 sin (kπ ) = 0 for all k ∈ N .
10
The theoretical values are also all 0. The values we see in MATLAB’s response
are within the limits of error of the computations.
We shall return to this phenomenon again when we discuss the graphical
capabilities of MATLAB. In this case, a graphical display can lead to strange
results and erroneous interpretations.
log10ofb = log10(b)
log2ofb = log2(b)
306 INTRODUCTION TO MATLAB & SIMULINK
log10ofb =
log2ofb =
...
th =
1.1071
0.6435
0.7854
0
0.1107
r =
2.2361
5.0000
1.4142
4.0000
9.0554
SOLUTIONS TO THE PROBLEMS 307
polarc2 =
2.2361 1.1071
5.0000 0.6435
1.4142 0.7854
4.0000 0
9.0554 0.1107
The mistake thus lies in the plot command and is attributable to the
different lengths of t and [sinfct, cosfct, expfct]. Although
the vectors sinfct, cosfct, and expfct all have the same length
as t, as can easily be confirmed by entering whos, the vector
[sinfct, cosfct, expfct] is three times as long, since it is produced
by writing the vectors with the functional values one after another (separated
by commas).
The correct way is to write the vectors one under the other (separated
by semicolons) in the form [sinfct, cosfct, expfct], so that in the
plot command t can be assigned to each of the row vectors in this n × 3
matrix and the plot can be made correctly.
Solution to Problem 24 (file: solwhatplot.m)
Fig. 4.2 shows the MATLAB graph generated by this sequence of
commands.
Only the exponential function is recognizable. The cosine shows up as a
triangular wave and the sine as a zero line.
This result is attributable to a phenomenon mentioned previously in the
solution to Problem 20. The choice of times in the vector t (here multiples
of 0.5) for evaluating the sine function and the frequency of the sine wave
(5 Hz) mean that the sine is evaluated at its zeroes. The cosine is evaluated
308 INTRODUCTION TO MATLAB & SIMULINK
1.5
0.5
−0.5
−1
−1.5
−2
0 1 2 3 4 5 6 7 8 9 10
at the points
2π · 3 · 0.5k = 3kπ, k ∈ {0, 1, · · · , 20}.
There the cosine alternates between +1 and −1. Between these values,
plot joins the values with a straight line, thereby producing the impression
of a triangular wave, and in the case of the sine, a zero line. In terms of
systems theory this phenomenon is related to the so-called sampling theorem,
which effectively states how signals must be sampled in order to avoid losing
information. In the above examples the premises of this theorem are violated,
so information has been lost. We won’t go into these theoretical aspects here.
The interested reader is referred to the relevant specialist literature.
This example shows that caution is required in interpreting graphics. It
is always best to use additional information for checking a graphical result
and not to accept the result blindly.
Solution to Problem 25 (file: solplotstem.m)
Study the source text for the script file solplotstem and experiment with
it as you make appropriate changes.
The original solution in solplotstem shows, in particular, that the
command stem is extremely unsuitable for small step sizes and is preferable
for sparse data sets. The opposite is true of the command plot.
SOLUTIONS TO THE PROBLEMS 309
omega = (0.01:0.01:5);
H1 = 1./(j*omega);
In the first case we get an error message from MATLAB saying that here
the matrix 1 must be divided by the matrix j*omega. What we should have
1
calculated is the value of jω for every frequency, (i.e., with respect to omega
term-by-term). This is again a field operation.
The second error is somewhat more subtle, since MATLAB produced no
error message. With this instruction, 1/j is multiplied by the vector omega.
This is indeed syntactically correct, but it is not what should be calculated.
The third common error applies to the plot itself. The instruction
plot(omega,H1);
f = sin(X.^2+Y.^2).*exp(-0.2*(X.^2+Y.^2));
X =
-1 0 1
-1 0 1
-1 0 1
>> Y
Y =
-2 -2 -2
0 0 0
2 2 2
now relies on the fact that for each calculation the terms of X and Y will
be combined pairwise. For example, the calculation involves x = X11 = −1
and y = Y11 = −2 for the term (1, 1) of the function value matrix f. The
matrix f thus contains the function value at the point ( − 1, −2) there. All
combinations for the lattice in the rectangle [−1, 1] × [−2, 2] with a grid
separation of 1 or 2 will be run through in constructing the matrices X and Y.
