DNA Fingerprinting Method Laboratory
DNA Fingerprinting Method Laboratory
Teachers Guide
Kit Inventory Check List Background For Teacher Implementation Timeline Workstation Check List Advance Preparation Quick Guide
Page
Kit Components and Required Accessories ....................3 Setting the Stage for Your Students..................................4 Advance Preparation and Student Lessons ......................8 Student and Instructor Lab Setups ....................................9 Lab Prep and Lesson Highlights ....................................11 Graphic Laboratory Protocol ..........................................16
Student Manual
Lesson 1 Lesson 2 Lesson 3 Lesson 4 Introduction to DNA Fingerprinting ..............................19 Restriction Digests of DNA Samples ............................21 Electrophoresis and Staining of DNA Samples..............28 Analyzing the DNA Patterns and Drying Gels ..............33
Appendices
Appendix A Appendix B Alternative DNA Fingerprinting Scenarios....................41 Prelab Activities ..............................................................44 Review of Restriction Enzymes ..............................44 Review of Electrophoresis ......................................49 Teachers Answer Guide ................................................51 Plasmid DNA and Restriction Enzymes ........................65
Appendix C Appendix D
u u u
Restriction Enzymes
Restriction enzymes sit on a DNA molecule and slide along the helix until they recognize specific sequences of base pairs that signals the enzyme to stop sliding. The enzymes then digest (chemically separate) the DNA molecule at that sitecalled a "restriction site"acting like molecular scissors, cutting DNA at a specific sequence of base pairs. If a specific restriction site occurs in more than one location on a DNA molecule, a restriction enzyme will make a cut at each of those sites, resulting in multiple fragments. Therefore, if a given linear piece of DNA is cut with a restriction enzyme whose specific recognition code is found at two different locations on the DNA molecule, the result will be three fragments of different lengths. If the given piece of DNA is circular and is cut with a restriction enzyme whose specific recognition code is found at two different locations on the DNA molecule, the result will be two fragments of different lengths. The length of each fragment will depend upon the location of restriction sites on the DNA molecule. When restriction enzymes are used to cut strands of circular plasmid DNA, such as the samples included in this kit, fragments of varying sizes are produced. DNA that has been cut with restriction enzymes can be separated and observed using a process known as agarose gel electrophoresis. The term electrophoresis means to carry with electricity.
DNA Fingerprinting
Each person has similarities and differences in DNA sequences. To show that a piece of DNA contains a specific nucleotide sequence, a radioactive complementary DNA probe can be made that will recognize and bind that sequence. Radioactive probes allow molecular biologists to locate, identify, and compare the DNA of different individuals. This probe can be described as a "radioactive tag" that will bind to a single stranded DNA fragment and produce a band in a gel or a band on a piece of nylon blotting membrane that is a replica of the gel (also known as a Southern blot). Because of its specificity, the radioactive probe can be used to demonstrate genotypic similarities between individuals. In DNA fingerprinting, the relative positions of radiolabeled bands in a gel are determined by the size of the DNA fragments in each band. The size of the fragments reflect variations in individuals DNA. We are rapidly getting beyond the scope and intention of this manual. For more detailed information, we recommend a review of the references listed on page 7. The evidence needed for DNA fingerprinting can be obtained from any biological material that contains DNA: body tissues, body fluids (blood and semen), hair follicles, etc. The DNA analysis can even be done from dried material, such as blood stains or mummified tissue. If a sample of DNA is too small it may be amplified using PCR techniques. The DNA is then treated with restriction enzymes that cut the DNA into fragments of various length.4
G A AT T C C T TA A G
For the enzyme: PstI
CTGCAG GACGTC
Like all enzymes, restriction enzymes function best under specific buffer and temperature conditions. The proper restriction enzyme buffer has been included with the DNA sample, so that when the rehydrated DNA and enzymes are mixed, the ideal conditions are created for the enzymes to function optimally. The final reaction buffer consists of 50 mM Tris, 100 mM NaCl, 10 mM MgCl2, 1 mM DDT, pH 8.0, which is the ideal condition for EcoRI and PstI enzymes to function.
Its easy to see that the DNA taken from the crime scene and the DNA from S3 is identical. You may want to point out how "strong or weak" this evidence is in convicting a suspect. The DNA evidence may place the suspect at the scene, but other evidence may be needed to prove him or her guilty!5,6 You may point out to your students that this is a simulation. In actual DNA fingerprinting, technicians analyze much larger segments of DNA and many more bands and lanes are produced. These technicians are looking for a specific DNA segment, common to a given population, that will produce a unique banding pattern for each individual.
References
1. 2. 3. DNA Profiling Fast Becoming Accepted Tool For Identification, Pamela Zurer, Chemical and Engineering News, Oct. 10, 1994. PCR means polymerase chain reaction; it is a technique used to amplify small amounts of DNA (in this case so that further analysis of the DNA can occur). RFLP means restriction fragment length polymorphisms..."riff-lips" in biotech jargon...Pieces of DNA are cut with restriction enzymes into fragments of various lengths. Individuals possess variable restriction recognition sites so that two pieces of DNA from separate sources may have different fragment lengths when their DNA is cut by the same enzyme. An excellent resource for the classroom teacher is Genetic Fingerprinting, Pauline Lowrie and Susan Wells, New Scientist, 16 November 1991. Is DNA Fingerprinting ready for the courts?, William C. Thompson and Simon Ford, New Scientist, March 31, 1990. When Science Takes the Witness Stand, Peter Neufeld and Nevelle Coleman, Scientific American, Vol. 262: 5, May 1990.
4. 5. 6.
Implementation Timeline
There are five student lessons in this fingerprinting curriculum. All lessons are designed to be carried out in consecutive 50 minute periods. All lessons include: A series of prelab considerations for students An active student investigation Questions for analysis and interpretation of lab results
Student Schedule
Lesson 1: Activity Lesson 2: Activity Lesson 3: Activity Lesson 4: Activity Introduction to DNA Fingerprinting Lecture and discussion Prelab Considerations 1 and 2 Restriction Digest of DNA Samples Pour gels; perform the restriction digests Complete preliminary analysis and review questions Electrophoresis of DNA Samples Load and run gels; stain gels overnight Do analysis and review questions Analysis and Interpretation of Results Destain gels Do analysis questions Generate standard curve Discuss results and weigh evidence
Prior to Lesson 2
20 minutes
10 minutes 10 minutes/day
1 vial 1 vial 1 vial 1 vial 1 vial 1 vial 1/class 3540 ml/gel 1/station 1/station
u u u u u u u u u u
Protective eye goggles should be worn in the laboratory at all times. Proper safety precautions, such as no eating or drinking, should always be practiced.
