Next Article in Journal
Predicting the Impact of Climate Change on the Future Distribution of Paederus fuscipes Curtis, 1826, in China Based on the MaxEnt Model
Next Article in Special Issue
Lethal, Sublethal, and Offspring Effects of Fluralaner and Dinotefuran on Three Species of Bactrocera Fruit Flies
Previous Article in Journal
Newly Woody Artificial Diet Reveals Antibacterial Activity of Hemolymph in Larvae of Zophobas atratus (Fabricius, 1775) (Coleoptera: Tenebrionidae)
Previous Article in Special Issue
Influence of Ethanol Grade on Captures of Ambrosia Beetles in Tree Fruit Orchards, Ornamental Nurseries, and Lumber Yards
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 6
10.3390/insects15060436
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly

by
Jingjing Li
,
Chaoqiang Zhu
,
Yunhao Xu
,
Haifang He
,
Chenchen Zhao
and
Fengming Yan
*
College of Plant Protection, Henan Agricultural University, Zhengzhou 450046, China
*
Author to whom correspondence should be addressed.
Insects 2024, 15(6), 436; https://doi.org/10.3390/insects15060436
Submission received: 8 May 2024 / Revised: 31 May 2024 / Accepted: 6 June 2024 / Published: 8 June 2024
(This article belongs to the Special Issue Monitoring and Management of Invasive Insect Pests)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

As an invasive pest, whitefly causes great losses in agricultural production, and resistance increases in whitefly to chemical insecticides are an important problem in plant protection. Our study revealed that imidacloprid stress inhibits the expression of AKH, thereby increasing ROS and the expression levels of the resistance gene CYP6CM1 and upstream regulatory factors in Bemisia tabaci. AKH silencing by RNA interference affected the resistance of whiteflies to imidacloprid. These results provide insight into the resistance mechanism in whitefly.

Abstract

Synthetic insecticides used to control Bemisia tabaci include organophosphorus, pyrethroids, insect growth regulators, nicotinoids, and neonicotinoids. Among these, neonicotinoids have been used continuously, which has led to the emergence of high-level resistance to this class of chemical insecticides in the whitefly, making whitefly management difficult. The adipokinetic hormone gene (AKH) and reactive oxygen species (ROS) play roles in the development of insect resistance. Therefore, the roles of AKH and ROS in imidacloprid resistance in Bemisia tabaci Mediterranean (MED; formerly biotype Q) were evaluated in this study. The expression level of AKH in resistant B. tabaci MED was significantly lower than that in sensitive B. tabaci (MED) (p < 0.05). AKH expression showed a decreasing trend. After AKH silencing by RNAi, we found that ROS levels as well as the expression levels of the resistance gene CYP6CM1 and its upstream regulatory factors CREB, ERK, and P38 increased significantly (p < 0.05); additionally, whitefly resistance to imidacloprid increased and mortality decreased (p < 0.001). These results suggest that AKH regulates the expression of resistance genes via ROS in Bemisia tabaci.

1. Introduction

Bemisia tabaci is one of the most important vegetable and ornamental crop pests in the world [1]. It is characterized by a high reproductive capacity and wide host range, with more than 1000 vegetable crops and ornamental plants identified as hosts [2]. Therefore, it is found on all continents except Antarctica [3].
Neonicotinoid insecticides have been used to control whiteflies in the past few decades owing to their low toxicity to mammals [4,5]. This has led to the development of widespread resistance of whiteflies. Imidacloprid, a first-generation neonicotinoid insecticide, is still widely used. Extensive research has focused on the mechanism underlying resistance to imidacloprid [6,7,8], for example, the trans-regulation of CYP6CM1, a cytochrome P450 that confers resistance to neonicotinoid insecticides in the whitefly Bemisia tabaci, by the mitogen-activated protein kinase (MAPK)-directed activation of the transcription factor cAMP-response element binding protein (CREB) [9]. In addition, recent studies have shown that miR-1517 may be involved in regulating the expression of CYP6CM1 [10].
One of these hormones, the adipokinetic hormone (Akh), is secreted by the corpora cardiaca (CC) and elicits both carbohydrate and lipid mobilization from the fat body (trehalose from glycogen and diacylglycerol from triacylglycerol, respectively), acting as a functional homolog of glucagon [11,12]. This hormone signals to the G-protein coupled receptor encoded by the Akh receptor gene AkhR to elevate hemolymph lipid and/or trehalose titers and thus redirects energy to the sites and processes where it is required [13,14].
Insecticides can induce a strong oxidative stress response in insects, which is accompanied by the production of a large number of ROS. Excessive ROS will damage insect cells and even lead to insect death [15,16]. The role of Akh in regulating antioxidant systems involved in insect resistance to insecticides has been reported [17]. Velki et al. found that the Akh mature peptide levels in the hemolymph of the firebug Pyrrhocoris apterus increased significantly after insecticide treatment [18]. AKH regulates the expression of imidacloprid resistance genes by regulating ROS levels [19].
In this study, imidacloprid resistance levels in Bemisia tabaci MED were studied. In particular, the molecular mechanism underlying imidacloprid resistance in B. tabaci MED was investigated using resistant and sensitive strains, with a focus on the roles of AKH and ROS. To evaluate the role of AKH in resistance, its response to imidacloprid as well as changes in resistance after AKH silencing by RNA interference (RNAi) were evaluated. To evaluate the role of ROS in resistance and changes in ROS in response to imidacloprid, as well as changes in imidacloprid resistance after ROS elimination, were evaluated. Furthermore, the effect of AKH on ROS was studied by silencing AKH. The results of this study provide insight into the molecular mechanism underlying the imidacloprid resistance of B. tabaci MED from the perspectives of ROS and AKH and provide a new target for the development of insecticides.

