ASSOCIATION OF VDR GENETIC POLYMORPHISM WITH INCREASED RISK OF TYPE-I DIABETES MELLITUS AND CORRELATION OF SERUM CALCIUM LEVEL

A SYNOPSIS SUBMITTED TO INSTITUTE OF MOLECULAR BIOLOGY AND BIOTECHNOLOGY

SUPERVISOR: Dr. Hamid Ma !""r SUBMITTED BY: #ia A$%ra& M.P%i' M"'()*'ar Bi"'"+, a d Bi"-()% "'"+, R"'' . /0

INSTITUTE OF MOLECULAR BIOLOGY AND BIOTECHNOLOGY BAHAUDDIN #AKARIYA UNIVERSITY1 MULTAN

INTRODUCTION
Type I diabetes is usually diagnosed in children and young adults, and was previously known as juvenile diabetes. In type 1 diabetes, the body does not produce insulin. Insulin is a hormone that is needed to convert sugar, starches and other food into energy needed for daily life. Only 5 of people with diabetes have this form of the disease. It is widely recognised that genetic factors are important in common, multifactorial diseases such as cancer, ischaemic heart disease and diabetes mellitus. !owever, it is a common misconception that developing a serious infection is entirely due to environmental and social factors or even simple bad luck. In fact, host genetic factors are probably at least as important in determining the outcome of infection as they are in other comple" diseases. #$. %ellamy, &''(). The type 1 diabetes has a strong genetic component is now indisputable. !uman leukocyte antigen class II genes have been identified as the most important genetic factor in determining the risk of developing type 1 diabetes. The *+T$ #variable number of tandem repeats) polymorphism located in the promoter region of the insulin gene and the cytoto"ic T, cell,associated antigen,- gene also have been identified #1, &). !owever, these genes are neither sufficient nor necessary to cause type 1 diabetes. !ence, the search for other genes and environmental triggers has been ongoing. $ecently, in the .iabetes /utoimmunity 0tudy in the 1oung, 2ronc3ak et al. #4) reported that the presence of islet autoantibodies in offspring was inversely correlated. VITAMIN D RECEPTOR GENE POLYMORPHISMS AND DIABETES *itamin . receptor #*.$) polymorphisms are reported to be associated with insulin secretory capacity in humans #5). In e"perimental studies, oral administration of 1 a,&5, dihydro"yvitamin .(, the activated form of vitamin ., completely protects +O. mice from type 1 diabetes #6, 7). In addition, it has been reported that a vitamin . analog can down, regulate proinflammatory chemokine production by pancreatic islets, thereby inhibiting T, cell recruitment and development of type 1 diabetes #6). These epidemiologic and e"perimental data appear to indicate that vitamin . deficiency may be involved in the pathogenesis of type 1 diabetes, possibly because vitamin . is a potent

modulator of the immune system and is involved in regulating cell proliferation and differentiation #1, &). *itamin . and its analogs e"ert their actions through *.$, which is a member of the steroid hormone receptor superfamily. The *.$ gene, located on chromosome 1&81&981-, has at least five promoter regions #(), eight protein,coding e"ons, and si" untranslated e"ons, which are alternatively spliced #-). 2ok I #in e"on &), %sm I and /pa I #both in intron 6), and Ta8 I #in e"on 7) are the four common single nucleotide polymorphisms #0+:s) #rs1'5(561', rs15---1', rs5755&(&, and rs5(1&(4, respec, tively) in the *.$ gene that have been most often investi, gated #&, 5). The first report of a type 1 diabetes,*.$ association was made by ;c.ermott et al. #4) in 1775. They reported that the <<b== allele of the %sm I polymorphism in the *.$ gene was preferentially transmitted to offspring afflicted with type 1 diabetes. /s with other genetic association studies, however, reports on the type 1 diabetes,*.$ association have been conflicting. / recent study involving over (,''' families with type 1 diabetes found no evidence for an as, sociation of type 1 diabetes with any of the four 0+:s men, tioned above or with any of numerous other polymorphisms across the *.$ gene #5). It has been suggested that the m$+/ coded from the TaqI t allele of the *.$ gene is more stable than the m$+/ from the T allele of the *.$ gene. / non,silent *.$ gene polymorphism is the FokI polymorphism, found in e"on &, which is at a translation initiation start site and is predicted to change the structure of the coded protein./ thymine,to,cytosine #T>?) change found in the 2 allele leads to an alternative trans,lational start site and a *.$ protein that is three amino acids shorter than that of the f variant. /lthough the difference between the two proteins is only three amino acids, it has been suggested that the more commonly observed shorter *.$ protein is functionally more active. 0ince an individual study may not have enough statistical power to detect any association between type 1 diabetes and *.$ polymorphisms, a meta,analysis that combines data from all published studies may provide a more accurate estimate of effect si3es, leading to a reduced probability of false,negative results #7). Thus, I want to conduct a comprehensive and 8uantitative assessment of the association between type 1 diabetes and the four aforementioned polymorphisms.