u u u
10
Time required:
Whats required: Electrophoresis gel boxes, casting trays and combs Electrophoresis buffer (50x TAE) Agarose powder 16 clear microtubes Procedures 1. Rehydrate samples: Note: All of the DNA and enzyme vials should contain a white residue, which may appear as a loose powder in the DNA vials. The lyophilized DNA samples have color-coded labels on clear glass vials. The lyophilized EcoRI/PstI enzyme mix is in an amber vial. A. To rehydrate DNA/buffer samples, add 200 l of sterile water to each lyophilized DNA vial and swirl to resuspend. Allow DNA/buffer samples to rehydrate at room temperature for 5 minutes or until dissolved. Gentle heating at 37 C for 10 minutes may be necessary. You may choose to transfer the rehydrated DNA/buffer samples to colorcoded, labeled 1.5 ml microtubes to make pipetting easier for your students. The rehydrated DNA samples are now at a concentration of 0.3 g/l in 100 mM Tris, 200 mM NaCl, 20 mM MgCl2, 2 mM DTT, pH 8.0. Once the DNA in buffer is added to the enzyme, the final concentration of buffer will be 50 mM Tris, 100 mM NaCl, 10 mM MgCl2, 1 mM DTT, pH 8.0, which is the ideal condition for EcoRI and PstI enzymes to function. B. To rehydrate EcoRI/PstI enzyme mix, add 750 l sterile water and swirl to resuspend the enzymes. Allow enzymes to rehydrate on ice for 5 minutes. It is critical that the enzyme mix is kept on ice, but not frozen, once it has been rehydrated. The rehydrated enzymes should be used within 12 hours. 2. Aliquot enzyme mix: Transfer 80 l of the rehydrated enzyme mix into each of eight, 1.5 ml microtubes labeled ENZ.
11
3. Prepare electrophoresis buffer. TAE (Tris, acetate, EDTA) electrophoresis buffer is available as a 50x concentrated solution. In addition to the 1x TAE buffer needed to make the agarose gels, approximately 275 ml is also required for each electrophoresis chamber. Three liters of 1x TAE buffer will be sufficient to run 8 electrophoresis chambers and pour 8 agarose gels. To make 3 liters of 1x TAE from a 50x TAE concentrate add 60 ml of 50x concentrate to 2.94 liters of distilled water. 4. Prepare agarose. These procedures may be carried out 1 to 2 days ahead of time by the teacher or done during class by the individual student teams. A. The recommended gel concentration for this classroom application is 1% agarose. This concentration of agarose provides excellent resolution and minimizes run time required for electrophoretic separation of DNA fragments. To make a 1% solution, add 1 gram of agarose to 100 ml of 1x TAE electrophoresis buffer. The agarose must be made using electrophoresis buffer, not water. If gel boxes are limiting, you can use a 7 x 10 cm tray and two 8-well combs to pour a gel that can be used to run two sets of student digests. Use this table as a guide for gel volume requirements when casting single or multiple gels. Volume of 1% agarose for: Number of gels 1 2 4 8 7 x 7 cm tray 40 ml 80 160 320 7 x 10 cm tray 50 ml 100 200 400
B. Add the agarose powder to a suitable container (e.g. 500-ml Erlenmeyer flask for 200 ml or less). Add the appropriate amount of 1x TAE electrophoresis buffer and swirl to suspend the agarose powder in the buffer. If using an Erlenmeyer flask, invert a 25-ml Erlenmeyer flask into the open end of the 500 ml Erlenmeyer flask containing the agarose. The small flask acts as a reflux chamber, thus allowing long or vigorous boiling without much evaporation. The agarose can be melted for gel casting by boiling until agarose has melted completely on a magnetic hot plate, hot water bath, or in a microwave oven. Caution: Always wear protective gloves, goggles, and lab coat while preparing and casting agarose gels. Boiling molten agarose or the vessels containing hot agarose can cause severe burns if allowed to contact skin. Microwave Oven Method. This technique is the fastest and safest way to dissolve agarose. Place the gel solution in an appropriate bottle or flask into the microwave. LOOSEN THE CAP IF YOU ARE USING A BOTTLE. Use a medium setting and set to 3 minutes. Stop the microwave oven every 30 seconds and swirl the flask to suspend any undissolved agarose. Boil and swirl the solution until all of the small translucent agarose particles are dissolved. Set aside to cool to 55-60 C before pouring. Magnetic Hot Plate Method. Add a stir bar to the undissolved agarose solution. Heat the solution to boiling while stirring on a magnetic hot plate. Bubbles or foam should disrupt before rising to the neck of the flask. Boil the solution until all of the small translucent agarose particles are dissolved. Set aside to cool to 55-60 C before pouring gels.
12
If you choose, you can melt the agarose several hours in advance and keep it in a waterbath at 55-60 C until you or your students are ready to pour the gels. 5. Pour agarose gels. This lab activity requires that each gel has at least 8 sample loading wells. Follow the above instructions to prepare the agarose and determine what volume of 1% agarose will be needed. Pour enough agarose to cover the gel comb teeth or to a depth of 0.50.75 cm. Do not move or handle the gel tray until the gel has solidified. When solidified, gels can be stored in sealable bags at room temperature or in the refrigerator until use on the next day. Have students label their plastic bags. The time needed to pour gels by an entire class is approximately 30 minutes. If possible, pour one or two extra gels for back-up. 6. Restriction Digests. A 45 minute incubation at 37 C is the optimum digestion condition. If a 37 C heating block, water bath, or incubator is not available, samples can be digested by placing tubes in foam racks, floating them in a large volume (1 liter or more) of 37 C water, and allowing them to incubate overnight as the water cools to room temperature. Procedure for casting gels Using Bio-Rads Mini Sub-Cell GT system, gels can be cast directly in the gel box by using the casting gates with the gel tray. This section outlines the conventional tape-the-tray method for casting gels. Other methods are detailed in Bio-Rad's Sub-Cell GT instruction manual. Step 1. Seal the ends of the gel tray securely with strips of standard laboratory tape. Press the tape firmly to the edges of the gel tray to form a fluid-tight seal. Level the gel tray on a leveling table or workbench using the leveling bubble provided with the instrument. Prepare the desired concentration and amount of agarose in 1x TAE electrophoresis buffer. Cool the agarose to at least 60 C before pouring. While the agarose is cooling to 60 C, place the comb into the appropriate slot of the gel tray. Gel combs should be placed within 3/4 of an inch of the end of the gel casting tray (not in the middle of the gel). Allow the gel to solidify at room temperature for 10 to 20 minutesit will appear cloudy, or opaque, when ready to use. Carefully remove the comb from the solidified gel. Remove the tape from the edges of the gel tray. Place the tray onto the leveled DNA electrophoresis cell so that the sample wells are at the cathode (black) end of the base. DNA samples will migrate towards the anode (red) end of the base during electrophoresis.
