Role of the Copper Transporter, CTR1, in Platinum-Induced Ototoxicity

Reagents

Antibodies for immunohistochemistry, immunofluorescence, and Western blotting were purchased from the following sources: rabbit polyclonal anti-Ctr1 antibody from Novus Biologicals, rabbit polyclonal anti-OCT2 antibody from Alpha Diagnostic International, myosin VIIa (Proteus Biosciences), and mouse monoclonal anti-β-actin antibody from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated anti-rabbit (sc-2004; Santa Cruz Biotechnology) Ig was used as the secondary antibody. Lipofectamine RNAiMAx, SuperScript III, and hygromycin B were from Invitrogen. The cell culture media DMEM, Opti-MEM, and fetal bovine serum (FBS) were from the Cell Culture Facility at University of California, San Francisco (San Francisco, CA). Cisplatin and copper sulfate were purchased from Sigma-Aldrich.

Animals and cell lines

The FVB and C57BL/6 wild-type mice (3–4 weeks) were purchased from Charles River Laboratories. All experimental procedures and animal handling were executed in accordance with national ethics guidelines, approved and complied with all protocol requirements at the University of California, San Francisco (Institutional Animal Care and Use Committee). The cochlear cell line, HEI-OC1, was kindly provided by Dr. Federico Kalinec (House Ear Institute, Los Angeles, CA). The cells were cultured in DMEM-H21 containing 10% FBS and were incubated at 33°C in a humidified atmosphere containing 10% CO₂. Human embryonic kidney 293 (HEK293) cells transfected with pcDNA5/FRT (Invitrogen) vector containing the full-length human CTR1 cDNA (HEK-CTR1) and with the empty vector (HEK-EV) were established using Lipofectamine 2000 (Invitrogen) as per the manufacturer's instructions. Transfected HEK293 cells were maintained in DMEM-H21 containing 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, and 750 μg/ml hygromycin B at 37°C in a humidified atmosphere containing 5% CO₂.

Reverse transcriptase-PCR

Total RNA was extracted from the cochleae from male/female mice and HEI-OC1 cells using the Purelink RNA mini kit (Invitrogen) as per the manufacturer's instructions. Reverse transcription PCR of RNA samples was performed with Superscript III (Invitrogen) using oligo-dT₂₀ primers. Two microliters of the reverse transcriptase (RT) reaction product was used for subsequent PCRs (TaqDNA Polymerase; Invitrogen) of 35 cycles with the following parameters: 94°C for 30 s, 60°C for 45 s, 72°C for 1 min, followed by a final extension of 72°C for 10 min and storage at 4°C. Primers were designed to amplify a unique sequence of mouse Ctr1, OCT1, OCT2, and OCT3, each spanning intron–exon boundaries to ensure that no genomic DNA was amplified. The PCR primers that were used for mouse were as follows: Ctr1 (GenBank accession number NM_175090), forward, CATGATGATGATGCCTATGACC, and reverse, CAGCATCTGCTGCCCAAC, were designed to amplify a 268 bp fragment; OCT1 (NM_009202), forward, ACACCTTGATCACAGAGTTTG, and reverse, CAAGGCACATCATCTTCAGGT, were designed to amplify a 306 bp fragment; OCT2 (NM_013667), forward, TCTTGATGTACAATTGGTTCACG, and reverse, AACCACAGCAAATACGACCAG, primers were designed to amplify a 461 bp fragment; and OCT3 (NM_011395), forward, TTATGTTTGCTTGGTTCACGAG, and reverse, AGGATCCCAAAGATGATCAGAG, primers were designed to amplify a 457 bp fragment. Analysis of each PCR sample was then performed on 2% agarose gels containing 0.5 μg/ml ethidium bromide. Gels were visualized using a digital camera and an image processing system (Kodak).

Quantitative PCR

Real-time PCR was performed using Taqman Universal Master Mix (Applied Biosystems). Primer and probe sets for each gene were Assays-on-Demand purchased from Applied Biosystems. Reactions were run on an ABI Prism 7700 instrument, and cycling conditions were as follows: 95°C for 20 s followed by 60 cycles of 95°C for 3 s and 60°C for 30 s. The amplification of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was performed as an internal control. The expression of specific gene of interest normalized to GAPDH is reported as the level relative to the expression of the lowest expressing transporter, OCT3, in that particular sample.

