Next Article in Journal
Biological Evaluation of the Osteoinductive Potential of Dry Teeth after Chemical Demineralization Treatment Using the Tooth Transformer Device
Previous Article in Journal
Functions of Representative Terpenoids and Their Biosynthesis Mechanisms in Medicinal Plants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomolecules
Volume 13
Issue 12
10.3390/biom13121726
biomolecules-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Oral Immunization with Attenuated Salmonella Choleraesuis Expressing the FedF Antigens Protects Mice against the Shiga-Toxin-Producing Escherichia coli Challenge

by
Guihua Zhang
1,2,†,
Yang Fu
1,2,†,
Yu’an Li
1,2,
Quan Li
1,2,
Shifeng Wang
3 and
Huoying Shi
1,2,4,*
1
College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China
2
Jiangsu Co-Innovation Center for the Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China
3
Department of Infectious Diseases and Immunology, College of Veterinary Medicine, University of Florida, Gainesville, FL 32611-0880, USA
4
Joint International Research Laboratory of Agriculture and Agri-Product Safety, Yangzhou University (JIRLAAPS), Yangzhou 225009, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biomolecules 2023, 13(12), 1726; https://doi.org/10.3390/biom13121726
Submission received: 19 October 2023 / Revised: 18 November 2023 / Accepted: 22 November 2023 / Published: 30 November 2023
Browse Figures
Review Reports Versions Notes

Abstract

:
Edema disease (ED) is a severe and lethal infectious ailment in swine, stemming from Shiga-toxin-producing Escherichia coli (STEC). An efficient, user-friendly, and safe vaccine against ED is urgently required to improve animal welfare and decrease antibiotic consumption. Recombinant attenuated Salmonella vaccines (RASV) administered orally induce both humoral and mucosal immune responses to the immunizing antigen. Their potential for inducing protective immunity against ED is significant through the delivery of STEC antigens. rSC0016 represents an enhanced recombinant attenuated vaccine vector designed for Salmonella enterica serotype Choleraesuis. It combines sopB mutations with a regulated delay system to strike a well-balanced equilibrium between host safety and immunogenicity. We generated recombinant vaccine strains, namely rSC0016 (pS-FedF) and rSC0016 (pS-rStx2eA), and assessed their safety and immunogenicity in vivo. The findings demonstrated that the mouse models immunized with rSC0016 (pS-FedF) and rSC0016 (pS-rStx2eA) generated substantial IgG antibody responses to FedF and rStx2eA, while also provoking robust mucosal and cellular immune responses against both FedF and rStx2eA. The protective impact of rSC0016 (pS-FedF) against Shiga-toxin-producing Escherichia coli surpassed that of rSC0016 (pS-rStx2eA), with percentages of 83.3%. These findings underscore that FedF has greater suitability for vaccine delivery via recombinant attenuated Salmonella vaccines (RASVs). Overall, this study provides a promising candidate vaccine for infection with STEC.

1. Introduction

ED is a condition of intestinal toxemia triggered by STEC, often seen in piglets aged 4–12 weeks [1]. Clinical presentations include eyelid swelling, paralysis, abnormal vocalizations, neurological signs, and a significantly increased mortality rate, leading to substantial economic losses in the swine farming industry [2]. In the realm of clinical application, the pathogenic strain of Escherichia coli has been undergoing evolutionary changes [3]. Moreover, the emergence of novel resistance genes, fueled by antibiotic misuse, has given rise to widespread multidrug resistance. This complex scenario engenders significant impediments to the efficacious management and containment of Escherichia-coli-associated maladies [4]. Consequently, there persists an exigent demand for the expeditious development of a novel vaccine technology platform [5,6]. Meanwhile, Salmonella Choleraesuis is a significant pathogen responsible for paratyphoid fever in piglets aged 2 to 4 months. This bacterium can induce widespread illness in recently weaned piglets, resulting in various clinical symptoms such as sepsis and localized inflammation in other tissues. Its impact on the breeding industry is pivotal [7,8]. STEC and Salmonella, both Gram-negative facultative anaerobic bacilli, are prevalent commensal and pathogenic bacteria within the gastrointestinal tracts of warm-blooded animals [9].
The Recombinant Attenuated Salmonella Vaccines (RASVs) approach stands out as a compelling platform for delivering antigens [10]. It offers an economical and needle-free approach to transporting foreign antigens, leading to a substantial enhancement in vaccine immunogenicity and cost-effectiveness [11]. To date, RASVs have effectively delivered antigens from various sources, including bacteria, viruses, and parasites, eliciting immune responses [12,13,14]. Many research efforts have utilized attenuated Salmonella as a vehicle for delivering E. coli antigens, with the goal of preventing and managing pathogenic Escherichia coli. Up to now, the researchers have used attenuated Salmonella as a vector to express the pathogenic Escherichia coli antigens K88, K99, FedA, FedF, FasA, and F41 [15,16,17,18,19,20,21,22]. Salmonella possesses inherent attributes as a carrier. These encompass its notable adjuvant properties and the capability to produce various Toll-like receptor agonists like flagellin, lipopolysaccharides, and lipoproteins. These components serve as potent adjuvants, enhancing the generated immune response. This significantly boosts both the Th1-dominant and mucosal immune response to exogenous antigens [23,24,25]. RASVs could use a type III secretion system (T3SS) for injection of effector proteins into the host cell cytosol which presented by MHC-I molecules generating efficient CD8+ T-cell responses [12,26,27,28]. RASVs are recognized for their capacity to vigorously stimulate both the humoral and cellular components of the immune response in vaccinated individuals. They can grow within the host’s body and have been extensively employed in the management of Salmonellosis. Their capacity to access the host effectively through mass oral administration along the mucosal route results in comprehensive protection against Salmonella [10]. Research has demonstrated that the utilization of RASVs carrying exogenous antigens can confer dual protection at the same time [29,30,31].
The selection of antigens has always been a research focus in the development of edema disease vaccines. Among them, F18 fimbriae and Stx2e are highly concerned [32,33]. The clinical evidence has substantiated a frequent correlation between F18 fimbriae and piglet diarrhea. The F18-fimbriae-fed gene cluster encompasses essential genes including fedA (coding for the primary subunit protein), fedB (coding for the molecular chaperone), fedC (coding for the introducer protein), fedE (coding for the secondary subunit), and fedF (coding for the adhesin) [34]. It has been observed that the gene fedF, responsible for encoding the adhesion subunit, demonstrates noteworthy conservation [35]. Moreover, in vitro experiments have confirmed that mutant strains lacking the FedF gene experience a decline in adhesion capability [36]. This has led researchers to predominantly target FedF for vaccine development purposes. As for the edema-disease-associated Stx2e whole toxin, it consists of a toxic A subunit housing N-terminal glycosidase activity and five nontoxic B subunits responsible for cell receptor binding [37,38,39]. Notably, the A subunit assumes the role of toxicity induction. In consideration of this, during the formulation of vaccines directed at A-subunit proteins, the essential step of codon optimization becomes imperative to effectively mitigate and eliminate toxicity [40].
In order to create a potent edema disease vaccine, we utilized a recombinant strain known as rSC0016 [41]. Vaccine candidate strains, namely rSC0016(pS-FedF) and rSC0016(pS-rStx2eA), were engineered to express the FedF and rStx2eA antigens. We assessed the immune responses elicited by rSC0016(pS-FedF) and rSC0016(pS-rStx2eA), along with their protective efficacy against STEC, using a mouse model. Our findings demonstrated that these constructs might present a novel avenue in the pursuit of preventing and controlling edema disease.

