Transcriptome Analyses of Liver Sinusoidal Endothelial Cells Reveal a Consistent List of Candidate Genes Associated with Endothelial Dysfunction and the Fibrosis Progression
Abstract
:1. Introduction
2. Materials and Methods
2.1. Data Sources for the Microarray
2.2. Identification of Differentially Expressed Genes
2.3. Functional Enrichment and GSEA
2.4. Selection and Analysis of PPI Network Core DEGs
2.5. Machine Learning of Lasso and Random Forest
2.6. Liver Fibrosis Mouse Model
2.7. Histology and Immunohistochemistry
2.8. Quantitative Reverse Transcription-PCR (qRT-PCR)
2.9. Statistical Analysis
3. Results
3.1. Identification of Co-DEGs Associated with Endothelial Dysfunction in Liver Fibrosis LSECs
3.2. Functional Enrichment and GSEA of Co-DEGs
3.3. Screening of the Hub Genes via the Protein–Protein Interaction Network
3.4. Correlations of Co-DEGs with the Progression of Human Liver Cirrhosis
3.5. Co-DEGs and Survival Status of Patients with Liver Cirrhosis
3.6. Verification of the Expression of Key DEGs in Mice with Liver Fibrosis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gines, P.; Krag, A.; Abraldes, J.G.; Sola, E.; Fabrellas, N.; Kamath, P.S. Liver cirrhosis. Lancet 2021, 398, 1359–1376. [Google Scholar] [CrossRef] [PubMed]
- Disease, G.B.D.; Injury, I.; Prevalence, C. Global, regional, and national incidence, prevalence, and years lived with disability for 354 diseases and injuries for 195 countries and territories, 1990–2017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet 2018, 392, 1789–1858. [Google Scholar] [CrossRef]
- Collaborators, G.B.D.C. The global, regional, and national burden of cirrhosis by cause in 195 countries and territories, 1990–2017: A systematic analysis for the Global Burden of Disease Study 2017. Lancet Gastroenterol. Hepatol. 2020, 5, 245–266. [Google Scholar] [CrossRef]
- Fleming, K.M.; Aithal, G.P.; Card, T.R.; West, J. All-cause mortality in people with cirrhosis compared with the general population: A population-based cohort study. Liver Int. 2012, 32, 79–84. [Google Scholar] [CrossRef] [PubMed]
- Jalan, R.; D’Amico, G.; Trebicka, J.; Moreau, R.; Angeli, P.; Arroyo, V. New clinical and pathophysiological perspectives defining the trajectory of cirrhosis. J. Hepatol. 2021, 75 (Suppl. S1), S14–S26. [Google Scholar] [CrossRef] [PubMed]
- Poisson, J.; Lemoinne, S.; Boulanger, C.; Durand, F.; Moreau, R.; Valla, D.; Rautou, P.E. Liver sinusoidal endothelial cells: Physiology and role in liver diseases. J. Hepatol. 2017, 66, 212–227. [Google Scholar] [CrossRef] [PubMed]
- Shetty, S.; Lalor, P.F.; Adams, D.H. Liver sinusoidal endothelial cells—Gatekeepers of hepatic immunity. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 555–567. [Google Scholar] [CrossRef] [PubMed]
- Qu, J.; Wang, L.; Li, Y.; Li, X. Liver Sinusoidal Endothelial Cell: An Important Yet Often Overlooked Player in the Liver Fibrosis. Clin. Mol. Hepatol. 2024, 30, 303–325. [Google Scholar] [CrossRef]