Immunohistochemistry and immunofluorescence

The male FVB mice (3–4 weeks of age) were anesthetized and their cochleae were isolated, dissected, perfused through oval and round windows by 2% paraformaldehyde in 0.1 m phosphate buffer (PB) at pH 7.4, and incubated in the same fixative for 2 h. On fixation, the cochleae were rinsed with PB and immersed in 5% EDTA in 0.1 m PB for decalcification. When the cochleae were completely decalcified (∼2 d), they were incubated overnight in 30% sucrose for cryoprotection. The cochleae then were embedded in OCT TissueTek Compound (Miles Scientific). Tissues were cryosectioned at 10–12 μm thickness for immunohistochemistry, mounted on Superfrost microscope slides (Erie Scientific), and stored at −20°C until their use.

For immunohistochemical staining of the mouse cochlea, rabbit polyclonal antibodies against Ctr1 (Novus Biologicals) and OCT2 (Alpha Diagnostic) were used. After incubation of the slides at 37°C for 30 min, antigen retrieval was performed using 0.4% pepsin (Sigma-Aldrich) in 0.01N hydrochloric acid for 5 min at 37°C. The sections were rinsed twice for 5 min in 0.1 m PBS, pH 7.4, and then preincubated for 1 h in 0.3% Triton X-100 and 30% normal goat serum before incubating with rabbit anti-Ctr1 (1:500) or rabbit anti-OCT2 (1:250) diluted in the blocking serum overnight at 4°C. The slides were then rinsed (two times for 10 min each time) and Vector biotinylated goat anti-rabbit Ig was used as the secondary antibody followed by Vector ABC (Vector Laboratories). Peroxidase activity was identified by reaction with 3,3′-diaminobenzidine tetrahydrochloride tablets (Sigma-Aldrich). Sections were mounted in equal parts of glycerol and PBS buffer before being coverslipped. Slides treated with the same technique, but without incubation with the primary antibody, were used as the negative control.

Immunofluorescence studies were conducted on whole-mount cochleae prepared as described below (see Hair cell counts). A primary antibody against a hair cell-specific marker, myosin VIIa, was used at a dilution of 1:50 in PBS. After an overnight incubation at 4°C, the sections were rinsed twice for 10 min with PBS and then incubated for 2 h in goat anti-rabbit IgG conjugated to Cy3 diluted to 1:2000 in PBS. The sections were rinsed in PBS twice for 10 min, and mounted in a 1:1 mixture of PBS buffer and glycerol before being coverslipped. Slides treated with the same technique but without incubation with the primary antibody were used as controls. Slides were observed under an Olympus microscope with confocal immunofluorescence.

Western blot analysis

Total protein extract was prepared from male/female mice cochleae using a lysis buffer containing the following: 20 mm Tris HCl, pH 7.5–8.0, 150 mm NaCl, 0.5% sodium deoxycolate, 1% Triton X-100, 0.1% SDS, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, and protease inhibitor mixture. The HEI-OC1 cell pellet was lysed using CellLytic M cell lysis buffer (Sigma-Aldrich) at 4°C for 10 min. The cochlear and HEI-OC1 cell homogenate was spun for 10 min at 14,000 rpm at 4°C. The protein concentration in the supernatant was determined by the BCA protein assay. Approximately 50 μg of the supernatant was fractioned by SDS-PAGE and transferred onto a polyvinylidene difluoride membrane. The blots were incubated for 1 h in a blocking buffer containing 5% nonfat dry milk in TBS and then incubated overnight at 4°C with anti-Ctr1 or OCT2 antibodies used for immunohistochemistry and with anti-β-actin antibody, as a loading control, diluted in TBS-T buffer containing 2% milk (dilutions: Ctr1, 1:1000; OCT2, 1:500; β-actin, 1:5000). The blots were washed three times with TBS-T for 15 min each and incubated for 2 h at room temperature with the secondary antibody (goat anti-rabbit IgG peroxidase conjugate; Santa Cruz Biotechnology; 1:5000) in TBS-T buffer containing 3% milk. The blots were washed again with TBS-T and visualized with the ECL Western blotting detection reagent (GE Healthcare).

