The study developed 17 polymorphic microsatellite markers for Parabramis pekinensis, an economically important freshwater fish, from an enriched genomic library. The markers showed high levels of polymorphism, with allele numbers ranging from 4 to 7 per locus. These new microsatellite markers will be useful for assessing genetic diversity and population structure of P. pekinensis, which has experienced declines from factors like pollution and overfishing.
The study developed 17 polymorphic microsatellite markers for Parabramis pekinensis, an economically important freshwater fish, from an enriched genomic library. The markers showed high levels of polymorphism, with allele numbers ranging from 4 to 7 per locus. These new microsatellite markers will be useful for assessing genetic diversity and population structure of P. pekinensis, which has experienced declines from factors like pollution and overfishing.
The study developed 17 polymorphic microsatellite markers for Parabramis pekinensis, an economically important freshwater fish, from an enriched genomic library. The markers showed high levels of polymorphism, with allele numbers ranging from 4 to 7 per locus. These new microsatellite markers will be useful for assessing genetic diversity and population structure of P. pekinensis, which has experienced declines from factors like pollution and overfishing.
The study developed 17 polymorphic microsatellite markers for Parabramis pekinensis, an economically important freshwater fish, from an enriched genomic library. The markers showed high levels of polymorphism, with allele numbers ranging from 4 to 7 per locus. These new microsatellite markers will be useful for assessing genetic diversity and population structure of P. pekinensis, which has experienced declines from factors like pollution and overfishing.
Download as DOC, PDF, TXT or read online from Scribd
Download as doc, pdf, or txt
You are on page 1/ 7
Isolation and characteristics of polymorphic microsatellite
markers in Parabramis pekinensis
Abstract The bleeker (Parabramis pekinensis) is an economically important freshwater fish which are widely distributed in China. In order to obtain a set of genetic markers for evaluating the genetic diversity of bleeker, we developed thirty-four microsatellites from a (AC) 13-enriched genomic library in 30 individuals collected from Liangzi Lake. Seventeen of those loci were polymorphic with allele numbers ranged from 4 to 7. The observed, expected heterozygosities and polymorphism information content range from 0.5000 to 1.0000, 0.6328 to 0.8211 and 0.571 to 0.797, respectively. The polymorphic microsatellite loci developed in this study will be of potential use in understanding population genetic structure and conservation genetics of P. pekinensis. Keywords Parabramis pekinensis, microsatellite, polymorphism Introduction The bleeker (Parabramis pekinensis) is the most common and widespread species in the genus of Parabramis in China. It is characterised by an increased body height that is 34.48% to 40.00% of standard length, a protracted diamond body and skinny body breadth (Wu XW et al., 1964). Several species are considered endemic to the Heilong River and the Liaohe River
including P. pekinensis P. strenosomus and P. liaohonensis. However, it has a great
commercial importance as food resource since its a crucial aquaculture income for the coastal communities. Various factors such as water pollution, overfishing, construction of dams for power generation and so on affected the population drastically which led to a decline in population of P. pekinensis. Despite decades of study, there is not much information pertaining to genetics of this species (Li et al. 2008; Miao et al. 2013). Microsatellite markers are commonly used to assess genetic population structure because of their high level of polymorphism and co-dominant inheritance (Goldstein and Schltterer 1999). So far, Polymorphic microsatellite loci have been isolated from various fish species such as Amblema neislerii (DazFerguson et al. 2011), Siniperca chuatsi (Liu et al. 2011) and Pelteobagrus fulvidraco (Hu et al. 2009). But no Microsatellite markers have been developed for P. pekinensis. Therefore, in this study we focused isolate novel polymorphic microsatellite loci of P.