2. Materials and Methods

2.1. Insect Rearing

A colony of the Bemisia tabaci Mediterranean (MED; formerly biotype Q) cryptic species was maintained on cucumber plants, which was not exposed to any insecticide during the culture period and served as a sensitive population in this experiment. Resistant whiteflies were collected from the greenhouse of the Plant Protection Institute of Hunan Academy of Agricultural Sciences (Changsha, Hunan, China, 28°12′ N, 112°59′ E). B. tabaci MED was a multi-generation population reared in the presence of imidacloprid (as the resistant population). The culture conditions were 16 h light/8 h dark, 26 ± 0.5 °C, and 75 ± 0.5% humidity.

2.2. Bioassay of Insecticide Resistance

The LC50 values and drug resistance of whiteflies after treatment with imidacloprid (pesticide registration no.: PD20131915; product standard no.: GB/T28143-2011; dosage form: emulsifiable oil; imidacloprid 5%, Bayer Crop Science (China), Hangzhou, China) were determined using the agar disk diffusion method. The test device was improved by using a small box with a lid that was ventilated with gauze mesh, leaving a small opening for insects [20]. An appropriate amount of 1% agar was added to the bottom of the lid. The plate was immersed in diluted imidacloprid at various concentrations for 10 s and then placed on the agar after drying naturally. In total, 20 individuals were placed in each small box and the experiment was repeated 10 times. B. tabaci MED death was quantified after 48 h, and water was used as the control.

2.3. RNA Extraction, cDNA Synthesis, and Real-Time Quantitative Polymerase Chain Reaction

Total RNA was extracted using the TaKaRa RNAiso Plus Kit (Cat# 9109, Lot# AL42064A, TaKaRa, Beijing, China), according to the manufacturer’s instructions. Then, cDNA was synthesized using the TaKaRa Reverse Transcription Kit (Cat# RR047A, Lot# AL21113A, TaKaRa, Beijing, China). To detect the expression of the resistance gene CYP6CM1, quantitative real-time PCR (qRT-PCR) was performed using TaKaRa TB GreenR Premix Ex TaqTM II (Cat# RR820A, Lot# AJF2612A, TaKaRa, Beijing, China), according to the manufacturer’s instructions.

2.4. RNAi

Cloning and ligation of the adipokinin gene fragment were performed using the pMDTM18-T Vector Cloning Kit (TaKaRa, Cat#6011, Lot#AK91485A, TaKaRa, Beijing, China). After sequencing, double-stranded RNA (dsAKH) was cloned. dsGFP was synthesized using the T7 High Yield RNA Synthesis Kit (YESEN, Code No: 10623ES50, YESEN, Shanghai, China), following the kit instructions. The membrane feeding method (refer to Li et al. 2015) [21] was used to feed dsAKH and dsGFP to sensitive B. tabaci MED. The feeding concentration was 500 ng/μL, determined based on a preliminary experiment. After feeding for 48 h, the silencing efficiency and the change in the expression level of the resistance gene CYP6CM1 were analyzed by qRT-PCR with sequence-specific primers (Table 1). dsGFP was used for comparison.

2.5. Determination of ROS Contents in B. tabaci MED

The ROS content in B. tabaci MED was measured after treatment and grinding with 250 μL of phosphate buffer (pH 7.4). After full grinding, samples were centrifuged at 13,680× g for 5 min, 190 μL of the supernatant was transferred to a 96-well plate, and 10 μL of DCFH-DA (Solarbio, Cat#CA1410, Solarbio, Beijing, China) (10 μmol/L) was added and mixed well. Samples were incubated in a dark room for 1 h [22]. Fluorescence was detected at an excitation wavelength of 488 nm and emission wavelength of 525 nm. The same volume of phosphate buffer and DCFH-DA-adjusted fluorescence value were used as the blank control, and dsGFP treatment was used as the control.

2.6. Scavenging Effect of N-acetylcysteine on ROS

The scavenging effect of N-acetylcysteine (NAC) on ROS in insects was evaluated following a previously reported method [19]. In particular, a NAC solution of 1 mol/L was used based on preliminary analyses of concentrations up to 10 mol/L. The volume of liquid feed used was 200 μL, and pure liquid feed was used as the control.

2.7. Statistical Analysis

IBM SPSS Statistics 20.0 software (IBM Corp., Armonk, NY, USA) was used for the numerical analyses of all experimental data [23], and independent samples t-tests were used for comparisons between groups [24]. The quantitative fluorescence data were analyzed using the 2−ΔΔCt method. The LC50 of imidacloprid was calculated using the SPSS Probit function [25], and then the regression model was fitted and R2 was calculated. Plots were generated using GraphPad Prism 8.0.2 [26]. The experimental results are expressed as the mean ± standard error.