2. Materials and Methods

2.1. Animals and Ethics Statement

Female BALB/c mice were procured from the Comparative Medicine Center at Yangzhou University in Jiangsu, China. All animal experiments adhered rigorously to the animal welfare regulations outlined in the Animal Research Committee Guidelines of Jiangsu Province (License Number: SYXK(SU) 2017-0044) and received approval from the Ethics Committee for Animal Experimentation at Yangzhou University. In the course of the animal experiments, every endeavor was made to reduce suffering and optimize animal welfare.

2.2. Plasmids and Bacterial Strains

The strains and plasmids utilized in this study are presented in Table 1. The STEC strain STEC20, preserved in our laboratory, was used to amplify the gene fragments fedf and rstx2eA. Plasmid pYA3493 functions as an Asd+ vector, and plasmids pS-FedF and pS-rStx2eA, derived from pYA3493, carry the fedF or rstx2eA gene from STEC20, respectively. The strain rSC0016 was prepared through prior laboratory research [41].

2.3. Protein Expression, Protein Purification, and Antibody Preparation

The sequences of fedF or rstx2eA genes were amplified via PCR and then inserted into the expression vector pET28a. For rStx2eA amplification, overlap PCR was employed to substitute the codons at the 167th and 170th amino acid positions with codons encoding Gln and Lys. This modification aimed to reduce its toxicity and enhance its immunogenicity [40]. The primers utilized in this study are detailed in Table 2. The vectors pET28a-FedF and pET28a-rStx2eA transformed E. coli BL21 (DE3) competent cells to generate purified proteins. BL21 cells harboring pET28a-FedF and pET28a-rStx2eA were grown in LB medium. The medium was supplemented with kanamycin, and the cells were incubated at 37 °C. The incubation continued until they reached an OD600 of 0.6, which marked the logarithmic growth phase. Following this, the bacterium was subjected to induction for a duration of 4 h using IPTG. The proteins were then purified utilizing Ni-NTA. Purified recombinant proteins were measured for their protein concentrations using the BCA method, identifying proteins through Western blot analysis with anti-His-tag monoclonal primary antibodies (Boster Biological Technology Co., Ltd., Wuhan, China).
The proteins were diluted as necessary and mixed with an equal volume of QuickAntibody-Mouse3W adjuvant (Biodragon, Suzhou, China). Six-week-old female BALB/c mice received two intramuscular immunizations in the leg, spaced two weeks apart, with each mouse receiving 20 μg of the immunogen ever time. One week after the final immunization, blood samples were collected from both immunized and nonimmunized mice. Following centrifugation at 3000× g for 15 min, the sera were separated, and their antibody titers were evaluated using ELISA assay.

2.4. Indirect ELISA

An ELISA analysis was conducted to determine antibody titers targeting FedF and rStx2eA as previously described [41]. Recombinant FedF and rStx2eA proteins or S. Choleraesuis OMPs (0.5 μg/mL) were immobilized onto microtiter plates using 0.1 M sodium carbonate buffer (pH 9.6), subsequent to an overnight incubation at 4 °C. Following the incubation with a blocking buffer, the wells were subjected to a 2 h incubation at 37 °C with polyclonal antibody serum that had been appropriately diluted in PBST (varying from 1:1000 to 1:128,000) or serum and vaginal mucosal flushing solution from Salmonella-vaccine-immunized subjects (ranging from 1:100 to 1:12,800). Following that, 100 μL of goat anti-mouse IgG or goat anti-mouse IgA antibody (1:5000) was allowed to incubate at 37 °C for 90 min. The color reaction was initiated by the addition of 100 μL of TMB (Solarbio, Beijing, China) and allowed to progress for 15 min. The reaction was subsequently terminated with the addition of 50 μL of 2 M H2SO4. Lastly, the optical density (OD) was assessed at 450 nm using an automated microplate reader. The outer membrane proteins (OMPs) from the wild-type S. Choleraesuis strain C78-3 were obtained using the established procedure as previously described [41]. In brief, bacterial pellets were collected by centrifugation and suspended in a 4 mL buffer comprising 1% Sarkosyl and 20 mM of Tris-HCl (pH 8.6). The suspension was then incubated on ice for 30 min. Subsequently, OMPs were isolated by centrifugation at 4 °C for 1 h at 132,000× g. The separated OMPs were resuspended in a 4 mL buffer containing 20 mM of Tris-HCl (pH 8.6).

2.5. Construction of Vaccine Strains and Detection of Proteins Expression

The genes fedF and rstx2eA were gain from pET28a-FedF and pET28a-rStx2eA and integrated into the EcoR Ι and Hind ΙΙΙ restriction enzyme sites of the plasmid pYA3493 backbone, resulting in plasmids named pS-FedF and pS-rStx2eA, respectively. The primer sequences used in this study can be found in Table 2. The vector control plasmid pYA3493, along with the pS-FedF and pS-rStx2eA plasmids, were introduced into the asd-deficient S. Choleraesuis vector rSC0016, resulting in strains designated as rSC0016(pYA3493), rSC0016(pS-FedF), and rSC0016(pS-rStx2eA). To confirm the successful expression of FedF and rStx2eA proteins in these vaccine candidate strains, Western blot was conducted using the anti-FedF and anti-rStx2eA serum prepared earlier.

2.6. Bacterial Growth Curves

Cultures of rSC0016(pS-FedF), rSC0016(pS-rStx2eA), and rSC0016(pYA3493) in the mid-exponential growth phase were adjusted to an OD600 of 0.5. They were then diluted 1:100 in fresh LB medium and subsequently incubated at 37 °C. Bacterial growth curves were derived from OD600 measurements taken every two hours over an 8 h period.

