Propolis Extracts Inhibit UV-Induced Photodamage in Human Experimental In Vitro Skin Models
Abstract
:1. Introduction
2. Materials and Methods
2.1. Propolis Samples Collection, Extraction and Processing
2.2. Assessment of Total Phenolic Content
2.3. Assessment of Total Flavonoid Content
2.4. Evaluation of Cell-Free Antioxidant Activity by ABTS (2,2′-Azino-bis(3-Ethylbenzothiazoline-6-Sulfonic Acid) and DPPH (2,2-Diphenyl-1-Picrylhydrazyl) Assays
2.5. HPTLC Profiling
2.6. Cell Culture
2.7. Sulforhodamine B (SRB) Assay
2.8. Single Cell Gel Electrophoresis (Comet) Assay
2.9. Determination of Antioxidant Capacity in Cell Lysates
2.10. Assessment of Protein Carbonyl Content
2.11. Human Reconstituted Skin Tissue Model (EpiDermTM EPI-200)
2.12. Treatment and UVB Irradiation of EpiDermTM EPI-200
2.13. Quantitative Real-Time PCR
2.14. Immunohistochemistry (IHC)
2.15. Statistical Analysis
3. Results
3.1. Chemical Characterization, Assessment of Radical Scavenging Activity, and Cytotoxicity Profile of Propolis Extracts
3.2. Propolis Extracts Protect Human Epidermal Keratinocytes (HaCaT) Cells from UVB-Induced DNA Damage
3.3. Protection of HaCaT Cells by Propolis Extracts against UVB-Induced Oxidative Damage and Photoaging
3.4. Propolis Extracts Inhibit UVB-Induced Overexpression of Matrix Metalloproteinases (MMPs) in a Human Reconstituted Skin Model
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Matsumura, Y.; Ananthaswamy, H.N. Toxic effects of ultraviolet radiation on the skin. Toxicol. Appl. Pharmacol. 2004, 195, 298–308. [Google Scholar] [CrossRef]
- Stiefel, C.; Schwack, W. Photoprotection in changing times—UV filter efficacy and safety, sensitization processes and regulatory aspects. Int. J. Cosmet. Sci. 2015, 37, 2–30. [Google Scholar] [CrossRef]
- Calo, R.; Visone, C.M.; Marabini, L. Thymol and Thymus Vulgaris L. activity against UVA- and UVB-induced damage in NCTC 2544 cell line. Mutat. Res. Genet. Toxicol. Environ. Mutagen. 2015, 791, 30–37. [Google Scholar] [CrossRef]
- Cadet, J.; Sage, E.; Douki, T. Ultraviolet radiation-mediated damage to cellular DNA. Mutat. Res. 2005, 571, 3–17. [Google Scholar] [CrossRef]
- F’Guyer, S.; Afaq, F.; Mukhtar, H. Photochemoprevention of skin cancer by botanical agents. Photodermatol. Photoimmunol. Photomed. 2003, 19, 56–72. [Google Scholar] [CrossRef]
- Nishigori, C.; Hattori, Y.; Toyokuni, S. Role of reactive oxygen species in skin carcinogenesis. Antioxid. Redox Signal. 2004, 6, 561–570. [Google Scholar] [CrossRef]
- Laga, A.C.; Murphy, G.F. The translational basis of human cutaneous photoaging: On models, methods, and meaning. Am. J. Pathol. 2009, 174, 357–360. [Google Scholar] [CrossRef]
- Fisher, G.J.; Kang, S.; Varani, J.; Bata-Csorgo, Z.; Wan, Y.; Datta, S.; Voorhees, J.J. Mechanisms of photoaging and chronological skin aging. Arch. Dermatol. 2002, 138, 1462–1470. [Google Scholar] [CrossRef]
- Lee, K.H. Current developments in the discovery and design of new drug candidates from plant natural product leads. J. Nat. Prod. 2004, 67, 273–283. [Google Scholar] [CrossRef]
- Silva-Carvalho, R.; Baltazar, F.; Almeida-Aguiar, C. Propolis: A Complex Natural Product with a Plethora of Biological Activities That Can Be Explored for Drug Development. Evid. Based Complement. Alternat. Med. 2015, 2015, 206439. [Google Scholar] [CrossRef]
- Premratanachai, P.; Chanchao, C. Review of the anticancer activities of bee products. Asian Pac. J. Trop. Biomed. 2014, 4, 337–344. [Google Scholar] [CrossRef] [Green Version]
- Farooqui, T.; Farooqui, A.A. Molecular Mechanism Underlying the Therapeutic Activities of Propolis: A Critical Review. Curr. Nutr. Food Sci. 2010, 6, 86–199. [Google Scholar] [CrossRef]
- Moreira, L.; Dias, L.G.; Pereira, J.A.; Estevinho, L. Antioxidant properties, total phenols and pollen analysis of propolis samples from Portugal. Food Chem. Toxicol. 2008, 46, 3482–3485. [Google Scholar] [CrossRef] [Green Version]
- Fabris, S.; Bertelle, M.; Astafyeva, O.; Gregoris, E.; Zangrando, R.; Gambaro, A.; Pace Pereira Lima, G.; Stevanato, R. Antioxidant properties and chemical composition relationship of Europeans and Brazilians propolis. Pharmacol. Pharm. 2013, 4, 46–51. [Google Scholar] [CrossRef]
- Yang, H.; Dong, Y.; Du, H.; Shi, H.; Peng, Y.; Li, X. Antioxidant compounds from propolis collected in Anhui, China. Molecules 2011, 16, 3444–3455. [Google Scholar] [CrossRef]
- Miguel, M.G.; Nunes, S.; Dandlen, S.A.; Cavaco, A.M.; Antunes, M.D. Phenols and antioxidant activity of hydro-alcoholic extracts of propolis from Algarve, South of Portugal. Food Chem. Toxicol. 2010, 48, 3418–3423. [Google Scholar] [CrossRef]
- Valente, M.J.; Baltazar, A.F.; Henrique, R.; Estevinho, L.; Carvalho, M. Biological activities of Portuguese propolis: Protection against free radical-induced erythrocyte damage and inhibition of human renal cancer cell growth in vitro. Food Chem. Toxicol. 2011, 49, 86–92. [Google Scholar] [CrossRef] [Green Version]
- Nakanishi, I.; Uto, Y.; Ohkubo, K.; Miyazaki, K.; Yakumaru, H.; Urano, S.; Okuda, H.; Ueda, J.; Ozawa, T.; Fukuhara, K.; et al. Efficient radical scavenging ability of artepillin C, a major component of Brazilian propolis, and the mechanism. Org. Biomol. Chem. 2003, 1, 1452–1454. [Google Scholar] [CrossRef]
- Scazzocchio, F.; D’Auria, F.D.; Alessandrini, D.; Pantanella, F. Multifactorial aspects of antimicrobial activity of propolis. Microbiol. Res. 2006, 161, 327–333. [Google Scholar] [CrossRef]
- Silva, J.C.; Rodrigues, S.; Feas, X.; Estevinho, L.M. Antimicrobial activity, phenolic profile and role in the inflammation of propolis. Food Chem. Toxicol. 2012, 50, 1790–1795. [Google Scholar] [CrossRef] [Green Version]
- Mirzoeva, O.K.; Grishanin, R.N.; Calder, P.C. Antimicrobial action of propolis and some of its components: The effects on growth, membrane potential and motility of bacteria. Microbiol. Res. 1997, 152, 239–246. [Google Scholar] [CrossRef]
- Hu, F.; Hepburn, H.R.; Li, Y.; Chen, M.; Radloff, S.E.; Daya, S. Effects of ethanol and water extracts of propolis (bee glue) on acute inflammatory animal models. J. Ethnopharmacol. 2005, 100, 276–283. [Google Scholar] [CrossRef]
- Michaluart, P.; Masferrer, J.L.; Carothers, A.M.; Subbaramaiah, K.; Zweifel, B.S.; Koboldt, C.; Mestre, J.R.; Grunberger, D.; Sacks, P.G.; Tanabe, T.; et al. Inhibitory effects of caffeic acid phenethyl ester on the activity and expression of cyclooxygenase-2 in human oral epithelial cells and in a rat model of inflammation. Cancer Res. 1999, 59, 2347–2352. [Google Scholar]
- Paulino, N.; Abreu, S.R.; Uto, Y.; Koyama, D.; Nagasawa, H.; Hori, H.; Dirsch, V.M.; Vollmar, A.M.; Scremin, A.; Bretz, W.A. Anti-inflammatory effects of a bioavailable compound, Artepillin C, in Brazilian propolis. Eur. J. Pharmacol. 2008, 587, 296–301. [Google Scholar] [CrossRef]
- Sforcin, J.M. Propolis and the immune system: A review. J. Ethnopharmacol. 2007, 113, 1–14. [Google Scholar] [CrossRef]
- Orsolic, N.; Basic, I. Immunomodulation by water-soluble derivative of propolis: A factor of antitumor reactivity. J. Ethnopharmacol. 2003, 84, 265–273. [Google Scholar] [CrossRef]
- Chan, G.C.; Cheung, K.W.; Sze, D.M. The immunomodulatory and anticancer properties of propolis. Clin. Rev. Allergy Immunol. 2013, 44, 262–273. [Google Scholar] [CrossRef]
- Calhelha, R.C.; Falcao, S.; Queiroz, M.J.; Vilas-Boas, M.; Ferreira, I.C. Cytotoxicity of Portuguese propolis: the proximity of the in vitro doses for tumor and normal cell lines. BioMed Res. Int. 2014, 2014, 897361. [Google Scholar] [CrossRef]
- Sulaiman, G.M.; Ad’hiah, A.H.; Al-Sammarrae, K.W.; Bagnati, R.; Frapolli, R.; Bello, E.; Uboldi, S.; Romano, M.; Panini, N.; Scanziani, E.; et al. Assessing the anti-tumour properties of Iraqi propolis in vitro and in vivo. Food Chem. Toxicol. 2012, 50, 1632–1641. [Google Scholar] [CrossRef]
- Silva-Carvalho, R.; Miranda-Goncalves, V.; Ferreira, A.M. Antitumoural and antiangiogenic activity of Portuguese propolis in in vitro and in vivo models. J. Funct. Foods 2014, 11, 160–171. [Google Scholar] [CrossRef] [Green Version]
- Bolfa, P.; Vidrighinescu, R.; Petruta, A.; Dezmirean, D.; Stan, L.; Vlase, L.; Damian, G.; Catoi, C.; Filip, A.; Clichici, S. Photoprotective effects of Romanian propolis on skin of mice exposed to UVB irradiation. Food Chem. Toxicol. 2013, 62, 329–342. [Google Scholar] [CrossRef]
- Amoros, M.; Simoes, C.M.; Girre, L.; Sauvager, F.; Cormier, M. Synergistic effect of flavones and flavonols against herpes simplex virus type 1 in cell culture. Comparison with the antiviral activity of propolis. J. Nat. Prod. 1992, 55, 1732–1740. [Google Scholar] [CrossRef]
- Mirzoeva, O.K.; Calder, P.C. The effect of propolis and its components on eicosanoid production during the inflammatory response. Prostaglandins, Leukot. Essent. Fatty Acids 1996, 55, 441–449. [Google Scholar] [CrossRef]
- Orsatti, C.L.; Missima, F.; Pagliarone, A.C.; Bachiega, T.F.; Bufalo, M.C.; Araujo, J.P., Jr.; Sforcin, J.M. Propolis immunomodulatory action in vivo on Toll-like receptors 2 and 4 expression and on pro-inflammatory cytokines production in mice. Phytother. Res. 2010, 24, 1141–1146. [Google Scholar] [CrossRef]
- Orsi, R.O.; Funari, S.R.C.; Soares, A.M.V.C.; Calvi, S.A. Immunomodulatory action of propolis on macrophage activation. J. Venom. Anim. Toxins 2000, 6, 205–219. [Google Scholar] [CrossRef]
- Sá-Nunesa, A.; Facciolia, L.H.; Sforcin, J.M. Propolis: Lymphocyte proliferation and IFN-γ production. J. Ethnopharmacol. 2003, 87, 93–97. [Google Scholar] [CrossRef]
- Kubina, R.; Kabala-Dzik, A.; Dziedzic, A.; Bielec, B.; Wojtyczka, R.D.; Buldak, R.J.; Wyszynska, M.; Stawiarska-Pieta, B.; Szaflarska-Stojko, E. The Ethanol Extract of Polish Propolis Exhibits Anti-Proliferative and/or Pro-Apoptotic Effect on HCT 116 Colon Cancer and Me45 Malignant Melanoma Cells In Vitro Conditions. Adv. Clin. Exp. Med. 2015, 24, 203–212. [Google Scholar] [CrossRef]
- Ishihara, M.; Naoi, K.; Hashita, M.; Itoh, Y.; Suzui, M. Growth inhibitory activity of ethanol extracts of Chinese and Brazilian propolis in four human colon carcinoma cell lines. Oncol. Rep. 2009, 22, 349–354. [Google Scholar]
- Li, H.; Kapur, A.; Yang, J.X.; Srivastava, S.; McLeod, D.G.; Paredes-Guzman, J.F.; Daugsch, A.; Park, Y.K.; Rhim, J.S. Antiproliferation of human prostate cancer cells by ethanolic extracts of Brazilian propolis and its botanical origin. Int. J. Oncol. 2007, 31, 601–606. [Google Scholar] [CrossRef]
- Kuo, H.C.; Kuo, W.H.; Lee, Y.J.; Lin, W.L.; Chou, F.P.; Tseng, T.H. Inhibitory effect of caffeic acid phenethyl ester on the growth of C6 glioma cells in vitro and in vivo. Cancer Lett. 2006, 234, 199–208. [Google Scholar] [CrossRef]
- Chen, Y.J.; Shiao, M.S.; Hsu, M.L.; Tsai, T.H.; Wang, S.Y. Effect of caffeic acid phenethyl ester, an antioxidant from propolis, on inducing apoptosis in human leukemic HL-60 cells. J. Agric. Food Chem. 2001, 49, 5615–5619. [Google Scholar] [CrossRef] [PubMed]
- Watabe, M.; Hishikawa, K.; Takayanagi, A.; Shimizu, N.; Nakaki, T. Caffeic acid phenethyl ester induces apoptosis by inhibition of NFkappaB and activation of Fas in human breast cancer MCF-7 cells. J. Biol. Chem. 2004, 279, 6017–6026. [Google Scholar] [CrossRef] [PubMed]
- Hoff, J.E.; Singleton, K.I. A method for determination of tannins in foods by means of immobilized protein. J. Food Sci. 1997, 42, 1566–1569. [Google Scholar] [CrossRef]
- Miliauskas, G.; Venskutonis, P.R.; van Beek, T.A. Screening of radical scavenging activity of some medicinal and aromatic plant extracts. Food Chem. 2004, 85, 231–237. [Google Scholar] [CrossRef]
- Chatatikun, M.; Chiabchalard, A. Phytochemical screening and free radical scavenging activities of orange baby carrot and carrot (Daucus carota Linn.) root crude extracts. J. Chem. Pharm. Res. 2013, 5, 97–102. [Google Scholar]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
- Pellegrini, N.; Re, R.; Yang, M.; Rice-Evans, C. Screening of dietary carotenoids and carotenoid-rich fruit extracts for antioxidant activities applying 2, 2′-azinobis (3-ethylbenzothiazolyne-6-sulfonic acid) radical cation decolorization assay. Methods Enzymol. 1999, 299, 379–389. [Google Scholar]
- Lee, S.K.; Mbwambo, Z.H.; Chung, H.; Luyengi, L.; Gamez, E.J.; Mehta, R.G.; Kinghorn, A.D.; Pezzuto, J.M. Evaluation of the antioxidant potential of natural products. Com. Chem. High Throughput Screen. 1998, 1, 35–46. [Google Scholar]
- Olive, P.L.; Banath, J.P. The comet assay: A method to measure DNA damage in individual cells. Nat. Protoc. 2006, 1, 23–29. [Google Scholar] [CrossRef] [PubMed]
