A Multi-Strain Probiotic Formulation Improves Intestinal Barrier Function by the Modulation of Tight and Adherent Junction Proteins
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals, Reagents, and Media
2.2. Cell Cultures
2.3. Treatment with the Probiotic Formulation
2.4. MTT Assay
2.5. TEER Measurements
2.6. RT-PCR
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Cell Viability
3.2. TEER Measurement
3.3. Effect of Serobioma on TJ Gene Expression in Caco-2 Cells
3.4. Protein Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Morgan, X.C.; Tickle, T.L.; Sokol, H.; Gevers, D.; Devaney, K.L.; Ward, D.V.; Reyes, J.A.; Shah, S.A.; LeLeiko, N.; Snapper, S.B.; et al. Dysfunction of the Intestinal Microbiome in Inflammatory Bowel Disease and Treatment. Genome Biol. 2012, 13, R79. [Google Scholar] [CrossRef] [PubMed]
- Maloy, K.J.; Powrie, F. Intestinal Homeostasis and Its Breakdown in Inflammatory Bowel Disease. Nature 2011, 474, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Watanabe, K.; Kimura, I. Gut Microbiota Dysbiosis Drives and Implies Novel Therapeutic Strategies for Diabetes Mellitus and Related Metabolic Diseases. Front. Immunol. 2017, 8, 1882. [Google Scholar] [CrossRef] [PubMed]
- Abdellatif, A.M.; Sarvetnick, N.E. Current Understanding of the Role of Gut Dysbiosis in Type 1 Diabetes. J. Diabetes 2019, 11, 632–644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.; Huang, C.; Wang, J.; Zhou, H.; Lu, Y.; Lou, L.; Zheng, J.; Tian, L.; Wang, X.; Cao, Z.; et al. Dysbiosis of Intestinal Microbiota and Decrease in Paneth Cell Antimicrobial Peptide Level during Acute Necrotizing Pancreatitis in Rats. PLoS ONE 2017, 12, e0176583. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; He, C.; Li, X.; Cai, Y.; Hu, J.; Liao, Y.; Zhao, J.; Xia, L.; He, W.; Liu, L.; et al. Gut Microbiota Dysbiosis Worsens the Severity of Acute Pancreatitis in Patients and Mice. J. Gastroenterol. 2019, 54, 347–358. [Google Scholar] [CrossRef] [PubMed]
- Lee, N.Y.; Yoon, S.J.; Han, D.H.; Gupta, H.; Youn, G.S.; Shin, M.J.; Ham, Y.L.; Kwak, M.J.; Kim, B.Y.; Yu, J.S.; et al. Lactobacillus and Pediococcus Ameliorate Progression of Non-Alcoholic Fatty Liver Disease through Modulation of the Gut Microbiome. Gut Microbes 2020, 11, 882–899. [Google Scholar] [CrossRef]
- Maccioni, L.; Gao, B.; Leclercq, S.; Pirlot, B.; Horsmans, Y.; De Timary, P.; Leclercq, I.; Fouts, D.; Schnabl, B.; Stärkel, P. Intestinal Permeability, Microbial Translocation, Changes in Duodenal and Fecal Microbiota, and Their Associations with Alcoholic Liver Disease Progression in Humans. Gut Microbes 2020, 12, 1782157. [Google Scholar] [CrossRef]
- Zou, R.; Xu, F.; Wang, Y.; Duan, M.; Guo, M.; Zhang, Q.; Zhao, H.; Zheng, H. Changes in the Gut Microbiota of Children with Autism Spectrum Disorder. Autism Res. 2020, 13, 1614–1625. [Google Scholar] [CrossRef]