2.7. Immunization in Mice

The bacterial solution preserved at −80 °C was revived on an LB plate enriched with 0.2% arabinose and mannose. Subsequently, individual colonies were transferred into LB liquid medium supplemented with 0.2% arabinose and mannose, and they were incubated at 37 °C for 16–18 h. For the inoculation, a 1:100 dilution was made in LB liquid medium enriched with 0.2% arabinose and mannose. The mixture was shaken and cultured on a constant temperature shaker at 37 °C until the OD600 value of the bacterial solution reached approximately 0.9. The bacterial solution was subsequently centrifuged, washed with sterile PBS, and the bacterial pellet was collected. Afterwards, PBS was added to resuspend the bacterial pellet, resulting in a thoroughly mixed immune bacterial solution [43].
Immunoprotective experiments were conducted with 6-week-old female BALB/c mice (n = 9). Mice were kept 1 week after arrival to acclimate them to our animal facility before immunization and were deprived of food and water for 6 h before oral immunization. Two groups received PBS through oral administration, serving as healthy control and subsequent challenge control groups. Furthermore, two groups were subjected to oral pipette feeding with a 20 μL (1 ± 0.3 × 109 CFU) bacterial solution of rSC0016 (pS-FedF) and rSC0016 (pS-rStx2eA), while a separate group received the bacterial solution of rSC0016 (pYA3493) as an empty control. Food and water were returned to the mice 30 min after immunization. After 21 days from the initial immunization, each group received an additional immunization. On the 21st and 35th days after the initial immunization, serum samples were collected to assess IgG levels. In addition, vaginal mucosal flushing solutions were obtained by rinsing the vagina with sterile PBS to measure secretory IgA levels. The collected blood was placed in a refrigerator set at 4 °C overnight, followed by centrifugation to extract serum. All collected serum and vaginal rinse samples from each group were stored at −80 °C for preservation. Specific antibody titers in both vaginal mucosal flushing solution and serum were detected using an indirect ELISA. IFN-γ and IL-4 levels were detected using the Mouse IFN-γ and IL-4 ELISA KIT (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China), following the provided instructions.

2.8. Challenge in Mice

Select a single colony of STEC20 and allow it to incubate overnight in 5 mL of LB liquid culture medium. On the following day, inoculate the colony at a 1:100 ratio into 50 mL of LB liquid medium and shake it at 37 °C for cultivation. When the OD600 value of the bacterial solution reaches 0.8, harvest the bacterial cells. Resuspend the bacterial cells in 300 μL of PBS. Perform successive 10-fold dilutions and select the appropriate dilution for the challenge. Randomly divide 25 female BALB/c mice into 5 groups, each containing 5 mice. Inject the leg muscles of each mouse in the groups with 4 different target dilutions of the bacterial solution. An additional 5 mice comprise the blank control group, receiving individual injections of the same volume of PBS. Utilize the Reed–Muench method to calculate the LD50 based on these injections shown in Table S1. Three weeks after the second immunization, inject STEC20 into their leg muscles for challenge, using a challenge dose equivalent to 3.5 times the LD50. Following the challenge, continuously observe the mice to calculate the survival rate based on their mortality status. The experimental design is shown in Figure S1.

2.9. Statistical Analysis

Statistical analyses were conducted using GraphPad Prism 8. Data were presented as the mean ± SEM for all assays. Group comparisons were performed using the Mann–Whitney U Test. A p-value of less than 0.05 was considered statistically significant for all tests.

3. Results

3.1. Expression Recombinant FedF and rStx2eA Proteins and Production Polyclonal Antibody Sera

Using the STEC20 strain as a template, we amplified an 840 bp fedF gene fragment and an 891 bp rstx2eA gene fragment through PCR (Figure 1A,B). The fedF and rstx2eA fragments were then inserted into the pET28a vector. Positive plasmids were identified using double-restriction endonuclease digestion (Figure 1C). Afterward, they were introduced into the expression strain E. coli BL21(DE3), resulting in the creation of BL21(pET28a-rStx2eA) and BL21(pET28a-FedF) strains. Western blot showed that both BL21(pET28a-rStx2eA) and BL21 (pET28a-FedF) lanes exhibited specific bands of the expected size, while the empty control strain did not show any bands (Figure 1D). The results demonstrated the successful expression of FedF and rStx2eA proteins by BL21(pET28a-FedF) and BL21(pET28a-rStx2eA), respectively. Subsequently, the purified FedF protein and rStx2eA protein were used to generate polyclonal antibody sera in mice. Antibody titers were determined via indirect ELISA, revealing serum titers of 1:51,200 for the FedF antigen and 1:25,600 for the rStx2eA antigen.

3.2. Construction and Characterization of rSC0016(pS-FedF) and rSC0016(pS-rStx2eA)

The fedF and rstx2eA genes from STEC20 were inserted into the pYA3493, resulting in the creation of pS-FedF and pS-rStx2eA (Figure 2A). The pS-FedF and pS-rStx2eA plasmids were verified using double-restriction enzyme digestion. The sizes of the fragments were as follows: 3113 bp for pYA3493, 840 bp for fedF, and 891 bp for rstx2eA (Figure 2B). The pS-FedF and pS-rStx2eA plasmids were introduced into the competent rSC0016 strain to create vaccines rSC0016(pS-rStx2eA) and rSC0016(pS-FedF). Equal volumes of bacterial solutions of three vaccine strains were subjected to Western blot analysis. The results revealed an approximately 36 kDa protein expression in rSC0016(pS-FedF) and an approximately 38 kDa protein expression in rSC0016(pS-rStx2eA). No distinct bands were observed in the lane corresponding to rSC0016(pYA3493) (Figure 2C). These observed protein band sizes aligned with the anticipated sizes of FedF and rStx2eA proteins, indicating the accurate synthesis of the target antigens by both vaccine candidates. The growth curve outcomes indicated that despite carrying heterologous antigens, there was no notable difference in the growth rate among rSC0016(pS-FedF), rSC0016(pS-rStx2eA), and rSC0016(pYA3493) (Figure 2D).

3.3. S. Choleraesuis Vaccine Vector Strains rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) Elicited Elevated Serum IgG and Mucosal IgA Responses to FedF and rStx2eA

Indirect ELISA measured IgG levels for FedF and rStx2eA proteins in serum after 3 and 5 weeks of initial immunization, along with IgA levels in vaginal rinses. Also, IgG levels for induced C78-3 outer membrane proteins (OMPs) were assessed using indirect ELISA. In comparison to the rSC0016(pYA3493) and the blank control group, the results revealed that following the first and second immunizations, those immunized with rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) demonstrated markedly elevated concentrations of serum IgG and mucosal IgA against FedF and rStx2eA. Moreover, all immunized groups exhibited higher antibody levels at 5 weeks post-initial immunization compared to 3 weeks (Figure 3A,B). There was no significant difference in antibody levels between the rSC0016(pS-FedF) immune group and the rSC0016(pS-rStx2eA) immune group. The rSC0016(pYA3493) empty vector group did not express heterologous antigens; consequently, no corresponding antibodies were produced. Notably, the antibody levels against the OMPs induced by rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) were comparable to those of the empty vector immunized group after both immunizations (Figure 3C). This indicates that the two vaccine candidate strains not only induced immune responses to heterologous antigens but also triggered immune responses against Salmonella. In contrast, the blank control group did not generate any antibodies.