3. Results

3.1. Bioassay of Imidacloprid Sensitivity of B. tabaci

We first estimated imidacloprid LC50 values in B. tabaci MED. The LC50 of the sensitive B. tabaci MED was 51.820 mg/L, and the LC50 of the resistant B. tabaci MED was 535.932 mg/L, with a resistance ratio of 10.34. The resistant B. tabaci MED was moderately resistant (Table 2).

3.2. The Role of AKH in the Response of B. tabaci MED to Imidacloprid

We compared adipokinin gene expression levels in resistant and sensitive whiteflies. We also evaluated changes in adipokinin in sensitive whiteflies after treatment with imidacloprid. The expression level of AKH in resistant B. tabaci MED was significantly lower than that in sensitive B. tabaci MED (p < 0.05) (Figure 1A). After treatment with 50 mg/L imidacloprid, the relative expression level of AKH decreased but did not differ significantly from that of the control. Under treatment with 100 mg/L, relative AKH expression increased but did not differ significantly from that of the control. After treatment with 150 mg/L imidacloprid, the relative expression of AKH decreased but was not significantly different from that in the control (Figure 1B).

3.3. Effect of AKH on the Expression of CYP6CM1 and Its Upstream Regulatory Factors

After preliminary experimental data processing and a literature review, we predicted that the lipid-motility hormone is related to imidacloprid resistance in B. tabaci MED. Therefore, we used RNAi technology to disrupt AKH expression and evaluated the effects on CYP6CM1 and the three upstream regulatory factors. After feeding double-stranded RNA at a concentration of 500 ng/μL for 48 h by the membrane feeding technique, the relative expression of AKH decreased significantly (p < 0.0001) (Figure 2A) and the expression of the resistance gene CYP6CM1 was significantly higher than that in the control (p < 0.01) (Figure 2B). The expression levels of CREB (p < 0.05) (Figure 2C), ERK (p < 0.05) (Figure 2D), and P38 (Figure 2E) were significantly higher (p < 0.05) in the RNAi group than in the control group, indicating that AKH could have an impact on resistance genes and their signaling pathways (Abbreviations).

3.4. Effect of AKH Silencing on Imidacloprid Sensitivity

Previous analyses indicated that AKH can affect the expression of an imidacloprid resistance gene, which is crucial for the metabolism of imidacloprid. Therefore, we evaluated the imidacloprid sensitivity of B. tabaci fed dsAKH. After 2 days of feeding with dsAKH, the B. tabaci MED was transferred to a bioassay unit and treated with imidacloprid at the LC50 of sensitive B. tabaci MED for 48 h. B. tabaci MED mortality was significantly lower in the treatment group than in the control group (p < 0.001) (Figure 3).

3.5. ROS Response to Imidacloprid

Insects subjected to insecticide stress will produce a large number of ROS, thus reducing the harmful effects of pesticides [27]. Therefore, sensitive B. tabaci MED was treated with imidacloprid to evaluate changes in ROS levels. After treatment with 100 mg/L imidacloprid, the ROS content in B. tabaci in the treatment group was significantly higher than that in the control group (p < 0.05) (Figure 4A). In addition, to further study the role of ROS in resistance, the ROS scavenger NAC was used to treat resistant B. tabaci MED [19]. The results showed that under treatment with 1, 5, and 10 mmol/L NAC, the ROS contents in resistant whiteflies decreased; however, a significant difference was only observed between 10 mmol/L and the control (p < 0.05) (Figure 4B). For subsequent studies of resistance mechanisms, a concentration of 10 mmol/L was optimal.

3.6. Effects of ROS Scavengers on CYP6CM1 and Its Upstream Regulators

ROS levels changed in response to stimulation with imidacloprid, and ROS scavengers significantly reduced ROS levels in resistant B. tabaci MED. Therefore, we further evaluated whether ROS could affect the expression of resistance genes. After treatment with 10 mmol/L NAC, the expression level of CYP6CM1 in resistant B. tabaci MED was significantly lower than that in the control group (p < 0.05) (Figure 5A). The expression levels of ERK, P38, and CREB were significantly lower than those in the control (all p < 0.05) (Figure 5B–D). These results indicate that ROS levels influence the expression of resistance genes and related regulatory factors.

3.7. Effect of an ROS Scavenger on Imidacloprid Sensitivity

The previous analyses showed that ROS can affect the expression of the resistance gene CYP6CM1, which is crucial for the metabolism of imidacloprid. Therefore, a bioassay of imidacloprid sensitivity was performed after whiteflies were fed NAC. After 2 days of NAC feeding, whiteflies were treated with imidacloprid at the LC50 dose for 48 h. B. tabaci MED mortality was significantly lower in the treatment group than in the control group (p < 0.001) (Figure 6).

