Next Article in Journal
nZVI@BC as a Soil Amendment and Its Effects on Potted Rice Growth and Soil Properties
Next Article in Special Issue
Influence of Weather Conditions and the Aphid Population on the Potato Virus Y Infection of Tobacco in the Field
Previous Article in Journal
Leveraging Wheat Competition to Manage Seasonal Expansion of Feathertop Rhodes Grass (Chloris virgata)
Previous Article in Special Issue
Development of a Multiplex RT-PCR for Simultaneous Detection of Five Actinidia Viruses
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 8
10.3390/agronomy14081709
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China

by
Bin Zhang
1,†,
Liping Chen
1,†,
Pingping Sun
2,
Zhengnan Li
2 and
Lei Zhang
2,*
1
College of Life Science and Technology, Inner Mongolia Normal University, Hohhot 010018, China
2
College of Horticulture and Plant Protection, Inner Mongolia Agricultural University, Hohhot 010010, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2024, 14(8), 1709; https://doi.org/10.3390/agronomy14081709
Submission received: 27 June 2024 / Revised: 14 July 2024 / Accepted: 27 July 2024 / Published: 3 August 2024
(This article belongs to the Special Issue Viral Diseases and the Threats of Their Arthropod Vectors to Crop Health: Surveillance, Detection, and Early-Warning Systems)
Browse Figures
Versions Notes

Abstract

:
Purple coneflower (Echinacea purpurea L.), which is a perennial herbaceous plant belonging to the Asteraceae family, is extensively cultivated because of its medicinal applications. However, in Hohhot, Inner Mongolia, China, purple coneflowers in the field exhibited symptoms such as mottle, mosaic, and crinkle. This study aimed to explore the biological and molecular characteristics of the cucumber mosaic virus (CMV) infecting the purple coneflowers in China. We observed isometric particles approximately 30 nm in diameter in the symptomatic leaf specimens. Infection with the CMV was confirmed via high-throughput sequencing and RT-PCR validation. Mechanical inoculation assays demonstrated that the CMV-SGJ isolate could infect both Nicotiana benthamiana and Nicotiana tabacum. Three viral genomic components were identified: RNA1 with 3321 nucleotides, RNA2 with 3048 nucleotides, and RNA3 with 2209 nucleotides. Phylogenetic analysis revealed that the CMV-SGJ isolate clustered into phylogenetic subgroup IA, exhibiting a nucleotide identity of 92.2–95% with subgroup IA CMV isolates in GenBank. This report is the first documentation of the complete genome of the CMV infecting purple flowers in China.