3.4. S. Choleraesuis Vaccine Vector Strains rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) Induced Higher Levels of IFN-γ and IL-4 in Mice

Seven days after the second immunization, three mice were randomly selected from each group, and their spleens were obtained and homogenized. Following multiple freeze–thaw cycles, the samples were subjected to centrifugation at 12,000× g for 1 min to acquire the supernatant. This supernatant was then used for subsequent analysis. Using the obtained supernatant, cytokine levels were measured using IL-4 and IFN-γ ELISA kits. In comparison to the rSC0016(pYA3493) group, both vaccine formulations induced significantly higher levels of IL-4 and IFN-γ in immunized groups. The spleen samples from rSC0016(pS-FedF) mice exhibited an average IFN level of 600 pg/mL, which is five times higher than that of the rSC0016(pYA3493) group. Likewise, the rSC0016(pS-FedF) group exhibited IL-4 levels approximately three times greater than the empty vector group. Furthermore, there was no significant disparity in IL-4 and IFN-γ cytokine levels between the spleens of mice immunized with the rSC0016(pS-rStx2eA) strain and those immunized with the rSC0016(pS-rStx2eA) strain. The blank control group did not show detectable serum factor levels (Figure 4).

3.5. S. rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) Vaccine Strains Protects Mice against STEC Infection

Except for the mice in the PBS group, all other mice were challenged by injecting STEC20 into their leg muscles at a dose equivalent to 3.5 times the LD50. Within a span of 36 h following exposure, mice in both the rSC0016(pS-FedF) immunized group and the blank control group exhibited gradual fatalities. The survival rates for the rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) immunization groups were 83.3% and 33.3%, respectively (Figure 5). The surviving mice displayed mild clinical symptoms including mental fatigue, disordered hair, and eyelid congestion. They subsequently resumed normal activities and eating patterns. The results underscore that both the rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) immunization groups conferred a certain level of protection against Escherichia coli infection in mice. Notably, the protective efficacy of rSC0016(pS-FedF) was significantly superior in comparison to that of rSC0016(pS-rStx2eA).

4. Discussion

STEC is a pathogen of edema disease (ED). Being a highly deadly infectious disease among piglets, it has resulted in substantial economic losses to the global breeding industry. Vaccine immunization remains a powerful measure for preventing and controlling edema disease [5]. Given the rise of multidrug-resistant strains of STEC in afflicted pigs, employing vaccines remains a potent strategy for preventing and managing edema disease [5,44]. Inactivated vaccines are currently widely used in the market, but they require multiple immunizations and large doses, thus increasing the cost of use. Consequently, there persists a necessity for the development of vaccines that are both more efficient and user-friendly, while ensuring safety [45].
Our recent research has devised mechanisms for controlled delayed attenuation and antigen synthesis [41,46,47]. During the initial phases of oral immunization, the meticulously controlled delayed attenuated Salmonella vaccine strain demonstrates efficient colonization of deep lymphoid tissues similar to virulent wild-type strains. Subsequently, due to the lack of mannose and arabinose in the host, the rSC0016 demonstrate detoxification characteristics and do not elicit disease symptoms. Research indicates that the controlled delayed antigen synthesis system can govern the production of foreign antigens. This empowers vaccines to induce robust levels of specific antigen antibodies upon colonization of lymphatic tissue [48]. FedF is regarded as a promising protective antigen for vaccine development. This is because it is relatively conserved and associated with bacterial adhesion [35,36]. Active immunity to Stx2e toxin induces strong immune responses in piglets and sows [49].
Vaccine candidate strains rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) were prepared that can express two virulence-related factors FedF and rStx2eA (including dual mutations) of STEC. To assess the potential of rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) as vaccine candidates against STEC, we analyzed the characteristics of these strains. The growth patterns of rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) exhibited a similarity to that of the control strain containing an empty vector, which is rSC0016(pYA3496). Furthermore, the production of exogenous protective antigens FedF and rStx2eA was observed in rSC0016(pS-FedF) and rSC0016(pS-rStx2eA). Following the immunization of mice, the vaccine strains elicited a robust, targeted immune response, resulting in elevated titers of IgG and IgA. Th1 cells are pivotal in orchestrating cellular immune responses against intracellular parasites [50,51], mainly secreting IFN-γ. IL-4 is secreted by Th2-type cells, and its primary function is to stimulate B-cell proliferation. It plays a significant role in both humoral immune responses and mechanisms of inflammation [52]. In this research, the average cytokine levels of IL-4 and IFN-γ in the spleens of mice immunized with rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) were greater than those in the control group. Furthermore, the immune groups involving rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) also provoked comparable levels of IL-4 and IFN-γ, suggesting the establishment of a harmonious Th1/Th2 immune response.
As for the protective effect, our results show that the rSC0016(pS-FedF) group achieved an 83.3% post-challenge survival rate. This outcome aligns closely with the survival rate of approximately 80%, as reported by Ren W et al. in their study involving a vaccine targeting the pili adhesion factor FedF [53]. These results further underscore the potential of the pili subunit FedF as a prime target in the development of edema disease vaccines. In contrast to the impressive protective efficacy observed with the modified Stx2e whole-toxin subunit vaccine [49], the protective effectiveness achieved by utilizing the Salmonella vector to deliver rStx2eA post-immunization yielded suboptimal results in this investigation. This discrepancy could be attributed to the apparent lack of production of efficacious neutralizing antibodies following immunization with rSC0016(pS-rStx2eA) in mice [54]. Additionally, a limitation of this study is the absence of a comparative analysis between the immune efficacies of the vaccine strains and commercially available edema disease vaccines.
Overall, rSC0016(pS-FedF) and rSC0016(pS-rStx2eA) vaccines induce cellular, mucosal, and humoral immune responses in mice. The rSC0016(pS-FedF) amalgamates the benefits of both rSC0016 and FedF, striking a favorable equilibrium between host safety and immunogenicity, thereby providing protection against SETC in mice. The findings of this research strongly indicate that the rSC0016(pS-FedF) strain holds significant promise as a candidate for the development of vaccines targeting Shiga-toxin-producing Escherichia coli.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biom13121726/s1, Table S1. Median lethal dose results of strain STEC20. Figure S1. Schematic diagram of the immunization and challenge experiment. Figure S2. Original images of Figure 1A–C. Figure S3. Original images of Figure 1D. Figure S4. Original images of Figure 2B. Figure S5. Original images of Figure 2C.

Author Contributions

H.S., Y.F., G.Z., Y.L., Q.L. and S.W. conceived the study. Y.F. and G.Z. collected study samples. Y.F. and G.Z. performed experiments. Y.F. and G.Z. performed data analysis. G.Z. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (grant numbers 32172802, 31672516, 32002301, 31172300, 30670079); Jiangsu Province Science and Technology Program Special Fund Project (BZ2022042); China Postdoctoral Science Foundation (grant number 2019M661953); Postgraduate Research & Practice Innovation Program of Jiangsu Province (SJCX21_1636); Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and supported by the 111 Project D18007.