3.8. Effect of AKH on ROS Levels in B. tabaci MED

It has been reported that AKH exerts an antioxidant effect in insects [17]. We found that AKH and ROS can affect the expression of resistance genes. Therefore, we speculated that AKH may regulate the expression of resistance genes by influencing ROS. To evaluate this prediction, levels of ROS in whiteflies were measured after AKH was silenced by RNAi. The results showed that the ROS content in the treatment group was significantly higher than that in the control group (p < 0.05) (Figure 7), indicating that AKH could affect ROS in B. tabaci MED.

4. Discussion

As a major pest worldwide, B. tabaci seriously endangers food security [28,29]. To control B. tabaci MED, a large number of chemical pesticides (organophosphorus, pyrethroids, insect growth regulators, nicotinoids, and neonicotinoids.) are used, causing environmental pollution and posing a threat to human health. Pesticide residues are becoming more and more serious; at the same time, whitefly resistance is increasing.
In this study, we found that the AKH gene of B. tabaci MED contributes to the regulation of resistance to imidacloprid. In particular, AKH expression levels were lower in resistant than in sensitive whiteflies After treatment with 50, 100, and 150 mg/L imidacloprid in sensitive B. tabaci MED, AKH expression exhibited variable levels. This trend was consistent with the results of Tang et al., showing that the AKH expression level in the brown planthopper (Nilaparvata lugens) is low in resistant strains and decreases after treatment with imidacloprid. However, in this study, the AKH expression level increased after treatment with 100 mg/L imidacloprid. It is possible that excess ROS activated the antioxidant system of whiteflies, which has been reported previously [19].
Imidacloprid resistance in B. tabaci is mainly caused by the P450 family gene CYP6CM1 [30]. Consistent with our expectations, we found that CYP6CM1 expression in B. tabaci was significantly increased. Furthermore, CYP6CM1 is regulated by the MAPK pathway, and the expression levels of the three regulatory factors ERK, P38, and CREB also increased significantly [31]. This suggests that AKH may act as a negative regulator of resistance genes. However, the increased levels of resistance genes do not necessarily mean that B. tabaci MED tolerance to imidacloprid increased. Therefore, we tested the sensitivity of B. tabaci MED to insecticides after silencing AKH, revealing that the sensitivity of B. tabaci MED to insecticides decreased. This suggests that AKH can indeed influence the expression of CYP6CM1 and thus the resistance of B. tabaci MED to imidacloprid.
We found that AKH exerts a negative regulatory effect on CYP6CM1 in B. tabaci MED. However, the pathways through which AKH exerts these effects are still unclear. We speculate that AKH exerts its effects through its antioxidant stress function [32,33]. Therefore, we treated the resistant B. tabaci MED with the antioxidant NAC and found that the expression levels of the resistance gene CYP6CM1 and the upstream regulatory factors ERK, P38, and CREB decreased. Moreover, the sensitivity of B. tabaci MED to imidacloprid increased (Scheme 1). These results are consistent with those of Tang et al. (2020), who showed that the resistance of the brown planthopper to imidacloprid is mediated by ROS. In another study on the brown planthopper, the expression levels of Akh and AkhR increased significantly under stimulation with chlorpyrifos. Interference with the expression of Akh or AkhR significantly reduced the activity of carboxylesterase and the resistance of the brown planthopper to chlorpyrifos [34]. This suggests that the role of AKH in insecticide resistance depends on the type of insecticide and the degree of insecticide stimulation [17,35].
In conclusion, this study demonstrated that exposure to imidacloprid stimulation decreased AKH expression, inhibited antioxidant activity mediated by this gene, and increased ROS in B. tabaci MED, thereby activating the MAPK signaling pathway and increasing the expression of the resistance gene CYP6CM1 [31].

Author Contributions

Conceptualization, J.L. and F.Y.; Data curation, C.Z. (Chaoqiang Zhu); Formal analysis, J.L.; Funding acquisition, J.L.; Investigation, C.Z. (Chenchen Zhao); Methodology, C.Z. (Chaoqiang Zhu); Project administration, J.L. and F.Y.; Software, C.Z. (Chaoqiang Zhu); Supervision, J.L., C.Z. (Chenchen Zhao) and F.Y.; Validation, Y.X. and H.H.; Visualization, Y.X. and H.H.; Writing—original draft, J.L. and C.Z. (Chaoqiang Zhu); Writing—review and editing, J.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Natural Science Foundation of China (Project Nos. 31901886, 31871973).

Data Availability Statement

Data are available on request to the authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

AKHAdipokinetic Hormone
CREBcAMP-response element binding protein
ERKextracellular signal-regulated kinases
P38p38 mitogen activited protein kinase
ROSreactive oxygen species