- Wasser, C.I.; Mercieca, E.-C.; Kong, G.; Hannan, A.J.; McKeown, S.J.; Glikmann-Johnston, Y.; Stout, J.C. Gut Dysbiosis in Huntington’s Disease: Associations among Gut Microbiota, Cognitive Performance and Clinical Outcomes. Brain Commun. 2020, 2, fcaa110. [Google Scholar] [CrossRef]
- Canale, M.P.; Noce, A.; Di Lauro, M.; Marrone, G.; Cantelmo, M.; Cardillo, C.; Federici, M.; Di Daniele, N.; Tesauro, M. Gut Dysbiosis and Western Diet in the Pathogenesis of Essential Arterial Hypertension: A Narrative Review. Nutrients 2021, 13, 1162. [Google Scholar] [CrossRef] [PubMed]
- Battson, M.L.; Lee, D.M.; Jarrell, D.K.; Hou, S.; Ecton, K.E.; Weir, T.L.; Gentile, C.L. Suppression of Gut Dysbiosis Reverses Western Diet-Induced Vascular Dysfunction. Am. J. Physiol. Endocrinol. Metab. 2018, 314, E468–E477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mudd, J.C.; Brenchley, J.M. Gut Mucosal Barrier Dysfunction, Microbial Dysbiosis, and Their Role in HIV-1 Disease Progression. J. Infect. Dis. 2016, 214, S58–S66. [Google Scholar] [CrossRef] [PubMed]
- Andersen, K.; Kesper, M.S.; Marschner, J.A.; Konrad, L.; Ryu, M.; Vr, S.K.; Kulkarni, O.P.; Mulay, S.R.; Romoli, S.; Demleitner, J.; et al. Intestinal Dysbiosis, Barrier Dysfunction, and Bacterial Translocation Account for CKD–Related Systemic Inflammation. JASN 2017, 28, 76–83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stadlbauer, V.; Engertsberger, L.; Komarova, I.; Feldbacher, N.; Leber, B.; Pichler, G.; Fink, N.; Scarpatetti, M.; Schippinger, W.; Schmidt, R.; et al. Dysbiosis, Gut Barrier Dysfunction and Inflammation in Dementia: A Pilot Study. BMC Geriatr. 2020, 20, 248. [Google Scholar] [CrossRef] [PubMed]
- Stolfi, C.; Maresca, C.; Monteleone, G.; Laudisi, F. Implication of Intestinal Barrier Dysfunction in Gut Dysbiosis and Diseases. Biomedicines 2022, 10, 289. [Google Scholar] [CrossRef]
- Conte, C.; Sichetti, M.; Traina, G. Gut–Brain Axis: Focus on Neurodegeneration and Mast Cells. Appl. Sci. 2020, 10, 1828. [Google Scholar] [CrossRef] [Green Version]
- van Tongeren, S.P.; Slaets, J.P.J.; Harmsen, H.J.M.; Welling, G.W. Fecal Microbiota Composition and Frailty. Appl. Environ. Microbiol. 2005, 71, 6438–6442. [Google Scholar] [CrossRef] [Green Version]
- Benson, K.; Cramer, S.; Galla, H.-J. Impedance-Based Cell Monitoring: Barrier Properties and Beyond. Fluids Barriers CNS 2013, 10, 5. [Google Scholar] [CrossRef] [Green Version]
- Odijk, M.; van der Meer, A.D.; Levner, D.; Kim, H.J.; van der Helm, M.W.; Segerink, L.I.; Frimat, J.-P.; Hamilton, G.A.; Ingber, D.E.; van den Berg, A. Measuring Direct Current Trans-Epithelial Electrical Resistance in Organ-on-a-Chip Microsystems. Lab Chip 2015, 15, 745–752. [Google Scholar] [CrossRef]
- Groschwitz, K.R.; Hogan, S.P. Intestinal Barrier Function: Molecular Regulation and Disease Pathogenesis. J. Allergy Clin. Immunol. 2009, 124, 3–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gareau, M.G.; Sherman, P.M.; Walker, W.A. Probiotics and the Gut Microbiota in Intestinal Health and Disease. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 503–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- LeBlanc, J.G.; Milani, C.; de Giori, G.S.; Sesma, F.; van Sinderen, D.; Ventura, M. Bacteria as Vitamin Suppliers to Their Host: A Gut Microbiota Perspective. Curr. Opin. Biotechnol. 2013, 24, 160–168. [Google Scholar] [CrossRef]