Step 2.
Step 3.
Step 4. Step 5.
Step 6.
To pour a double gel using the 7 x 10 cm tray and two 8-well combs, place one comb at one end of the tray and the other comb in the middle of the tray.
13
1. Aliquot loading dye. A. Label 8 clear microtubes "LD" for Loading Dye. Aliquot 35 l of loading dye into 8 clear microtubes that are labeled "LD". Distribute to student workstations. B. Add 20 l of loading dye to the stock tube containing the HindIII DNA Size Markers. If possible, heat the markers to 65 C for 5 minutes, then chill on icethis results in better separation of the marker bands. Label clear microtubes "M". Aliquot 15 l of the DNA markers containing loading dye to the 8 clear microtubes labeled M. Distribute to student workstations. 2. Prepare Bio-Safe DNA staining solution. Dilute the 1 ml volume of 500x DNA stain in 499 ml of distilled water in an appropriate sized flask. Cover the flask and store at room temperature until ready to use. 3. Electrophoresis of samples. Suggested running time is 30 minutes. If your laboratory schedule allows, increasing running time to 40 minutes will enhance the resolution.
DNA Staining ProcedureBio-Safe DNA Staining Solution The volume of 1x Bio-Safe solution needed to stain one 7 x 7 or 7 x 10 cm gel is approximately 60 ml. Gels should be removed from the gel tray before staining. This is easily accomplished by holding the base of the gel in one hand, and gently pushing out the gel with the thumb of the other hand. Special attention must be given to supporting the well portion of the gel since it can crack along the well line. Pour enough stain into the tray to cover the gel(s) completely. For best results, shake gels while staining overnight. If you have a rocking platform, multiple gels can be stained in one large container if they are marked to distinguish different student groups gels, by cutting off different corners, for example. If the provided staining trays are used, each gel should be stained in an individual staining tray. Stain the gels overnight in 1x Bio-Safe stain. The next day, rinse the stained gel with water and destain at least 10 minutes. To produce maximum contrast, the gels can be destained overnight with water. This stain is nontoxic; however, you should use latex or vinyl gloves while handling gels to keep your hands from being stained.
14
Method 1
Method 2
Note: Avoid extended exposure of dried gels to direct light to prevent band fading. Graphing the Data Many of your students may not be familiar with logarithms and semi-log graph paper. It is suggested that you prepare a short lesson presented on the overhead or computer to demonstrate the proper way to label coordinates and plot points. You may choose to include a lesson on the different uses of semi-log vs. standard graph paper in this instance. A math extension implemented here may provide a perfect opportunity to explore linear and exponential (arithmetic and geometric) sequences of numbers. We have included both semi-log and standard graph paper on pages 38 and 39 of this manual.
15
2.
Ice
CS
S1
S2
S3
S4
S5
3.
Pipet 10 l of each DNA sample from the stock tubes and transfer to the corresponding colored microtubes. Use a separate tip for each DNA sample. Make sure the sample is transferred to the bottom of the tubes. Pipet 10 l of enzyme mix (ENZ) into the very bottom of each tube. Use a separate tip for each ENZ sample.
4.
Stock
5. Cap the tubes and mix the components by gently flicking the tubes with your finger. If a microcentrifuge is available, pulse spin in the centrifuge to collect all the liquid in the bottom of the tube. Otherwise, tap the tube on a table top.
CS
S1
S2
S3
S4
S5
Flick
Tap
6.
Place the tubes in the floating rack and incubate 45 min at 37 C or overnight at room temperature in a large volume of water heated to 37 C.
Water bath
7.
After the incubation period, remove the tubes from the water bath and place in the refrigerator until the next laboratory period.
16
Day 2 Gel Electrophoresis 1. Remove your digested DNA samples from the refrigerator. If a centrifuge is available, pulse spin the tubes in the centrifuge to bring all of the liquid into the bottom of the tube. Using a separate tip for each sample, add 5 l of loading dye "LD" into each tube. Cap the tubes and mix by gently flicking the tube with your finger. Place an agarose gel in the electrophoresis apparatus. Fill the electrophoresis chamber with 1x TAE buffer to cover the gel, using approximately 275 ml of buffer. Check that the wells of the agarose gels are near the black (-) electrode and the base of the gel is near the red (+) electrode. Using a separate tip for each sample, load the indicated volume of each sample into 7 wells of the gel in the following order: Lane 1: M, DNA size marker, 10 l Lane 2: CS, green, 20 l Lane 3: S1, blue, 20 l Lane 4: S2, orange, 20 l Lane 5: S3, violet, 20 l Lane 6: S4, red, 20 l Lane 7: S5, yellow, 20 l Place the lid on the electrophoresis chamber. The lid will attach to the base in only one orientation. The red and black jacks on the lid will match with the red and black jacks on the base. Plug the electrodes into the power supply. Turn on the power and electrophorese your samples at 100 V for 30 minutes. When the electrophoresis is complete, turn off the power and remove the top of the gel box. Carefully remove the gel and tray from the gel box. Be carefulthe gel is very slippery! Slide the gel into the staining tray. Add 60 ml of DNA stain to the tray. Cover the tray with plastic wrap. Let the gel stain overnight, with shaking for best results.
2. DNA Loading Dye
Centrifuge
2.
3.
4.
5.
(+) ()
6.
7. 8.
9.
1.
2. 3.
Pour off the DNA stain into a bottle. Add 60 ml of water to the gel and let the gel destain 15 minutes. Pour off the water into a waste beaker. Analyze the results with the help of your teacher. Let the gel dry on gel support film or on your lab bench until completely dry. When the gel is dry, tape into your lab notebook for a permanent record.
3.
17
DNA Fingerprinting
Student Manual
Contents Lesson 1 Lesson 2 Lesson 3 Lesson 4
Page
Introduction to DNA Fingerprinting ..............................................................19 Restriction Digests of DNA Samples ............................................................21 Electrophoresis and Staining of DNA Samples..............................................28 Drying Gels and Analyzing the DNA Patterns ..............................................33
18
The schematics above represent a very small section of DNA from three different individuals. In this representation of DNA the symbol system is as follows: Side Chains S = Five carbon SUGAR molecule known as deoxyribose P = PHOSPHATE molecule composed of a phosphorous and oxygen atoms DNA Nucleotide Bases: A = adenine C = cytosine G = guanine T = thymine
Analysis of the three DNA samples above (see next page) might help us detect similarities and differences in samples of DNA from different people.