Institutional Review Board Statement

Female BALB/c mice were procured from the Comparative Medicine Center at Yangzhou University in Jiangsu, China. All animal experiments adhered rigorously to the animal welfare regulations outlined in the Animal Research Committee Guidelines of Jiangsu Province (License Number: SYXK(SU) 2017-0044) and received approval from the Ethics Committee for Animal Experimentation at Yangzhou University.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Casanova, N.A.; Redondo, L.M.; Dailoff, G.C.; Arenas, D.; Fernandez Miyakawa, M.E. Overview of the role of Shiga toxins in porcine edema disease pathogenesis. Toxicon 2018, 148, 149–154. [Google Scholar] [CrossRef] [PubMed]
  2. Alexa, P.; Hamrik, J.; Stouracova, K.; Konstantinova, L.; Salajka, E. Passive immunoprophylaxis of edema disease in weaned piglets. Vet. Med. Czech 2004, 49, 447–452. [Google Scholar] [CrossRef]
  3. Vernozy-Rozand, C.; Montet, M.P.; Bertin, Y.; Trably, F.; Girardeau, J.P.; Martin, C.; Livrelli, V.; Beutin, L. Serotyping, stx2 subtyping, and characterization of the locus of enterocyte effacement island of shiga toxin-producing Escherichia coli and E. coli O157:H7 strains isolated from the environment in France. Appl. Environ. Microbiol. 2004, 70, 2556–2559. [Google Scholar] [CrossRef] [PubMed]
  4. Moriel, D.G.; Tan, L.; Goh, K.G.; Phan, M.D.; Ipe, D.S.; Lo, A.W.; Peters, K.M.; Ulett, G.C.; Beatson, S.A.; Schembri, M.A. A Novel Protective Vaccine Antigen from the Core Escherichia coli Genome. mSphere 2016, 1, e00326-16. [Google Scholar] [CrossRef] [PubMed]
  5. Alghamdi, S. The role of vaccines in combating antimicrobial resistance (AMR) bacteria. Saudi J. Biol. Sci. 2021, 28, 7505–7510. [Google Scholar] [CrossRef] [PubMed]
  6. Antonelli, G.; Cappelli, L.; Cinelli, P.; Cuffaro, R.; Manca, B.; Nicchi, S.; Tondi, S.; Vezzani, G.; Viviani, V.; Delany, I.; et al. Strategies to Tackle Antimicrobial Resistance: The Example of Escherichia coli and Pseudomonas aeruginosa. Int. J. Mol. Sci. 2021, 22, 4943. [Google Scholar] [CrossRef] [PubMed]
  7. Coburn, B.; Grassl, G.A.; Finlay, B.B. Salmonella, the host and disease: A brief review. Immunol. Cell Biol. 2007, 85, 112–118. [Google Scholar] [CrossRef]
  8. McGovern, V.J.; Slavutin, L.J. Pathology of salmonella colitis. Am. J. Surg. Pathol. 1979, 3, 483–490. [Google Scholar] [CrossRef]
  9. Pavez-Munoz, E.; Fernandez-Sanhueza, B.; Urzua-Encina, C.; Galarce, N.; Alegria-Moran, R. Risk Factors for Positivity to Shiga Toxin-Producing Escherichia coli and Salmonella enterica in Backyard Production Systems Animals from Metropolitana Region, Chile: A Threat to Public Health? Int. J. Environ. Res. Public Health 2021, 18, 10730. [Google Scholar] [CrossRef]
  10. Clark-Curtiss, J.E.; Curtiss, R., 3rd. Salmonella Vaccines: Conduits for Protective Antigens. J. Immunol. 2018, 200, 39–48. [Google Scholar] [CrossRef]
  11. Su, H.; Liu, Q.; Bian, X.; Wang, S.; Curtiss, R., 3rd; Kong, Q. Synthesis and delivery of Streptococcus pneumoniae capsular polysaccharides by recombinant attenuated Salmonella vaccines. Proc. Natl. Acad. Sci. USA 2021, 118, e2013350118. [Google Scholar] [CrossRef] [PubMed]
  12. Ashraf, S.; Kong, W.; Wang, S.; Yang, J.; Curtiss, R., 3rd. Protective cellular responses elicited by vaccination with influenza nucleoprotein delivered by a live recombinant attenuated Salmonella vaccine. Vaccine 2011, 29, 3990–4002. [Google Scholar] [CrossRef] [PubMed]
  13. Hassan, A.S.; Perera, D.J.; Ward, B.J.; Ndao, M. Therapeutic activity of a Salmonella-vectored Schistosoma mansoni vaccine in a mouse model of chronic infection. Vaccine 2021, 39, 5580–5588. [Google Scholar] [CrossRef] [PubMed]
  14. Li, Q.; Lv, Y.; Li, Y.A.; Du, Y.; Guo, W.; Chu, D.; Wang, X.; Wang, S.; Shi, H. Live attenuated Salmonella enterica serovar Choleraesuis vector delivering a conserved surface protein enolase induces high and broad protection against Streptococcus suis serotypes 2, 7, and 9 in mice. Vaccine 2020, 38, 6904–6913. [Google Scholar] [CrossRef]
  15. Attridge, S.; Hackett, J.; Morona, R.; Whyte, P. Towards a live oral vaccine against enterotoxigenic Escherichia coli of swine. Vaccine 1988, 6, 387–389. [Google Scholar] [CrossRef] [PubMed]
  16. Morona, R.; Morona, J.K.; Considine, A.; Hackett, J.A.; van den Bosch, L.; Beyer, L.; Attridge, S.R. Construction of K88- and K99-expressing clones of Salmonella typhimurium G30: Immunogenicity following oral administration to pigs. Vaccine 1994, 12, 513–517. [Google Scholar] [CrossRef]
  17. Gu, J.; Ning, Y.; Wang, H.; Xiao, D.; Tang, B.; Luo, P.; Cheng, Y.; Jiang, M.; Li, N.; Zou, Q.; et al. Vaccination of attenuated EIS-producing Salmonella induces protective immunity against enterohemorrhagic Escherichia coli in mice. Vaccine 2011, 29, 7395–7403. [Google Scholar] [CrossRef]
  18. Hur, J.; Lee, J.H. Immune responses to new vaccine candidates constructed by a live attenuated Salmonella typhimurium delivery system expressing Escherichia coli F4, F5, F6, F41 and intimin adhesin antigens in a murine model. J. Vet. Med. Sci. 2011, 73, 1265–1273. [Google Scholar] [CrossRef]
  19. Hur, J.; Lee, J.H. Comparative evaluation of a vaccine candidate expressing enterotoxigenic Escherichia coli (ETEC) adhesins for colibacillosis with a commercial vaccine using a pig model. Vaccine 2012, 30, 3829–3833. [Google Scholar] [CrossRef]
