Scribd
Upload
61 views1 page

PS Review

The document provides an overview of protein synthesis. It explains that DNA contains the genetic code for proteins and is made up of nucleotides. During transcription, one DNA strand acts as a template for mRNA. The mRNA strand leaves the nucleus and helps with protein production at the ribosome. Translation then occurs where tRNA pairs mRNA codons with amino acids, forming a protein chain. The document includes a practice problem where students are asked to convert DNA sequences to mRNA and determine the amino acid sequences.

Uploaded by

Chichi Chipy
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as ODT, PDF, TXT or read online on Scribd
61 views1 page

PS Review

The document provides an overview of protein synthesis. It explains that DNA contains the genetic code for proteins and is made up of nucleotides. During transcription, one DNA strand acts as a template for mRNA. The mRNA strand leaves the nucleus and helps with protein production at the ribosome. Translation then occurs where tRNA pairs mRNA codons with amino acids, forming a protein chain. The document includes a practice problem where students are asked to convert DNA sequences to mRNA and determine the amino acid sequences.

Uploaded by

Chichi Chipy
Copyright
© Attribution Non-Commercial (BY-NC)
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as ODT, PDF, TXT or read online on Scribd
You are on page 1/ 1

Valhalla High School Name:________________

Biology
Protein Synthesis Review
One of the main functions of DNA is to code for proteins. DNA consists of 2
complementary strands made up of many nucleotides. DNA nucleotides are made of a
sugar, a phosphate, and 1 of 4 nitrogen bases: adenine, guanine, thymine or cytosine.
In protein synthesis, the DNA molecule's strands are uncoiled. One of those strands
is momentarily used as the template for creating an mRNA strand. The mRNA strand
will be able to leave the nucleus and help in the protein making process at the
ribosome. The 2 DNA strands will re-coil after the mRNA has been made. These
events make up transcription. At the ribosome, which is made up of rRNA, the mRNA
strand is read in groups of 3 consecutive nucleotides, or a codon. The anticodon of
the tRNA pairs with the codon of the mRNA, bringing a specific amino acid to the
ribosome. These events make up translation. The long chain of amino acids connected
by peptide bonds make a specific protein. Remember, DNA replication is NOT part of
protein synthesis.
1. Divide the correct (top or bottom) DNA strand into groups of 3.
2. Find the start codon (in DNA= TAC, in RNA= AUG)
3. Find the stop codon (1 of 3: UAA(ATT), UGA(ACT), UAG(ATC))
4. Change the entire gene from DNA to RNA.
5. Decode the groups of 3 RNA nucleotides using your mRNA codon chart.
Practice: Use these top strands of DNA and convert them into protein sequences.
1. GCTTCCTACGCTGGAACCGCGCGATTCATCGCT

DNA base sequence:________________________________________________

mRNA base sequence:_______________________________________________

amino acid sequence:________________________________________________

2. AATGTACAGTACCCGAGTATAAATTCTACTCAT

DNA base sequence:________________________________________________

mRNA base sequence:_______________________________________________

amino acid sequence:________________________________________________

3. ATTACTGGTTACCCGAGTATACTTGCTTGAATT

DNA base sequence:________________________________________________

mRNA base sequence:_______________________________________________

amino acid sequence:________________________________________________

You might also like