Cytotoxicity studies

The cytotoxicity of cisplatin was measured by standard MTT assays in 96-well plates as previously described (Zhang et al., 2006) in HEK293 and HEI-OC1 cells. After seeding the cells at the desired density and overnight incubation, cisplatin with or without a CTR1 competitive inhibitor, copper sulfate (1 mm), was then added to the culture medium to various concentrations. After 7 h of drug exposure, the drug-containing medium was replaced with fresh, drug-free medium, and the incubation was allowed to continue for 72 h after the addition of the drugs. At the end of the incubation, 20 μl of MTT stock solution (5 mg/ml) was added to each well. After additional incubation for 3 h at 37°C, the MTT reaction medium was discarded and the purple-blue MTT formazan crystals were dissolved by the addition of 100 μl of 0.1N HCI in isopropanol. The optical density, which is a reflection of the mitochondrial function of the viable cells, was read directly with a microplate reader (Versamax; Molecular Devices) at 580 nm and a reference wavelength of 680 nm. Concentration response graphs were generated for each drug using GraphPad Prism software (GraphPad Software). These graphs were analyzed using a curve fit for sigmoid dose–response, and IC₅₀ values were derived. Results are expressed as mean IC₅₀ with the SEM.

Cellular accumulation of platinum

The cellular accumulation of platinum was determined as previously described (Zhang et al., 2006). Briefly, the cells were seeded in poly-d-lysine-coated 12-well plates. After an overnight incubation, the cells were treated with 10 μm concentration of cisplatin in antibiotic-free culture medium in the presence or absence of copper sulfate at 37°C in 5% CO₂ for 2 h. At the end of incubation, the cellular uptake was terminated by washing three times with ice-cold PBS, harvested, and pelleted by centrifugation. Cell pellets were solubilized in 70% nitric acid at 65°C for 3 h and diluted with distilled water containing 10 ppb of iridium (Sigma-Aldrich) and 0.1% Triton X-100 to adjust the nitric acid concentration to 7%. Platinum content was then determined by inductively coupled plasma mass spectrometry (ICP-MS) in the Analytical Facility at University of California, Santa Cruz (Santa Cruz, CA). Cellular platinum uptake was normalized to the protein content determined by BCA protein assay.

Cisplatin uptake in HEI-OC1 cells was performed after siRNA-mediated Ctr1 knockdown using Lipofectamine RNAiMax (Invitrogen). Briefly, the cells were transfected with siRNA-lipofectamine RNAiMax complexes of Ctr1 and negative control siRNA (Applied Biosystems) in a poly-d-lysine-coated 24-well plate per the manufacturer's instructions. The percentage knockdown of Ctr1 was determined 48 h after transfection in comparison with negative control transfected cells. Cisplatin uptake was performed at this time using conditions described before.

To examine cochlear uptake of cisplatin in vitro, cochlear organs of Corti from 12-d-old male mice were dissected in sterile saline solution composed of the following (in mm): 6.8 KCl, 144 NaCl, 0.9 MgCl₂, 1.3 CaCl₂, 0.7 NaH₂PO₄, 5.6 d-glucose, 10 HEPES. The cochlea was isolated from the surrounding temporal bone. The isolated and intact organ of Corti (basal, mid, and apical turns) was progressively freed after removal of the lateral half of the cochlea otic capsule. The organ of Corti was fully exposed at this point and remained in the medial or bilateral half of the cochlear capsule. This organ of Corti was then immediately placed in an antibiotic-free medium (DMEM-H21) and incubated with cisplatin (10 μm) in the presence or absence of copper sulfate (1 mm) at 37°C for 2 h to determine the rate of platinum uptake. The net platinum concentrations, determined through aforementioned methods, were normalized to the weight of dry tissue.

Platinum-DNA adduct formation

The platinum content associated with genomic DNA was determined as previously described (Zhang et al., 2006). Briefly, the cells were seeded in 60 mm tissue culture dishes. After overnight incubation, cells were treated with cisplatin (10 μm) in antibiotic-free culture medium with or without an OCT inhibitor at 37°C in 5% CO₂ for 2 h. At the end of incubation, the cells were washed with ice-cold PBS, harvested, and pelleted. Genomic DNA was isolated from the cell pellets using Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer's protocol. The DNA-bound platinum concentration was determined by ICP-MS, which was normalized to total DNA content (absorption spectrometry at 260 nm).

In vivo study design

To determine the effect of intratympanic administration of copper sulfate on intraperitoneal cisplatin treatment, the study was divided in three phases. In phases 1 and 2, ototoxic and nonototoxic doses of intraperitoneal cisplatin and intratympanic copper sulfate were determined, respectively. The animals were anesthetized before administration of extraneous agents, by intraperitoneal injection of a mixture of ketamine hydrochloride (Ketaset; 100 mg/kg) and xylazine hydrochloride (Xyla-Ject; 10 mg/kg). Body temperature was maintained with the aid of a heating pad. The depth of anesthesia was determined by measurement of pedal reflex.

Eighteen C57BL/6 male mice were divided into six treatment groups of cisplatin (0, 10, 14, 18, 20, and 22 mg/kg) and copper sulfate (0, 0.025, 0.04, 0.05, 0.1, and 0.5 mg/kg) for phases 1 and 2, respectively. For each group, pretreatment acoustic brainstem response (ABR) thresholds were determined on day 1 at click, 8, 16, 32 kHz frequencies. Determination of changes in ABR thresholds of an individual animal with respect to the control was performed after 72 h of cisplatin administration. Based on ABR results and survival data, a dose of 20 mg/kg cisplatin and 0.025 mg/kg for copper sulfate was chosen for the phase 3 experiments. Effect of copper sulfate on cisplatin-induced ototoxicity was determined 72 h after cisplatin administration. In this study, 15 C57BL/6 male mice were randomized into three groups of 5 animals each.

ABR measurements

The animals were anesthetized with ketamine hydrochloride and xylazine before testing. Evoked acoustic brainstem response thresholds were differentially recorded from the scalp of the mice as described previously (Akil et al., 2006). The sound stimuli used included click (5 ms duration) and tone pips at 8, 16, and 32 kHz (10 ms duration). Measurements were done using the TDT BioSig III system (Tucker-Davis Technologies). Computerized analysis of stored waveforms for ABR threshold (Matlab software; The MathWorks) was also performed. The mean value of thresholds checked by visual inspection and computer analysis was defined as the ABR threshold at each stimulus and was compared among different treatment groups.

Histopathology with light microscopy

Following our previous protocols (Akil et al., 2006), the C57BL/6 mice of groups 1 and 2 were anesthetized and the cochleae were isolated, dissected, perfused through the round window with 2% paraformaldehyde and 2% glutaraldehyde in 0.1 m phosphate buffer, pH 7.4, and incubated in the same fixative overnight at 4°C. The cochleae were subsequently rinsed with 0.1 m PB and postfixed in 1% osmium tetroxide for 1 h. The bone surrounding the cochlea was thinned and the cochlea subsequently immersed in 5% EDTA (0.2 m). The decalcified cochleae were dehydrated in ethanol and propylene oxide, whereupon they were embedded in Araldite 502 resin (Electron Microscopy Sciences) and sectioned at 5 μm. Sections were stained with toluidine blue and mounted with Permount (Thermo Fisher Scientific) on microscope slides.

Hair cell counts

The cochleae from C57BL/6 mice used in groups 1 and 2 were perfused with 4% PFA in 0.1 m PBS, pH 7.4, and stored in the fixative overnight at 4°C. The cochleae were subsequently rinsed with PBS three times for 10 min each, and then decalcified with 5% EDTA in 0.1 m PBS for 3 d. The otic capsule, the lateral wall, tectorial membrane, and Reissner's membrane were removed in that order. The remaining organ of Corti was stained with rhodamine–phalloidin (stock solution of 200 U/ml methanol diluted 1:100 in PBS) for an hour. The whole mount was then rinsed with PBS and further dissected into a surface preparation (microdissected into individual turns) and mounted on glass slides in a mounting solution. Hair cells in the organ of Corti were visualized under a microscope equipped with epifluorescence, using a 40× objective. To quantify hair cell loss in the cochlea after the various treatments, Inner hair cells and OHCs were counted over each 0.1 mm sectional distance along the cochlea.

Data analysis

Data were analyzed statistically by unpaired or paired Student's t tests, as appropriate. Statistical significance was set at p < 0.05. For the cytotoxicity experiments, concentration response graphs were generated for each drug using the sigmoidal dose–response model in GraphPad Prism software (GraphPad Software). The IC₅₀ values derived from these graphs are expressed as mean IC₅₀ with SEM. ANOVA was used to compare within and between treatment groups for our in vivo studies in mice to derive statistical significance.