- Gracia-Sancho, J.; Caparros, E.; Fernandez-Iglesias, A.; Frances, R. Role of liver sinusoidal endothelial cells in liver diseases. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 411–431. [Google Scholar] [CrossRef]
- DeLeve, L.D. Liver sinusoidal endothelial cells in hepatic fibrosis. Hepatology 2015, 61, 1740–1746. [Google Scholar] [CrossRef]
- Ruan, B.; Duan, J.-L.; Xu, H.; Tao, K.-S.; Han, H.; Dou, G.-R.; Wang, L. Capillarized Liver Sinusoidal Endothelial Cells Undergo Partial Endothelial-Mesenchymal Transition to Actively Deposit Sinusoidal ECM in Liver Fibrosis. Front. Cell Dev. Biol. 2021, 9, 671081. [Google Scholar] [CrossRef]
- Winkler, M.; Staniczek, T.; Kürschner, S.W.; Schmid, C.D.; Schönhaber, H.; Cordero, J.; Kessler, L.; Mathes, A.; Sticht, C.; Neßling, M.; et al. Endothelial GATA4 controls liver fibrosis and regeneration by preventing a pathogenic switch in angiocrine signaling. J. Hepatol. 2021, 74, 380–393. [Google Scholar] [CrossRef]
- Xiong, X.; Wang, Q.; Wang, S.; Zhang, J.; Liu, T.; Guo, L.; Yu, Y.; Lin, J.D. Mapping the molecular signatures of diet-induced NASH and its regulation by the hepatokine Tsukushi. Mol. Metab. 2019, 20, 128–137. [Google Scholar] [CrossRef]
- Wang, M.; Gong, Q.; Zhang, J.; Chen, L.; Zhang, Z.; Lu, L.; Yu, D.; Han, Y.; Zhang, D.; Chen, P.; et al. Characterization of gene expression profiles in HBV-related liver fibrosis patients and identification of ITGBL1 as a key regulator of fibrogenesis. Sci. Rep. 2017, 7, 43446. [Google Scholar] [CrossRef] [PubMed]
- Graupera, I.; Isus, L.; Coll, M.; Pose, E.; Díaz, A.; Vallverdú, J.; Rubio-Tomás, T.; Martínez-Sánchez, C.; Huelin, P.; Llopis, M.; et al. Molecular characterization of chronic liver disease dynamics: From liver fibrosis to acute-on-chronic liver failure. JHEP Rep. Innov. Hepatol. 2022, 4, 100482. [Google Scholar] [CrossRef]
- Roessler, S.; Jia, H.-L.; Budhu, A.; Forgues, M.; Ye, Q.-H.; Lee, J.-S.; Thorgeirsson, S.S.; Sun, Z.; Tang, Z.-Y.; Qin, L.-X.; et al. A unique metastasis gene signature enables prediction of tumor relapse in early-stage hepatocellular carcinoma patients. Cancer Res. 2010, 70, 10202–10212. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Miao, B.; Wang, S.; Dong, W.; Xu, H.; Si, C.; Wang, W.; Duan, S.; Lou, J.; Bao, Z.; et al. Hiplot: A comprehensive and easy-to-use web service for boosting publication-ready biomedical data visualization. Brief. Bioinform. 2022, 23, bbac261. [Google Scholar] [CrossRef]
- Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.; Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523. [Google Scholar] [CrossRef] [PubMed]
- Chin, C.-H.; Chen, S.-H.; Wu, H.-H.; Ho, C.-W.; Ko, M.-T.; Lin, C.-Y. cytoHubba: Identifying hub objects and sub-networks from complex interactome. BMC Syst. Biol. 2014, 8 (Suppl. S4), S11. [Google Scholar] [CrossRef]