References

  1. Polston, J.E.; De Barro, P.; Boykin, L.M. Transmission specificities of plant viruses with the newly identified species of the Bemisia tabaci species complex. Pest Manag. Sci. 2014, 70, 1547–1552. [Google Scholar] [CrossRef] [PubMed]
  2. EFSA Panel on Plant Health (PLH). Scientific opinion on the risks to plant health posed by Bemisia tabaci species complex and viruses it transmits for the EU territory. EFSA J. 2013, 11, 3162. [Google Scholar]
  3. Yan, F.M.; Bai, R.E. Whitefly Fauna of China; Henan Science and Technology Press: Zhengzhou, China, 2017. [Google Scholar]
  4. Tomizawa, M.; Casida, J.E. Neonicotinoid insecticide toxicology: Mechanisms of selective action. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 247–268. [Google Scholar] [CrossRef] [PubMed]
  5. Jeschke, P.; Nauen, R.; Beck, M.E. Nicotinic acetylcholine receptor agonists: A milestone for modern crop protection. Angew. Chem. (Int. Ed. Engl.) 2013, 52, 9464–9485. [Google Scholar] [CrossRef] [PubMed]
  6. Yang, X.; Xie, W.; Wang, S.L.; Wu, Q.J.; Pan, H.P.; Li, R.M.; Yang, N.N.; Liu, B.M.; Xu, B.Y.; Zhou, X.; et al. Two cytochrome P450 genes are involved in imidacloprid resistance in field populations of the whitefly, Bemisia tabaci, in China. Pestic. Biochem. Physiol. 2013, 107, 343–350. [Google Scholar] [CrossRef] [PubMed]
  7. Xue, H.; Fu, B.; Huang, M.; He, C.; Liang, J.; Yang, J.; Wei, X.; Liu, S.; Du, T.; Ji, Y.; et al. CYP6DW3 metabolizes imidacloprid to imidacloprid-urea in whitefly (Bemisia tabaci). J. Agric. Food Chem. 2023, 71, 2333–2343. [Google Scholar] [CrossRef] [PubMed]
  8. Wei, X.; Hu, J.; Yang, J.; Yin, C.; Du, T.; Huang, M.; Fu, B.; Gong, P.; Liang, J.; Liu, S.; et al. Cytochrome P450 CYP6DB3 was involved in thiamethoxam and imidacloprid resistance in Bemisia tabaci Q (Hemiptera: Aleyrodidae). Pestic. Biochem. Physiol. 2023, 194, 105468. [Google Scholar] [CrossRef] [PubMed]
  9. Yang, X.; Deng, S.; Wei, X.; Yang, J.; Zhao, Q.; Yin, C.; Du, T.; Guo, Z.; Xia, J.; Yang, Z.; et al. MAPK-directed activation of the whitefly transcription factor CREB leads to P450-mediated imidacloprid resistance. Proc. Natl. Acad. Sci. USA 2020, 117, 10246–10253. [Google Scholar] [CrossRef] [PubMed]
  10. Gong, P.P.; Wei, X.G.; Liu, S.N.; Yang, J.; Fu, B.L.; Liang, J.J.; Huang, M.J.; Du, T.H.; Yin, C.; Ji, Y.; et al. Novel_miR-1517 mediates CYP6CM1 to regulate imidacloprid resistance in Bemisia tabaci (Hemiptera: Aleyrodidae). Pestic. Biochem. Physiol. 2023, 194, 105469. [Google Scholar] [CrossRef]
  11. Van der Horst, D.J.; Van Marrewijk, W.J.; Diederen, J.H. Adipokinetic hormones of insect: Release, signal transduction, and responses. Int. Rev. Cytol. 2001, 211, 179–240. [Google Scholar]
  12. Van der Horst, D.J. Insect adipokinetic hormones: Release and integration of fight energy metabolism. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2003, 136, 217–226. [Google Scholar] [CrossRef] [PubMed]
  13. Grönke, S.; Müller, G.; Hirsch, J.; Fellert, S.; Andreou, A.; Haase, T.; Jäckle, H.; Kühnlein, R.P. Dual lipolytic control of body fat storage and mobilization in Drosophila. PLoS Biol. 2007, 5, e137. [Google Scholar] [CrossRef] [PubMed]
  14. Lee, G.; Park, J.H. Hemolymph sugar homeostasis and starvation-induced hyperactivity afected by genetic manipulations of the adipokinetic hormone-encoding gene in Drosophila melanogaster. Genetics 2004, 167, 311–323. [Google Scholar] [CrossRef] [PubMed]
  15. Ledirac, N.; Antherieu, S.; d’Uby, A.D.; Caron, J.C.; Rahmani, R. Effects of organochlorine insecticides on MAP kinase pathways in human HaCaT keratinocytes: Key role of reactive oxygen species. Toxicol. Sci. Off. J. Soc. Toxicol. 2005, 86, 444–452. [Google Scholar] [CrossRef] [PubMed]
  16. Martelli, F.; Zuo, Z.; Wang, J.; Wong, C.O.; Karagas, N.E.; Roessner, U.; Rupasinghe, T.; Venkatachalam, K.; Perry, T.; Bellen, H.J.; et al. Low doses of the neonicotinoid insecticide imidacloprid induce ROS triggering neurological and metabolic impairments in Drosophila. Proc. Natl. Acad. Sci. USA 2020, 117, 25840–25850. [Google Scholar] [CrossRef] [PubMed]
  17. Kodrík, D.; Bednářová, A.; Zemanová, M.; Krishnan, N. Hormonal regulation of response to oxidative stress in Insects-An Update. Int. J. Mol. Sci. 2015, 16, 25788–25816. [Google Scholar] [CrossRef] [PubMed]
  18. Velki, M.; Kodrík, D.; Večeřa, J.; Hackenberger, B.K.; Socha, R. Oxidative stress elicited by insecticides: A role for the adipokinetic hormone. Gen. Comp. Endocrinol. 2011, 172, 77–84. [Google Scholar] [CrossRef] [PubMed]