1. Introduction

Purple coneflower (Echinacea purpurea L.) is a perennial herbaceous plant indigenous to North America that belongs to the Asteraceae family. It has ornamental qualities in gardens, is a popular choice in the cut flower market, and has significant medicinal value as an herbal treatment [1]. Additionally, it is commercially cultivated for the production of herbal teas and extracts and is believed to strengthen the immune system [2]. In China, purple coneflowers have been recognized in the veterinary field. In 2012, the plant, its powdered version, and the oral solution were officially recognized to be within the first category of novel veterinary drugs (Certification Numbers 2012-23, -24, and -25, respectively) [3]. Subsequently, in 2014 in China, the root and powder of the purple coneflower were certified as belonging to the second category of novel veterinary drugs (Certification Numbers 2014-44 and 2014-45, respectively) [4].
Purple coneflowers are susceptible to diseases. In 2002, Letchamo et al. reported that shoot fungi (Cercospora sp.) and root rot (Phymatotrichum omnivorum) were the most common fungal diseases that posed a threat to purple coneflower cultivation in farms in the United States [5]. In 2005, anomalous symptoms reminiscent of phytoplasma infections, including leaf greening, phyllody, and chlorosis, were observed in purple coneflower fields in northern Tasmania, Australia. This was the first report of the occurrence of witch’s broom phytoplasma (16SrII-D group) in the purple coneflower in Australia [6]. In 2012, Franova et al. [7] initially documented the presence of a 16SrIII-B subgroup phytoplasma linked to the symptoms of leaf virescence, reddening, and phyllody in purple coneflowers. In 2013, Dunich and Mishchenko reported that purple coneflower plants were infected with the tomato spotted blight virus [8]. In 2018, Garibaldi et al. [9] reported the first instance of Botrytis blight triggered by Botrytis cinerea, which affected purple coneflower in Italy. In the same year, they uncovered the presence of powdery mildew induced by Golovinomyces cichoracearum, affecting the Eastern purple coneflower in Italy [1]. Hwang et al. suggested that phytoplasma-induced yellow disease affects purple coneflowers.
Purple coneflower is propagated through seed or root cuttings. Notably, it is susceptible to viral diseases; this was well reviewed by Dunich and Mishchenko [10]. Among the viruses infecting purple coneflower, the cucumber mosaic virus (CMV), a highly destructive plant virus belonging to the genus Cucumovirus of the family Bromoviridae, has emerged as a prevalent and detrimental one. The CMV has an extensive host spectrum, being able to infect over 1200 species, encompassing monocotyledonous and dicotyledonous plants [11]. Subsequently, the CMV has been identified in various regions worldwide, encompassing Japan [12], the United States [13], New Zealand [14], Italy [15], Hungary [16], Belarus [17], China [18], Bulgaria [19], and Iran [20]. In 1964, the infection of the CMV in E. purpurea was first reported in Germany [21]. The CMV genome is composed of three linear, single-stranded, positive-sense RNAs named RNA1, RNA2, and RNA3, as well as two subgenomic RNAs referred to as RNA4 and RNA4a. The genetic blueprint of this virus comprises five proteins that are encoded by its specific genomic architecture [22,23]. CMV isolates are classified into subgroups I and II based on their biological characteristics, serological reactions, and molecular signatures [24,25]. Subgroup I is further divided into two groups, IA and IB, based on variability in the coat protein (CP) gene and the 5′ untranslated region (UTR) sequence [26]. Despite the prevalence of CMV infection, reports on its occurrence in purple coneflowers in China are limited. This study aimed to provide insight into the incidence of CMV isolates infecting purple coneflowers in China and explore their biological and molecular characteristics.

2. Materials and Methods

2.1. Viral Source

In 2022, instances of symptomatic purple coneflowers were documented in a field located in Hohhot, Inner Mongolia, China. Fresh leaf samples with symptoms of mottle, mosaic, and crinkle (Figure 1) were systematically collected to further investigate. These samples were immediately frozen in liquid nitrogen for 2 min and subsequently stored at −80 °C until use for mechanical sap transmission and high-throughput sequencing. This comprehensive approach aimed to elucidate the underlying factors contributing to the observed symptoms in purple coneflowers.

2.2. Electron Microscopy

The leaf samples were ground in 0.01 M phosphate-buffered saline (PBS) at a 1:10 (w/v) ratio. The samples were then centrifuged at 9000 rpm for 3 min. The supernatant was collected and deposited onto carbon-coated copper grids with a 37 µm aperture for 5 min. Subsequently, the grids were stained with 2% (w/v) sodium phosphotungstic acid solution for 20 min and were allowed to dry for 15 min. The fabricated specimens were examined using H-7650 transmission electron microscope (Hitachi High-Technologies, Tokyo, Japan) [27]. This technique provides high-resolution imaging, enabling the detailed examination of plant samples at the ultrastructural level.

2.3. Sap Transmission Experiments

To assess infectivity, herbaceous species of Nicotiana benthamiana and N. tabacum at the six-leaf stage and E. purpurea of about 15 cm in height were mechanically inoculated with sap extracted from the leaf samples; five individuals of each species were inoculated. The inoculum was prepared by pulverizing the leaf samples in 0.01 M PBS at a ratio of 1:10 (w/v) and subsequent blending with a small quantity of 600-mesh carborundum. The inoculum was gently applied to the fresh true leaves of the tested plants via rubbing them with a paintbrush. After 5 min, the plants were rinsed with tap water. As negative controls, another five plants representing each indicator species were inoculated with PBS. All inoculated plants were placed in a greenhouse maintained at 25 ± 3 °C with a 16 h light/8 h darkness period. Plants were regularly monitored for symptom development. At 21 days post-inoculation, the leaves from the tested plants were collected and frozen at −80 °C until subsequent reverse transcription polymerase chain reaction detection. This experiment was conducted to evaluate the transmission and symptom development in indicator plants, helping to characterize the nature of the infecting agent in purple coneflower leaf samples.