pekinensis using FIASCO (Fast Isolation by AFLP of Sequences Containing Repeats)
for future population genetic studies. Methodology Genomic DNA of P. pekinensis was extracted from caudal fin by using proteinase-K digestion and Ammonium acetate chromatography with RNase treatment, and then an enriched partial genomic library for the repeat motif (AC) 13 was constructed using the FIASCO protocol (Zane et al. 2002) with some modifications (Zhu et al. 2005). Enriched fragments were ligated into pMD19-T vector (TaKaRa) and then transformed into Escherichia coli DH5 (TaKaRa) cells. Grown overnight in a SOC solid medium with ampicillin, clones were confirmed by polymerase chain reaction (PCR) amplifications using M13 forward and reverse primers. After PCR confirmation, 57 positive clones were sequenced by Sangon (Shanghai). Sequences were analyzed for the repeat region using software SSRHunter 1.3. The software Primer 5.0 was used to design 57 pairs of primers flanking the repeat regions of interest. Thirty individuals of adult P. pekinensis were sampled from Liangzi Lake in Hubei province of China. Genomic DNA of P. pekinensis was extracted using ammonium acetate high salt chromatography, and these DNA samples were used for the test and characterization of polymorphism of the isolated microsatellite loci. The conditions for polymerase chain reaction were optimized for each pair of primers, and the tests of polymorphism were performed in 30 individuals of P. pekinensis population. The PCR amplifications were carried out in 10 L volume on a Veriti 96 well Thermal Cycler (ABI), the mixture containing 1 PCR buffer (10mM Tris-Cl, 1.5mM MgCl2, 50mM KCl), 10ng genomic DNA, 0.1M for each primer, 100mol/L dNTPs and 0.2 U rTaq DNA polymerase (TaKaRa). The amplification system was set as a initial denaturation at 95 for 5 min; 33 cycles including denaturation for 45s, annealing at annealed temperature (Table 1) for 45s and elongation at 72 for 30s; and a final extension at 72 for 10 min. Amplified fragments were size-fractionated on 10% non-denaturing polyacrylamide gels running at 135V for 200 min and visualized by silver nitrate staining, photographed, and analyzed using the Ultraviolet Gel Document System (Biotech). The analyses of polymorphism, including allele diversity, observed (H0), polymorphism information content (PIC), expected heterozygosities (HE), and the exact test for Hardy-Weinberg
57 pairs of primers designed, 23 failed to amplify PCR products. In sum,
17 of the 34 successfully amplified microsatellite loci were polymorphic, with the
number of alleles per locus ranging from 4 to 7. For those 17 polymorphic loci, H0, HE and PIC ranged from 0.5000 to 1.0000, from 0.6328 to 0.8211 and from 0.571 to 0.797, respectively (Table 1). The remaining 18 loci were monomorphic. The tests for HWE revealed that the majority (3 out of 17) of these polymorphic microsatellites were in HWE, and Ppe5, Ppe10, Ppe12 of the 17 loci showed significant departure from HWE (P<0.005), which may suggest population subdivision or occurrence of null allele may be detected as homozygotes. These 17 polymorphic microsatellite loci of P. pekinensis will facilitate future studies on conservation genetics in P. pekinensis populations.
Table 1 Characterization of 17 polymorphic microsatellites of P. pekinensis in Liangzi Lake
53 240-280 5 0.5333 0.7700 R: GTTCTTTATTGGTTGCTTGC T: annealing temperature (); Na: number of alleles; HO: observed heterozygosity; HE: expected heterozygosity; PIC: polymorphism
0.730
F: CCTAACAACCAACCCGAC
R: AGGCTTCTTATTCCTGACG F: ATCCTTTGTGTTTGCCCT
information content; * indicated deviation from Hardy-Weinberg equilibrium (P<0.05) after Bonferroni correction
Acknowledgements This study was supported by grants from the Modern Agroindustry Technology Research System, Staple Freshwater Fishery Industry Technology System (No. CARS-46-05), Fundamental Research Funds for the Central Universities (No. 2011PY0232011PY0432011SC27, 2011ZC011 and 2012YB08), and Guangdong Haid Group Co., Ltd. Wu WX, et al. (1964) Chinese Cyprinidae records. Science and Technology, Shanghai. Goldstein DB, Schiltterer C (1999) Microsatellite: evolution and applications. Oxford University Presss, New York. Diaz-Ferguson E, Williams AS, Moyer GR (2011) Isolation and characterization of microsatellite loci in the federally endangered fat threeridge mussel (Amblema neislerii). Conservation Genet Resour 3: 757-759. Liu XL, Luo W, Zeng C, Wang WM, Gao ZX (2011) Isolation of new 40 microsatellite markers in mandarin fish (Siniperca chuatsi). Int. J. Mol. Sci. 12: 41804189. Hu GF, Liang HW, Li Z, Wang CZ, Wu QC, Liu XJ, Luo XZ, Zou GW (2009) Isolation and characterization of polymorphic microsatellite markers in the yellow catfish, Pelteobagrus fulvidraco. Conservation Genet Resour 1: 63-66. Li JL, Tang YK, Yu JH (2008) Genetic diversity in Parabram is pekinensis from the lower reaches of the Yangtze River from RAPD analysis and mitochondrial D-loop sequences. Journal of Shanghai Fisheries University 17(2):145-151. Miao LH, Ge XP, Liu B, Xie J, Zhu J, Feng XY (2013) Nutritive quality and nutritional component in the muscle of Megalobrama tarminalis and Parabramis pekinensis. Chinese Journal of Zoology 48(1): 87-94. Zane L, Bargelloni L, Patarnello T (2002) Strategies for microsatellite isolation: a review. Molecular Ecology, 11, 1-16. Zhu B, Liao X, Shao Z, Rosenthal H, Chang J (2005) Isolation and characterization of microsatellites in Chinese sturgeon, Acipenser sinensis. Molecular Ecology Notes, 5, 888-892. Zeng C, Luo W, Liu XL, Wang WM, Gao ZX (2011) Isolation and characterization of 32 polymorphic microsatellites for Xenocypris microlepis. Conservation Genet Resour
Cladistic Relationships Among The Pleurotus Ostreatus Complex, The Pleurotus Pulmonarius Complex, and Pleurotus Eryngii Based On The Mitochondrial Small Subunit Ribosomal DNA Sequence Analysis
Cladistic Relationships Among The Pleurotus Ostreatus Complex, The Pleurotus Pulmonarius Complex, and Pleurotus Eryngii Based On The Mitochondrial Small Subunit Ribosomal DNA Sequence Analysis