  20. Hur, J.; Lee, J.H. Development of a novel live vaccine delivering enterotoxigenic Escherichia coli fimbrial antigens to prevent post-weaning diarrhea in piglets. Vet. Immunol. Immunopathol. 2012, 146, 283–288. [Google Scholar] [CrossRef]
  21. Hur, J.; Stein, B.D.; Lee, J.H. A vaccine candidate for post-weaning diarrhea in swine constructed with a live attenuated Salmonella delivering Escherichia coli K88ab, K88ac, FedA, and FedF fimbrial antigens and its immune responses in a murine model. Can. J. Vet. Res 2012, 76, 186–194. [Google Scholar] [PubMed]
  22. Hur, J.; Lee, J.H. Protection against neonatal Escherichia coli diarrhea by vaccination of sows with a novel multivalent vaccine candidate expressing E. coli adhesins associated with neonatal pig colibacillosis. Res. Vet. Sci. 2013, 94, 198–204. [Google Scholar] [CrossRef] [PubMed]
  23. Lee, S.E.; Kim, S.Y.; Jeong, B.C.; Kim, Y.R.; Bae, S.J.; Ahn, O.S.; Lee, J.J.; Song, H.C.; Kim, J.M.; Choy, H.E.; et al. A bacterial flagellin, Vibrio vulnificus FlaB, has a strong mucosal adjuvant activity to induce protective immunity. Infect. Immun. 2006, 74, 694–702. [Google Scholar] [CrossRef] [PubMed]
  24. Mata-Haro, V.; Cekic, C.; Martin, M.; Chilton, P.M.; Casella, C.R.; Mitchell, T.C. The vaccine adjuvant monophosphoryl lipid A as a TRIF-biased agonist of TLR4. Science 2007, 316, 1628–1632. [Google Scholar] [CrossRef] [PubMed]
  25. Yoshino, S.; Sasatomi, E.; Ohsawa, M. Bacterial lipopolysaccharide acts as an adjuvant to induce autoimmune arthritis in mice. Immunology 2000, 99, 607–614. [Google Scholar] [CrossRef]
  26. Galan, J.E.; Collmer, A. Type III secretion machines: Bacterial devices for protein delivery into host cells. Science 1999, 284, 1322–1328. [Google Scholar] [CrossRef]
  27. Galan, J.E. Salmonella interactions with host cells: Type III secretion at work. Annu. Rev. Cell Dev. Biol. 2001, 17, 53–86. [Google Scholar] [CrossRef]
  28. Russmann, H.; Shams, H.; Poblete, F.; Fu, Y.; Galan, J.E.; Donis, R.O. Delivery of epitopes by the Salmonella type III secretion system for vaccine development. Science 1998, 281, 565–568. [Google Scholar] [CrossRef]
  29. Han, Y.; Luo, P.; Chen, Y.; Xu, J.; Sun, J.; Guan, C.; Wang, P.; Chen, M.; Zhang, X.; Zhu, Y.; et al. Regulated delayed attenuation improves vaccine efficacy in preventing infection from avian pathogenic Escherichia coli O(78) and Salmonella typhimurium. Vet. Microbiol. 2021, 254, 109012. [Google Scholar] [CrossRef]
  30. Redweik, G.A.J.; Stromberg, Z.R.; Van Goor, A.; Mellata, M. Protection against avian pathogenic Escherichia coli and Salmonella Kentucky exhibited in chickens given both probiotics and live Salmonella vaccine. Poult. Sci. 2020, 99, 752–762. [Google Scholar] [CrossRef]
  31. Liu, Q.; Li, P.; Luo, H.; Curtiss, R., 3rd; Kong, Q. Attenuated Salmonella Typhimurium expressing Salmonella Paratyphoid A O-antigen induces protective immune responses against two Salmonella strains. Virulence 2019, 10, 82–96. [Google Scholar] [CrossRef]
  32. Bertschinger, H.U.; Nief, V.; Tschape, H. Active oral immunization of suckling piglets to prevent colonization after weaning by enterotoxigenic Escherichia coli with fimbriae F18. Vet. Microbiol. 2000, 71, 255–267. [Google Scholar] [CrossRef]
  33. Moxley, R.A. Edema disease. Vet. Clin. N. Am. Food Anim. Pract. 2000, 16, 175–185. [Google Scholar] [CrossRef] [PubMed]
  34. Smeds, A.; Hemmann, K.; Jakava-Viljanen, M.; Pelkonen, S.; Imberechts, H.; Palva, A. Characterization of the adhesin of Escherichia coli F18 fimbriae. Infect. Immun. 2001, 69, 7941–7945. [Google Scholar] [CrossRef] [PubMed]
  35. Tiels, P.; Verdonck, F.; Smet, A.; Goddeeris, B.; Cox, E. The F18 fimbrial adhesin FedF is highly conserved among F18+Escherichia coli isolates. Vet. Microbiol. 2005, 110, 277–283. [Google Scholar] [CrossRef] [PubMed]
  36. Imberechts, H.; Wild, P.; Charlier, G.; de Greve, H.; Lintermans, P.; Pohl, P. Characterization of F18 fimbrial genes fedE and fedF involved in adhesion and length of enterotoxemic Escherichia coli strain 107/86. Microb. Pathog. 1996, 21, 183–192. [Google Scholar] [CrossRef] [PubMed]
  37. Fraser, M.E.; Fujinaga, M.; Cherney, M.M.; Melton-Celsa, A.R.; Twiddy, E.M.; O’Brien, A.D.; James, M.N.G. Structure of Shiga Toxin Type 2 (Stx2) from Escherichia coli O157:H7. J. Biol. Chem. 2004, 279, 27511–27517. [Google Scholar] [CrossRef] [PubMed]
  38. Johannes, L.; Decaudin, D. Protein toxins: Intracellular trafficking for targeted therapy. Gene Ther. 2005, 12, 1360–1368. [Google Scholar] [CrossRef] [PubMed]
  39. Sandvig, K.; van Deurs, B. Delivery into cells: Lessons learned from plant and bacterial toxins. Gene Ther. 2005, 12, 865–872. [Google Scholar] [CrossRef] [PubMed]
  40. Gordon, V.M.; Whipp, S.C.; Moon, H.W.; O’Brien, A.D.; Samuel, J.E. An enzymatic mutant of Shiga-like toxin II variant is a vaccine candidate for edema disease of swine. Infect. Immun. 1992, 60, 485–490. [Google Scholar] [CrossRef]
  41. Li, Y.A.; Ji, Z.; Wang, X.; Wang, S.; Shi, H. Salmonella enterica serovar Choleraesuis vector delivering SaoA antigen confers protection against Streptococcus suis serotypes 2 and 7 in mice and pigs. Vet. Res. 2017, 48, 89. [Google Scholar] [CrossRef] [PubMed]