@enetic variability may influence not only host susceptibility to active .iabetes but also host response to treatment. :olymorphisms of many different gene candidates have been studied and the gene for the vitamin . receptor #*.$) is of great interest.

Ma-(ria'$ a d m(-%"d$

Sam2'i +
DNA E3-ra)-i" a d I$"'a-i"
Ahite blood cells #A%?) are the only nucleated cell present in the blood and an easily source to e"tract genomic .+/ of individuals. @enomic .+/ will be e"tracted from the blood samples following a non,organic method #@rimberg et al., 1767) as underB Ten milliliters of venous blood samples will be collecting in 5' ml 0terilinC falcon tubes containing -'' Dl of '.5 ; E.T/. Till the commencement of .+/ e"traction, blood samples will be kept fro3en either at ,5'F? for &',(' min or at ,&'F? for long term storage. %lood samples will be thawed for the red blood cells #$%?) lyses. (5 ml of TE buffer #1' m; Tris !?l, & m; E.T/, p! 6.') will be added for washing of blood samples. 0amples will be centrifuged at (''' rpm for &' min and supernatant will be discarded to wash out the lysed $%?. Aashing will be repeat for three to four times till the A%? pellet is free of hemoglobin. .igestion of proteins in the pellets of A%? will be carried out by adding '.5 mg of proteinase G along with &'' Dl of 1' 0.0 in the presence of 4 ml T+E buffer #1' m; Tris !?l, & m; E.T/, -'' m; +a?l). 0amples will be left overnight in an incubating shaker at a temperature of (5H? and a speed of &5' rpm. :roteins will be precipitated by adding 1ml of super saturated +a?l, followed by vigorous shaking and chilling on ice for 15 min before centrifugation at &-'' rpm. 0upernatant will be shifted to another 0terilinC falcon tube and .+/ will be e"tracted from the supernatant by adding e8ual volume of Isopropanol. /fter washing the .+/ pellet with 5' ethanol, .+/ will be dissolved in TE buffer #1' m; Tris !?l, '.& m; E.T/) and heated at 5'H? in a water bath for 1 h to inactivate any remaining nucleases. 2urther the .+/ will be kept at ,&'F? for long storage #@rimberg, 1767).

G( "-,2i +
@enotyping of *.$ gene polymorphisms will be done by polymerase chain reaction based restriction fragment length polymorphism #:?$,$2I:). The details of the primers and the information about studied gene variants are given #Table 1). :?$ will be performed with 1'' ng of .+/ using 1 J Ta8 .+/ polymerase #%angalore genei, India), 1'K Ta8 %uffer / with