- Panayiotidis, M.; Tsolas, O.; Galaris, D. Glucose oxidase-produced H2O2 induces Ca2+-dependent DNA damage in human peripheral blood lymphocytes. Free Radic. Biol. Med. 1999, 26, 548–556. [Google Scholar] [CrossRef]
- Popova, M.P.; Graikou, K.; Chinou, I.; Bankova, V.S. GC-MS Profiling of Diterpene Compounds in Mediterranean Propolis from Greece. J. Agric. Food Chem. 2010, 58, 3167–3176. [Google Scholar] [CrossRef]
- Amaro-Ortiz, A.; Yan, B.; D’Orazio, J.A. Ultraviolet radiation, aging and the skin: Prevention of damage by topical cAMP manipulation. Molecules 2014, 19, 6202–6219. [Google Scholar] [CrossRef]
- D’Orazio, J.; Jarrett, S.; Amaro-Ortiz, A.; Scott, T. UV radiation and the skin. Int. J. Mol. Sci. 2013, 14, 12222–12248. [Google Scholar] [CrossRef]
- Lee, C.H.; Wu, S.B.; Hong, C.H.; Yu, H.S.; Wei, Y.H. Molecular Mechanisms of UV-Induced Apoptosis and Its Effects on Skin Residential Cells: The Implication in UV-Based Phototherapy. Int. J. Mol. Sci. 2013, 14, 6414–6435. [Google Scholar] [CrossRef] [Green Version]
- Danert, F.C.; Zampini, C.; Ordonez, R.; Maldonado, L.; Bedascarrasbure, E.; Isla, M.I. Nutritional and functional properties of aqueous and hydroalcoholic extracts from Argentinean propolis. Nat. Prod. Commun. 2014, 9, 167–170. [Google Scholar] [CrossRef]
- Andrade, J.K.S.; Denadai, M.; de Oliveira, C.S.; Nunes, M.L.; Narain, N. Evaluation of bioactive compounds potential and antioxidant activity of brown, green and red propolis from Brazilian northeast region. Food Res. Int. 2017, 101, 129–138. [Google Scholar] [CrossRef]
- Zhang, J.; Shen, X.; Wang, K.; Cao, X.; Zhang, C.; Zheng, H.; Hu, F. Antioxidant activities and molecular mechanisms of the ethanol extracts of Baccharis propolis and Eucalyptus propolis in RAW64.7 cells. Pharm. Biol. 2016, 54, 2220–2235. [Google Scholar] [CrossRef]
- Machado, B.A.; Silva, R.P.; Barreto Gde, A.; Costa, S.S.; Silva, D.F.; Brandao, H.N.; Rocha, J.L.; Dellagostin, O.A.; Henriques, J.A.; Umsza-Guez, M.A.; Padilha, F.F. Chemical Composition and Biological Activity of Extracts Obtained by Supercritical Extraction and Ethanolic Extraction of Brown, Green and Red Propolis Derived from Different Geographic Regions in Brazil. PLoS ONE 2016, 11, e0145954. [Google Scholar] [CrossRef]
- Socha, R.; Galkowska, D.; Bugaj, M.; Juszczak, L. Phenolic composition and antioxidant activity of propolis from various regions of Poland. Nat. Prod. Res. 2015, 29, 416–422. [Google Scholar] [CrossRef]
- Narimane, S.; Demircan, E.; Salah, A.; Ozcelik, B.O.; Salah, R. Correlation between antioxidant activity and phenolic acids profile and content of Algerian propolis: Influence of solvent. Pak. J. Pharm. Sci. 2017, 30, 1417–1423. [Google Scholar]
- Huang, S.; Zhang, C.P.; Wang, K.; Li, G.Q.; Hu, F.L. Recent advances in the chemical composition of propolis. Molecules 2014, 19, 19610–19632. [Google Scholar] [CrossRef]
- Varanda, E.A.; Monti, R.; Tavares, D.C. Inhibitory effect of propolis and bee venom on the mutagenicity of some direct- and indirect-acting mutagens. Teratog. Carcinog. Mutagen. 1999, 19, 403–413. [Google Scholar] [CrossRef]
- Roberto, M.M.; Matsumoto, S.T.; Jamal, C.M.; Malaspina, O.; Marin-Morales, M.A. Evaluation of the genotoxicity/mutagenicity and antigenotoxicity/antimutagenicity induced by propolis and Baccharis dracunculifolia, by in vitro study with HTC cells. Toxicol. In Vitro 2016, 33, 9–15. [Google Scholar] [CrossRef]
- Yalcin, C.O.; Aliyazicioglu, Y.; Demir, S.; Turan, I.; Bahat, Z.; Misir, S.; Deger, O. Evaluation of the radioprotective effect of Turkish propolis on foreskin fibroblast cells. J. Cancer Res. Ther. 2016, 12, 990–994. [Google Scholar] [CrossRef]
- Benkovic, V.; Kopjar, N.; Horvat Knezevic, A.; Dikic, D.; Basic, I.; Ramic, S.; Viculin, T.; Knezevic, F.; Orolic, N. Evaluation of radioprotective effects of propolis and quercetin on human white blood cells in vitro. Biol. Pharm. Bull. 2008, 31, 1778–1785. [Google Scholar] [CrossRef]
- Benkovic, V.; Knezevic, A.H.; Dikic, D.; Lisicic, D.; Orsolic, N.; Basic, I.; Kosalecm, I.; Kopjar, N. Radioprotective effects of propolis and quercetin in gamma-irradiated mice evaluated by the alkaline comet assay. Phytomedicine 2008, 15, 851–858. [Google Scholar] [CrossRef]
- Kim, H.B.; Yoo, B.S. Propolis Inhibits UVA-Induced Apoptosis of Human Keratinocyte HaCaT Cells by Scavenging ROS. Toxicol. Res. 2016, 32, 345–351. [Google Scholar] [CrossRef] [Green Version]
- Fonseca, Y.M.; Marquele-Oliveira, F.; Vicentini, F.T.; Furtado, N.A.; Sousa, J.P.; Lucisano-Valim, Y.M.; Fonseca, M.J. Evaluation of the Potential of Brazilian Propolis against UV-Induced Oxidative Stress. Evid. Based Complement. Alternat. Med. 2011, 2011, 863917. [Google Scholar] [CrossRef]
- Ebadi, P.; Fazeli, M. Anti-photoaging potential of propolis extract in UVB-irradiated human dermal fibroblasts through increasing the expression of FOXO3A and NGF genes. Biomed. Pharmacother. 2017, 95, 47–54. [Google Scholar] [CrossRef]
- Jin, U.H.; Chung, T.W.; Kang, S.K.; Suh, S.J.; Kim, J.K.; Chung, K.H.; Gu, Y.H.; Suzuki, I.; Kim, C.H. Caffeic acid phenyl ester in propolis is a strong inhibitor of matrix metalloproteinase-9 and invasion inhibitor: Isolation and identification. Clin. Chim. Acta 2005, 362, 57–64. [Google Scholar] [CrossRef]
- Saavedra, N.; Cuevas, A.; Cavalcante, M.F.; Dorr, F.A.; Saavedra, K.; Zambrano, T.; Abdalla, D.S.; Salazar, L.A. Polyphenols from Chilean Propolis and Pinocembrin Reduce MMP-9 Gene Expression and Activity in Activated Macrophages. Biomed. Res. Int. 2016, 2016, 6505383. [Google Scholar] [CrossRef]
- Pittayapruek, P.; Meephansan, J.; Prapapan, O.; Komine, M.; Ohtsuki, M. Role of Matrix Metalloproteinases in Photoaging and Photocarcinogenesis. Int. J. Mol. Sci. 2016, 17, 868. [Google Scholar] [CrossRef]
- Onoue, S.; Kobayashi, T.; Takemoto, Y.; Sasaki, I.; Shinkai, H. Induction of matrix metalloproteinase-9 secretion from human keratinocytes in culture by ultraviolet B irradiation. J. Dermatol. Sci. 2003, 33, 105–111. [Google Scholar] [CrossRef]
- Kim, C.; Ryu, H.-C.; Kim, J.-H. Low-dose UVB irradiation stimulates matrix metalloproteinase-1 expression via a BLT2-linked pathway in HaCaT cells. Exp. Mol. Med. 2010, 42, 833–841. [Google Scholar] [CrossRef]
- Ujfaludi, Z.; Tuzesi, A.; Majoros, H.; Rothier, B.; Pankotai, T.; Boros, I.M. Coordinated activation of a cluster of MMP genes in response to UVB radiation. Sci. Rep. 2018, 8, 2660. [Google Scholar] [CrossRef] [Green Version]
Propolis Sample | Origin | Season of Harvest |
---|---|---|
PR_1 | Arta Ano Peta | Fall 2013 |
PR_2 | Arta Mainland | Fall 2013 |
PR_3 | Mt Olympus | Fall 2013 |
PR_4 | Drama | Fall 2013 |
PR_5 | Arta Mountainous | Fall 2013 |
PR_6 | Serres | Fall 2013 |
PR_7 | Chania-Stavros | Fall 2013 |
PR_8 | Evia | Fall 2013 |
PR_9 | Mt Olympus | Spring 2013 |
Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
---|---|---|
MMP-1 | CCTCGCTGGGAGCAAACA | TTGGCAAATCTGGCGTGTAA |
MMP-3 | GAGGCATCCACACCCTAGGTT | ATCAGAAATGGCTGCATCGAT |
MMP-7 | CTGCATTTCAGGAAAGTTGTATGG | AGCTCCTCGCGCAAAGC |
MMP-9 | GGACGATGCCTGCAACGT | CAAATACAGCTGGTTCCCAATCT |
β-actin | GCGCGGCTACAGCTTCA | CTTAATGTCACGCACGATTTCC |
Propolis Extract | TPC C = 0.1 mg/mL mg GAE/g Extract | TFC C = 0.1 mg/mL mg QE/g Extract |
---|---|---|
PR_1a | 6.54 | 14.28 |
PR_2a | 8.87 | 14.81 |
PR_3a | 8.36 | 17.09 |
PR_4a | 8.30 | 19.48 |
PR_5a | 9.29 | 15.09 |
PR_6a | 10.93 | 16.78 |
PR_7a | 6.49 | 6.80 |
PR_8a | 5.37 | 9.98 |
PR_9a | 10.18 | 13.45 |
PR_10a | 10.72 | 11.99 |
PR_1b | 160.64 | 158.82 |
PR_2b | 151.16 | 181.43 |
PR_3b | 189.44 | 155.91 |
PR_4b | 107.73 | 101.51 |
PR_5b | 205.70 | 215.76 |
PR_6b | 154.51 | 134.88 |
PR_7b | 55.67 | 54.02 |
PR_8b | 93.90 | 75.09 |
PR_9b | 172.24 | 169.03 |
PR_10b | 74.79 | 58.64 |
Propolis Extract | ABTS Inhibition (%) (C = 0.33 mg/mL) | DPPH Inhibition (%) (C = 0.25 mg/mL) |
---|---|---|
PR_1b | 50.60 | 91.79 |
PR_2b | 44.90 | 91.93 |
PR_3b | 48.41 | 92.07 |
PR_4b | 32.44 | 88.62 |
PR_5b | 53.93 | 91.47 |
PR_6b | 44.80 | 90.36 |
PR_7b | 31.11 | 57.60 |
PR_8b | 27.11 | 83.90 |
PR_9b | 45.37 | 90.67 |
PR_10b | 23.83 | 62.99 |
Propolis Extract | EC50 (μg/mL) 1 | EC10 (μg/mL) 1 |
---|---|---|
PR_1b | 57.34 ± 3.45 | 22.18 ± 0.87 |
PR_9b | 69.30 ± 2.76 | 23.32 ± 0.76 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Karapetsas, A.; Voulgaridou, G.-P.; Konialis, M.; Tsochantaridis, I.; Kynigopoulos, S.; Lambropoulou, M.; Stavropoulou, M.-I.; Stathopoulou, K.; Aligiannis, N.; Bozidis, P.; et al. Propolis Extracts Inhibit UV-Induced Photodamage in Human Experimental In Vitro Skin Models. Antioxidants 2019, 8, 125. https://doi.org/10.3390/antiox8050125
Karapetsas A, Voulgaridou G-P, Konialis M, Tsochantaridis I, Kynigopoulos S, Lambropoulou M, Stavropoulou M-I, Stathopoulou K, Aligiannis N, Bozidis P, et al. Propolis Extracts Inhibit UV-Induced Photodamage in Human Experimental In Vitro Skin Models. Antioxidants. 2019; 8(5):125. https://doi.org/10.3390/antiox8050125
Chicago/Turabian StyleKarapetsas, Athanasios, Georgia-Persephoni Voulgaridou, Manolis Konialis, Ilias Tsochantaridis, Spyridon Kynigopoulos, Maria Lambropoulou, Maria-Ioanna Stavropoulou, Konstantina Stathopoulou, Nektarios Aligiannis, Petros Bozidis, and et al. 2019. "Propolis Extracts Inhibit UV-Induced Photodamage in Human Experimental In Vitro Skin Models" Antioxidants 8, no. 5: 125. https://doi.org/10.3390/antiox8050125