2.4. High-Throughput RNA Sequencing, Sequence Processing, and Assembly

Total RNA was isolated from representative samples of diseased leaves using TRIzol Reagent (Invitrogen, Shanghai, China) following the manufacturer’s guidelines. Ribosomal RNA (rRNA) was removed using a Ribo-Zero rRNA Removal Kit (Epicenter, Madison, WI, USA), followed by construction of an rRNA-depleted cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA). Library sequencing was conducted by Biozeron Biotechnology Co., Ltd. (Shanghai, China) using an Illumina HiSeq 6000 platform. Subsequently, adapter sequences were trimmed, and low-quality sequences were filtered using Trimmomatic software version 0.39 [28]. The refined reads were de novo assembled into contigs using the rnaviralSPAdes method in SPAdes v3.15.3 software (https://github.com/ablab/spades, (accessed on 20 June 2023)) with default configurations. The assembled contig datasets were subjected to homology analysis using a Basic Local Alignment Search Tool (BLAST) search.

2.5. CMV Genome Sequence

To verify the full genome sequence of the virus obtained by high-throughput sequencing, three primer pairs (Table 1) were designed using contig sequences as a reference. Single-stranded cDNA was synthesized using M-MLV reverse transcriptase (Promega, Madison, WI, USA), and PCR amplification was performed using KOD One™ PCR Master Mix (TOYOBO, Osaka, Japan). The 5′ and 3′ terminal sequences were amplified utilizing a SMARTer™ RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA). All the amplified products were retrieved, purified, cloned into the pMD18-T simple vector (TaKaRa, Dalian, China), and sequenced. Each amplicon was sequenced from three independent clones. The comprehensive genome sequence of the virus, referred to as CMV-SGJ, was constructed using Vector NTI, relying on overlapping sequences, and was deposited in the GenBank database under accession numbers PP942734, PP942735, and PP942736 for RNA1, RNA2, and RNA3, respectively. To examine the genome, ORFs and conserved domains within the encoded proteins were predicted using ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder, (accessed on 17 August 2023)) and MotifFinder (https://www.genome.jp/tools/motif/, (accessed on 20 August 2023)), respectively [29,30]. Genome sequences from the GenBank database were retrieved, and the identity values of the nucleotide and aa sequences were determined using SDT software version 1.2 [31].

2.6. Analyses of Evolutionary Relationships and Genetic Diversity

BLAST was used to compare the sequence of the CMV-SGJ coneflower isolate with those of the CMV deposited in the NCBI GenBank database. Nucleotide sequences of the coat protein genes of 81 CMV isolates from different countries were obtained from the NCBI GenBank database. The identity values of both the nucleotide and aa sequences were determined using SDTv1.2 software, and these sequences were aligned using MEGA 11 [32]. Phylogenetic trees were constructed on MEGA 11 using the maximum likelihood approach, incorporating 1000 bootstrap replications.