Solution to Problem 29 (file: solsurf2.m)
The corresponding commands are named plot3, surf, mesh, and fill3.
Put these commands1 in the script file solsurf.m instead of surf and
execute the script file by entering the command solsurf in the MATLAB
command window.
Solution to Problem 30 (file: solTransFunc.m)
We limit ourselves to displaying the plot instructions from solTransFunc.m:
subplot(211)
loglog(omega, abs(H2));
grid
1
We recommend consulting MATLAB help beforehand, in order to make correct
syntactic use of them.
312 INTRODUCTION TO MATLAB & SIMULINK
xlabel('Frequency / rad/s');
ylabel('Amplitude');
subplot(212)
semilogx(omega, angle(H2));
grid
xlabel('Frequency / rad/s');
ylabel('Phase');
Graphs are placed next to one another or above and below one another
using the subplot command, as with
subplot(121); % Plot the first function
plot(t,f1,'b');
subplot(122); % Plot the second function next to it
plot(t,f2,'r');
The plots can be copied into the cache using the menu command Edit -
Copy Figure. Then they can be pasted into another windows application.
Solution to Problem 32 (file: sol2Dplot.m)
This problem can be solved as follows using the MATLAB function
meshgrid:
% Setting up the vectors for partitioning the axes
[X,Y] = meshgrid(x,y);
f = X.^2+Y.^2;
SOLUTIONS TO THE PROBLEMS 313
...
If everything has run properly, you should get the following responses:
>> whos
Name Size Bytes Class
>> TestMat
TestMat =
3 -4 5
-1 4 6
0 6 -3
The matrix of the text file can then be processed further in MATLAB.
With this technique you can conveniently upload data that is stored, for
instance, in ASCII format into MATLAB for further processing.
2
If in doubt, just enter the command path.
314 INTRODUCTION TO MATLAB & SIMULINK
KVector =
1.0000 + 1.0000i
0 + 1.0000i
1.0000 - 1.0000i
>> KVector
KVector =
1.0000 + 1.0000i
0 + 1.0000i
1.0000 - 1.0000i
shows that in this case the complex vector has been correctly stored and again
read.
Unlike in the ASCII format (see Problem 34), complex fields can thus
be stored and read in binary MATLAB format without difficulty.
SOLUTIONS TO THE PROBLEMS 315
M = [ 1 2 3; ...
1+j 6 0; ...
3+j 0 -j];
dlmwrite('Mmatrix.txt', M, 'delimiter','\n','precision','%.4f');
signal = 10*signal;
Compare the two audio signals by playing them with a suitable program
(e.g., with Windows Media Player).
Solution to Problem 38 (file: none)
;-)
Solution to Problem 39 (file: none)
First, the path C:\mymatlab is set up in the toolbar of the MATLAB
command interface (see Fig. 1.1). This is done by pressing the . . .-button
and then selecting within the file choice window.
With that, the command
>> path(path, 'C:\mymatlab');
is added to the MATLAB search path (for commands and instructions) in the
directory C:\mymatlab.
If the search path is to be kept for later MATLAB sessions, this must be
done via the menu command File - SetPath .... As an alternative to
the above method, the new search path can be set here. After that, you can
supply the search path with a directory containing all the subdirectories.
Solution to Problem 40 (file: none)
The complex terms in the (row) vector r are defined using the j symbol. For
defining the corresponding column vector it is best to use the transposition
operator '. Thus,
>> rz = [j j+1 j-7 j+1 -3];
>> rs = rz.';
v = logspace(0,1,10);
loglog(v,v);
[X,Y] = meshgrid(x,y);
f = sin(X.^2+Y.^2).*exp(-0.2*(X.^2+Y.^2));
Columns 1 through 11
...
Columns 89 through 91
z = (1:0.5:100);
factor = floor(length(z)/3);
rest = length(z)-3*factor;
resultV = z(xLogic)'
first create an auxiliary vector with three components which are appended to
one another factor times using repmat. This factor is calculated from the
length of z. In order to make the factor integral, use the function floor.3
The resulting numerical vector is then filled to the length of z with zeroes
and converted into a logical vector. It will select the desired values.
This is shown by calling solrepmat:
>> solrepmat
resultV =
2.0000
3.5000
5.0000
3
In this example, the solution is generally well behaved. Of course, it was necessary
to be able to figure out explicitly the required number of components and to enter it.