- Shen, W.; Song, Z.; Zhong, X.; Huang, M.; Shen, D.; Gao, P.; Qian, X.; Wang, M.; He, X.; Wang, T.; et al. Sangerbox: A comprehensive, interaction-friendly clinical bioinformatics analysis platform. iMeta 2022, 1, e36. [Google Scholar] [CrossRef]
- McConnell, M.J.; Kostallari, E.; Ibrahim, S.H.; Iwakiri, Y. The evolving role of liver sinusoidal endothelial cells in liver health and disease. Hepatology 2023, 78, 649–669. [Google Scholar] [CrossRef] [PubMed]
- Koch, P.S.; Lee, K.H.; Goerdt, S.; Augustin, H.G. Angiodiversity and organotypic functions of sinusoidal endothelial cells. Angiogenesis 2021, 24, 289–310. [Google Scholar] [CrossRef] [PubMed]
- DeLeve, L.D.; Maretti-Mira, A.C. Liver Sinusoidal Endothelial Cell: An Update. Semin. Liver Dis. 2017, 37, 377–387. [Google Scholar] [CrossRef] [PubMed]
- Velliou, R.I.; Legaki, A.I.; Nikolakopoulou, P.; Vlachogiannis, N.I.; Chatzigeorgiou, A. Liver endothelial cells in NAFLD and transition to NASH and HCC. Cell. Mol. Life Sci. 2023, 80, 314. [Google Scholar] [CrossRef]
- Qi, J.; Yan, X.; Li, L.; Qiu, K.; Huang, W.; Zhou, Z. CXCL5 promotes lipotoxicity of hepatocytes through upregulating NLRP3/Caspase-1/IL-1β signaling in Kupffer cells and exacerbates nonalcoholic steatohepatitis in mice. Int. Immunopharmacol. 2023, 123, 110752. [Google Scholar] [CrossRef]
- Wu, P.; Luo, X.; Sun, M.; Sun, B.; Sun, M. Synergetic regulation of kupffer cells, extracellular matrix and hepatic stellate cells with versatile CXCR4-inhibiting nanocomplex for magnified therapy in liver fibrosis. Biomaterials 2022, 284, 121492. [Google Scholar] [CrossRef]
- Ehling, J.; Bartneck, M.; Wei, X.; Gremse, F.; Fech, V.; Möckel, D.; Baeck, C.; Hittatiya, K.; Eulberg, D.; Luedde, T.; et al. CCL2-dependent infiltrating macrophages promote angiogenesis in progressive liver fibrosis. Gut 2014, 63, 1960–1971. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Liu, H.; Xue, Y.; Xu, Z.; Miao, X.; Guo, Y.; Li, Z.; Fan, Z.; Xu, Y. Targetable Brg1-CXCL14 axis contributes to alcoholic liver injury by driving neutrophil trafficking. EMBO Mol. Med. 2023, 15, e16592. [Google Scholar] [CrossRef]
- Hwang, J.-H.; Heo, W.; Park, J.I.; Kim, K.M.; Oh, H.T.; Yoo, G.D.; Park, J.; Shin, S.; Do, Y.; Jeong, M.G.; et al. Endothelial TAZ inhibits capillarization of liver sinusoidal endothelium and damage-induced liver fibrosis via nitric oxide production. Theranostics 2023, 13, 4182–4196. [Google Scholar] [CrossRef]
- Jung, E.; Baek, E.B.; Hong, E.-J.; Kang, J.H.; Park, S.; Park, S.; Hong, E.-J.; Cho, Y.-E.; Ko, J.-W.; Won, Y.-S.; et al. TXNIP in liver sinusoidal endothelial cells ameliorates alcohol-associated liver disease via nitric oxide production. Int. J. Biol. Sci. 2024, 20, 606–620. [Google Scholar] [CrossRef]
- Su, T.; Yang, Y.; Lai, S.; Jeong, J.; Jung, Y.; McConnell, M.; Utsumi, T.; Iwakiri, Y. Single-Cell Transcriptomics Reveals Zone-Specific Alterations of Liver Sinusoidal Endothelial Cells in Cirrhosis. Cell. Mol. Gastroenterol. Hepatol. 2021, 11, 1139–1161. [Google Scholar] [CrossRef] [PubMed]