19
1. Compare the backbone of the sugar-phosphate arrangement in the side chains of all three figures. Are there any differences?
2. In the above figure, do all three samples contain the same bases? Describe your observations.
3. Are the bases paired in an identical manner in all three samples? Describe the pattern of the base pair bonding.
4. In your attempt to analyze DNA samples from three different individuals, what conclusions can you make about the similarities and differences of the DNA samples?
5. What will you need to compare between these DNA samples to determine if they are identical or non-identical?
20
AT G A AT T C T C A AT TA C C T TA C T TA A G A G T TA AT G G A
The line through the base pairs represents the sites where bonds will break if a restriction endonuclease recognizes the site GAATTC. The following analysis questions refer to how a piece of DNA would be affected if a restriction endonuclease were to "cut" the DNA molecule in the manner shown above. 1. How many pieces of DNA would result from this cut? ___________
2. Write the base sequence of both the left and right side DNA fragments. Left: Right:
21
4. DNA fragment size can be expressed as the number of base pairs in the fragment. Indicate the size of the fragments [mention any discrepancy you may detect]. a) b) The smaller fragment is ___________ base pairs (bp). What is the length of the longer fragment? ______________
5. Consider the two samples of DNA shown below - single strands are shown for simplicity: Sample #1 CAGTGATCTCGAATTCGCTAGTAACGTT
Sample #2 TCATGAATTCCTGGAATCAGCAAATGCA
If both samples are treated with a restriction enzyme [recognition sequence GAATTC] then indicate the number of fragments and the size of each fragment from each sample of DNA. Sample # 1 Sample # 2
# of fragments:________
# of fragments:_________
Sample # 1
Sample # 2
22
Now that you have a fairly clear understanding of these three items you are ready to proceed to the first phase of the DNA fingerprinting procedureperforming a restriction digest of your DNA samples.
u u u u u u u
23
Lesson 2 Laboratory
Digest the DNA Samples 1. Label reaction tubes. A. Obtain one each of the the following colored microtubes. Label the 5 colored microtubes as follows: CS (crime scene) S1 (suspect 1) S2 (suspect 2) S3 (suspect 3) S4 (suspect 4) S5 (suspect 5)
Put your name and period number on the tubes! The restriction digests will take place in these tubes. These tubes may now be kept in your rack.
CS
S1
S2
S3
S4
S5
2. Locate the clear microtube that contains the restriction enzyme mix, labeled ENZ. ENZ = Enzyme mix
ENZ
3. Obtain your DNA samples. Using a fresh tip for each sample, transfer 10 l of each DNA sample from the colored stock tubes into each of the corresponding labeled colored tubes.
DNA
Stock DNA
CS
S1
S2
S3
S4
S5
24
4) Combine and react. Using the micropipet, and a new pipet tip for each sample, transfer 10 l of the enzyme mix ENZ to each reaction tube as shown below. Note: Change tips whenever you switch reagents, or, if the tip touches any of the liquid in one of the tubes accidentally. When in doubt, change the tip! DNA goes in the tube before the enzyme. Always add the enzyme last.
ENZ
CS
S1
S2
S3
S4
S5
25
DNA Samples (10 l each) Crime Scene [CS] Suspect 1 [S1] Suspect 2 [S2] Suspect 3 [S3] Suspect 4 [S4] Suspect 5 [S5]
5. Mix the contents. Close the caps on all the tubes. Mix the components by gently flicking the tubes with your finger. If there is a centrifuge available, pulse the tubes for two seconds to force the liquid into the bottom of the tube to mix and combine reactants. (Be sure the tubes are in a BALANCED arrangement in the rotor). If your lab is not equipped with a centrifuge, briskly shake the tube (once is sufficient) like a thermometer. Tapping the tubes on the lab bench will also help to combine and mix the contents.
CS
S1
S2
S3
S4
S5
Flick
Tap
6. Incubate the samples. Place the tubes in the floating rack and incubate them at 37 C for 45 minutes. Alternatively, the tubes can be incubated in a large volume of water heated to 37 C and allowed to slowly reach room temperature overnight. After the incubation, store the DNA digests in the refrigerator until the next lab period.
Water bath
26
2. Can you see any evidence to indicate that your samples of DNA were fragmented or altered in any way by the addition of EcoRI/PstI? Explain.
3. In the absence of any visible evidence of change, is it still possible that the DNA samples were fragmented? Explain your reasoning.
4. (Answer the next day) After a 24 hour incubation period, are there any visible clues that the restriction enzymes may have in some way changed the DNA in any of the tubes? Explain your reasoning.
27
Therefore, you must somehow get evidence to answer the following question: Do the EcoRI and PstI restriction sites occur at the same locations in any of the DNA samples? The following facts will be helpful to you in your attempt to determine the actual range of DNA fragment sizes in your samples. Restriction Digestion Analysis The 3-dimensional structure of restriction enzymes allows them to attach themselves to a double-stranded DNA molecule and slide along the helix until they recognize a specific sequence of base pairs which signals the enzyme to stop sliding. The enzymes then digest (chemically separate) the DNA molecule at that sitecalled a "restriction site"acting like molecular scissors, they cut DNA at a specific sequence of base pairs. If a specific restriction site occurs in more than one location on a DNA molecule, a restriction enzyme will make a cut at each of those sites resulting in multiple fragments. The length of each fragment will depend upon the location of restriction sites contained within the DNA molecule. When restriction enzymes are used to cut a long strand of DNA, fragments of varying sizes may be produced. The fragments can be separated and visualized using a process known as agarose gel electrophoresis. The term electrophoresis means to carry with electricity. Agarose Gel Electrophoresis Electrophoresis separates DNA fragments according to their relative size. DNA fragments are loaded into an agarose gel slab, which is placed into a chamber filled with a conductive liquid buffer solution. A direct current is passed between wire electrodes at each end of the chamber. DNA fragments are negatively charged, and when placed in an electric field will be drawn toward the positive pole. The matrix of the agarose gel acts as a molecular sieve through which smaller DNA fragments can move more easily than larger ones. Over a period of time smaller fragments will travel farther than larger ones. Fragments of the same size stay together and migrate in single "bands" of DNA. An analogy: Equate this situation to your classroom in which all the desks and chairs have been randomly scattered around the room. An individual student can wind his/her way through the maze quickly and with little difficulty, whereas a string of four students holding hands would require more time and have difficulty working their way through the maze of chairs. Try it!