1'' m; Tris #p! 7.'), 5'' m; G?l, 15 m; ;g?l& and '.1

gelatine, 1' m;

deo"yribonucleoside triphosphates #d+T:s) mi" #%angalore genei, India) and 1&.5 pmol of each primer #;etabion International /@, ;artinsried, @ermany). :?$ conditions will be, initial denaturation at 7- ? for - min, followed by (& cycles at 7- ? for (' s, at 45 ? for (' s and at 5& ? for 1 min #/paI and Ta8I) and for 2okI and %smI, as mentioned by 0elvaraj et al. #&''(). :?$ will be carried out in Eppendorf /@ :?$ 0ystem #Eppendorf, !amburg, @ermany). The amplified &''' bp product will be subjected to /pa1 and Ta81 restriction en3yme #:romega, J0/) digestions. /bout 5 ml of :?$ product will be restriction digested with 5 units of each restriction en3yme #/paI and Ta8I) in a 5.5 ml reaction mi"ture containing en3yme, %ovine 0erum /lbumin #%0/) and buffer, provided by the manufacturer. The reaction mi"ture will be incubated at (5 6? and 45 6? for ( h with /pa1 and Ta81, respectively. The restriction digestion products will be resolved on 1.5 agarose gel, stained with ethidium bromide and observed under J*. :?$,$2I: results will be further confirmed by direct se8uencing #/%I (1'' 0e8uencer, J0/) of sufficient number of major homo3ygotes, hetero3ygotes and minor homo3ygotes for each of the 0+:s. (Prithvi R.
Sharma et al 2011)

Ta4'( 5 .etails of *.$ gene polymorphisms and primers which will be used for genotyping.
Polymorphis m (rs ID)
ApaI (rs7975232) CAACCAAGACTACAAGTACCGCGTCAGTGA

Primer 53

Enzym e
ApaI

Allele name
C T

Commo n name
A a T t ! # $ '

PCR product size ( p)

TaqI (rs731236)

CACTTCGAGCACAAGGGGCGTTAGC

TaqI

C G

!smI (rs15"""10)

CAACCAAGACTACAAGTACCGCGTCAGTGA AACCAGCGGGAAGAGGTCAAGGG

!smI

G T

$%&I (rs222 570)

AGCTGGCCCTGGCACTGACTCTGCTCT ATGGAAACACCTTGCTTCTTCTCCCTC

$%&I

A G

S-a-i$-i)a' A a',$i$

@enotypic and allelic fre8uencies of *.$ gene variants will be calculated in cases and controls. :earson=s chi,s8uare and odd ratio #O$) calculation will be done using 0:00 software. ?hi,s8uare p,value L '.'5 will be considered statistically significant. 1ates correction will be applied to association test p,values. :air,wise linkage dise8uilibrium test will be carried out using !aploview software.

R(&(r( )($:
1. !olick, ;.2. #&''() *itamin .B a millenium perspective. M. ?ell. %iochem. 66, &749('5 &. Iope3, E.$. et al. #&''-) / promoter polymorphism of the ?1:&5%1 gene is associated with /ddison=s disease, !ashimoto=s thyroiditis, @raves= type 1 diabetes mellitus in @ermans. Eur. M. Endocrinol. 151, 17(9175 (. Iope3, E.$. et al. #&''-) ?1:&5%1 polymorphism variants are associated with type 1 diabetes mellitus in @ermans. M. 0teroid %iochem. ;ol. %iol. 6797', 1559 155 -. 0lattery, ;.I. et al. #&''-) .ietary calcium, vitamin ., *.$ genotypes and colorectal cancer. Int. M. ?ancer 111, 55'9554 5. :ani, ;./. et al. 4. ;c.ermott, ;.2. #&''') et al. *itamin . receptor allele combinations influence #1775) /llelic variation in the vitamin . receptor genetic susceptibility to I..; in @ermans. .iabetes -7, 5'-95'5 influences susceptibility to I..; in Indian /sians. .iabetologia -', 7519755 5. 2assbender, A.M. et al. #&''&) *.$ gene polymorphisms are over, represented in @erman patients with type 1 diabetes compared to healthy controls without effect on biochemical parameters of bone metabolism. !orm. ;etab. $es. (-, (('9((5 6. Turpeinen, !. et al. #&''() *itamin . receptor polymorphismsB no association with type 1 diabetes in the 2innish population. Eur. M. Endocrinol. 1-7, 5719574 7. +ejentsev, 0. et al. #&''-) /nalysis of the vitamin . receptor gene se8uence variants in type 1 diabetes. .iabetes 5(, &5'79&51& disease and