- Pozzi, A.; Yurchenco, P.D.; Iozzo, R.V. The nature and biology of basement membranes. Matrix Biol. 2017, 57–58, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Calvier, L.; Martinez-Martinez, E.; Miana, M.; Cachofeiro, V.; Rousseau, E.; Sádaba, J.R.; Zannad, F.; Rossignol, P.; López-Andrés, N. The impact of galectin-3 inhibition on aldosterone-induced cardiac and renal injuries. JACC Heart Fail. 2015, 3, 59–67. [Google Scholar] [CrossRef] [PubMed]
- Mackinnon, A.C.; Gibbons, M.A.; Farnworth, S.L.; Leffler, H.; Nilsson, U.J.; Delaine, T.; Simpson, A.J.; Forbes, S.J.; Hirani, N.; Gauldie, J.; et al. Regulation of transforming growth factor-β1-driven lung fibrosis by galectin-3. Am. J. Respir. Crit. Care Med. 2012, 185, 537–546. [Google Scholar] [CrossRef] [PubMed]
- Ho, J.E.; Liu, C.; Lyass, A.; Courchesne, P.; Pencina, M.J.; Vasan, R.S.; Larson, M.G.; Levy, D. Galectin-3, a marker of cardiac fibrosis, predicts incident heart failure in the community. J. Am. Coll. Cardiol. 2012, 60, 1249–1256. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.; Zhang, R.; Xia, Y.; Jiang, X.; Zhou, K.; Li, J.; Guo, M.; Cao, X.; Zhang, S. The necroptosis related gene LGALS3 can be used as a biomarker for the adverse progression from chronic HBV infection to HCC. Front. Immunol. 2023, 14, 1142319. [Google Scholar] [CrossRef] [PubMed]
- Song, M.; Pan, Q.; Yang, J.; He, J.; Zeng, J.; Cheng, S.; Huang, Y.; Zhou, Z.-Q.; Zhu, Q.; Yang, C.; et al. Galectin-3 favours tumour metastasis via the activation of β-catenin signalling in hepatocellular carcinoma. Br. J. Cancer 2020, 123, 1521–1534. [Google Scholar] [CrossRef] [PubMed]
- Jiang, S.-S.; Weng, D.-S.; Wang, Q.-J.; Pan, K.; Zhang, Y.-J.; Li, Y.-Q.; Li, J.-J.; Zhao, J.-J.; He, J.; Lv, L.; et al. Galectin-3 is associated with a poor prognosis in primary hepatocellular carcinoma. J. Transl. Med. 2014, 12, 273. [Google Scholar] [CrossRef]
- Wanninger, J.; Weigert, J.; Wiest, R.; Bauer, S.; Karrasch, T.; Farkas, S.; Scherer, M.N.; Walter, R.; Weiss, T.S.; Hellerbrand, C.; et al. Systemic and hepatic vein galectin-3 are increased in patients with alcoholic liver cirrhosis and negatively correlate with liver function. Cytokine 2011, 55, 435–440. [Google Scholar] [CrossRef]
- Henderson, N.C.; Mackinnon, A.C.; Farnworth, S.L.; Poirier, F.; Russo, F.P.; Iredale, J.P.; Haslett, C.; Simpson, K.J.; Sethi, T. Galectin-3 regulates myofibroblast activation and hepatic fibrosis. Proc. Natl. Acad. Sci. USA 2006, 103, 5060–5065. [Google Scholar] [CrossRef]
- Zetterberg, F.R.; MacKinnon, A.; Brimert, T.; Gravelle, L.; Johnsson, R.E.; Kahl-Knutson, B.; Leffler, H.; Nilsson, U.J.; Pedersen, A.; Peterson, K.; et al. Discovery and Optimization of the First Highly Effective and Orally Available Galectin-3 Inhibitors for Treatment of Fibrotic Disease. J. Med. Chem. 2022, 65, 12626–12638. [Google Scholar] [CrossRef] [PubMed]