28
Laboratory Check ( ) List Student workstations Agarose gel Digested DNA samples DNA sample loading dye "LD" Marking pen Pipet tips P-10 or P-20 micropipet Lab marker Waste container Styrofoam microtube rack Gel box and power supply Gel staining tray HindIII DNA size markers "M" Instructors workstation 1x TAE electrophoresis buffer Bio-Safe DNA stain1x solution Number/Station 1 5 1 1 1 box 1 1 1 1 1 1 1 ( ) u u u u u u u u u u u u
u u
29
Lesson 3 Laboratory
Electrophoresis of DNA Samples 1. Obtain a prepoured agarose gel from your teacher, or if your teacher instructs you to do so, prepare your own gel. 2. After preparing the gel, remove your digested samples from the refrigerator. Using a new tip for each sample add 5 l of sample loading dye "LD" to each tube: DNA Samples Crime Scene [CS] Suspect 1 [S1] Suspect 2 [S2] Suspect 3 [S3] Suspect 4 [S4] Suspect 5 [S5]
Loading Dye
Loading dye 5 l 5 l 5 l 5 l 5 l 5 l
CS LD
S1
S2
S3
S4
S5
Flick
Tap
Close the caps on all the tubes. Mix the components by gently flicking the tubes with your finger. If a centrifuge is available, pulse spin the tubes to bring the contents to the bottom of the tube. Otherwise, tap the tubes upon a table top. 3. Place the casting tray with the solidified gel in it, into the platform in the gel box. The wells should be at the (-) cathode end of the box, where the black lead is connected. Very carefully, remove the comb from the gel by pulling it straight up. 4. Pour ~ 275 ml of electrophoresis buffer into the electrophoresis chamber. Pour buffer in the gel box until it just covers the wells.
5. Locate your lambda HindIII DNA size marker in the tube labeled "M". Gels are read from left to right. The first sample is loaded in the well at the left hand corner of the gel.
30
6. Using a separate pipet tip for each sample, load your gel as follows: Lane 1: Lane 2: Lane 3: Lane 4: Lane 5: Lane 6: Lane 7: HindIII DNA size marker, clear, 10 l CS, green, 20 l S1, blue, 20 l S2, orange, 20 l S3, violet, 20 l S4, red, 20 l S5, yellow, 20 l
7. Secure the lid on the gel box. The lid will attach to the base in only one orientation: red to red and black to black. Connect electrical leads to the power supply. 8. Turn on the power supply. Set it for 100 V and electrophorese the samples for 3040 minutes.
While you are waiting for the gel to run, you may begin the review questions on the following page. 9. When the electrophoresis is complete, turn off the power and remove the lid from the gel box. Carefully remove the gel tray and the gel from the gel box. Be careful, the gel is very slippery! Nudge the gel off the gel tray with your thumb and carefully slide it into your plastic staining tray.
10. Pour 60 ml of Bio-Safe DNA stain into your plastic staining tray, cover with plastic wrap, and let the gel stain overnight, shaking intermittently if no rocking platform is available.
31
3. After DNA samples are loaded into the sample wells, they are forced to move through the gel matrix. What size fragments (large vs. small) would you expect to move toward the opposite end of the gel most quickly? Explain.
4. Which fragments (large vs. small) are expected to travel the shortest distance from the well? Explain.
32
B. Analyze the number and positions of visible DNA bands on your gel. Making DNA Fragments Visible Unaided visual examination of gels indicates only the positions of the loading dyes and not the positions of the DNA fragments. DNA fragments are visualized by staining the gel with a blue dye. The blue dye molecules have a high affinity for the DNA and strongly bind to the DNA fragments, which makes them visible. These visible bands of DNA may then be traced, photographed, sketched, or retained as a permanently dried gel for analysis. The drawing below represents an example of a stained DNA gel after electrophoresis. For fingerprinting analysis, the following information is important to remember: Each lane has a different sample of DNA
Each DNA sample was treated with the same restriction endonucleases.
With reference to the numbered lanes, analyze the bands in the gel drawing below, then answer the questions on the following page.
Lane
1 2
3 4 5 6
33
Lesson 4 Questions
1. What can you assume is contained within each band?
2. If this were a fingerprinting gel, how many samples of DNA can you assume were placed in each separate well?
3. What would be a logical explanation as to why there is more than one band of DNA for each of the samples?
5. Which of the DNA samples have the same number of restriction sites for the restriction endonucleases used? Write the lane numbers.
7. Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites were there in lane three?
8. Which DNA samples appear to have been "cut" into the same number and size of fragments?
9. Based on your analysis of the gel, what is your conclusion about the DNA samples in the photograph? Do any of the samples seem to be from the same source? If so, which ones? Describe the evidence that supports your conclusion.
34
2. Pour the water out of the staining tray. Ask the instructor how to properly dispose of the stain.
3. Trim away any empty lanes of the gel with a knife or razorblade. Let the gel dry on the hydrophilic side of a piece of gel support film or in your staining tray on your lab bench for 35 days. When the gel is dry, tape it into your lab notebook for a permanent record.
35
1. Using the ruler, measure the migration distance of each band. Measure the distance in millimeters from the bottom of the loading well to each center of each DNA band and record your numbers in the table on the next page. The data in the table will be used to construct a standard curve and to estimate the sizes of the crime scene and suspect restriction fragments.
2. To make an accurate estimate of the fragment sizes for either the crime scene or the suspects, a standard curve is created using the distance (x-axis) and fragment size (y-axis) data from the Lambda/HindIII size marker. Using both linear and semi-log graph paper, plot distance versus size for bands 26. On each graph, use a ruler and draw a line joining the points. Extend the line all the way to the right hand edge of the graph. Which graph provides the straightest line that you could use to estimate the crime scene or the suspects fragment sizes? Why do you think one graph is straighter than the other?
3. Decide which graph, linear or semi-log, should be used to estimate the DNA fragment sizes of the crime scene and suspects. Justify your selection.
4. To estimate the size of an unknown crime scene or suspect fragment, find the distance that fragment traveled. Locate that distance on the x-axis of your standard graph. From that position on the x-axis, read up to the standard line, and then follow the graph line to over to the y-axis. You might want to draw a light pencil mark from the x-axis up to the standard curve and over to the y-axis showing what youve done. Where the graph line meets the y-axis, this is the approximate size of your unknown DNA fragment. Do this for all crime scene and suspect fragments.