- Hagihara, M.; Kuroki, Y.; Ariyoshi, T.; Higashi, S.; Fukuda, K.; Yamashita, R.; Matsumoto, A.; Mori, T.; Mimura, K.; Yamaguchi, M.; et al. Clostridium Butyricum Modulates the Microbiome to Protect Intestinal Barrier Function in Mice with Antibiotic-Induced Dysbiosis. iScience 2020, 23, 100772. [Google Scholar] [CrossRef] [Green Version]
- Nusrat, A.; Turner, J.R.; Madara, J.L. Molecular Physiology and Pathophysiology of Tight Junctions. IV. Regulation of Tight Junctions by Extracellular Stimuli: Nutrients, Cytokines, and Immune Cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2000, 279, G851–G857. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arrieta, M.C.; Bistritz, L.; Meddings, J.B. Alterations in Intestinal Permeability. Gut 2006, 55, 1512–1520. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupta, P.; Andrew, H.; Kirschner, B.S.; Guandalini, S. Is Lactobacillus GG Helpful in Children with Crohn’s Disease? Results of a Preliminary, Open-Label Study. J. Pediatr. Gastroenterol. Nutr. 2000, 31, 453–457. [Google Scholar] [CrossRef]
- Chaiyasut, C.; Sivamaruthi, B.S.; Lailerd, N.; Sirilun, S.; Khongtan, S.; Fukngoen, P.; Peerajan, S.; Saelee, M.; Chaiyasut, K.; Kesika, P.; et al. Probiotics Supplementation Improves Intestinal Permeability, Obesity Index and Metabolic Biomarkers in Elderly Thai Subjects: A Randomized Controlled Trial. Foods 2022, 11, 268. [Google Scholar] [CrossRef]
- Francavilla, R.; Miniello, V.; Magistà, A.M.; De Canio, A.; Bucci, N.; Gagliardi, F.; Lionetti, E.; Castellaneta, S.; Polimeno, L.; Peccarisi, L.; et al. A Randomized Controlled Trial of Lactobacillus GG in Children with Functional Abdominal Pain. Pediatrics 2010, 126, e1445–e1452. [Google Scholar] [CrossRef] [Green Version]
- Lamprecht, M.; Bogner, S.; Schippinger, G.; Steinbauer, K.; Fankhauser, F.; Hallstroem, S.; Schuetz, B.; Greilberger, J.F. Probiotic Supplementation Affects Markers of Intestinal Barrier, Oxidation, and Inflammation in Trained Men; a Randomized, Double-Blinded, Placebo-Controlled Trial. J. Int. Soc. Sports Nutr. 2012, 9, 45. [Google Scholar] [CrossRef] [Green Version]
- Liu, Z.-H.; Huang, M.-J.; Zhang, X.-W.; Wang, L.; Huang, N.-Q.; Peng, H.; Lan, P.; Peng, J.-S.; Yang, Z.; Xia, Y.; et al. The Effects of Perioperative Probiotic Treatment on Serum Zonulin Concentration and Subsequent Postoperative Infectious Complications after Colorectal Cancer Surgery: A Double-Center and Double-Blind Randomized Clinical Trial. Am. J. Clin. Nutr. 2013, 97, 117–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Probiotics: What You Need to Know. Available online: https://www.nccih.nih.gov/health/probiotics-what-you-need-to-know (accessed on 26 March 2022).
- Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. The International Scientific Association for Probiotics and Prebiotics Consensus Statement on the Scope and Appropriate Use of the Term Probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014, 11, 506–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anderson, R.C.; Cookson, A.L.; McNabb, W.C.; Park, Z.; McCann, M.J.; Kelly, W.J.; Roy, N.C. Lactobacillus Plantarum MB452 Enhances the Function of the Intestinal Barrier by Increasing the Expression Levels of Genes Involved in Tight Junction Formation. BMC Microbiol. 2010, 10, 316. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Corridoni, D.; Pastorelli, L.; Mattioli, B.; Locovei, S.; Ishikawa, D.; Arseneau, K.O.; Chieppa, M.; Cominelli, F.; Pizarro, T.T. Probiotic Bacteria Regulate Intestinal Epithelial Permeability in Experimental Ileitis by a TNF-Dependent Mechanism. PLoS ONE 2012, 7, e42067. [Google Scholar] [CrossRef] [Green Version]
- Barnett, A.M.; Roy, N.C.; Cookson, A.L.; McNabb, W.C. Metabolism of Caprine Milk Carbohydrates by Probiotic Bacteria and Caco-2:HT29−MTX Epithelial Co-Cultures and Their Impact on Intestinal Barrier Integrity. Nutrients 2018, 10, 949. [Google Scholar] [CrossRef] [Green Version]
- Ohland, C.L.; Macnaughton, W.K. Probiotic Bacteria and Intestinal Epithelial Barrier Function. Am. J. Physiol. Gastrointest. Liver Physiol. 2010, 298, G807–G819. [Google Scholar] [CrossRef] [Green Version]
- Reid, G.; Younes, J.A.; Van der Mei, H.C.; Gloor, G.B.; Knight, R.; Busscher, H.J. Microbiota Restoration: Natural and Supplemented Recovery of Human Microbial Communities. Nat. Rev. Microbiol. 2011, 9, 27–38. [Google Scholar] [CrossRef]
- Bellavia, M.; Rappa, F.; Lo Bello, M.; Brecchia, G.; Tomasello, G.; Leone, A.; Spatola, G.; Uzzo, M.L.; Bonaventura, G.; David, S.; et al. Lactobacillus Casei and Bifidobacterium Lactis Supplementation Reduces Tissue Damage of Intestinal Mucosa and Liver after 2,4,6-Trinitrobenzenesulfonic Acid Treatment in Mice. J. Biol. Regul. Homeost. Agents 2014, 28, 251–261. [Google Scholar]
- Sichetti, M.; De Marco, S.; Pagiotti, R.; Traina, G.; Pietrella, D. Anti-Inflammatory Effect of Multistrain Probiotic Formulation (L. rhamnosus, B. lactis, and B. longum). Nutrition 2018, 53, 95–102. [Google Scholar] [CrossRef]
- Persichetti, E.; De Michele, A.; Codini, M.; Traina, G. Antioxidative Capacity of Lactobacillus Fermentum LF31 Evaluated in Vitro by Oxygen Radical Absorbance Capacity Assay. Nutrition 2014, 30, 936–938. [Google Scholar] [CrossRef]
- Traina, G.; Menchetti, L.; Rappa, F.; Casagrande-Proietti, P.; Barbato, O.; Leonardi, L.; Carini, F.; Piro, F.; Brecchia, G. Probiotic Mixture Supplementation in the Preventive Management of Trinitrobenzenesulfonic Acid-Induced Inflammation in a Murine Model. J. Biol. Regul. Homeost. Agents 2016, 30, 895–901. [Google Scholar] [PubMed]
- Benoit, R.; Rowe, S.; Watkins, S.C.; Boyle, P.; Garrett, M.; Alber, S.; Wiener, J.; Rowe, M.I.; Ford, H.R. Pure Endotoxin does not Pass across the Intestinal Epithelium in Vitro. Shock 1998, 10, 43–48. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Al-Sadi, R.; Said, H.M.; Ma, T.Y. Lipopolysaccharide Causes an Increase in Intestinal Tight Junction Permeability in Vitro and in Vivo by Inducing Enterocyte Membrane Expression and Localization of TLR-4 and CD14. Am. J. Pathol. 2013, 182, 375–387. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, S.; Nighot, M.; Al-Sadi, R.; Alhmoud, T.; Nighot, P.; Ma, T.Y. Lipopolysaccharide Regulation of Intestinal Tight Junction Permeability Is Mediated by TLR4 Signal Transduction Pathway Activation of FAK and MyD88. J. Immunol. 2015, 195, 4999–5010. [Google Scholar] [CrossRef]
- Grispoldi, L.; Giglietti, R.; Traina, G.; Cenci-Goga, B. How to Assess in Vitro Probiotic Viability and the Correct Use of Neutralizing Agents. Front. Microbiol. 2020, 11, 204. [Google Scholar] [CrossRef] [Green Version]
- Srinivasan, B.; Kolli, A.R.; Esch, M.B.; Abaci, H.E.; Shuler, M.L.; Hickman, J.J. TEER Measurement Techniques for in Vitro Barrier Model Systems. J. Lab. Autom. 2015, 20, 107–126. [Google Scholar] [CrossRef] [Green Version]
- Ferruzza, S.; Rossi, C.; Scarino, M.L.; Sambuy, Y. A Protocol for in Situ Enzyme Assays to Assess the Differentiation of Human Intestinal Caco-2 Cells. Toxicol. In Vitro 2012, 26, 1247–1251. [Google Scholar] [CrossRef]
- Zweibaum, A. Differentiation of human colon cancer cells: A new approach to colon cancer. Bull. Acad. Natl. Med. 1993, 177, 63–71. [Google Scholar] [CrossRef]
- Hubatsch, I.; Ragnarsson, E.G.E.; Artursson, P. Determination of Drug Permeability and Prediction of Drug Absorption in Caco-2 Monolayers. Nat. Protoc. 2007, 2, 2111–2119. [Google Scholar] [CrossRef]
- Taticchi, A.; Urbani, S.; Albi, E.; Servili, M.; Codini, M.; Traina, G.; Balloni, S.; Patria, F.F.; Perioli, L.; Beccari, T.; et al. In Vitro Anti-Inflammatory Effects of Phenolic Compounds from Moraiolo Virgin Olive Oil (MVOO) in Brain Cells via Regulating the TLR4/NLRP3 Axis. Molecules 2019, 24, 4523. [Google Scholar] [CrossRef] [Green Version]
- Boudeau, J.; Glasser, A.-L.; Julien, S.; Colombel, J.-F.; Darfeuille-Michaud, A. Inhibitory Effect of Probiotic Escherichia Coli Strain Nissle 1917 on Adhesion to and Invasion of Intestinal Epithelial Cells by Adherent–Invasive E. coli Strains Isolated from Patients with Crohn’s Disease. Aliment. Pharmacol. Ther. 2003, 18, 45–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhong, Y.; Wang, S.; Di, H.; Deng, Z.; Liu, J.; Wang, H. Gut Health Benefit and Application of Postbiotics in Animal Production. J. Anim. Sci. Biotechnol. 2022, 13, 38. [Google Scholar] [CrossRef] [PubMed]
- Wong, C.B.; Odamaki, T.; Xiao, J. Beneficial Effects of Bifidobacterium Longum Subsp. Longum BB536 on Human Health: Modulation of Gut Microbiome as the Principal Action. J. Funct. Foods 2019, 54, 506–519. [Google Scholar] [CrossRef]
- Akatsu, H.; Iwabuchi, N.; Xiao, J.-Z.; Matsuyama, Z.; Kurihara, R.; Okuda, K.; Yamamoto, T.; Maruyama, M. Clinical Effects of Probiotic Bifidobacterium Longum BB536 on Immune Function and Intestinal Microbiota in Elderly Patients Receiving Enteral Tube Feeding. JPEN J. Parenter Enter. Nutr. 2013, 37, 631–640. [Google Scholar] [CrossRef]
- Foligne, B.; Zoumpopoulou, G.; Dewulf, J.; Younes, A.B.; Chareyre, F.; Sirard, J.-C.; Pot, B.; Grangette, C. A Key Role of Dendritic Cells in Probiotic Functionality. PLoS ONE 2007, 2, e313. [Google Scholar] [CrossRef]
- Kayama, H.; Takeda, K. Manipulation of Epithelial Integrity and Mucosal Immunity by Host and Microbiota-Derived Metabolites. Eur. J. Immunol. 2020, 50, 921–931. [Google Scholar] [CrossRef]
- Guardamagna, O.; Amaretti, A.; Puddu, P.E.; Raimondi, S.; Abello, F.; Cagliero, P.; Rossi, M. Bifidobacteria Supplementation: Effects on Plasma Lipid Profiles in Dyslipidemic Children. Nutrition 2014, 30, 831–836. [Google Scholar] [CrossRef]
- Wong, A.R.C.; Pearson, J.S.; Bright, M.D.; Munera, D.; Robinson, K.S.; Lee, S.F.; Frankel, G.; Hartland, E.L. Enteropathogenic and Enterohaemorrhagic Escherichia Coli: Even More Subversive Elements. Mol. Microbiol. 2011, 80, 1420–1438. [Google Scholar] [CrossRef]
- Cao, S.; Zhang, Q.; Wang, C.; Wu, H.; Jiao, L.; Hong, Q.; Hu, C. LPS Challenge Increased Intestinal Permeability, Disrupted Mitochondrial Function and Triggered Mitophagy of Piglets. Innate Immun. 2018, 24, 221–230. [Google Scholar] [CrossRef] [Green Version]
- Poritz, L.S.; Harris, L.R.; Kelly, A.A.; Koltun, W.A. Increase in the Tight Junction Protein Claudin-1 in Intestinal Inflammation. Dig. Dis. Sci. 2011, 56, 2802–2809. [Google Scholar] [CrossRef] [Green Version]
- Furuse, M.; Sasaki, H.; Tsukita, S. Manner of Interaction of Heterogeneous Claudin Species within and between Tight Junction Strands. J. Cell Biol. 1999, 147, 891–903. [Google Scholar] [CrossRef] [PubMed]
- Zeissig, S.; Bürgel, N.; Günzel, D.; Richter, J.; Mankertz, J.; Wahnschaffe, U.; Kroesen, A.J.; Zeitz, M.; Fromm, M.; Schulzke, J.-D. Changes in Expression and Distribution of Claudin 2, 5 and 8 Lead to Discontinuous Tight Junctions and Barrier Dysfunction in Active Crohn’s Disease. Gut 2007, 56, 61–72. [Google Scholar] [CrossRef] [PubMed]
- Rose, E.C.; Odle, J.; Blikslager, A.T.; Ziegler, A.L. Probiotics, Prebiotics and Epithelial Tight Junctions: A Promising Approach to Modulate Intestinal Barrier Function. Int. J. Mol. Sci. 2021, 22, 6729. [Google Scholar] [CrossRef] [PubMed]
- Nelson, W.J. Adaptation of Core Mechanisms to Generate Cell Polarity. Nature 2003, 422, 766–774. [Google Scholar] [CrossRef]
- Niessen, C.M.; Leckband, D.; Yap, A.S. Tissue Organization by Cadherin Adhesion Molecules: Dynamic Molecular and Cellular Mechanisms of Morphogenetic Regulation. Physiol. Rev. 2011, 91, 691–731. [Google Scholar] [CrossRef] [Green Version]
- Rübsam, M.; Mertz, A.F.; Kubo, A.; Marg, S.; Jüngst, C.; Goranci-Buzhala, G.; Schauss, A.C.; Horsley, V.; Dufresne, E.R.; Moser, M.; et al. E-Cadherin Integrates Mechanotransduction and EGFR Signaling to Control Junctional Tissue Polarization and Tight Junction Positioning. Nat. Commun. 2017, 8, 1250. [Google Scholar] [CrossRef] [Green Version]
- Schreider, C.; Peignon, G.; Thenet, S.; Chambaz, J.; Pinçon-Raymond, M. Integrin-Mediated Functional Polarization of Caco-2 Cells through E-Cadherin—Actin Complexes. J. Cell Sci. 2002, 115, 543–552. [Google Scholar] [CrossRef]
- Capaldo, C.T.; Macara, I.G. Depletion of E-Cadherin Disrupts Establishment but Not Maintenance of Cell Junctions in Madin-Darby Canine Kidney Epithelial Cells. Mol. Biol. Cell 2007, 18, 189–200. [Google Scholar] [CrossRef] [Green Version]
- Din, A.U.; Hassan, A.; Zhu, Y.; Zhang, K.; Wang, Y.; Li, T.; Wang, Y.; Wang, G. Inhibitory Effect of Bifidobacterium Bifidum ATCC 29521 on Colitis and Its Mechanism. J. Nutr. Biochem. 2020, 79, 108353. [Google Scholar] [CrossRef]
- Bergmann, K.R.; Liu, S.X.L.; Tian, R.; Kushnir, A.; Turner, J.R.; Li, H.-L.; Chou, P.M.; Weber, C.R.; De Plaen, I.G. Bifidobacteria Stabilize Claudins at Tight Junctions and Prevent Intestinal Barrier Dysfunction in Mouse Necrotizing Enterocolitis. Am. J. Pathol. 2013, 182, 1595–1606. [Google Scholar] [CrossRef] [Green Version]
- Zhao, L.; Xie, Q.; Evivie, S.E.; Yue, Y.; Yang, H.; Lv, X.; Liu, F.; Li, B.; Huo, G. Bifidobacterium Longum Subsp. Longum K5 Alleviates Inflammatory Response and Prevents Intestinal Barrier Injury Induced by LPS in Vitro Based on Comparative Genomics. J. Funct. Foods 2022, 92, 105030. [Google Scholar] [CrossRef]
- Tamaki, H.; Nakase, H.; Inoue, S.; Kawanami, C.; Itani, T.; Ohana, M.; Kusaka, T.; Uose, S.; Hisatsune, H.; Tojo, M.; et al. Efficacy of Probiotic Treatment with Bifidobacterium Longum 536 for Induction of Remission in Active Ulcerative Colitis: A Randomized, Double-Blinded, Placebo-Controlled Multicenter Trial. Dig. Endosc. 2016, 28, 67–74. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Putaala, H.; Salusjärvi, T.; Nordström, M.; Saarinen, M.; Ouwehand, A.C.; Bech Hansen, E.; Rautonen, N. Effect of Four Probiotic Strains and Escherichia Coli O157:H7 on Tight Junction Integrity and Cyclo-Oxygenase Expression. Res. Microbiol. 2008, 159, 692–698. [Google Scholar] [CrossRef]
- Qin, H.-L.; Shen, T.-Y.; Gao, Z.-G.; Fan, X.-B.; Hang, X.-M.; Jiang, Y.-Q.; Zhang, H.-Z. Effect of Lactobacillus on the Gut Microflora and Barrier Function of the Rats with Abdominal Infection. World J. Gastroenterol. 2005, 11, 2591–2596. [Google Scholar] [CrossRef] [PubMed]
- Laval, L.; Martin, R.; Natividad, J.N.; Chain, F.; Miquel, S.; Desclée de Maredsous, C.; Capronnier, S.; Sokol, H.; Verdu, E.F.; van Hylckama Vlieg, J.E.T.; et al. Lactobacillus rhamnosus CNCM I-3690 and the Commensal Bacterium Faecalibacterium prausnitzii A2-165 Exhibit Similar Protective Effects to Induced Barrier Hyper-Permeability in Mice. Gut Microbes 2015, 6, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Ukena, S.N.; Singh, A.; Dringenberg, U.; Engelhardt, R.; Seidler, U.; Hansen, W.; Bleich, A.; Bruder, D.; Franzke, A.; Rogler, G.; et al. Probiotic Escherichia Coli Nissle 1917 Inhibits Leaky Gut by Enhancing Mucosal Integrity. PLoS ONE 2007, 2, e1308. [Google Scholar] [CrossRef] [PubMed]
- Mennigen, R.; Nolte, K.; Rijcken, E.; Utech, M.; Loeffler, B.; Senninger, N.; Bruewer, M. Probiotic Mixture VSL#3 Protects the Epithelial Barrier by Maintaining Tight Junction Protein Expression and Preventing Apoptosis in a Murine Model of Colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 2009, 296, G1140–G1149. [Google Scholar] [CrossRef]
- Donato, K.A.; Gareau, M.G.; Wang, Y.J.J.; Sherman, P.M. Lactobacillus rhamnosus GG Attenuates Interferon-γ and Tumour Necrosis Factor-Alpha-Induced Barrier Dysfunction and pro-Inflammatory Signalling. Microbiology 2010, 156, 3288–3297. [Google Scholar] [CrossRef] [Green Version]
- Coyne, C.B.; Ribeiro, C.M.P.; Boucher, R.C.; Johnson, L.G. Acute Mechanism of Medium Chain Fatty Acid-Induced Enhancement of Airway Epithelial Permeability. J. Pharmacol. Exp. Ther. 2003, 305, 440–450. [Google Scholar] [CrossRef]
- Oguro, M.; Koike, M.; Ueno, T.; Asaoka, D.; Mori, H.; Nagahara, A.; Uchiyama, Y.; Watanabe, S. Dissociation and Dispersion of Claudin-3 from the Tight Junction Could Be One of the Most Sensitive Indicators of Reflux Esophagitis in a Rat Model of the Disease. J. Gastroenterol. 2011, 46, 629–638. [Google Scholar] [CrossRef]
- Xu, R.; Li, Q.; Zhou, J.; Zhou, X.; Perelman, J.M.; Kolosov, V.P. The Degradation of Airway Tight Junction Protein under Acidic Conditions Is Probably Mediated by Transient Receptor Potential Vanilloid 1 Receptor. Biosci. Rep. 2013, 33, e00078. [Google Scholar] [CrossRef] [PubMed]
- MacPherson, C.W.; Shastri, P.; Mathieu, O.; Tompkins, T.A.; Burguière, P. Genome-Wide Immune Modulation of TLR3-Mediated Inflammation in Intestinal Epithelial Cells Differs between Single and Multi-Strain Probiotic Combination. PLoS ONE 2017, 12, e0169847. [Google Scholar] [CrossRef] [PubMed]
- Astolfi, M.L.; Protano, C.; Schiavi, E.; Marconi, E.; Capobianco, D.; Massimi, L.; Ristorini, M.; Baldassarre, M.E.; Laforgia, N.; Vitali, M.; et al. A Prophylactic Multi-Strain Probiotic Treatment to Reduce the Absorption of Toxic Elements: In-Vitro Study and Biomonitoring of Breast Milk and Infant Stools. Environ. Int. 2019, 130, 104818. [Google Scholar] [CrossRef] [PubMed]
- Bezkorovainy, A. Probiotics: Determinants of Survival and Growth in the Gut. Am. J. Clin. Nutr. 2001, 73, 399S–405S. [Google Scholar] [CrossRef]
- Timmerman, H.M.; Koning, C.J.M.; Mulder, L.; Rombouts, F.M.; Beynen, A.C. Monostrain, Multistrain and Multispecies Probiotics—A Comparison of Functionality and Efficacy. Int. J. Food Microbiol. 2004, 96, 219–233. [Google Scholar] [CrossRef]
Accession Number | Gene Name | Symbol | Product Length | Primer Sequences (F: Forward; R: Reverse) |
---|---|---|---|---|
NM_002046.7 | Glyceraldehyde-3-phosphate dehydrogenase | GAPDH | 120 | F: TGACTTCAACAGCGACACCCA R: CACCCTGTTGCTGTAGCCAAA |
NM_004360.5 | Cadherin 1 | CDH1 | 136 | F: CTTTGACGCCGAGAGCTACA R: TTTGAATCGGGTGTCGAGGG |
NM_002538.4 | Occludin | OCLN | 136 | F: ACCAATGCTCTCTCAGCCAG R: AGGCAAAGATGGCAATGCAC |
NM_021101.5 | Claudin 1 | CLDN1 | 170 | F: TTTACTCCTATGCCGGCGAC R: GAGGATGCCAACCACCATCA |
NM_020384.4 | Claudin 2 | CLDN2 | 161 | F: TATAGCACCCTTCTGGGCCT R: GCTACCGCCACTCTGTCTTT |
NM_001301025.3 | Tight junction protein 1 | ZO-1 | 157 | F: GGGACAACAGCATCCTTCCA R: GCAAAAGACCAACCGTCAGG |
NM_004817.4 | Tight junction protein 2 | ZO-2 | 130 | F: TTCGTTTGCAGTTCAGCAGC R: CTCAAAAGCCCGGTCATCCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
di Vito, R.; Conte, C.; Traina, G. A Multi-Strain Probiotic Formulation Improves Intestinal Barrier Function by the Modulation of Tight and Adherent Junction Proteins. Cells 2022, 11, 2617. https://doi.org/10.3390/cells11162617
di Vito R, Conte C, Traina G. A Multi-Strain Probiotic Formulation Improves Intestinal Barrier Function by the Modulation of Tight and Adherent Junction Proteins. Cells. 2022; 11(16):2617. https://doi.org/10.3390/cells11162617
Chicago/Turabian Styledi Vito, Raffaella, Carmela Conte, and Giovanna Traina. 2022. "A Multi-Strain Probiotic Formulation Improves Intestinal Barrier Function by the Modulation of Tight and Adherent Junction Proteins" Cells 11, no. 16: 2617. https://doi.org/10.3390/cells11162617