- Chalasani, N.; Abdelmalek, M.F.; Garcia-Tsao, G.; Vuppalanchi, R.; Alkhouri, N.; Rinella, M.; Noureddin, M.; Pyko, M.; Shiffman, M.; Sanyal, A.; et al. Effects of Belapectin, an Inhibitor of Galectin-3, in Patients With Nonalcoholic Steatohepatitis with Cirrhosis and Portal Hypertension. Gastroenterology 2020, 158, 1334–1345. [Google Scholar] [CrossRef] [PubMed]
- Bratteby, K.; Torkelsson, E.; L’Estrade, E.T.; Peterson, K.; Shalgunov, V.; Xiong, M.; Leffler, H.; Zetterberg, F.R.; Olsson, T.G.; Gillings, N.; et al. In Vivo Veritas: 18F-Radiolabeled Glycomimetics Allow Insights into the Pharmacological Fate of Galectin-3 Inhibitors. J. Med. Chem. 2020, 63, 747–755. [Google Scholar] [CrossRef] [PubMed]
- She, Z.Y.; Yang, W.X. SOX family transcription factors involved in diverse cellular events during development. Eur. J. Cell Biol. 2015, 94, 547–563. [Google Scholar] [CrossRef]
- Sarkar, A.; Hochedlinger, K. The sox family of transcription factors: Versatile regulators of stem and progenitor cell fate. Cell Stem Cell 2013, 12, 15–30. [Google Scholar] [CrossRef]
- Gribben, C.; Galanakis, V.; Calderwood, A.; Williams, E.C.; Chazarra-Gil, R.; Larraz, M.; Frau, C.; Puengel, T.; Guillot, A.; Rouhani, F.J.; et al. Acquisition of epithelial plasticity in human chronic liver disease. Nature 2024, 630, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Poncy, A.; Antoniou, A.; Cordi, S.; Pierreux, C.E.; Jacquemin, P.; Lemaigre, F.P. Transcription factors SOX4 and SOX9 cooperatively control development of bile ducts. Dev. Biol. 2015, 404, 136–148. [Google Scholar] [CrossRef]
- Katsuda, T.; Sussman, J.H.; Ito, K.; Katznelson, A.; Yuan, S.; Takenaka, N.; Li, J.; Merrell, A.J.; Cure, H.; Li, Q.; et al. Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity. Nat. Commun. 2024, 15, 1761. [Google Scholar] [CrossRef]
- Jiao, Y.; Zhao, J.; Zhang, Z.; Li, M.; Yu, X.; Yang, Y.; Liu, J.; Liao, S.; Li, D.; Wang, Y.; et al. SRY-Box Containing Gene 4 Promotes Liver Steatosis by Upregulation of SREBP-1c. Diabetes 2018, 67, 2227–2238. [Google Scholar] [CrossRef]
- Hanieh, H.; Ahmed, E.A.; Vishnubalaji, R.; Alajez, N.M. SOX4: Epigenetic regulation and role in tumorigenesis. Semin. Cancer Biol. 2020, 67, 91–104. [Google Scholar] [CrossRef]
- Wang, H.; Huo, X.; Yang, X.R.; He, J.; Cheng, L.; Wang, N.; Deng, X.; Jin, H.; Wang, N.; Wang, C.; et al. STAT3-mediated upregulation of lncRNA HOXD-AS1 as a ceRNA facilitates liver cancer metastasis by regulating SOX4. Mol. Cancer 2017, 16, 136. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.Z.; Huang, L.; Wu, Y.H.; Zhai, W.J.; Zhu, P.P.; Gao, Y.F. LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression. Nat. Commun. 2016, 7, 12598. [Google Scholar] [CrossRef] [PubMed]
- Bouton, M.-C.; Boulaftali, Y.; Richard, B.; Arocas, V.; Michel, J.-B.; Jandrot-Perrus, M. Emerging role of serpinE2/protease nexin-1 in hemostasis and vascular biology. Blood 2012, 119, 2452–2457. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Lv, L.-F.; Qi-Li, M.-G.; Yang, R.; Wang, Y.-J.; Chen, S.-S.; Zhang, M.-X.; Li, T.-Y.; Yu, T.; Zhou, Y.-H.; et al. Endocytosis of Peptidase Inhibitor SerpinE2 promotes Myocardial Fibrosis through activating ERK1/2 and β-catenin Signaling Pathways. Int. J. Biol. Sci. 2022, 18, 6008–6019. [Google Scholar] [CrossRef] [PubMed]