5. Compare the fragment sizes of the suspects and the crime scene. Is there a suspect that matches the crime scene?
36
Lambda/HindIII size marker Band Distance (mm) Actual size (bp) Distance (mm) Approx. size (bp) Distance (mm) Approx. size (bp) Distance (mm)
Crime Scene
Suspect 1
Suspect 2
Suspect 3
Suspect 4
Suspect 5
Distance (mm)
Distance (mm)
Distance (mm)
23,130
9,416
6,557
4,361
2,322
2,027
37
38
39
2. Which of your DNA samples were fragmented? What would your gel look like if the DNA were not fragmented?
5. A restriction endonuclease "cuts" two DNA molecules at the same location. What can you assume is identical about the molecules at that location?
6. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the same location as the DNA from the crime scene?
7. Based on the above analysis, do any of the suspect samples of DNA seem to be from the same individual as the DNA from the crime scene? Describe the scientific evidence that supports your conclusion.
40
Appendix A
Alternative DNA Fingerprinting Scenarios! DNA typing, DNA profiling, and DNA fingerprinting are all names for the same process, a process which uses DNA to show relatedness or identity of individual humans, plants, or animals. DNA typing has become the subject of much debate and interest because of its uses for forensics analysis in prominent criminal cases such as the O. J. Simpson case. The applications of DNA typing, however, are much broader than forensic science alone and are having a profound impact on our society. DNA typing is used in forensics, anthropology, and conservation biology not only to determine the identity of individuals but also to determine relatedness. This process has been used to free innocent suspects, reunite children with their relatives, identify stolen animals, and prove that whale meat has been substituted for fish in sushi. It is used in times of war to help identify the remains of soldiers killed in combat. It is also being used to find genetic linkages to inherited diseases. In addition, scientists are learning a great deal about our evolutionary history from DNA analysis. Each of the following paragraphs describes a scenario in which DNA has been used to show how individuals are related to each other, or to show that a person is (or is not) the perpetrator of a crime. These scenarios provide a context for using DNA typing for use in teaching molecular biology, conservation biology, and biotechnology. Have your students research a scenario that is interesting to them and present their findings to the class. 1. Food identification (endangered species identification). The purity of ground beef (or impurity) has been proven using DNA typing. Hamburger has been shown to often be a mixture of pork, and other non-beef meats. Using portable testing equipment, authorities have used DNA typing to determine that the fish served in sushi was really meat from whales and dolphins. These are, many times, endangered species that are protected by international law. 2. Accused and convicted felons set free because of DNA typing. A man imprisoned for 10 years was released when DNA testing, unavailable when he was convicted, was used to show that he could not have been the rapist. Statistics show that about one-third of all sexual assault suspects are freed as a result of DNA testing. 3. Identifying of human remains. Scientists have used DNA typing to confirm that the body in the grave was (or was not) the person that was supposed to be there. Bones found in Russia are believed to be those of the Romanovs, Russias last imperial family. Czar Nicholas II and his family were executed by the Bolsheviks in 1918. Experts from around the world have been studying the bones to match skulls, teeth, and other features with photographs. DNA from the bones will be compared to that of known descendants to determine whether the bones do indeed belong to the Czar and his family.
41
4. Determining relatedness of humans. DNA typing has shown that the 5000 year old Ice Man found in a melting glacier is most closely related to modern Europeans. ("Iceman Gets Real." Science, Vol. 264:1669. June 17, 1994.) The DNA typing evidence also removes all the suspicions that the body was a fraudthat it had been placed on the ice says Svante Paabo of the University of Munich. (Science, Vol. 264:1775. June 17, 1994). 5. Studying relatedness among ancient peoples. DNA found at archeological sites in western Montana is being used to help determine how many related groups of people (families) lived at a particular site. (Morell, Virginia. "Pulling Hair from the Ground." Science, Vol. 265:741-745 August 1994.) 6. DNA testing of families. DNA testing of families has been used in Argentina and El Salvador to identify the children of at least 9,000 citizens of these countries who disappeared between 1975 and 1983, abducted by special units of the ruling military and police. Many of the children born to the disappeared adults were kidnapped and adopted by military "parents" who claimed to be their biological parents. After genetic testing of the extended family revealed the true identity of a child, the child was placed in the home of its biological relatives. It was feared that transferring a child from its military "parents" who were kidnappers, but who had reared the child for years, would be agonizing. In practice, the transferred children became integrated into their biological families with minimal trauma. 7. Identifying organisms that cause disease. Eva Harris, a UCSF scientist, is helping scientists in Nicaragua and Ecuador to learn to use DNA technology to detect tuberculosis, and identify the dengue virus and various strains of Leishmania. Other available tests cause waits of many weeks while disease organisms are cultured and sent to foreign labs to be identified. (Marcia Barinaga, "A Personal Technology Transfer Effort in DNA Diagnostics." Science, 266:1317-1318. Nov. 25, 1994.) 8. Identifying birth parents (paternity testing). Girls in Florida were discovered to have been switched at birth when one girl died of a hereditary disease. The disease was not in her family, but was known to be in the family of another girl, born in the same hospital and about the same time she was born. 9. Proving paternity. A woman, raped by her employer on Jan. 7, 1943, her 18th birthday, became pregnant. The child knew who her father was, but as long as he lived, he refused to admit being her father. After the man died, DNA testing proved that she was his daughter and she was granted a half of his estate. ("A Child of Rape Wins Award from Estate of Her Father." New York Times, July 10, 1994.)
42
10. Determining effectiveness of bone marrow transplants. "DNA fingerprinting can help doctors to monitor bone marrow transplants. Leukemia is a cancer of the bone marrow and the diseased marrow must be removed. The bone marrow makes new blood cells, so the leukemia sufferer will die without a transplant of healthy marrow. Doctors can quickly tell whether the transplant has succeeded by DNA typing of the patient and the donor. If the transplant has worked, a fingerprint from the patients blood shows the donors bands. But if the cancerous bone marrow has not been properly destroyed, then the cancerous cells multiply rapidly and the patients own bands predominate." ("Our Ultimate Identity Card in Sickness and in Health," in "Inside Science", New Scientist, Nov. 16, 1991.) 11. Proving relatedness of immigrants. DNA fingerprinting has been used as proof of paternity for immigration purposes. In 1986, Britains Home Office received 12,000 immigration applications from the wives and children of Bangladeshi and Pakistani men residing in the United Kingdom. The burden of proof is on the applicant, but establishing the family identity can be difficult because of sketchy documentary evidence. Blood tests can also be inconclusive, but DNA fingerprinting results are accepted as proof of paternity by the Home Office. (DNA fingerprints, source unknown: Based on A. J. Jeffreys, et al., "Positive Identification of an Immigration Test-Case Using Human DNA Fingerprints." Nature, 317:818-819, 1985.) 12. Confirming relatedness among animals. Scientists who extracted DNA from the hair of chimpanzees throughout Africa now have evidence that there might be a third species of chimpanzee. At the same time they have learned things about chimp behavior and kinship patterns that would have once taken years to theorize. They discovered a group of chimps living in western Africa to be genetically distinct from the chimps living in other parts of Africa, suggesting that the group may be an endangered species. The have discovered that male chimps living in a given area are often as closely related as half-brothers, and many so-called sub-species may all be part of a single species. The male chimps relatedness may explain why, unlike other primates, the males are quite friendly to each other. 13. DNA testing of plant material puts murderer at the scene. Two small seed pods caught in the bed of his pick-up truck put an accused murderer at the murder scene. Genetic testing showed that DNA in the seed pod exactly matched the DNA of a plant found at the scene of the murder. The accused had admitted he had given the victim a ride, but he denied ever having been near the crime scene.