SOLUTIONS TO THE PROBLEMS 319
...
98.0000
99.5000
Graphic =
title: 'Example'
xlabel: 'time / s'
ylabel: 'voltage / V'
num: 2
color: 'rb'
grid: 1
xVals: [0 5]
yVals: [-2 0]
or
>> setfield(Graphic, 'yVals', [-2 0]);
color =
for k=1:20
Colorfield(k).red = 'yes';
Colorfield(k).blue = 'no';
Colorfield(k).green = [0, 256, 0];
end
>> Colorfield
Colorfield =
solstructarray
Colorfield2 = Colorfield;
clear Colorfield
for k=1:20
SOLUTIONS TO THE PROBLEMS 321
>> Colorfield
Colorfield =
>> Colorfield(10)
ans =
red: 'yes'
green: [0 256 256]
The reason is that the field elements have to be of the same kind. If the field
'blue' is eliminated in the first component, this structure does not match
the other 19. The elements of a field must, however, always be of the same
kind.
This is also the reason why the field Colorfield must first be cached
in the solution to Problem 50.
Solution to Problem 52 (file: solmeascampaign.m)
clear all
[n,m] = size(meascampaign{3,5}{2});
The call
>> solmeascampaign
>> meascampaign{3,5}{2}
ans =
-1 0
-1 0
SOLUTIONS TO THE PROBLEMS 323
-1 0
-1 0
-1 0
shows that the measured values (in cell 2) of field element (3, 5) have been
set in accordance with the problem statement.
Solution to Problem 53 (file: solweeklymeas.m)
clear all
for k=1:5
weeklyMeasurements{k} = measurements;
end
weeklyMeasurements{4}
weeklyMeasurements{5}
Calling
>> solweeklymeas
measurements =
weeklyMeasurements =
Columns 1 through 4
Column 5
{1x3 cell}
ans =
ans =
ans =
ans =
ans =
clear all
solweeklymeas;
weeklyMeasurements{1}{2} = [weeklyMeasurements{1}{2};[250,0]]
Day3 = weeklyMeasurements{3}
fid = fopen('sayings.txt');
fclose(fid);
celldisp(sayings)
>> soltextscan
sayings{1}{1} =
All
sayings{1}{2} =
your
sayings{1}{3} =
base
sayings{1}{4} =
are
sayings{1}{5} =
belong
sayings{1}{6} =
to
SOLUTIONS TO THE PROBLEMS 327
sayings{1}{7} =
us.
It would have also been possible to include the vector a in the return
value vector as well. But it is better programming style not to overwrite a
with the function, since in later MATLAB commands, after execution of this
function, this vector can be recalled if necessary.
Note that the color codes for plot must be passed on for a correct call
of the function; for example,
>> [t, sinfct, cosfct, expfct] = ...
solfnExample2(3, 'r', 2, 'b', 1.5, 'g');
t=(0:0.01:2);
sinfct=sin(2*pi*fctparams.f1*t);
cosfct=2*cos(2*pi*fctparams.f2*t);
expfct=exp(-fctparams.damp*t);
...
% ...
circumference = 2*pi*radius;
area = pi*radius^2;
fill(x, y, color);
axis equal
N = length(vector);
outvect = [];
N = length(vector1);
scprod = 0;
and thereby use the matrix algebra operations of MATLAB. Of course, the
premise for this command is that the vectors are row vectors (with equal
lengths).
Solution to Problem 62 (file: solfinput.m)
Essentially, the solution follows from the function FInput with different
preinitialization of the output vector and a slight shift within the while
loop.
function [InVector] = solfinput()
%
% ...