3. Results

In 2022, purple coneflowers with leaf mosaic, mottle, and crinkle were observed in a field in Hohhot, Inner Mongolia, China. Examination of the crude sap extracted from the original symptomatic purple coneflower leaves via transmission electron microscopy revealed isometric particles with diameters of approximately 30 nm (Figure 2).
The crude juice extracted from symptomatic leaf samples was inoculated into N. benthamiana, N. tabacum, and E. purpurea. The inoculated leaves did not exhibit local symptoms, whereas the systemic leaves manifested diverse viral disease symptoms. N. tabacum exhibited symptoms of leaf crinkle and mosaic (Figure 3a). N. benthamiana showed symptoms of leaf crinkle and distortion (Figure 3b), whereas E. purpurea showed symptoms of leaf mottle and crinkle (Figure 3c).
Using the three primer pairs (CMV-F1/CMV-R1, CMV-F2/CMV-R2, and CMV-F3/CMV-R3), three segments were amplified, which covered the entire genome of the CMV, with lengths of 3321 bp, 3048 bp, and 2209 bp, respectively (including the 5′ and 3′ UTRs). The complete genome sequence of the CMV-SGJ isolate in this study was reconstructed from three distinct fragments, along with the 5′ and 3′ terminal sequences, based on overlapping sections. We predicted the open reading frames (ORFs) and preserved regions or motifs within the encoded proteins, ultimately identifying a total of five ORFs (Table 2).
RNA1 encodes the 1a protein, comprising 993 amino acids (aa) spanning 95–3076 bp, which consists of two domains: the V methyltransferase domain, which facilitates RNA capping, and the helicase domain, which possesses helicase activity [33,34,35].
RNA2 harbors two overlapping ORFs, one encoding the 2a protein (858 aa) spanning 78–2654 bp, and the other encoding the 2b protein (111 aa) spanning 2413–2748 bp. The 2a protein encompasses the RdRp domain, which plays a pivotal role during replication [36], while the 2b protein functions as a viral suppressor of host defenses [37,38,39].
RNA3 also harbors two ORFs separated by a 292 bp intergenic region. MP (279 aa) spanned 120 to 959 bp, whereas CP (218 aa) spanned 1251 to 1907 bp. MP enables the cell-to-cell movement of the virus by augmenting the maximum allowable size for passage through the plasmodesmata. CP plays diverse roles, ranging from symptom manifestation to aphid-mediated transmission [40,41,42].
The three CMV-SGJ RNA sequences were deposited in the GenBank database (accession numbers RNA1—PP942734, RNA2—PP942735, and RNA3—PP942736). The entire available genome sequences were obtained from the National Center for Biotechnology Information (NCBI) database and aligned with the respective RNA1, RNA2, and RNA3 sequences of the CMV isolates. CMV isolates are categorized into three distinct subgroups: IA, IB, and II [43].
RNA1 exhibited nucleotide sequence identities ranging from 90 to 93.4%, 88.9 to 90.7%, and 76.7 to 77.6% with CMV isolates from subgroups IA, IB, and II, respectively. Notably, RNA1 demonstrated a peak nucleotide identity of 93.4% with the CMV isolate fly60335 (KX883763) reported in China. It shared aa identities of 93.2–95.9%, 90.5–94.6%, and 83.2–84.1% with IA, IB, and II, respectively. RNA1 shared a maximum aa identity of 95.9% with the CMV-Fny (D00356) and -SP (KY886409) isolates from Brazil.
RNA2 exhibited nucleotide sequence identities of 92.2–93.1%, 91.3–93.6%, and 73.1–73.7% with CMV isolates from subgroups IA, IB, and II, respectively. RNA2 had 93.6% nucleotide sequence identity with the CMV isolate HB24 (KC019300) reported in China. RNA2 shared aa identities of 75.8–97% and 79.1–94.6% with 2a and 2b, respectively. The 2a protein exhibited a maximum aa identity of 97% with the Ns isolate (CAD54665), while the 2b protein had a 94.6% aa identity with the MB-CMV isolate (AAD35093).
The MP genes of this sequence share 79.1–94.6% nucleotide identity and 84.9–97.1% aa identity. It had the highest level of 94.6%, with Japan D8 (AB004781) detected in Japanese radish plants. It also had an aa identity of 97.1% identity with IWD041J (BAW81752), CM95 (BAK61800), Fuka4-4 (BAK61795), and Mi (BAK61790) from Japan, and RP30 (AGN56079) and Can (BBD87889) from South Korea.
The CP genes of this sequence were compared with those of the 82 CMV isolates/strain sequences obtained from GenBank. Phylogenetic analysis revealed that isolate CMV-SGJ belonged to phylogenetic subgroup IA (Figure 4). The CP genes of RNA3 had nucleotide identities of 92.2–95%, 92.5–94.6%, and 78.3–79.7% with CMV isolates from subgroups IA, IB, and II, respectively (Figure 5). The CP genes shared a maximum nucleotide identity of 95% with Ukr-514 (KT199739) from Ukraine. It had aa identities of 93.6–96.2%, 95–99.1%, and 81.1–84.3% with IA, IB, and II, respectively (Figure 6). It also shared a maximum aa identity of 99.1% with Ukr-8 (KT199742), Ukr-sq13 (KJ921837), and Ukr-tom2 (KJ921838) from Ukraine.