43
Appendix B
Prelab Activity 1 A Review of Restriction Enzymes DNA consists of a series of nitrogen base molecules held together by weak hydrogen bonds. These base pairs are in turn bonded to a sugar and phosphate backbone. The four different nitrogen bases are adenine, thymine, guanine and cytosine. (A, T, G, and C: Remember the base-paring rule is A-T and G-C). Refer to Figure 1 to review the structure of a DNA molecule. Fig. 1. The Structure of DNA
If a segment of DNA is diagrammed without the sugars and phosphates, the base-pair sequence might appear as: Read to the right----> A C T C C G T A G A A T T C....> <....T G A G G C A T C T T A A G <----Read to the left Look at the linear sequence of bases (As, Ts, etc.) on each of the strands: Describe any pattern you might see in the upper sequence of bases.
Compare the bases in the upper portion of the molecule to those in the lower portion. Describe any relationship you can see.
Now look at the upper sequence of bases and compare it to the lower. Do you notice any grouping of bases that when read to the right and read to the left are exactly the same order?
44
You may have discovered that the base sequence seems to be arranged randomly and that the two strands seem to complement each other; As are paired with Ts, etc. You may have also noticed that a portion of the top strand GAATTC (read to the right) has a counterpart in the lower strand CTTAAG (read to the left). Similar sequences are AAGCTT and TTCGAA; and CTGCAG and GACGTC. These sequences, called palindromes, are quite common along the DNA molecule. A major enemy of bacteria are viruses called bacteriophages, such as lambda. These viruses infect bacteria by injecting their own DNA into bacteria in an attempt to take over the operations of the bacterial cell. Bacteria have responded by evolving a natural defense (called restriction enzymes) to cut up and destroy the invading DNA. These enzymes search the viral DNA looking for certain palindromes (GAATTCs, for example) and cut up the DNA into pieces at these sites. The actual place in the palindrome where the DNA is cut is called a restriction site. Look at the DNA sequence below:
Palindrome
G T A G A AT T C A T T C A C G C A C A T C T TA A G T A A G T G C G T
Restriction site
GTAG CATCTTAA
Fragment 1
ATTCATTCACGCA GTAAGTGCGT
Fragment 2
A restriction enzyme cut the DNA between the G and the A in a GAATTC palindrome. How many base pairs are there to the left of the "cut"?
How many base pairs are there to the right of the "cut"?
Counting the number of base pairs, is the right fragment the same size as the left fragment?
How could you describe fragment size in reference to the number of base pairs in the fragment?
45
An important fact to learn about restriction enzymes is that each one only recognizes a specific palindrome and cuts the DNA only at that specific sequence of bases. A palindrome can be repeated a number of times on a strand of DNA, and the specific restriction enzymes will cut all those palindromes at their restriction sites. The table below shows three kinds of palindromes that may be present in a strand of DNA along with the specific enzyme that recognizes the sequence. Name of enzyme that recognizes the palindrome EcoRI HindIII
If the GAATTC palindrome is repeated four times on the same piece of DNA, and the restriction enzyme that recognizes that base sequence is present. How many DNA fragments will be produced?
If the GAATTC palindrome repeats are randomly spaced along the DNA strand, then what can you say about the size of the fragments that will be produced?
46
The base sequence in one strand of DNA can have a palindrome in the other strand. (GAATTC and CTTAAG). Palindromes can be detected by restriction enzymes. Restriction enzymes cut the palindromes at restriction sites. A restriction enzyme only recognizes one specific kind of palindrome. Cutting DNA at restriction sites will produce DNA fragments. Fragment sizes can be described by the number of base pairs they contain.
If a linear DNA molecule had the restriction sites A and B for a specific palindrome, how many fragments would be produced?
47
Draw a DNA molecule that has 5 randomly spaced restriction sites for a specific palindrome. How many fragments would be produced if they were each cut by a restriction enzyme?
In this diagram, A and B are different palindrome sequences on a DNA strand. Only the restriction enzyme that recognizes site B is present. Explain why only two fragments would be produced.
48
Where would the larger fragmentsthose with the greater number of base pairsbe located; toward the top of the gel or the bottom? Why?
49
Suppose you had 500 pieces of each of the four fragments, how would the gel appear?
If it were possible to weigh each of the fragments, which one would be the heaviest? Why?
Complete this rule for the movement of DNA fragments through an agarose gel: The larger the DNA fragment, the ...
This diagram represents a piece of DNA cut with HindIII at each of the restriction sites pointed to by the arrows. The numbers represent the number of base pairs in each fragment.
2,027
23,130
6,557
9,416
4,361
2,322
Well
Negative
On the gel diagram at the right, show how you believe these fragments will sort out during electrophoresis. Label each fragment with its correct number of base pairs.
Positive
Agarose gel
50
51
ATG TACTTAA
AATTCTCAATTACCT GAGTTAATGGA
3. What differences are there in the two pieces? Each fragment is a different size. 4. DNA fragment size can be expressed as the number of base pairs in the fragment. Indicate the size of the fragments [mention any discrepancy you may detect]. One fragment is short and one is long; also some bases are unpaired. a) The smaller fragment is 3 base pairs (bp). 11
Consider the two samples of DNA shown below [single strands are shown for simplicity]: Sample #1: CAGTGATCTCGAATTCGCTAGTAACGTT
Sample #2:
TCATGAATTCCTGGAATCAGCAAATGCA
If both samples are treated with a restriction enzyme [recognition sequence GAATTC] then indicate the number of fragments and the size of each fragment from each sample of DNA. Sample # 1 Sample # 2
# of fragments:
# of fragments:
52
2. Is there any observable difference between the samples of DNA? No. All samples appear similar.
3. Describe the appearance of the restriction endonuclease mix. The restriction enzymes appear to be clear, colorless liquids.