  19. Tang, B.; Cheng, Y.; Li, Y.; Li, W.; Ma, Y.; Zhou, Q.; Lu, K. Adipokinetic hormone regulates cytochrome P450-mediated imidacloprid resistance in the brown planthopper, Nilaparvata lugens. Chemosphere 2020, 259, 127490. [Google Scholar] [CrossRef] [PubMed]
  20. Sparks, T.C.; Riley, D.G.; Simmons, A.M.; Guo, L. Comparison of toxicological bioassays for whiteflies. Insects 2020, 11, 789. [Google Scholar] [CrossRef]
  21. Li, J.; Li, X.; Bai, R.; Shi, Y.; Tang, Q.; An, S.; Song, Q.; Yan, F. RNA interference of the P450 CYP6CM1 gene has different efficacy in B and Q biotypes of Bemisia tabaci. Pest Manag. Sci. 2015, 71, 1175–1181. [Google Scholar] [CrossRef]
  22. Liang, P.; Ning, J.; Wang, W.; Zhu, P.; Gui, L.; Xie, W.; Zhang, Y. Catalase promotes whitefly adaptation to high temperature by eliminating reactive oxygen species. Insect Sci. 2023, 30, 1293–1308. [Google Scholar] [CrossRef] [PubMed]
  23. Lu, S.H.; Li, J.J.; Bai, R.E.; Yan, F.M. EPG-recorded feeding behaviors reveal adaptability and competitiveness in two species of Bemisia tabaci (Hemiptera: Aleyrodidae). J. Insect Behav. 2021, 34, 26–40. [Google Scholar] [CrossRef]
  24. He, H.F.; Zhao, C.C.; Zhu, C.Q.; Yan, W.L.; Yan, M.H.; Zhang, Z.L.; Liu, J.L.; Shi, B.Z.; Bai, R.E.; Li, J.J.; et al. Discovery of novel whitefly vector proteins that interact with a virus capsid component mediating virion retention and transmission. Int. J. Biol. Macromol. 2022, 226, 1154–1165. [Google Scholar] [CrossRef] [PubMed]
  25. Backus, E.A.; Bennett, W.H. The AC–DC Correlation Monitor: New EPG design with flexible input resistors to detect both R and emf components for any piercing–sucking hemipteran. J. Insect Physiol. 2009, 55, 869–884. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, J.S.; Zhang, Z.; Zhang, D.Y.; Zhang, Z.H.; Liu, Y.; Shi, X.B.; Zhang, Y.J. Transmission characteristics of Tomato chlorosis virus on Capsicum annuum by adult Bemisia tabaci MEAM1 and MED (Hemiptera: Aleryodidae). Acta Entomol. Sin. 2022, 65, 1452–1458. [Google Scholar]
  27. Lu, K.; Cheng, Y.; Li, W.; Ni, H.; Chen, X.; Li, Y.; Tang, B.; Li, Y.; Chen, D.; Zeng, R.; et al. Copper-induced H2O2 accumulation confers larval tolerance to xanthotoxin by modulating CYP6B50 expression in Spodoptera litura. Pestic. Biochem. Physiol. 2019, 159, 118–126. [Google Scholar] [CrossRef]
  28. Gilbertson, R.L.; Batuman, O.; Webster, C.G.; Adkins, S. Role of the Insect Supervectors Bemisia tabaci and Frankliniella occidentalis in the emergence and global spread of plant viruses. Annu. Rev. Virol. 2015, 2, 67–93. [Google Scholar] [CrossRef] [PubMed]
  29. Mansoor, S.; Zafar, Y.; Briddon, R.W. Geminivirus disease complexes: The threat is spreading. Trends Plant Sci. 2006, 11, 209–212. [Google Scholar] [CrossRef]
  30. Karunker, I.; Benting, J.; Lueke, B.; Ponge, T.; Nauen, R.; Roditakis, E.; Vontas, J.; Gorman, K.; Denholm, I.; Morin, S. Over-expression of cytochrome P450 CYP6CM1 is associated with high resistance to imidacloprid in the B and Q biotypes of Bemisia tabaci (Hemiptera: Aleyrodidae). Insect Biochem. Mol. Biol. 2008, 38, 634–644. [Google Scholar] [CrossRef]
  31. Yan, M.; He, H.; Zhang, Z.; Zhang, B.; Zhu, C.; Yan, W.; Zhao, C.; Li, J.; Yan, F. Molecular basis of mutual benefits between Cucurbit chlorotic yellows virus (CCYV) transmission and imidacloprid resistance in Bemisia tabaci. J. Pest Sci. 2022, 96, 489–497. [Google Scholar] [CrossRef]
  32. Caers, J.; Verlinden, H.; Zels, S.; Vandersmissen, H.P.; Vuerinckx, K.; Schoofs, L. More than two decades of research on insect neuropeptide GPCRs: An overview. Front. Endocrinol. 2012, 3, 151. [Google Scholar] [CrossRef] [PubMed]
  33. Lu, K.; Zhang, X.; Chen, X.; Li, Y.; Li, W.; Cheng, Y.; Zhou, J.; You, K.; Zhou, Q. Adipokinetic hormone receptor mediates lipid mobilization to regulate starvation resistance in the Brown Planthopper, Nilaparvata lugens. Front. Physiol. 2018, 9, 1730. [Google Scholar] [CrossRef] [PubMed]
  34. Tang, B.; Cheng, Y.; Li, Y.; Li, W.; Ma, Y.; Zhou, Q.; Lu, K. Adipokinetic hormone enhances CarE-mediated chlorpyrifos resistance in the brown planthopper, Nilaparvata Lugens. Insect Mol. Biol. 2020, 29, 511–522. [Google Scholar] [CrossRef]