  42. Lianlian, J.; Guoxiong, D.; Jiansheng, X.; Hui, D.; Bing, H. Coexpression of a subunit of fimbriae F18ab and a subunit of shiga-like toxin type Ⅱ variant (Stx 2eA). Dongwu Yixue Jinzhan 2005, 26, 80–84. [Google Scholar]
  43. Su, H.; Liu, Q.; Wang, S.; Curtiss, R., 3rd; Kong, Q. Regulated Delayed Shigella flexneri 2a O-antigen Synthesis in Live Recombinant Salmonella enterica Serovar Typhimurium Induces Comparable Levels of Protective Immune Responses with Constitutive Antigen Synthesis System. Theranostics 2019, 9, 3565–3579. [Google Scholar] [CrossRef] [PubMed]
  44. Kusumoto, M.; Hikoda, Y.; Fujii, Y.; Murata, M.; Miyoshi, H.; Ogura, Y.; Gotoh, Y.; Iwata, T.; Hayashi, T.; Akiba, M. Emergence of a Multidrug-Resistant Shiga Toxin-Producing Enterotoxigenic Escherichia coli Lineage in Diseased Swine in Japan. J. Clin. Microbiol. 2016, 54, 1074–1081. [Google Scholar] [CrossRef] [PubMed]
  45. Kannan, R.; Madden, K.; Andrews, S. Primer on immuno-oncology and immune response. Clin. J. Oncol. Nurs. 2014, 18, 311–326. [Google Scholar] [CrossRef] [PubMed]
  46. Ji, Z.; Shang, J.; Li, Y.; Wang, S.; Shi, H. Live attenuated Salmonella enterica serovar Choleraesuis vaccine vector displaying regulated delayed attenuation and regulated delayed antigen synthesis to confer protection against Streptococcus suis in mice. Vaccine 2015, 33, 4858–4867. [Google Scholar] [CrossRef] [PubMed]
  47. Zhou, P.; Zhou, Z.; Huayu, M.; Wang, L.; Feng, L.; Xiao, Y.; Dai, Y.; Xin, M.; Tang, F.; Li, R. A multi-epitope vaccine GILE against Echinococcus Multilocularis infection in mice. Front. Immunol. 2022, 13, 1091004. [Google Scholar] [CrossRef]
  48. Curtiss, R., 3rd; Wanda, S.Y.; Gunn, B.M.; Zhang, X.; Tinge, S.A.; Ananthnarayan, V.; Mo, H.; Wang, S.; Kong, W. Salmonella enterica serovar typhimurium strains with regulated delayed attenuation in vivo. Infect. Immun. 2009, 77, 1071–1082. [Google Scholar] [CrossRef]
  49. Oanh, T.K.; Nguyen, V.K.; De Greve, H.; Goddeeris, B.M. Protection of piglets against Edema disease by maternal immunization with Stx2e toxoid. Infect. Immun. 2012, 80, 469–473. [Google Scholar] [CrossRef]
  50. McSorley, S.J. The Role of Non-Cognate T Cell Stimulation during Intracellular Bacterial Infection. Front. Immunol. 2014, 5, 319. [Google Scholar] [CrossRef]
  51. O’Donnell, H.; McSorley, S.J. Salmonella as a model for non-cognate Th1 cell stimulation. Front. Immunol. 2014, 5, 621. [Google Scholar] [CrossRef] [PubMed]
  52. Nakayama, T.; Hirahara, K.; Onodera, A.; Endo, Y.; Hosokawa, H.; Shinoda, K.; Tumes, D.J.; Okamoto, Y. Th2 Cells in Health and Disease. Annu. Rev. Immunol. 2017, 35, 53–84. [Google Scholar] [CrossRef] [PubMed]
  53. Ren, W.; Yu, R.; Liu, G.; Li, N.; Peng, Y.; Wu, M.; Yin, Y.; Li, Y.; Fatufe, A.A.; Li, T. DNA vaccine encoding the major virulence factors of Shiga toxin type 2e (Stx2e)-expressing Escherichia coli induces protection in mice. Vaccine 2013, 31, 367–372. [Google Scholar] [CrossRef] [PubMed]
  54. Sato, T.; Matsui, T.; Takita, E.; Kadoyama, Y.; Makino, S.; Kato, K.; Sawada, K.; Hamabata, T. Evaluation of recombinant forms of the shiga toxin variant Stx2eB subunit and non-toxic mutant Stx2e as vaccine candidates against porcine edema disease. J. Vet. Med. Sci. 2013, 75, 1309–1315. [Google Scholar] [CrossRef]
Biomolecules 13 01726 g001
Figure 1. Amplification, clone, and expression of FedF and Stx2eA. (A) Amplification of fedF gene. M: DL 5000 DNA Marker. (B) Amplification of rstx2eA gene. M: DL 5000 DNA Marker. (C) Identification of recombinant plasmids by restriction endonuclease digestion. M: DL 10,000 DNA Marker; 1: pET28a-FedF; 2: pET28a-Stx2eA. (D) The results of Western blot for FedF and Stx2eA in BL21. M: Protein Marker. 1: BL21(pET28a-FedF); 2: BL21(pET28a-Stx2eA); 3: BL21(pET28a). Original images of (A–D) can be found in Supplementary Materials.
Figure 1. Amplification, clone, and expression of FedF and Stx2eA. (A) Amplification of fedF gene. M: DL 5000 DNA Marker. (B) Amplification of rstx2eA gene. M: DL 5000 DNA Marker. (C) Identification of recombinant plasmids by restriction endonuclease digestion. M: DL 10,000 DNA Marker; 1: pET28a-FedF; 2: pET28a-Stx2eA. (D) The results of Western blot for FedF and Stx2eA in BL21. M: Protein Marker. 1: BL21(pET28a-FedF); 2: BL21(pET28a-Stx2eA); 3: BL21(pET28a). Original images of (A–D) can be found in Supplementary Materials.
Biomolecules 13 01726 g001
Biomolecules 13 01726 g002
Figure 2. Plasmid maps and construction results, phenotypic characteristics of vaccine candidate strains. (A) Plasmid maps of pYA3493, pS-FedF, and pS-Stx2eA. (B) Identification of recombinant plasmid pS-FedF and pS-Stx2eA by restriction enzyme digestion. EcoR-I- and Hind-ΙΙΙ-digested pS-FedF and pS-Stx2eA. (C) The expression of FedF and Stx2eA in rSC0016 was analyzed by Western blot. (D) Growth curves of the rSC0016(pS-FedF), rSC0016(pS-Stx2eA), and rSC0016(pYA3493) strains in the LB medium. Original images of (B,C) can be found in Supplementary Materials.