InVector = [];
SOLUTIONS TO THE PROBLEMS 331
switch color
case 'red'
fcode = 'r'; % fcode is a variable for the
case 'blue' % plot color code
fcode = 'b';
case 'green'
fcode = 'g';
case 'magenta'
fcode = 'm';
otherwise
disp('The input parameter was not allowed!');
error('Please input help solcolorsin.');
end
% plot function
t = (0:0.01:2*pi);
plot(t, sin(t), fcode);
approximation = xn1;
res = 0;
rem = a;
% computational loop
t = linspace(grStruct.xVals(1), grStruct.xVals(2));
% plot graph
% label graph
title(grStruct.Title);
xlabel(grStruct.xlabel);
ylabel(grStruct.ylabel);
if grStruct.grid
grid
end;
freqs = [varargin{:}];
N = length(freqs); % set the number
sfct = [];
for k=1:N
sfct = [sfct; sin(2*pi*freqs(k)*time)];
end
plot(time, sfct)
for k = 1:n
fname = ['Sig', num2str(k)]; % create signal names
% create a string of commands
% for the assignment
assign = [fname, ' = ', 'rand(10,1);'];
eval(assign); % execute command
After execution of
>> soleval(5)
ffile and fname are already strings and should not be between apos-
trophes. Spaces should also be provided, so the individual elements of the
command string won’t be attached to one other and appear as unknown
commands to the MATLAB interpreter.
Solution to Problem 69 (file: fprinteval.m)
It is sufficient just to construct the format string inside the for-loop of the
program fprinteval and then call the function fprintf:
...
for k=1:N
% construct format string
336 INTRODUCTION TO MATLAB & SIMULINK
% evaluate F
% at the reference points
for i=2:1:N
integral = integral+h*F(intval(i));
end;
% screen output
fprintf('\n');
fprintf('\nTrapez (ours): %12.8f', integralT1);
fprintf('\nTrapez (MATLAB): %12.8f', integralTM);
fprintf('\nSimpson (ours): %12.8f', integralS1);
fprintf('\nSimpson (MATLAB): %12.8f\n\n', integralSM);
The solutions calculated using the trapezoidal rule are always consistent since
they are based on the same reference points. A calculation with identical
reference points was not possible for the Simpson rule, since the function
quad has a different calling convention from trapz. But the solutions differ
by little, as the following sample call shows:
>> solquad(0, 1, @sin, 4)
...
338 INTRODUCTION TO MATLAB & SIMULINK
Note that because of the inbuilt step size control in ode23, another time
vector name must be used here. The lengths of t and t2 are not necessarily
the same.
Fig. 4.4, which was created using the commands
>> plot(t,solutionLinear(:,1),'r-',t2, solution(:,1),'b-')
FIGURE 4.4 Comparing the solutions of the linearized and nonlinear differential
equations for a mathematical pendulum with a large initial deviation.
SOLUTIONS TO THE PROBLEMS 339
reveals a distinct difference between the two solutions and, thereby, the
error engendered by linearizing the differential equation for large deviations.
With appropriate MATLAB calls, verify the good agreement between the two
solutions for small deviations, say, π8 .
R = 10000; % resistance R
C = 4.7*10e-6; % capacitance C of the capacitor
f = 3; % frequency of the driving frequency
% in Hz
% preinitialization
udot = 0;
% the first order equation
% u1(t) must be defined
% as a function in MATLAB
FIGURE 4.5 Response to excitation of the RC low pass filter in the example by two
different oscillations.
reveals a difference between the solutions for values within the interval
[8, 20].
Solution to Problem 75 (file: solgrowth.m)
The differential equation is defined via the following function:
function [Pdot] = solgrowth(t,P)
%
% ...
we find the unit step function response shown in Fig. 1.28 (see file u1.m).
...
Thus, we first introduce a parameter for the length in the parameter list
of the definition function (solparamODE) and, accordingly, pass on the
code:
function [alphadot] = solparamODE(t, alpha, length)
%
% Function solparamODE
%
% ...
% preinitializing
342 INTRODUCTION TO MATLAB & SIMULINK
alphadot = [0;0];
Here, the equation will obviously be solved twice with pendulum lengths
of 20 and 5. The empty brackets ([]) are a placeholder for a structure of
options (see help odeset), which must be specified at this point. In the
present case the default options, which cover most cases, will be used because
of this placeholder.
Fig. 4.6 shows the results of the calculations.
You can see clearly that the period is twice as long for the pendulum of
length 20 as for the one with length 5 (period = √2π ).
g/l
FIGURE 4.6 Solutions of the differential equation for the mathematical pendulum for
pendulums of length 5 and 20.
SOLUTIONS TO THE PROBLEMS 343
% first equation
ydot(1) = -2*y(1) - y(2);
% second equation
ydot(2) = 4*y(1) - y(2);
The solution can then be calculated, say over the interval [0, 5], with
This numerical solution can be compared with the exact solution using
the symbolics toolbox help and the function dsolve:
sol =
>> pretty(sol.y1)
1/2 1/2
exp(- 3/2 x) (- 1/5 15 sin(1/2 15 x)
1/2
+ cos(1/2 15 x))
344 INTRODUCTION TO MATLAB & SIMULINK
>> pretty(sol.y2)
1/2 1/2
- 1/2 exp(- 3/2 x) (- 6/5 15 sin(1/2 15 x)
1/2
- 2 cos(1/2 15 x))
>> syms x
>> y1 = subs(sol.y1, x, t);
>> y2 = subs(sol.y2, x, t);
>> subplot(211)
>> plot(t,solution(:,1),'r-',t,solution(:,2),'b-')
>> xlabel('time / s');
>> subplot(212)
>> plot(t,y1,'r-',t,y2,'b-')
>> xlabel('time / s');
FIGURE 4.7 Solution of the system of differential equations from Problem 78. Top:
numerical solution with ode23, bottom: symbolic solution using dsolve.
SOLUTIONS TO THE PROBLEMS 345
>> soldeval
solStruct =
solver: 'ode23'
extdata: [1x1 struct]
x: [1x95 double]
y: [2x95 double]
stats: [1x1 struct]
idata: [1x1 struct]
sol =
Columns 1 through 5
Columns 6 through 10
syms x
g = sin(5*x-2);
G = int(g,x);
G2 = int(G,x);
You can see from the entry sym object that the entire set of quantities
are symbolic quantities.
The calculated functions are
>> G
G =
-1/5*cos(5*x-2)
>> G2
G2 =
-1/25*sin(5*x-2)
SOLUTIONS TO THE PROBLEMS 347
Note that the constants of integration have not been taken into account.
Solution to Problem 81 (file: solsymtaylor.m)
% define x as a symbolic quantity
syms x
g = sin(5*x-2);
T3 = taylor(g,4,1);
pretty(T3)
yields
2
sin(3) + 5 cos(3) (x - 1) - 25/2 sin(3) (x - 1)
3
- 125/6 cos(3) (x - 1)
Note that the second parameter must be set at one higher than the degree
of the Taylor polynomial which it is to determine.
Solution to Problem 82 (file: solsymDE.m)
% define x as a symbolic quantity
syms x
-2/(x^2-2*C1)
348 INTRODUCTION TO MATLAB & SIMULINK
syms x
g = sin(5*x-2);
% take the derivative of the function g(x) twice, symbolically
g1 = diff(g,x);
g2 = diff(g,x,2);
t=(0:0.01:10);
G = subs(g,x,t);
G1 = subs(g1,x,t);
G2 = subs(g2,x,t);
syms x
maple('g := sin(5*x-2);');
maple('G:= int(g,x);');
G2 = maple('int(G,x);')
SOLUTIONS TO THE PROBLEMS 349
N
TH E C
Solution to Problem 85 (file: s_test1.mdl)
D
O
t
y(t) = x(τ ) dτ + y(0) .
0
Differentiation of this equation gives Eq. (2.1). The system therefore solves
this (somewhat degenerate) differential equation.
350 INTRODUCTION TO MATLAB & SIMULINK
1 kg kg
b2 = 0.4 · · 63.6943 · 10−4 · 1000 m2 3 = 1.2739 .
2 m m
We assume that the round side is in the positive direction of motion5 and the
flat side, in the negative direction, so that b1 is used if sgn(x(t)) ≥ 0 and b2 if
sgn(x(t)) < 0.
This can be done using the switch block.
Fig. 4.9 shows the segment of the system s_solOscill of interest.
Here, the switch block is controlled by the output of the sgn function
of the installed Fcn block from the User-defined Functions func-
tion library. The parameter Threshold controls the threshold according to
which a high or low input is switched on.
In conclusion, it should be noted that the substitution corresponding to
Fig. 4.9 is easier if the Fcn block is used to calculate the whole quantity b ·
sgn(x(t)) · x2 (t) (see the solution to Problem 90). You just have to remember
that the input signal for this block is always called u.
FIGURE 4.10 Simulink system s_solpendul for solving the (unlinearized) differential
equation for the mathematical pendulum.
FIGURE 4.11 Simulink system for solving the initial value problem, Eq. (2.13).
FIGURE 4.12 Simulink system for solving the initial value problem (2.14).
1
ÿ(t) = (4 − 2ẏ(t) − 4y(t)) , y(1) = 1 , ẏ(1) = 1 (4.2)
t
Fig. 4.12 shows the Simulink system, which solves the initial value
problem. It is a graphical reflection of Eq. (4.2).
Note that the simulation start point must be set to 1 (viz. the initial
values!).
FIGURE 4.13 Simulink system for solving the system of differential equations (2.15).
S =
>> Y1 = S.y1;
>> Y2 = S.y2;
>> pretty(simplify(Y1))
>> pretty(simplify(Y2))
In order to be able to compare the signals with one another, you substitute
the time vector time created by the system s_solTD2 for t in the symbolic
variables Y1 and Y2 as follows:
>> syms t % symbolic variables in Y1 and Y2
>> sol1 = subs(Y1,t,time);% replace t with time values
>> sol2 = subs(Y2,t,time);% replace t with time values
ans =
1.0000 1.0000
0.9502 0.9502
0.9006 0.9006
0.8514 0.8514
0.8025 0.8025
0.7539 0.7539
0.7056 0.7056
...
-0.0162 -0.0162
-0.0580 -0.0580
-0.0993 -0.0993
356 INTRODUCTION TO MATLAB & SIMULINK
Here, the signals x(t) and ẋ(t) are first combined into a vector sig-
nal by a multiplexer. The differential equations is realized within the Fcn
block whereby the individual components of the vectorial input signal are
processed. Most of the blocks in the original system s_Denon are left out.
Solution to Problem 95 (file: s_solTD3.mdl)
The system of differential equations (2.15) can be solved using the Fcn blocks
shown in Fig. 4.15.
Here, the right-hand sides of the equations are each completely realized
in the Fcn blocks and the solutions are assembled into a vector valued signal,
which is used as an input signal for the Fcn blocks.
Solution to Problem 96 (file: s_DEnon5.mdl)
The result of combining the blocks in the feedback branch is shown in
Fig. 4.16.
It should first be noted that this subsystem has two inputs, unlike the
example from Section 2.4. This construction may be rather difficult to carry
SOLUTIONS TO THE PROBLEMS 357
FIGURE 4.15 Simulink system for solving the system of differential equations (2.15).
out if the blocks are also connected to the integrators and sink blocks. As
long as the system setup is incorrect, you will find that the menu entry
Edit - Create Subsystem cannot be selected. When that happens,
you have to recheck the selected partial system.
blks =
's_pendul/Gain'
's_pendul/Integrator1'
's_pendul/Integrator2'
's_pendul/sin(u)'
's_pendul/Out1'
GainPars =
Note that the Simulink system s_pendul has to be open in order for
find_system to work reasonably. Otherwise, an error message appears.
The corresponding calls for setting a new pendulum length as well as the
calls for the system and plotting the results look like
>> set_param('s_pendul/Gain','Gain','-9.81/5');
>> [t,x,y] = sim ('s_pendul', [0, 30]);
>> set_param('s_pendul/Gain','Gain','-9.81/8');
>> [t1,x1,y1] = sim ('s_pendul', [0, 30]);
>> plot(t,y,'r-',t1,y1,'b:');
Y = [ ];
iterations = length(lng);
for i=1:iterations
% Set the gain parameter with set_param
% for each new iteration!
frq = num2str(-9.81/lng(i));
set_param('s_Pendul/Gain','Gain',frq);
Please note that for this version of the program a fixed step procedure
must be set in s_pendul. Moreover, the Simulink system must be open,
otherwise MATLAB responds with an error message in a form something like
?? Error using ==> set_param
Invalid Simulink object name: s_pendul/Gain.
Y = [ ];
iterations1 = length(r);
iterations2 = length(Fc); % new relative to DEnonit
for i=1:iterations1
...
c = num2str(Fc(k)); % new relative to DEnonit
set_param('s_DEnon3/Factorc','Gain',c);
[t,x,y] = sim('s_DEnon3', [0,sz]);
Y = [Y,y];
end;
% ...
for i=1:iterations
% set the gain parameters with set_param
% for each new iteration!
frq = num2str(frequencies(i));
set_param('s_SolSin/Sinefunction','Frequency',frq);
SOLUTIONS TO THE PROBLEMS 361
[t,x,y] = sim('s_SolSin');
Y = [Y,y];
end;
FIGURE 4.17 Simulink system for solving the initial value problem (2.17).
The system can be called via the following function for variable step
heights h:
function [t,Y] = solSimDE(heights)
%
% ...
...
for i=1:iterations
% Set the gain parameters with set_param
% for each new iteration.
h = num2str(heights(i));
set_param('s_solSimDE/Step','After',h);
362 INTRODUCTION TO MATLAB & SIMULINK
[t,x,y] = sim('s_solSimDE');
Y = [Y,y];
end;
% ...
...
T = {}; Y = {};
for i=1:iterations
% Set the block parameters with set_param
% for each new iteration.
Reciprocalmass = num2str(1/M(i));
set_param('s_DEnon6/invm','Gain',Reciprocalmass);
b = num2str(B(i));
set_param('s_DEnon6/Factorb','Gain',b);
c = num2str(Fc);
set_param('s_DEnon6/Factorc','Gain',c);
[t,x,y] = sim('s_DEnon6', [0,sz]);
SOLUTIONS TO THE PROBLEMS 363
>> whos
Name Size Bytes Class
An analysis of the cell entries shows that the numerical vectors in the
cells have different lengths:
>> Y
Y =
>> T
T =
On calling the plot command, you will see that the curves are somewhat
“jagged,” since few reference points were used. The interpolation procedures
described above should be used to get a smoother display.
We skip the graphical display of the results here.
FIGURE 4.18 Simulink system for simulation of the characteristic curve (2.21).
Note that the characteristic curve block extrapolates the values outside
the defined segments, in this case to 0 at the bottom and to 2 at the top, as
the definition of k(x) also specifies.
As you can see, the preceding commands have already been used in a
problem in Chapter 1 on MATLAB techniques.
After these instructions have been entered into MATLAB, the character-
istic curve can be seen in the characteristic curve block, if the vectors x and
k have been entered appropriately there. In addition, we enter the variable
amp in the amplitude parameters of the sine wave block in order to be
able to change the amplitude from MATLAB.
SOLUTIONS TO THE PROBLEMS 365
You can see that negative values of the sine have been set equal to 0 with
the characteristic curve. If the amplitude exceeds 4, the output value is set
at 2 for the given time. In between, the value of a sin (2π x) is plotted.
Solution to Problem 104 (file: s_solcharfam.mdl)
Fig. 4.20 shows the Simulink system to be designed.
For this system, the parameters of the family of characteristic curves, x,
y, and k, set in s_solcharfam have to be set using the following MATLAB
instructions:
>> x = (-1:0.1:1);
366 INTRODUCTION TO MATLAB & SIMULINK
FIGURE 4.20 Simulink system for simulating the family of characteristic curves (2.22).
>> y = (-1:0.1:1);
>> ind = (0:1:length(x)-1);
>> [X,Y] = meshgrid(x,y);
>> k = X.^2+Y.^2;
Appendix A MATLAB
OPERATIONS
T
he following tables summarize the application of arithmetic opera-
tions in MATLAB as matrix and field operations.
367
368 INTRODUCTION TO MATLAB & SIMULINK
Operation
in MATLAB Effect Example
1 2
A+B matrix addition A+B=
2 2
3 0
A−B matrix subtraction A−B=
0 0
1
a+b vector addition a + b =
2
−1 3
A∗B matrix multiplication A·B=
0 2
a∗b (error!) undefined!
−6 −3
−3∗B scalar multiplication −3 · A =
−3 −3
−1 −2 0
A\B left division A ·B=
3 1
1
−1 − 2 − 32
A/B right division A·B =
0 1
Operation
in MATLAB Effect Example
5 3
Aˆ2 raising to a power (exponentiation) A =
2
3 2
2ˆA (error!) undefined!
aˆ2 (error!) undefined!
TABLE OF ARITHMETIC MATLAB OPERATIONS 369
Operation
in MATLAB Effect Example
371
NEW RELEASE
Appendix C INFORMATION
(R2007b)
M
ATLAB and Simulink are software packages themselves. The
MathWorks company looks to improve their software by correct-
ing bugs and adding features. A natural question for a software
user is, “Do I need to replace the current version that I have?” Often, the
answer is “no,” unless there is a compelling reason, such as a bug fix on a
function used in your simulation. Or perhaps the updated version supports
a new feature that you would use. If you want the security of having the
latest available software version, The MathWorks provides a “Maintenance
Service” for their software, if you pay the maintenance fee.
373
374 INTRODUCTION TO MATLAB & SIMULINK
if (and(a == 3, b == 0))
disp('yes');
else
disp('no');
end
The point here is that the newer version of MATLAB understands the
older MATLAB code, while the older MATLAB version is not able to handle
code made for the newer version. In a situation where multiple version of
MATLAB exist, we can specify the code to work with the oldest version, with
reasonable certainty that it will function correctly with the newer version, too.
While this book was being written, The MathWorks released new versions
of MATLAB (7.5) and Simulink (7.0). This section provides an overview of
the new features. Two new products were announced: a new design verifier
for Simulink, and a code development package for embedded systems called
Link for Analog Devices VisualDSP++® .
The Simulink Design Verifier produces test cases (design verification
blocks) to evaluate models. It reveals when elements cannot be reached,
as well as gives examples where model properties are violated. It generates
a report in HTML, meaning that the user can navigate the report like a
webpage. This software can be accessed by the sldvlib command at the
MATLAB prompt, or by the simulink command followed by clicking on
the “Simulink Design Verifier.”
Processors made by the company Analog Devices, Incorporated, are
supported by MATLAB and Simulink. Analog Devices has a product called
VisualDSP++ that allows people to program their processors in C/C++,
as well as link, debug, and simulate code. These processors are often
used in embedded systems, and now MATLAB and Simulink work with
VisualDSP++.
One new feature produces C language code from the subset that supports
embedded systems, which can be done through the command line interface.
Embedded systems are essentially computers, put in the role of a dedicated
task. For example, a building-monitoring system may use most of the same
hardware as a desktop computer, but have special components and sensors,
including a tiny display and keypad for communications with the user. While
a desktop computer should have good response, an embedded system must
reliably meet deadlines (hard-time constraints) or it is considered a failure.
We call this Real-Time computing. Embedded systems have different chal-
lenges and concerns than regular computers, so programming languages for
them also have special considerations.
376 INTRODUCTION TO MATLAB & SIMULINK
The new software from The MathWorks has updates to fix many known
bugs, affecting 50 MATLAB toolboxes and 30 Simulink toolboxes. A few
other noteworthy changes are listed below.
The new version supports AVI, MPG, MPEG and WMV video formats,
though only on the Microsoft Windows version. The mmreader object
allows the reading of these file formats.
Functions in MATLAB will support larger arrays of numbers (248 − 1
elements, instead of 231 ) on 64-bit computer systems. This should help
with video and sound processing.
MATLAB provides a new exception handling class, called MException.
It adds capability to the error handling feature, such as allowing the
catch block to have additional information about the error.
Custom made toolbars are supported with GUIDE, allowing the user to
create GUI toolbars with the mouse instead of programming statements.
377
378 SOFTWARE INDEX
381
382 INDEX
why, 58 editor
xlabel, 38 cell-toolbar, 124
xlsread, 53 cells, 124
xlswrite, 53 elements, 123
ylabel, 38 elementary functions, 27
zeros, 57, 224, 229 end operator, 62
zoom, 49 evaluate selection, 84
modifying, 9
repeating, 9 field operation, 15, 303
comments, 14 for-loops, 98, 99
comments in commands, 89 fprintf, 107
comparison operators, 22 function, 208
complex number, 6 function handle, 110, 114
complex numbers functions
converting, 96 elementary, 27
componentwise operation, 15
configuration parameters-window, graphical
145 processing, 41
content indexing, 72, 75 graphics
context menu, 83 overlay graphs, 47
control constructs
for-loops, 98, 99 handles, 110
if-construct, 96 history mechanism, 85
switch statement, 102 history-mechanism, 9
while-loop, 100
current directory, 4 I/O operations, 50
if-construct, 96
damped oscillations, 153 import wizard, 52
data cursor, 42 input function, 100
data transfer, 50 input prompt, 4
differential equations, 135 integration procedures
mathematical pendulum, 114 numerical, 170
RC low-pass filter, 119 integrator
system ordinary, 116 initialization, 151, 156
with MATLAB, 113 interpreter, 2
with Simulink, 135, 150
division, 16 Laplace-Transform, 139
docking mechanism, 7, 86 left division \, 16
dynamic systems, 135 logic operation, 21
logical and, 21
384 INDEX