53
2. Can you see any evidence to indicate that your samples of DNA were fragmented or altered in any way by the addition of EcoRI/PstI? Explain. No. No visible change apparent in the tubes.
3. In the absence of visible evidence of change, is it still possible that the DNA samples were fragmented? Explain your reasoning. Yes. They may be chemically changed but the changes may not be visible. Enzymes may have cut the DNA. 4. After a 24 hour incubation period, are there any visible clues that the restriction enzymes may have in some way changed the DNA in any of the tubes? Explain your reasoning.
No. No visible change apparent in the tubes but the enzymes may have cut the DNA. The reactions are at the molecular level and too small to be seen.
54
3. After DNA samples are loaded in wells, they are "forced" to move through the gel matrix. Which size fragment (large vs small) would you expect to move toward the opposite end of the gel most quickly? Explain. Smaller. There is less resistance to their movement through the gel matrix.
4. Which fragments are expected to travel the shortest distance [remain closest to the well]? Explain. Larger. There is more resistance to their movement through the gel matrix.
55
56
Lambda/HindIII size marker Band Distance (mm) Actual size (bp) Distance (mm) Approx. size (bp) Distance (mm) Approx. size (bp) Distance (mm) Approx. size (bp)
Crime Scene
Suspect 1
Suspect 2
Suspect 3
Suspect 4
Suspect 5***
Distance (mm)
Distance (mm)
Distance (mm)
11.0
23,130
19.0
3,679
21.0
2,860**
21.0
2,860**
19.0
3,679
21.0
2,860**
21.0
2,860**
13.0
9,416
20.5
2,860**
23.5
1,199
25.0
1,700
20.5
2,860**
29.5
1,093
24.0
1,986
15.0
6,557
32.0
828
30.5
941
28.5
1,159
32.0
828
29.5
1,093
23.0
2,322
24.0
2,027
*This fragment may appear faint if the markers were not heated to 65 C. Lamba HindIII digestion also generates bands of 564 and 125 bp that are usually too faint to see on a gel.
**The measured migration distance for these bands varies depending upon the thickness of the bands. See Appendix D to understand why the bands are so intense in S4 and S5. ***S4 and S5 DNA lanes may also contain a very faint band of 500 bp.
57
18.0
4,361*
To estimate the size of any unknown crime scene or suspect fragment, you first need to determine the distances the specific fragment travelled. Locate the distance on the X-axis of your standard graph. For example, Suspect 5, Band 2 migrated 24 mm (A). From the 24 mm mark on the X-axis, read up to the standard line; when you intersect your standard curve, mark the spot with a shaded circle (B). Follow the intersect point over to the Y-axis and determine where the graph line meets the Y-axis this is the approximate size of the fragment (C). Suspect 5, Band 2 is approximately 2000 bp. Repeat this procedure for the Crime Scene and all Suspects fragments. As you determine the approximate the approximate fragment sizes, fill the data into the data table.
58
59
2. Which of your DNA samples were fragmented? What would your gel look like if the DNA were not fragmented? The number of fragmented samples will vary. They will have one band on the gel if the DNA was not cut.
3. What caused the DNA to become fragmented? The addition of restriction enzymes.
4. What determines where a restriction endonuclease will "cut" a DNA molecule? A special sequence of bases on the DNA called restriction sites.
5. A restriction endonuclease "cuts" two DNA molecules at the same location. What can you assume is identical about the molecules at that location? The restriction sites are identical.
6. Do any of your suspect samples appear to have EcoRI or PstI recognition sites at the same location as the DNA from the crime scene? The samples in lanes 2 and 5 match (CS and S3).
7. Based on the above analysis, do any of the suspect samples of DNA seem to be from the same individual as the DNA from the crime scene? Describe the scientific evidence that supports your conclusion. The CS and S3 samples appear to be identical. They both produce similar banding patterns on the gel.
60
Compare the bases in the upper portion of the molecule to those in the lower portion. Describe any relationship you can see: A always pairs with T; G always pairs with C.
Now look at the upper sequence of bases and compare it to the lower. Do you notice any grouping of bases that when read to the right and read to the left are exactly the same order? GAATTC. A restriction enzyme cut the DNA between the G and the A in a GAATTC palindrome.
How many base pairs are there to the left of the "cut"? 4
How many base pairs are there to the right of the "cut"? 10
Counting the number of base pairs, is the right fragment the same size as the left fragment? No, it is larger.
How could you describe the fragment size in reference to the number of base pairs in the fragment. Fragment 1 is a 4 base pair fragment. Fragment 2 is a 10 base pair fragment. If the GAATTC palindrome is repeated four times on the same piece of DNA, and the restriction enzyme that recognizes that base sequence is present.
If the GAATTC palindrome repeats are randomly spaced along the DNA strand, then what can you say about the size of the fragments that will be produced? Random sized fragments will be produced.
61
If a DNA molecule had the restriction sites A and B for a specific palindrome, how many fragments would be produced? 3
Draw a DNA molecule that has 5 randomly spaced restriction sites for a specific palindrome, how many fragments would be produced if they were each cut by a restriction enzyme? Answers will vary.
Rank them in order of size from largest to smallest. Answers will vary.
In this diagram. A and B are different palindrome sequences on a DNA strand. Only the restriction enzyme that recognizes site B is present. Explain why only two fragments would be produced. The enzyme would cut at site B, producing 2 DNA fragments.
62
Have your teacher check your diagram before you proceed. Where would the larger fragments those with the greater number of base pairs be located; towards the top of the gel or the bottom? Why? The large fragments would be toward the top of the gel because it is more difficult for the larger pieces to strain through the gel.
Suppose you had 500 pieces of each of the four fragments, how would the gel appear? There would still be only 4 bands present.
If it were possible to weigh each of the fragments, which one would be the heaviest? Why? Fragment D would be heaviest because it is the largest piece of DNA and would thus have the greatest mass.
Complete this rule for the movement of DNA fragments through an agarose gel: The larger the DNA fragment, the slower it migrates through an agarose gel.
63
This diagram represents a piece of DNA cut with HindIII at each of the restrictions sites pointed to by the arrows. The numbers represent the number of base pairs in each fragment.
2,027 23,130 6,557 9,416 4,361 2,322
On the gel diagram at the right, show how you believe these fragments will sort out during electrophoresis. Label each fragment with its correct number of base pairs.
64
65
Plasmid Maps
66
67
68
69