Figure 2. Plasmid maps and construction results, phenotypic characteristics of vaccine candidate strains. (A) Plasmid maps of pYA3493, pS-FedF, and pS-Stx2eA. (B) Identification of recombinant plasmid pS-FedF and pS-Stx2eA by restriction enzyme digestion. EcoR-I- and Hind-ΙΙΙ-digested pS-FedF and pS-Stx2eA. (C) The expression of FedF and Stx2eA in rSC0016 was analyzed by Western blot. (D) Growth curves of the rSC0016(pS-FedF), rSC0016(pS-Stx2eA), and rSC0016(pYA3493) strains in the LB medium. Original images of (B,C) can be found in Supplementary Materials.
Biomolecules 13 01726 g002
Biomolecules 13 01726 g003
Figure 3. Detection of antibody titer in the immunized mice. (A) FedF-specific and Stx2eA-specific IgG antibody titer in serum determined by ELISA. (B) FedF-specific and Stx2eA-specific IgA antibody titer in vaginal rinses determined by ELISA. (C) OMPs-specific IgG antibody titer in serum determined by ELISA. The results are expressed as the mean ± SD. Degrees of significance are indicated as follows: * p <  0.05; ** p  <  0.01; ns p ≥ 0.05.
Figure 3. Detection of antibody titer in the immunized mice. (A) FedF-specific and Stx2eA-specific IgG antibody titer in serum determined by ELISA. (B) FedF-specific and Stx2eA-specific IgA antibody titer in vaginal rinses determined by ELISA. (C) OMPs-specific IgG antibody titer in serum determined by ELISA. The results are expressed as the mean ± SD. Degrees of significance are indicated as follows: * p <  0.05; ** p  <  0.01; ns p ≥ 0.05.
Biomolecules 13 01726 g003
Biomolecules 13 01726 g004
Figure 4. Levels of secreted IL-4 and IFN-γ were assayed by ELISA. Splenic lymphocytes were used to evaluate cytokine secretion in vitro following restimulation with purified FedF and Stx2eA protein, respectively. The results are expressed as the mean ± SD. Degrees of significance are indicated as follows: *** p < 0.01.
Figure 4. Levels of secreted IL-4 and IFN-γ were assayed by ELISA. Splenic lymphocytes were used to evaluate cytokine secretion in vitro following restimulation with purified FedF and Stx2eA protein, respectively. The results are expressed as the mean ± SD. Degrees of significance are indicated as follows: *** p < 0.01.
Biomolecules 13 01726 g004
Biomolecules 13 01726 g005
Figure 5. Protective efficacy of developed vaccine. Survival rates of mice after the Shiga-toxin-producing Escherichia coli challenge were determined.
Figure 5. Protective efficacy of developed vaccine. Survival rates of mice after the Shiga-toxin-producing Escherichia coli challenge were determined.
Biomolecules 13 01726 g005
Table 1. Bacterial strains and plasmids used in this study.
Table 1. Bacterial strains and plasmids used in this study.
Strains and PlasmidCharacteristicsSources, References, or Function
E. coli strains
DH5αFor amplification of the recombinant plasmid
BL21For expression of the recombinant plasmidsInvitrogen
χ7213thi-1, thr-1, leuB6, fhuA21, lacY1, glnV44, asdA4, recA1, RP4 2-Tc::Mu pir; KmrProvided by Dr. Roy Curtiss III
S. Choleraesuis
C78-3Wild-type, virulent, CVCC79103China Institute of Veterinary Drugs Control
rSC0016ΔPcrp527::TT araC PBADcrpΔpmi-2426ΔrelA199::araC PBADlacI TTΔsopB1686 ΔasdA33[41]
Shiga-toxin-producing Escherichia coli STEC20 Wild-type, virulent[42]
Plasmids
pYA3493Plasmid Asd+; pBR ori, β-lactamase signal sequence-based periplasmic secretion plasmidProvided by Dr. Roy Curtiss III
pET28aExpression vector, KanrNovagen
pMD19-TCloning vector; AmprTaKaRa
pET28a-FedFA recombinant expression vector containing FedF; KanrThis study
pET28a-rStx2eAA recombinant expression vector containing rStx2eA; KanrThis study
pS-FedFpYA3493 with FedFThis study
pS-rStx2eApYA3493 with rStx2eAThis study
Kanr, Kanamycin resistance; Ampr, Ampicillin resistance.
Table 2. The primers information.
Table 2. The primers information.
Primer NameSequences (5′-3′)References
fedF-28a-FCCGGAATTCACTCTACAAGTAGACAAGTCTGTTThis study
fedF-28a-RCCCAAGCTTTTACTGTATCTCGAAAACAAT
stx2eA-28a-1CCGGAATTCCAGGAGTTTACGATAGACTThis study
stx2eA-28a-2TATTTGCCTGAACTTTAAGGCTTGTGCTGTGACAGTGACAAAACG
stx2eA-28a-3CGTTTTGTCACTGTCACAGCACAAGCCTTAAAGTTCAGGCAAATA
stx2eA-28a-4CCCAAGCTTTTATTCACCAGTTGTATATAAAGG
pYA3493-FAACGCTGGTGAAAGTAAAAGATGThis study
pYA3493-RCAGACCGCTTCTGCGTTCT
pET-28a-FTAATACGACTCACTATAGGGThis study
pET-28a-RGCTAGTTATTGCTCAGCGG
fedF-3493-FCCGGAATTCACTCTACAAGTAGACAAGTCTGTTThis study
fedF-3493-RCCCAAGCTTCTGTATCTCGAAAACAAT
stx2eA-3493-FCCGGAATTCCAGGAGTTTACGATAGACTThis study
stx2eA-3493-RCCCAAGCTTTTCACCAGTTGTATATAAAGG
Underlined nucleotides denote enzyme restriction sites.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, G.; Fu, Y.; Li, Y.; Li, Q.; Wang, S.; Shi, H. Oral Immunization with Attenuated Salmonella Choleraesuis Expressing the FedF Antigens Protects Mice against the Shiga-Toxin-Producing Escherichia coli Challenge. Biomolecules 2023, 13, 1726. https://doi.org/10.3390/biom13121726

AMA Style

Zhang G, Fu Y, Li Y, Li Q, Wang S, Shi H. Oral Immunization with Attenuated Salmonella Choleraesuis Expressing the FedF Antigens Protects Mice against the Shiga-Toxin-Producing Escherichia coli Challenge. Biomolecules. 2023; 13(12):1726. https://doi.org/10.3390/biom13121726

Chicago/Turabian Style

Zhang, Guihua, Yang Fu, Yu’an Li, Quan Li, Shifeng Wang, and Huoying Shi. 2023. "Oral Immunization with Attenuated Salmonella Choleraesuis Expressing the FedF Antigens Protects Mice against the Shiga-Toxin-Producing Escherichia coli Challenge" Biomolecules 13, no. 12: 1726. https://doi.org/10.3390/biom13121726

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop