1. Introduction
Aging is a significant global challenge, marked by sharp increases in chronic diseases, such as diabetes, colon cancer, and Alzheimer’s disease. In addition, a poor diet contributes to a younger age at which aging manifests itself and increases its incidence. Chronic disease prevalence lowers quality of life and puts extra burden on public health system. Use of phytonutrients can be instrumental to address this issue. Studies reported the free radical-scavenging abilities of flavonoids, given the pivotal role of reactive oxygen species (ROS) in developing chronic diseases. Flavonoids have demonstrated potent antioxidant properties in laboratory settings [
1].
Flavonoids prevent age-related declines in memory and significantly promote human cognitive function [
2]. Evidence suggests that luteolin exhibits therapeutic potential in a transgenic
Drosophila melanogaster model of Alzheimer’s disease [
3]. Apigenin can mitigate the lifespan-reducing effects of D-galactose by enhancing antioxidant capabilities and preventing mitochondria-driven apoptosis in
Drosophila [
4]. To reduce the incidence of chronic diseases, the preventive effect of a daily diet is better than medical intervention. To minimize the incidence of chronic diseases, the preventive effect of a daily diet is better than medical intervention. Therefore, the concept of “Nutrition-sensitive agriculture (NSA)” was proposed in the Second International Conference on Nutrition (ICN2) in 2014 to address the increasingly severe problem of chronic diseases.
Due to its antioxidant activity, wheatgrass possesses preventive and therapeutic effects on various chronic diseases. In their early stages, the wheatgrass contained flavone-C-glycosides such as isoorientin and isovitexin [
5]. Another study identified 13 flavonoid glycosides in wheatgrass, which supports the above finding [
6]. The aglycones of flavonoid glycosides are mainly luteolin, chrysin, and apigenin; however, the structure of the specific glycosylation modification is complex and unclear. Moreover, the isolation and purification of the flavonoids in wheatgrass revealed disaccharide modifications and bis-glycosylation modifications on these glycosides, in addition to monoglycosylation modification [
7]. However, recent studies have primarily focused on identifying compound components, highlighting the need for broader screening of germplasm resources to support the practical application of wheatgrass.
Flavonoids play a role in plants’ defense response against pathogens. Wheat production faces significant losses due to various fungi, such as powdery mildew (caused by
Blumeria graminis f. sp.
Tritici,
Bgt) [
8]. Plant antimicrobial agents are mainly secondary metabolites. Soluble phenylpropanoids participated in the defensive responses against a soil-borne vascular pathogen
Verticillium longisporum in Arabidopsis [
9]. The introduction of the wheat
Lr34 gene into sorghum (
Sorghum bicolor) increased the expression levels of multiple genes involved in phenylpropanoid synthesis, such as
SbFNSII,
SbFNR, and
SbDFR3. The above change corresponded with the higher levels of luteolinidin observed in genotypes carrying
Lr34res at 72 h post-inoculation (hpi) [
10]. The significant presence of flavonoid glycosides in barley (
Hordeum vulgare L.) strengthens cell walls to confine
Fusarium graminearum in the initial infection area [
11]. Exogenous kaempferide and apigenin application on wheat spikes increased wheat resistance to Fusarium head blight (FHB) [
12].
Screening and analyzing the germplasm and commercial cultivars of wheat is an important step for identifying genotypes with high flavonoid and antioxidant properties. The objective of this study is to evaluate the changes in flavonoid content in a historical collection of wheat cultivars. By identifying genotypes with high flavonoid content, we aim to select potential parents for breeding programs to develop elite wheat cultivars with enhanced antioxidant properties.
2. Materials and Methods
2.1. Reagents and Chemicals
Acetonitrile (HPLC-grade) and Methanol (HPLC-grade) were procured from Sigma-Aldrich (St. Louis, MO, USA). Standards of isoorientin, isovitexin, and luteolin were obtained from Shanghai Yuanye Biotechnology Co., Ltd. (Shanghai, China). Sodium nitrite, potassium persulfate, aluminum chloride, and ferric chloride were obtained from Sangon Biotechnology Co., Ltd. (Shanghai, China). ABTS (2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)), TPTZ (2,4,6-Tripyridyl-S-triazine), and DPPH (1,1-Diphenyl-2-Picrylhydrazyl) were products obtained from Ourchem (Sinopharm Chemical Reagent, Shanghai, China).
2.2. Plant Genetic Resources and Growth Conditions
The wheat varieties were all previously reported [
13]. The germination and growth conditions for the wheat seedlings were as follows: immerse the dried wheat seeds in tap water for 16 h, sew them on pre-soaked filter paper, and maintain them at room temperature for 1 to 2 days to allow for germination. Upon observing the emergence of white embryonic roots, the germinating seeds were transferred to a 4 °C refrigerator and stored for a week before being transferred to the sterilized culture soil. The seedlings were grown in a chamber set at 22 °C under a 16 h light/8 h dark cycle. After one week, the aerial parts of the seedlings were collected, quickly washed with tap water, and then utilized for flavonoid extraction.
2.3. Extraction of Flavonoids from Wheatgrass
The samples were frozen in liquid nitrogen and homogenized in a tissue grinder, set at 55 Hz for 30 s, and repeated twice to ensure thorough homogenization. In total, 100 mg of the resulting fine powder was transferred into a clean centrifugal tube and received 80% methanol at a ratio of 1 mg of plant material to 10 μL of solvent. The samples were mixed in the tissue grinder at 60 Hz for one minute, repeating the process twice. The samples were sonicated for 30 min to efficiently extract the flavonoids from the leaf tissue. The homogenate was centrifuged at 12,000 rpm for 15 min. The supernatant was carefully drained into a fresh centrifuge tube and stored at 4 °C overnight. The next day, the supernatant was centrifuged at 12,000 rpm for 15 min. The clear supernatant was transferred to a new 1.5 mL centrifuge tube. The resulting solution was either used immediately for analysis or was stored in a low-temperature refrigerator at −80 °C for short-term storage. In the field test, the EMS mutants and control plants were grown without pesticide application at the farm in Fudan University, Shanghai, China (N: 31.329586, E: 121.522701). The powdery mildew naturally occurred in the field.
2.4. Total Flavonoid Content (TFC) Detection in Wheatgrass
We first added 90 μL of a 30% methanol solution into each well of a 96-well microplate and then mixed them with 10 μL flavonoid extract. The mixture was allowed to incubate at room temperature for 5 min to ensure proper blending. Following the initial incubation, each well was added 6 μL of a 5% sodium nitrate (NaNO3) solution, and the palter was rested for another 5 min. Subsequently, each well was received 6 μL of 5% aluminum chloride (AlCl3) solution and kept undisturbed for 10 min to facilitate the formation of the flavonoid–aluminum complex. Afterward, each well received 50 μL of 1 M sodium hydroxide (NaOH) solution to terminate the reaction. The plate was then set aside to rest for 5 min to stabilize the color change. Once the reaction was complete, the absorbance was measured in a microplate reader, using authentic catechin as the standard.
2.5. Antioxidant Activity Analysis
The 1,1-Diphenyl-2-picrylhydrazyl radical (DPPH) was dissolved into 80% methanol at 10 mM to prepare a stock solution, which was diluted with 80% methanol until the OD517 equaled 0.5 to prepare the DPPH working solution. In total, 10 μL of samples (standard, soluble, and wall-bound phenolic) were mixed with 190 μL of DPPH working solution in the dark. The samples were shaken for 10 s every 5 min at RT for 30 min, and we recorded their absorbances at 517 nm to calculate the corresponding DPPH radical scavenging activity following the standard curve ranging from 50 to 600 µM of luteolin. We used 80% methanol as the negative control.
A colorimetric method was applied to quantify the 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS)-removing activity. The ABTS reagent (7 mM ABTS and 2.45 mM K2S2O8, both in 5 mM PBS, pH 7.4) was prepared in the dark overnight, and was diluted with 5 mM of phosphate buffer (PBS) to OD734 equaling 0.7 ± 0.02. A volume of 195 μL ABTS reagent and 5 μL of crude extracts was mixed in a transparent 96-well plate and kept at 37 °C for five minutes. The absorbance at 734 nm was quantified using 80% methanol as the blank and PBS as the negative control. Authentic luteolin ranging from 50 to 600 µM worked as the standard to build the standard curve.
The Ferric ion-reducing antioxidant power (FRAP) working solution contained 300 mM pH3.6 acetate buffer, 10 mM TPTZ (TPTZ, 2,4,6-Tris (2-pyridyl)-s-triazine), and 20 mM FeCl
3 at a ratio of 10:1:1 (
v/
v). The FRAP solution (190 μL) and 10 μL of the samples (standard, soluble, and wall-bound phenolic) were mixed in a transparent 96-well plate and kept at 37 °C in the dark for 30 min with a 10 s shake every 5 min. The absorbance at 593 nm was measured to calculate the FRAP radical-scavenging activity according to the standard curve ranging from 50 to 600 µM with 80% methanol as the negative control [
14].
2.6. Characterization of Flavonoids
The samples were injected into a column at 30 °C, with the flow rate at 0.8 mL/min and the detection wavelength at 340 nm. The UHPLC-MS system included an Agilent 1290 ultrahigh-performance liquid chromatography system (UHPLC) coupled with an Agilent 6530B Accurate-Mass q-TOF (UHPLC-qTOF-MS) (Agilent Technologies, Inc., Lexington, MA, USA). Mass spectrometers were operated in the positive ion mode (ESI+). The MS spectra were acquired with a spectral mass-to-charge ratio range (m/z) of 110–950. All of the MS spectra were processed using the software package Qualitative Analysis and Profinder (Ver 8.08.00, Agilent Technologies, Inc., Lexington, MA, USA).
2.7. Detection of Flavonoids in Wheatgrass
The chromatographic column model is Thermo Accucore C18 (2.1 × 100 mm, 2.6 μm), employing a gradient elution method (
Table 1) equipped with the Thermo UltiMate 3000 Instrument (Thermo Fisher Scientific, Dreieich, Germany). The sample injection volume is 10 μL, the column temperature is set at 30 °C, and the flow rate is 0.8 mL/min. A DAD (Diode-Array Detector) is used for detection with the wavelength set to 340 nm. Chromatographic data are processed using the Thermo Chromeleon 7.2 SR4 software.
2.8. Powdery Mildew Infection Analysis
In the field trial at Fudan University in Shanghai, the EMS mutants in the Kronos background were infected by naturally occurring powdery mildew pathogens [
5]. Flag leaves at the ‘milk-ripe’ stage (Feekes Scale11.1) were collected and freeze-dried for further analysis. In controlled lab conditions, seedlings at the two leaves and one heart stage were inoculated with an equal density of fresh spores of an isolated
Bgt E09 pathogen [
15]. The samples were pictured and stained with Coomassie bright-blue (CBB) staining buffer at 4 or 8 days post-inoculation (DPI) to show powdery mildew development. At 8 DPI, the samples were collected to extract DNA and quantify the pathogen biomass.
2.9. DNA Extraction and Quantitative Real-Time PCR
Total DNA was extracted from 20 mg of the leaf powder prepared above using 1.0 mL of extraction buffer (60 °C) to each tube. The tubes were mixed well, incubated in a 60 °C water bath for 30 min, and mixed every 10 min. After cooling down to RT, the samples were mixed with 300 μL of ammonium acetate (stored at 4 °C) and incubated in a 4 °C refrigerator for 15 min. After centrifugation for 15 min at 13,000 rpm at 4 °C, supernatants were carefully drained into a new 1.5 mL tube with 360 μL of isopropanol. DNA was pelleted after centrifugation for 15 min at 13,000 rpm at 4 °C, rinsed with 75% ethanol, and air-dried. The dried DNA was dissolved in 100 μL of ddH2O overnight in a 4 °C refrigerator, and then was analyzed using real-time PCR using HieffTM qPCR SYBRTM Green Master Mix (Shanghai Yeasen Biotechnology, Shanghai, China) in a CFX 96-Realtime system (BIORAD, Singapore). Wheat or powdery mildew actin genes were applied with the following primers: TaAct-F(5′ TGTTGGTGATGAGGCGCAGT 3′) and TaAct-R (5′ TGCGACGTACATGGCAGGAA 3′), or BgtAct-F (5′ TTTGACCAGGAAATACAGACC 3′) and BgtAct-R (5′ AGAGCCACCAATCCATACAG 3′), respectively. Real-time PCR was performed following the PCR master mix instruction manual.
4. Discussion
This study investigated the trend in flavonoids in Chinese cultivars, landraces, and some international parental lines. In agreement with the flavonoid variations, these high-flavonoid cultivars have significantly higher antioxidant potential. Therefore, high-flavonoid cultivars are excellent genetic resources for boosting the health-promoting functions of wheatgrass. Furthermore, this study showed the main flavonoids in wheatgrass as C-glycosylated flavonoid glycosides, with the aglycones predominantly being apigenin, luteolin, and chrysoeriol. Glycosylation modifications include not only monosaccharide glycosylation, but also disaccharide and bis-glycosylation. As glycosylation modifications can potentially change the biochemical characters of flavonoids, cultivars with different combinations of flavonoid core and glycosylation modifications could meet the specialized needs of different customers. Although there were no commercial standards for each flavonoid glycoside present in wheatgrass, this work paved a critical step to correlate the flavonoids with antioxidant activities and potential anti-microbial functions.
The current study explored a collection of 145 wheat varieties, which provided insights into the content of flavonoids in wheat varieties from different historical periods in China. First, this study revealed that some cultivars introduced to China 60 years ago were rich in flavonoids, such as Mexipak 66 (
Figure 2). Mexipak 66 was first introduced to India and Pakistan and also has significant contributions to the Chinese wheat-breeding history. The current experiment suggested that Mexipak 66 could contribute to the high flavonoids in MCC. Second, this work found that wheat varieties developed in the past 20 years have a higher content of flavonoids, whereas few earlier breeders studied flavonoid content. This involuntarily increase is consistent with the correlation between flavonoids and resilience to environmental stresses in plants. The observation in this work provides a potential direction for subsequent selection and breeding of wheat elite cultivars that show advantages in their resilience to climate change.
Genetic factors play a significant role in the accumulation of flavonoids [
17]. Following our discovery that the content of flavonoids in the wheatgrass of Chinese wheat varieties has increased with the breeding process, we hypothesized that this may be due to the accumulation of flavonoids in some founder parents, leading to a continuous accumulation in subsequent varieties. Indeed, we found that the flavonoid content in some founder parents, such as XiaoYan96 and YanShi4Hao, is higher than in other varieties from the same era. However, there are also essential founder parents with low flavonoid content, such as YuMai2 and AiFeng3 (
Supplementary Figure S4). XiaoYan96 is famous for its high yield potential and resilience to fungal diseases, and the enriched flavonoids could contribute to disease tolerance in XiaoYan96 and its derived cultivars.
Flavonoids conferred antimicrobial activity widely in plants, e.g., desert cotton (
Avera Javanica), flax (
Linum ustitatissimum), and alfalfa (
Medicago sativa L.) [
18,
19]. The flavonoid mutants used here provided novel information for the role of different flavonoids in wheat fungal resistance. The correlation analysis between individual flavonoids and
Bgt resistance revealed four Luteolin C-glucoside derivatives with dominant contributions. The above phenomenon was consistent with a previous report that luteolin had a more potent inhibition on
Colletotrichum sublineolum spore germination in vitro than apigenin [
20]. The current data suggest a weak positive correlation between luteolin derivatives and
Bgt resistance in MCC. We studied a tetraploid wheat EMS mutant population to minimize the effect of unknown
Bgt resistance genes. The luteolin glucosides, based on the reduction in plaque coverages in
lif mutants at the early stage, could negatively regulate the germination of the
Bgt spore. As a result, luteolin C-glucoside is promising to select potentially resistant plants and improve fungal resistance in future wheat breeding programs.
Despite the positive correlation between flavonoids and
Bgt tolerance in cultivars (
Figure 3) and EMS mutants (
Figure 4 and
Figure 5), stronger genetic evidence is still needed to support flavonoids’ protective role in wheat against fungal pathogens. The cloning of candidate genes underpinning flavonoid accumulation and transgenic plants will significantly benefit the explanation of why recently grown varieties have accumulated more flavonoids. The correlation of flavonoids with wheat resistance could be a clue. Identifying critical genes in the cultivars and EMS mutants and studying their working mechanisms underlying the accumulation of flavonoids in wheatgrass may answer this question [
21]. We are now constructing subsequent genetic materials to clone the genes and elucidate the mechanisms underlying flavonoid variations.