- Bergeron, S.; Lemieux, E.; Durand, V.; Cagnol, S.; Carrier, J.C.; Lussier, J.G.; Boucher, M.-J.; Rivard, N. The serine protease inhibitor serpinE2 is a novel target of ERK signaling involved in human colorectal tumorigenesis. Mol. Cancer 2010, 9, 271. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Jia, X.; Dai, H.; Zhu, X.; Song, W.; Bian, S.; Wu, H.; Chen, S.; Tang, Y.; Chen, J.; et al. SERPINE2 promotes liver cancer metastasis by inhibiting c-Cbl-mediated EGFR ubiquitination and degradation. Cancer Commun. 2024, 44, 384–407. [Google Scholar] [CrossRef] [PubMed]
- Rashidi, M.; Bandala-Sanchez, E.; Lawlor, K.E.; Zhang, Y.; Neale, A.M.; Vijayaraj, S.L.; O’Donoghue, R.; Wentworth, J.M.; Adams, T.E.; Vince, J.E.; et al. CD52 inhibits Toll-like receptor activation of NF-κB and triggers apoptosis to suppress inflammation. Cell Death Differ. 2018, 25, 392–405. [Google Scholar] [CrossRef] [PubMed]
- Bandala-Sanchez, E.; Zhang, Y.; Reinwald, S.; Dromey, J.A.; Lee, B.-H.; Qian, J.; Böhmer, R.M.; Harrison, L.C. T cell regulation mediated by interaction of soluble CD52 with the inhibitory receptor Siglec-10. Nat. Immunol. 2013, 14, 741–748. [Google Scholar] [CrossRef] [PubMed]
- Syed, Y.Y. Alemtuzumab: A Review in Relapsing Remitting Multiple Sclerosis. Drugs 2021, 81, 157–168. [Google Scholar] [CrossRef]
- Li, Y.; Lu, X.; Cao, W.; Liu, N.; Jin, X.; Li, Y.; Tang, S.; Tao, L.; Zhu, Q.; Liang, H. Exploring the diagnostic value of endothelial cell and angiogenesis-related genes in Hashimoto’s thyroiditis Based on transcriptomics and single cell RNA sequencing. Arch. Biochem. Biophys. 2024, 757, 110013. [Google Scholar] [CrossRef]
- Khan, A.; Li, W.; Ambreen, A.; Wei, D.-Q.; Wang, Y.; Mao, Y. A protein coupling and molecular simulation analysis of the clinical mutants of androgen receptor revealed a higher binding for Leupaxin, to increase the prostate cancer invasion and motility. Comput. Biol. Med. 2022, 146, 105537. [Google Scholar] [CrossRef] [PubMed]
- Klapproth, S.; Bromberger, T.; Türk, C.; Krüger, M.; Moser, M. A kindlin-3-leupaxin-paxillin signaling pathway regulates podosome stability. J. Cell Biol. 2019, 218, 3436–3454. [Google Scholar] [CrossRef]
- Sundberg-Smith, L.J.; DiMichele, L.A.; Sayers, R.L.; Mack, C.P.; Taylor, J.M. The LIM protein leupaxin is enriched in smooth muscle and functions as an serum response factor cofactor to induce smooth muscle cell gene transcription. Circ. Res. 2008, 102, 1502–1511. [Google Scholar] [CrossRef] [PubMed]
Dataset | Platform | Etiology | Number of Samples | Ref. |
---|---|---|---|---|
GSE120281 | GPL21493 | CCL4 liver fibrosis mice | Fibrotic LSECs = 3 Quiescent LSECs = 3 | [11] |
GSE140994 | GPL24557 | CDAA liver fibrosis mice | Fibrotic LSECs = 5 Quiescent LSECs = 5 | [12] |
GSE119340 | GPL23479 | NASH liver fibrosis mice | Fibrotic LSECs = 3 Quiescent LSECs = 3 | [13] |
GSE84044 | GPL570 | Human HBV cirrhosis patients | S0 = 43 S1 = 20 S2 = 33 S3 = 18 S4 = 10 | [14] |
GSE139602 | GPL13667 | Human chronic liver disease patients | Healthy = 6 Fibrosis = 5 Compensated cirrhosis = 8 Decompensated cirrhosis = 12 ACLF = 8 | [15] |
GSE14520 | GPL3921 | Human hepatocellular carcinoma patients | HCC = 212 | [16] |
Gene | Forward (5′ > 3′) | Reverse (5′ > 3′) |
---|---|---|
Sox4 | CCTCGCTCTCCTCGTCCT | TCGTCTTCGAACTCGTCGT |
Lgals3 | CACTGACGGTGCCCTATGAC | TTGGGTTTCACTGTGCCCAT |
Serpine2 | CAGATCATCAAGTCACGGCCT | ACCGTGGAGAGCTGCTTCTTT |
Lpxn | GCTGCTCCCATCACAGATAAAGTG | TCGGCAGTATGGCTTCTTGTCCTTC |
Cd52 | CTCTTCCTCACTATCATTCTTCTGG | CTTTAGCCTCCTTGGATATCTGCTA |
Acta2 | TCGGATACTTCAGCGTCAGGA | GTCCCAGACATCAGGGAGTAA |
18s | GTCTGTGATGCCCTTAGATG | AGCTTATGACCCGCACTTAC |
EPC | MCC | MNC | Degree | Radiality | Closeness |
---|---|---|---|---|---|
Itgax | Itgax | Mmp13 | Itgax | Itgax | Itgax |
Igf1 | Cybb | Itgax | Igf1 | Cybb | Cybb |
Cd68 | Cd68 | Igf1 | Cd68 | Igf1 | Igf1 |
Cxcr4 | Cd74 | Cd68 | Cd74 | Cd68 | Cd68 |
Ctss | Cxcr4 | Cxcr4 | Cxcr4 | Cxcr4 | Cxcr4 |
Tyrobp | Ctss | Ctss | Ctss | Ctss | Ctss |
Ccl4 | Tyrobp | Tyrobp | Tyrobp | Tyrobp | Tyrobp |
Cd14 | Ccl4 | Ccl4 | Ccl4 | Ccl4 | Ccl4 |
Cd44 | Cd14 | Cd44 | Cd44 | Cd44 | Cd44 |
Ccl2 | Cd44 | Ccl2 | Ccl2 | Ccl2 | Ccl2 |
Cx3cr1 | Ccl2 | Fn1 | Fn1 | Cx3cr1 | Cx3cr1 |
Fn1 | Cx3cr1 | Cd34 | Cd34 | Fn1 | Fn1 |
Cd34 | Fn1 | Lgals3 | Lgals3 | Cd34 | Cd34 |
Lgals3 | Cd34 | Cd163 | Cd163 | Lgals3 | Lgals3 |
Cd163 | Trem2 | Src | Src | Cd163 | Cd163 |
Ccl3 | Lgals3 | Ccl3 | Ccl3 | Src | Src |
Timp1 | Cd163 | Timp1 | Timp1 | Ccl3 | Ccl3 |
Itgb2 | Ccl3 | Itgb2 | Itgb2 | Timp1 | Timp1 |
Col1a1 | Itgb2 | Col1a1 | Col1a1 | Itgb2 | Itgb2 |
Fcgr1 | Fcgr1 | Fcgr1 | Fcgr1 | Fcgr1 | Fcgr1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, P.; Xie, W.; Wei, H.; Yang, F.; Chen, Y.; Li, Y. Transcriptome Analyses of Liver Sinusoidal Endothelial Cells Reveal a Consistent List of Candidate Genes Associated with Endothelial Dysfunction and the Fibrosis Progression. Curr. Issues Mol. Biol. 2024, 46, 7997-8014. https://doi.org/10.3390/cimb46080473
Li P, Xie W, Wei H, Yang F, Chen Y, Li Y. Transcriptome Analyses of Liver Sinusoidal Endothelial Cells Reveal a Consistent List of Candidate Genes Associated with Endothelial Dysfunction and the Fibrosis Progression. Current Issues in Molecular Biology. 2024; 46(8):7997-8014. https://doi.org/10.3390/cimb46080473
Chicago/Turabian StyleLi, Penghui, Wenjie Xie, Hongjin Wei, Fan Yang, Yan Chen, and Yinxiong Li. 2024. "Transcriptome Analyses of Liver Sinusoidal Endothelial Cells Reveal a Consistent List of Candidate Genes Associated with Endothelial Dysfunction and the Fibrosis Progression" Current Issues in Molecular Biology 46, no. 8: 7997-8014. https://doi.org/10.3390/cimb46080473