  35. Diederen, J.H.; Oudejans, R.C.; Harthoorn, L.F.; Van der Horst, D.J. Cell biology of the adipokinetic hormone-producing neurosecretory cells in the locust corpus cardiacum. Microsc. Res. Tech. 2002, 56, 227–236. [Google Scholar] [CrossRef] [PubMed]
Insects 15 00436 g001
Figure 1. AKH expression in sensitive and resistant strains and in response to imidacloprid. Note: (A) Comparison of AKH expression levels between resistant and sensitive Bemisia tabaci, R indicates resistant B. tabaci, and S indicates sensitive B. tabaci. (B) Effect of imidacloprid treatment on the expression level of AKH in sensitive B. tabaci; the horizontal axis indicates the concentration of imidacloprid, CK represents the control (water). Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05, ns indicates insignificant difference).
Figure 1. AKH expression in sensitive and resistant strains and in response to imidacloprid. Note: (A) Comparison of AKH expression levels between resistant and sensitive Bemisia tabaci, R indicates resistant B. tabaci, and S indicates sensitive B. tabaci. (B) Effect of imidacloprid treatment on the expression level of AKH in sensitive B. tabaci; the horizontal axis indicates the concentration of imidacloprid, CK represents the control (water). Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05, ns indicates insignificant difference).
Insects 15 00436 g001
Insects 15 00436 g002
Figure 2. Effect of RNAi silencing targeting AKH on the expression of CYP6CM1 and upstream regulatory factors in sensitive Bemisia tabaci MED. Note: (A) Expression level of AKH after feeding with dsAKH; (B) Expression level of CYP6CM1 after feeding with dsAKH; (C) Expression level of CREB after feeding with dsAKH; (D) Expression level of ERK after feeding with dsAKH; (E) Expression level of P38 after feeding with dsAKH. Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05, ** p < 0.01, **** p < 0.0001).
Figure 2. Effect of RNAi silencing targeting AKH on the expression of CYP6CM1 and upstream regulatory factors in sensitive Bemisia tabaci MED. Note: (A) Expression level of AKH after feeding with dsAKH; (B) Expression level of CYP6CM1 after feeding with dsAKH; (C) Expression level of CREB after feeding with dsAKH; (D) Expression level of ERK after feeding with dsAKH; (E) Expression level of P38 after feeding with dsAKH. Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05, ** p < 0.01, **** p < 0.0001).
Insects 15 00436 g002
Insects 15 00436 g003
Figure 3. Effect of RNAi silencing targeting AKH on the sensitivity of Bemisia tabaci MED to imidacloprid. Note: The horizontal axis represents the treatments, and the vertical axis represents the mortality rate of B. tabaci. Groups were compared using an independent samples t-test, with a significance level of 0.05. Data are presented as the mean ± standard error (*** p < 0.001).
Figure 3. Effect of RNAi silencing targeting AKH on the sensitivity of Bemisia tabaci MED to imidacloprid. Note: The horizontal axis represents the treatments, and the vertical axis represents the mortality rate of B. tabaci. Groups were compared using an independent samples t-test, with a significance level of 0.05. Data are presented as the mean ± standard error (*** p < 0.001).
Insects 15 00436 g003
Insects 15 00436 g004
Figure 4. ROS changes in response to imidacloprid. Note: (A) ROS response to imidacloprid, CK represents the control (water), and 100 mg/L imidacloprid was applied in the treatment group; (B) Changes in ROS contents in resistant B. tabaci MED after N-acetylcysteine treatment; CK is the control group (pure liquid feed), and 1, 5, and 10 mmol/L are the concentrations of N-acetylcysteine in the liquid feed. Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05, ns indicates insignificant difference).
Figure 4. ROS changes in response to imidacloprid. Note: (A) ROS response to imidacloprid, CK represents the control (water), and 100 mg/L imidacloprid was applied in the treatment group; (B) Changes in ROS contents in resistant B. tabaci MED after N-acetylcysteine treatment; CK is the control group (pure liquid feed), and 1, 5, and 10 mmol/L are the concentrations of N-acetylcysteine in the liquid feed. Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05, ns indicates insignificant difference).
Insects 15 00436 g004
Insects 15 00436 g005
Figure 5. Effect of ROS scavengers on the expression of CYP6CM1 and upstream regulatory factors in resistant Bemisia tabaci MED. Note: (A) Expression level of CYP6CM1 after treatment with 10 mmol/L N-acetylcysteine; (B) Expression level of CREB after treatment with 10 mmol/L N-acetylcysteine; (C) Expression level of ERK after treatment with 10 mmol/L N-acetylcysteine; (D) Expression level of P38 after treatment with 10 mmol/L N-acetylcysteine. Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05).
Figure 5. Effect of ROS scavengers on the expression of CYP6CM1 and upstream regulatory factors in resistant Bemisia tabaci MED. Note: (A) Expression level of CYP6CM1 after treatment with 10 mmol/L N-acetylcysteine; (B) Expression level of CREB after treatment with 10 mmol/L N-acetylcysteine; (C) Expression level of ERK after treatment with 10 mmol/L N-acetylcysteine; (D) Expression level of P38 after treatment with 10 mmol/L N-acetylcysteine. Groups were compared using independent samples t-tests, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05).
Insects 15 00436 g005
Insects 15 00436 g006
Figure 6. Effect of ROS scavengers on the sensitivity of Bemisia tabaci MED to imidacloprid. Note: The horizontal axis represents different treatments, and the vertical axis represents the mortality rate of B. tabaci MED. Groups were compared using the independent samples t-test, with a significance level of 0.05. Data are presented as the mean ± standard error (*** p < 0.001).
Figure 6. Effect of ROS scavengers on the sensitivity of Bemisia tabaci MED to imidacloprid. Note: The horizontal axis represents different treatments, and the vertical axis represents the mortality rate of B. tabaci MED. Groups were compared using the independent samples t-test, with a significance level of 0.05. Data are presented as the mean ± standard error (*** p < 0.001).
Insects 15 00436 g006
Insects 15 00436 g007
Figure 7. Effect of RNAi silencing AKH on the ROS content in Bemisia tabaci MED. Note: The horizontal axis represents different treatments, and the vertical axis represents the ROS content in B. tabaci. Groups were compared using the independent samples t-test, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05).
Figure 7. Effect of RNAi silencing AKH on the ROS content in Bemisia tabaci MED. Note: The horizontal axis represents different treatments, and the vertical axis represents the ROS content in B. tabaci. Groups were compared using the independent samples t-test, with a significance level of 0.05. Data are presented as the mean ± standard error (* p < 0.05).
Insects 15 00436 g007
Insects 15 00436 sch001
Scheme 1. Proposed mechanism of ROS-mediated AKH resistance to imidacloprid.
Scheme 1. Proposed mechanism of ROS-mediated AKH resistance to imidacloprid.
Insects 15 00436 sch001
Table 1. Primers of related genes for qRT-PCR and RT-PCR.
Table 1. Primers of related genes for qRT-PCR and RT-PCR.
Primer NameLength (bp)Sequence (5′→3′)
CYP6CM1-RT-F24CACTCTTTTGGATTTACTGCACCC
CYP6CM1-RT-R22GTGAAGCTGCCTCTTTAATGGC
CREB-F22ACTCAAGGCAGTCTCCAAACCC
CREB-R22TTTCTGCTCCGCCTAAATCGTT
P38-F21GAACGCCGTCGGAGGATACTT
P38-R21TTGGCTCCTTTGAACACTTGC
ERK-F23AGATTATTTCCTTCAGCCGATGC
ERK-R22GGGCAAGGGCATCTTCAACTAC
Actin-F20TCTTCCAGCCATCCTTCTTG
Actin-R20CGGTGATTTCCTTCTGCATT
dsAKH-F47GATCACTAATACGACTCACTATAGGGCTTGTCGCACAATTCTGGTGT
dsAKH-R50GATCACTAATACGACTCACTATAGGGAACTTCTGAACTTCTCACAATCTG
AKH-RT-F21CTTGTCGCACAATTCTGGTGT
AKH-RT-R20TTGCGCCTCATTCTCGATCA
dsCYP6CM1-F46GATCACTAATACGACTCACTATAGGGACTTTTTCAGGGAGGCCATT
dsCYP6CM1-R46GATCACTAATACGACTCACTATAGGGGTCGCAGCGTCTCATCAATA
Table 2. Virulence equation and resistance multiplicity for Bemisia tabaci.
Table 2. Virulence equation and resistance multiplicity for Bemisia tabaci.
Bemisia tabaciToxic Regression EquationCorrelation CoefficientLC50 (mg/L)Resistance Ratio
ResistibilityY = −4.093 + 1.5X0.961535.93210.34
SensibilityY = −2.699 + 1.574X0.98751.820------
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Zhu, C.; Xu, Y.; He, H.; Zhao, C.; Yan, F. Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly. Insects 2024, 15, 436. https://doi.org/10.3390/insects15060436

AMA Style

Li J, Zhu C, Xu Y, He H, Zhao C, Yan F. Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly. Insects. 2024; 15(6):436. https://doi.org/10.3390/insects15060436

Chicago/Turabian Style

Li, Jingjing, Chaoqiang Zhu, Yunhao Xu, Haifang He, Chenchen Zhao, and Fengming Yan. 2024. "Molecular Mechanism Underlying ROS-Mediated AKH Resistance to Imidacloprid in Whitefly" Insects 15, no. 6: 436. https://doi.org/10.3390/insects15060436

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop