Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii
Abstract
:1. Introduction
2. Materials and Methods
2.1. Microalgae Strains and Growth Conditions
2.2. Identification of the AOX Gene Family in C. reinhardtii
2.3. Chromosomal Distribution, AOX Gene Structure and Subcellular Localization
2.4. Phylogenetic and Collinearity Analysis
2.5. Visualization of CrmiRNAs’ Predicted Cleavage Sites and GO Enrichment Analysis
2.6. Extraction and Purification of RNA and RNA Reverse Transcription
2.7. Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
2.8. Analysis of Mitochondrial DNA (mtDNA) Copy Number
2.9. Statistical Analysis
3. Results
3.1. Screening of Inhibiting Dyes and Time Duration to Eliminate mtDNA
3.2. Selection of Gene and Strain to Minimize the mtDNA Contents
3.3. Effect of mtDNA Elimination on Genes Reported for mETC Inhibition
3.4. Identification and Characterization of CrAOX Genes
3.5. Sequence Feature, Gene Structure Analysis and Chromosomal Location of CrAOX Genes
3.6. Phylogenetics and Collinearity Analysis
3.7. Gene Ontology (GO) Annotation Analysis and miRNAs Analysis
3.8. CrAOX Genes Expression Patterns under AF Treatment
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Ott, M.; Amunts, A.; Brown, A. Organization and Regulation of Mitochondrial Protein Synthesis. Annu. Rev. Biochem. 2016, 85, 77–101. [Google Scholar] [CrossRef]
- Hiramatsu, T.; Nakamura, S.; Misumi, O.; Kuroiwa, T.; Nakamura, S. Morphological changes in mitochondrial and chloroplast nucleoids and mitochondria during the Chlamydomonas reinhardtii (Chlorophyceae) cell cycle. J. Phycol. 2006, 42, 1048–1058. [Google Scholar] [CrossRef]
- Alber, N.A.; Vanlerberghe, G.C. Signaling interactions between mitochondria and chloroplasts in Nicotiana tabacum leaf. Physiol. Plant. 2019, 167, 188–204. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.; Rasmussen, A.; Chatterjee, A.; Rasmussen, L. Mitochondria-mediated nuclear mutator phenotype in Saccharomyces cerevisiae. Biochim. Biophys. Acta-Bioenerg. 2004, 1657, 21–22. [Google Scholar]
- Macmillan, C.J.; Shoubridge, E.A. Mitochondrial DNA depletion: Prevalence in a pediatric population referred for neurologic evaluation. Pediatr. Neurol. 1996, 14, 203–210. [Google Scholar] [CrossRef]
- Morten, K.J.; Ashley, N.; Wijburg, F.; Hadzic, N.; Parr, J.; Jayawant, S.; Adams, S.; Bindoff, L.; Bakker, H.D.; Mieli-Vergani, G. Liver mtDNA content increases during development: A comparison of methods and the importance of age-and tissue-specific controls for the diagnosis of mtDNA depletion. Mitochondrion 2007, 7, 386–395. [Google Scholar] [CrossRef]
- Xing, J.; Chen, M.; Wood, C.G.; Lin, J.; Spitz, M.R.; Ma, J.; Amos, C.I.; Shields, P.G.; Benowitz, N.L.; Gu, J. Mitochondrial DNA content: Its genetic heritability and association with renal cell carcinoma. J. Natl. Cancer Inst. 2008, 100, 1104–1112. [Google Scholar] [CrossRef] [PubMed]
- Blokhin, A.; Vyshkina, T.; Komoly, S.; Kalman, B. Variations in mitochondrial DNA copy numbers in MS brains. J. Mol. Neurosci. 2008, 35, 283–287. [Google Scholar] [CrossRef] [PubMed]
- Tiao, M.-M.; Lin, T.-K.; Kuo, F.-Y.; Huang, C.-C.; Du, Y.-Y.; Chen, C.-L.; Chuang, J.-H. Early stage of biliary atresia is associated with significant changes in 8-hydroxydeoxyguanosine and mitochondrial copy number. J. Pediatr. Gastroenterol. Nutr. 2007, 45, 329–334. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.; Zhou, Y.; Shi, Y.; Ning, L.; Yang, Y.; Wei, X.; Zhang, N.; Hao, X.; Niu, R. Reduced mitochondrial DNA copy number is correlated with tumor progression and prognosis in Chinese breast cancer patients. IUBMB Life 2007, 59, 450–457. [Google Scholar] [CrossRef]
- Gillham, N.W.; Boynton, J.E.; Harris, E.H. Specific elimination of mitochondrial-DNA from chlamydomonas by intercalating dyes. Curr. Genet. 1987, 12, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Del-Saz, N.F.; Ribas-Carbo, M.; McDonald, A.E.; Lambers, H.; Fernie, A.R.; Florez-Sarasa, I. An In Vivo Perspective of the Role(s) of the Alternative Oxidase Pathway. Trends Plant Sci. 2018, 23, 206–219. [Google Scholar] [CrossRef] [PubMed]
- Millar, A.H.; Whelan, J.; Soole, K.L.; Day, D.A. Organization and Regulation of Mitochondrial Respiration in Plants. Annu. Rev. Plant Biol. 2011, 62, 79–104. [Google Scholar] [CrossRef] [PubMed]
- Dahal, K.; Vanlerberghe, G.C. Alternative oxidase respiration maintains both mitochondrial and chloroplast function during drought. New Phytol. 2017, 213, 560–571. [Google Scholar] [CrossRef] [PubMed]
- Florez-Sarasa, I.; Flexas, J.; Rasmusson, A.G.; Umbach, A.L.; Siedow, J.N.; Ribas-Carbo, M. In vivo cytochrome and alternative pathway respiration in leaves of Arabidopsis thaliana plants with altered alternative oxidase under different light conditions. Plant Cell Environ. 2011, 34, 1373–1383. [Google Scholar] [CrossRef] [PubMed]
- Fromm, S.; Senkler, J.; Eubel, H.; Peterhänsel, C.; Braun, H.P. Life without complex I: Proteome analyses of an Arabidopsis mutant lacking the mitochondrial NADH dehydrogenase complex. J. Exp. Bot. 2016, 67, 3079–3093. [Google Scholar] [CrossRef] [PubMed]
- Kramer, D.M.; Evans, J.R. The Importance of Energy Balance in Improving Photosynthetic Productivity. Plant Physiol. 2011, 155, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Laitz, A.V.N.; Acencio, M.L.; Budzinski, I.G.F.; Labate, M.T.V.; Lemke, N.; Ribolla, P.E.M.; Maia, I.G. Transcriptome Response Signatures Associated with the Overexpression of a Mitochondrial Uncoupling Protein (AtUCP1) in Tobacco. PLoS ONE 2015, 10, e0130744. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Wang, W.; Bai, X.; Qi, Y. Gene silencing by artificial microRNAs in Chlamydomonas. Plant J. 2009, 58, 157–164. [Google Scholar] [CrossRef]
- Si, X.; Lyu, S.; Hussain, Q.; Ye, H.; Huang, C.; Li, Y.; Huang, J.; Chen, J.; Wang, K. Analysis of Delta (9) fatty acid desaturase gene family and their role in oleic acid accumulation in Carya cathayensis kernel. Front. Plant Sci. 2023, 14, 1193063. [Google Scholar] [CrossRef]
- Bailey, T.L.; Williams, N.; Misleh, C.; Li, W.W. MEME: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef]
- Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9, 299–306. [Google Scholar] [CrossRef]
- Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL): An online tool for phylogenetic tree display and annotation. Bioinformatics 2007, 23, 127–128. [Google Scholar] [CrossRef]
- Darzentas, N. Circoletto: Visualizing sequence similarity with Circos. Bioinformatics 2010, 26, 2620–2621. [Google Scholar] [CrossRef]
- Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef] [PubMed]
- Ge, S.X.; Jung, D.; Yao, R. ShinyGO: A graphical gene-set enrichment tool for animals and plants. Bioinformatics 2020, 36, 2628–2629. [Google Scholar] [CrossRef] [PubMed]
- Quiros, P.M.; Goyal, A.; Jha, P.; Auwerx, J. Analysis of mtDNA/nDNA Ratio in Mice. Curr. Protoc. Mouse Biol. 2017, 7, 47–54. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Zhang, Y.; Havey, M.J.; Shou, W. Copy numbers of mitochondrial genes change during melon leaf development and are lower than the numbers of mitochondria. Hortic. Res. 2019, 6, 95. [Google Scholar] [CrossRef]
- Zhang, N.; Pazouki, L.; Nguyen, H.; Jacobshagen, S.; Bigge, B.M.; Xia, M.; Mattoon, E.M.; Klebanovych, A.; Sorkin, M.; Nusinow, D.A.; et al. Comparative Phenotyping of Two Commonly Used Chlamydomonas reinhardtii Background Strains: CC-1690 (21gr) and CC-5325 (The CLiP Mutant Library Background). Plants 2022, 11, 585. [Google Scholar] [CrossRef]
- Alber, N.A.; Vanlerberghe, G.C. The flexibility of metabolic interactions between chloroplasts and mitochondria in Nicotiana tabacum leaf. Plant J. 2021, 106, 1625–1646. [Google Scholar] [CrossRef]
- Khozhukhar, N.; Spadafora, D.; Rodriguez, Y.; Alexeyev, M. Elimination of Mitochondrial DNA from Mammalian Cells. Curr. Protoc. Cell Biol. 2018, 78, 20.11.1–20.11.14. [Google Scholar] [CrossRef] [PubMed]
- Matagne, R.F.; Michelwolwertz, M.R.; Munaut, C.; Duyckaerts, C.; Sluse, F. Induction and characterization of mitochondrial-dna mutants in Chlamydomonas reinhardtii. J. Cell Biol. 1989, 108, 1221–1226. [Google Scholar] [CrossRef] [PubMed]
- Umbach, A.L.; Zarkovic, J.; Yu, J.; Ruckle, M.E.; McIntosh, L.; Hock, J.J.; Bingham, S.; White, S.J.; George, R.M.; Subbaiah, C.C.; et al. Comparison of Intact Arabidopsis thaliana Leaf Transcript Profiles during Treatment with Inhibitors of Mitochondrial Electron Transport and TCA Cycle. PLoS ONE 2012, 7, e044339. [Google Scholar] [CrossRef]
- Mazorra Morales, L.M.; Cosme Silva, G.M.; Santana, D.B.; Pireda, S.F.; Dorighetto Cogo, A.J.; Heringer, A.S.; de Oliveira, T.d.R.; Reis, R.S.; dos Santos Prado, L.A.; de Oliveira, A.V.; et al. Mitochondrial dysfunction associated with ascorbate synthesis in plants. Plant Physiol. Biochem. 2022, 185, 55–68. [Google Scholar] [CrossRef] [PubMed]
- Ding, C.-Q.; Ng, S.; Wang, L.; Wang, Y.-C.; Li, N.-N.; Hao, X.-Y.; Zeng, J.-M.; Wang, X.-C.; Yang, Y.-J. Genome-wide identification and characterization of Alternative oxidase genes and their response under abiotic stresses in Camellia sinensis (L.) O. Kuntze. Planta 2018, 248, 1231–1247. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Geng, X.; Bi, X.; Li, R.; Chen, Y.; Lu, C. Genome-wide identification of AOX family genes in Moso bamboo and functional analysis of PeAOX1b_2 in drought and salinity stress tolerance. Plant Cell Rep. 2022, 41, 2321–2339. [Google Scholar] [CrossRef] [PubMed]
- Brew-Appiah, R.A.T.; York, Z.B.; Krishnan, V.; Roalson, E.H.; Sanguinet, K.A. Genome-wide identification and analysis of the ALTERNATIVE OXIDASE gene family in diploid and hexaploid wheat. PLoS ONE 2018, 13, e0201439. [Google Scholar] [CrossRef]
- Polidoros, A.N.; Mylona, P.V.; Arnholdt-Schmitt, B. Aox gene structure, transcript variation and expression in plants. Physiol. Plant. 2009, 137, 342–353. [Google Scholar] [CrossRef]
- Costa, J.H.; McDonald, A.E.; Arnholdt-Schmitt, B.; de Melo, D.F. A classification scheme for alternative oxidases reveals the taxonomic distribution and evolutionary history of the enzyme in angiosperms. Mitochondrion 2014, 19, 172–183. [Google Scholar] [CrossRef]
- Liu, C.; Wright, B.; Allen-Vercoe, E.; Gu, H.; Beiko, R. Phylogenetic Clustering of Genes Reveals Shared Evolutionary Trajectories and Putative Gene Functions. Genome Biol. Evol. 2018, 10, 2255–2265. [Google Scholar] [CrossRef]
- Wang, W.; Xia, M.; Chen, J.; Deng, F.; Yuan, R.; Zhang, X.; Shen, F. Genome-wide analysis of superoxide dismutase gene family in Gossypium raimondii and G. arboreum. Plant Gene 2016, 6, 18–29. [Google Scholar] [CrossRef]
- Wang, B.; Zhang, F.; Hu, J.; Gao, X.; Bian, P.; Liu, Y.; Wang, G. Cre-miR914-regulated RPL18 is involved with UV-B adaptation in Chlamydomonas reinhardtii. J. Plant Physiol. 2019, 232, 151–159. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Name | Sequence (5′-3′) | Length |
---|---|---|---|
AOX1 | 1-F 1-R | ATGCTTCAGACCGCACCTATG GCGGAACCGAAGCTATGGAG | 21 20 |
AOX2 | 2-F 2-R | CCTTTCGCTGCACTCCCA ACACAAGCCCTGACATGCTG | 18 20 |
AOX3 | 3-F 3-R | GATGAAGAGTGCAGCGCATTT TTGAAGTTGTCCCAGCCCAG | 21 20 |
AOX4 | 4-F 4-R | GGCCGTGTTCTACTACTGGG CCACCCGTTGCATGAAGTTG | 20 20 |
tubulin | 5-F 5-R | CTCGCTTCGCTTTGACGGTG CGTGGTACGCCTTCTCGGC | 20 19 |
rrnL6 | 6-F 6-R | ACAATTACGCTGAAAACAGTACCA TCACTGTTTGTTATGCAAAACCTT | 24 24 |
nad5 | 7-F 7-R | GCTGGCAGAATAAACGTTAAGCAA TGGTTTGCTAATGTGGGGTGTCTTG | 24 25 |
cox1 | 8-F 8-R | CAGCCCTAGCTTTGTTGCTA TAGTGGTGGATAAGCGGTCC | 20 20 |
CLPD24 | 9-F 9-R | TGTTTCTCCTTGTTCCACCTCTG CCGGGTTGACGTCTGTCTTG | 23 20 |
Gene Number | Phytozome Identifier | Chromosome Localization (bp) | PSL (aa) | MW (kDa) | pI | Hydrophilicity | II | SCL |
---|---|---|---|---|---|---|---|---|
CrAOX1 | Cre09.g395950 | Chr.9: 2124774–2129058 | 360 | 38.35496 | 8.76 | −0.013 | 43.52 | Mitochondrial |
CrAOX2 | Cre03.g169550 | Chr.3: 3777960–3782234 | 346 | 37.48834 | 9.30 | 0.027 | 51.17 | Mitochondrial |
CrAOX3 | Cre03.g172500 | Chr.3: 4108250–4112716 | 471 | 53.82027 | 5.76 | −0.352 | 49.47 | Mitochondrial |
CrAOX4 | Cre07.g074050 | Chr.7: 5429513–5434922 | 416 | 46.77041 | 6.47 | −0.176 | 42.59 | Mitochondrial |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khan, A.; Jihong, Z.; Luo, H.; Raza, A.; Hussain, Q.; Hu, Z. Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii. Processes 2024, 12, 1654. https://doi.org/10.3390/pr12081654
Khan A, Jihong Z, Luo H, Raza A, Hussain Q, Hu Z. Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii. Processes. 2024; 12(8):1654. https://doi.org/10.3390/pr12081654
Chicago/Turabian StyleKhan, Asadullah, Zuo Jihong, Haolin Luo, Ali Raza, Quaid Hussain, and Zhangli Hu. 2024. "Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii" Processes 12, no. 8: 1654. https://doi.org/10.3390/pr12081654