4. Discussion

In the NCBI GenBank, sequences of 12 CMV isolates derived from Echinacea plants are available, including the WA-CMV isolate from the United States (EU677748), the CMV-ECH isolate from Italy (EU432180) [44], the 2-1-2 isolate from China (EF088683) [45], the P-EP-Ukr-19 isolate from Ukraine (MT978189), and the 1J, 3J, 5J, 6J, 9J, 10J, 11J, and 12J isolates from Poland (OR750493, OR750494, OR750495, OR750496, OR750497, OR750498, OR750499, and OR750500, respectively). However, our phylogenetic analysis did not include all sequences. The Italian isolate sequence was that of the movement protein gene, whereas the CP genetic sequences from the American and Chinese isolates exhibited minimal overlap with ours. Additionally, the Ukraine isolate belonged to group IB, as indicated by its CP gene sequence, and the Polish isolates were placed within phylogenetic group II.
Based on the biology, particle morphology, serology, and dsRNA pattern of the virus, Guifen et al. [18] first reported a CMV infection in E. purpurea. However, the occurrence of coinfections or simultaneous infections with two or more viral species within a single plant is common in nature. Using traditional methodologies that rely solely on serological reactions or targeted primers to identify all viruses present in a single sample poses a significant challenge. Consequently, high-throughput sequencing has become increasingly popular for viral identification in plant tissues [46]. Theoretically, this approach enables the detection of all viruses present in tested plant tissues. This article is based on the report of Guifen et al. in which they constructed the whole genome of the CMV infecting purple coneflowers, analyzed the consistency of CMV nucleic acid and aa sequences, and its evolution was analyzed.
Phylogenetic analysis revealed that the CP nucleotide and aa sequences of CMV-SGJ had the highest similarity with those of pumpkin isolates, with remarkably high identities ranging from 93.2 to 95% at the nucleotide level and 95 to 99.1% at the aa level. The remarkably high sequence identity between the purple coneflower and pumpkin isolates is believed to result from the transmission of the CMV between purple coneflower plantations and pumpkin fields, facilitated by viral vectors such as aphids. In future research, we will study how viral vectors, such as aphids, transmit the CMV between purple flower plantations and pumpkin fields.

5. Conclusions

Purple coneflowers showing symptoms of mottle, mosaic and crinkle were observed in the field, the pathogens can be transmitted to N. benthamiana, N. tabacum and Purple coneflower plants through sap inoculation and cause symptoms. Using a transmission electron microscope, isometric particles were observed in the symptomatic samples. High-throughput RNA sequencing revealed the existence of CMV in the samples, and by RT-PCR and RACE amplification, the cDNA of the RNA1, RNA2, and RNA3 of the CMV were amplified for determining the complete genome of the CMV, namely CMV-SGJ. Phylogeny analysis revealed that the CMV-SGJ isolate clustered into phylogenetic subgroup IA. This was the first documentation of the complete genome of CMV infecting purple flowers in China.

Author Contributions

Conceptualization, Z.L. and L.Z.; methodology, B.Z.; software, L.C.; validation, P.S. and Z.L.; formal analysis, B.Z. and L.C.; investigation, P.S.; resources, L.Z.; data curation, L.C.; writing—original draft preparation, B.Z. and L.C.; writing—review and editing, L.Z. and P.S.; visualization, Z.L.; supervision, L.Z.; project administration, L.Z. and Z.L.; funding acquisition, B.Z., Z.L. and L.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32260122), the Natural Science Foundation of Inner Mongolia, China (grant nos. 2023LHMS03020 and 2022QN03018), and the Research Start-up Funds for High-level Researchers in Inner Mongolia Agricultural University (grant no. NDYB2019-1).

Data Availability Statement

The data presented in this study are openly available in GenBank under accession numbers PP942734 (CMV RNA1), PP942735 (CMV RNA2), and PP942736 (CMV RNA3).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Garibaldi, A.; Gilardi, G.; Franco Ortega, S.; Gullino, M.L. First Report of Botrytis Blight Caused by Botrytis cinerea on Purple Coneflower in Italy. Plant Dis. 2018, 102, 821. [Google Scholar] [CrossRef]
  2. Lee, I.M.; Bottner, K.D.; Dally, E.L.; Davis, R.E. First Report of Purple Coneflower Phyllody Associated with a 16SrI-B Phytoplasma in Maryland. Plant Dis. 2008, 92, 654. [Google Scholar] [CrossRef]
  3. China’s Ministry of Agriculture. Announcement No. 1787 of the Ministry of Agriculture. In China, the Purple Coneflower, Its Powder and Oral Solution Have Been Certificated by China’s Ministry of Agriculture as the Second Class New Veterinary Drug; China’s Ministry of Agriculture: Beijing, China, 19 June 2012. (In Chinese) [Google Scholar]
  4. China’s Ministry of Agriculture. Announcement No. 2171 of the Ministry of Agriculture. In China, the Purple Coneflower Root and Root Powder Have Been Certificated by China’s Ministry of Agriculture as the Second Class New Veterinary Drug; China’s Ministry of Agriculture: Beijing, China, 24 November 2014. (In Chinese) [Google Scholar]
  5. Hwang, S.F.; Chang, K.F.; Howard, R.J.; Khadhair, A.H.; Gaudiel, R.G.; Hiruki, C. First report of a yellows phytopiasma disease in purple coneflower (Echinace spp.) in canada. Z. Pflanzenkrankh. Pflanzenschutz 1997, 104, 182–192. [Google Scholar]
  6. Letchamo, W.; Polydeonny, L.V.; Gladisheva, N.O.; Arnason, T.J.; Livesey, J.; Awang, D. Factors affecting Echinacea quality. In Trends in New Crops and New Uses: Proceedings of the Fifth National Symposium New Crops and New Uses: Strength in Diversity, Atlanta, GA, USA, 10–13 November 2001; Janick, J., Whipkey, A., Eds.; ASHS Press: Alexandria, VA, USA, 2002; pp. 514–521. [Google Scholar]
  7. Pearce, T.; Scott, J.; Pethybridge, S. First Report of Witch’s Broom Phytoplasma (16SrII-D Group) in Purple Coneflower in Australia. Plant Dis. 2011, 95. [Google Scholar] [CrossRef] [PubMed]
  8. Franova, J.; Spak, J.; Simkova, M. First report of a 16SrIII-B subgroup phytoplasma associated with leaf reddening, virescence and phyllody of purple coneflower. Eur. J. Plant Pathol. 2012, 136, 7–12. [Google Scholar] [CrossRef]
  9. Dunich, A.; Mishchenko, L. Heavy metals content in virus infected purple coneflower plants. Bull. Taras Shevchenko Natl. Univ. Kyiv. Ser. Biol. 2013, 65, 22–26. [Google Scholar]
  10. Dunich, A.A.; Mishchenko, L.T. Purple coneflower viruses: Species diversity and harmfulness. Biopolym. Cell 2015, 31, 15–28. [Google Scholar] [CrossRef]
  11. Stanković, I.; Vučurović, A.; Zečević, K.; Petrović, B.; Nikolić, D.; Delibašić, G. Characterization of cucumber mosaic virus and its satellite RNAs associated with tomato lethal necrosis in Serbia. Eur. J. Plant Pathol. 2021, 160, 301–313. [Google Scholar] [CrossRef]
  12. Yamamoto, T.; Ishii, M.; Sasaya, T.; Iwasaki, M. Mosaic disease of Echinacea (Echinacea purpurea, Compositae). Proc. Assoc. Pl. Protec Shikoku 1993, 28, 49–53. [Google Scholar]
  13. Beckerman. Cucumber mosaic virus. Yard Gard. Line New 2001, 3, 21–23. [Google Scholar]
  14. Rangahau, M.K. Echinacea—The purple coneflowers. Crop Food Res. 2001, 33, 12–13. [Google Scholar]
  15. Bellardi, M.G.; Rubies–Autonell, C.; Hudaib, M. Effect of Cucumber mosaic virus infection on the quality of Echinacea purpurea root extracts. J. Plant Pathol. 2001, 83, 69. [Google Scholar]
  16. Horvath, J.; Baracsi, E.; Takacs, A.; Kazinczi, G.; Gaborjanyi, R.; Krajczinger, R. Virus infection of ornamental plants in Hungary. Cereal Res. Commun. 2006, 34, 485–488. [Google Scholar] [CrossRef]
  17. Voinylo, N.V. Some aspects of protection of floral and ornamental plants against viral diseases in botanical gardens. Plant Prot. Minsk. 2006, 30, 190–191. [Google Scholar]
  18. Li, G.; Zhu, S.; Zhou, Q.; Shi, Z.; Zhang, Y.; Li, M. Identification of Cucumber mosaic virus isolated from Echinacea purpurea. Plant Prot. 2007, 33, 54–56. [Google Scholar]
  19. Dikova, B. Establishment of some viruses—Polyphagues on economically important essential oil–bearing and medicinal plants in Bulgaria. Biotechnol. Biotechnol. Equip. 2009, 23, 80–84. [Google Scholar] [CrossRef]
  20. Kardani, S.G.; Rastegar, M. Identification and management of Cucumber mosaic virus in Purple coneflower (Echinacea purpurea) Farms. Iran. Med. Plants Technol. 2019, 2, 34–46. (In Persian) [Google Scholar]
  21. Muehle, E.; Schumann, K. On the presence of Cucumber mosaic virus (Marmor cucumeris H.) on Echinacea purpurea (L.) Moench. Pharmazie 1964, 19, 417–421. [Google Scholar]
  22. De Wispelaere, M.; Rao AL, N. Production of cucumber mosaic virus RNA5 and its role in recombination. Virology 2009, 384, 179–191. [Google Scholar] [CrossRef]
  23. Lot, H.; Marchoux, G.; Marrou, J.; Kaper, J.M.; West, C.K.; Van Vloten-Doting, L.; Hull, R. Evidence for three functional RNA species in several strains of cucumber mosaic virus. J. Gen. Virol. 1974, 22, 81–93. [Google Scholar] [CrossRef]
  24. Anderson, B.J.; Boyce, P.M.; Blanchard, C.L. RNA 4 sequences from cucumber mosaic virus subgroups, I and II. Gene 1995, 161, 293–294. [Google Scholar] [CrossRef] [PubMed]
  25. Quemada, H.; Kearney, C.; Gonsalves, D.; Slightom, J.L. Nucleotide sequences of the coat protein genes and fanking regions of cucumber mosaic virus strains C and WL RNA 3. J. Gen. Virol. 1989, 70, 1065–1073. [Google Scholar] [CrossRef] [PubMed]
  26. Rossinck, M.J.; Zhang, L.; Hellwald, K.H. Rearrangements in the 5′ nontranslated region and phylogenetic analyses of cucumber mosaic virus RNA 3 indicate radial evolution of three subgroups. J. Virol. 1999, 73, 6752–6758. [Google Scholar] [CrossRef]
  27. Song, S.; Cui, J.; Lei, G.; Chen, Y.; Yang, M.; Li, Z.; Zhang, J. Occurrence, infectivity and molecular characterization of hosta virus X in North-east China. Can. J. Plant Pathol. 2020, 42, 595–603. [Google Scholar] [CrossRef]
  28. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
  29. Belete, M.T.; Gudeta, W.F.; Kim, S.E.; Igori, D.; Moon, J.S. Complete genome sequence of Codonopsis torradovirus A, a novel torradovirus infecting Codonopsis Ianceolata in South Korea. Arch Virol. 2021, 166, 3473–3476. [Google Scholar] [CrossRef] [PubMed]
  30. Liang, X.; Mei, S.; Yu, H.; Zhang, S.; Wu, J.; Cao, M. Mixed infection of an emaravirus, a Crinivirus, and a begomovirus in Pueraria lobata (Wild) Ohwi. Front. Microbiol. 2022, 13, 926724. [Google Scholar] [CrossRef]
  31. Muhire, B.M.; Varsani, A.; Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PLoS ONE 2014, 9, e108277. [Google Scholar] [CrossRef]
  32. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  33. Rozanov, M.N.; Koonin, E.V.; Gorbalenya, A.E. Conservation of the putative methyltransferase domain: A hallmark of the ‘Sindbis-like’supergroup of positive-strand RNA viruses. J. Gen. Virol. 1992, 73, 2129–2134. [Google Scholar] [CrossRef]
  34. Habili, N.; Symons, R.H. Evolutionary relationship between luteoviruses and other RNA plant viruses based on sequence motifs in their putative RNA polymerases and nucleic acid helicases. Nucleic Acids Res. 1989, 17, 9543–9555. [Google Scholar] [CrossRef] [PubMed]
  35. Palukaitis, P.; García-Arenal, F. Cucumoviruses. Adv. Virus Res. 2003, 62, 241–323. [Google Scholar] [PubMed]
  36. Argos, P. A sequence motif in many polymerases. Nucleic Acids Res. 1988, 16, 9909–9916. [Google Scholar] [CrossRef]
  37. Brigneti, G.; Voinnet, O.; Li, W.X.; Ji, L.H.; Ding, S.W.; Baulcombe, D.C. Retracted: Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J. 1998, 17, 6739–6746. [Google Scholar] [CrossRef] [PubMed]
  38. González, I.; Martínez, L.; Rakitina, D.V.; Lewsey, M.G.; Atencio, F.A.; Llave, C.; Kalinina, N.O.; Carr, J.P.; Palukaitis, P.; Canto, T. Cucumber mosaic virus 2b protein subcellular targets and interactions: Their significance to RNA silencing suppressor activity. Mol. Plant-Microbe Interact. 2010, 23, 294–303. [Google Scholar] [CrossRef] [PubMed]
  39. Guo, H.S.; Ding, S.W. A viral protein inhibits the long range signaling activity of the gene silencing signal. EMBO J. 2002, 21, 398–407. [Google Scholar] [CrossRef]
  40. Gera, A.; Loebenstein, G.; Raccah, B. Protein coats of two strains of cucumber mosaic virus affect transmission by Aphis gossypii. Phytopathology 1979, 69, 396–399. [Google Scholar] [CrossRef]
  41. Pirone, T.P.; Blanc, S. Helper-dependent vector transmission of plant viruses. Annu. Rev. Phytopathol. 1996, 34, 227–247. [Google Scholar] [CrossRef]
  42. Shintaku, M.H.; Zhang, L.; Palukaitis, P. A single amino acid substitution in the coat protein of cucumber mosaic virus induces chlorosis in tobacco. Plant Cell 1992, 4, 751–757. [Google Scholar]
  43. Roossinck, M.J. Evolutionary history of Cucumber mosaic virus deduced by phylogenetic analyses. J. Virol. 2002, 76, 3382–3387. [Google Scholar] [CrossRef]
  44. Davino, S.; Panno, S.; Rangel, E.A.; Davino, M.; Bellardi, M.G.; Rubio, L. Population genetics of cucumber mosaic virus infecting medicinal, aromatic and ornamental plants from northern Italy. Arch. Virol. 2012, 157, 739–745. [Google Scholar] [CrossRef] [PubMed]
  45. Zhang, Y.-J.; Li, G.-F.; Zhu, S.-F.; Shi, Z.-W.; Li, M.-F. The analysis on the characteristics of the coat protein genes of Cucumber mosaic virus isolated from Echinacea purpurea Moench. Acta Agric. Univ. Jiangxiensis 2007, 1, 34–37. [Google Scholar]
  46. Liang, P.; Navarro, B.; Zhang, Z.; Wang, H.; Lu, M. Identification and characterization of a novel geminivirus with a monopartite genome infecting apple tree. J. Gen. Virol. 2015, 96, 2411–2420. [Google Scholar] [CrossRef] [PubMed]
Agronomy 14 01709 g001
Figure 1. Purple coneflower field onset symptoms: (a) the leaf mosaic and (b) the leaf mottle and crinkle in the purple coneflower in the field.
Figure 1. Purple coneflower field onset symptoms: (a) the leaf mosaic and (b) the leaf mottle and crinkle in the purple coneflower in the field.
Agronomy 14 01709 g001
Agronomy 14 01709 g002
Figure 2. Transmission electron micrographs of the particles of the cucumber mosaic virus from the crude extracts of (a) the sample showing mosaic symptoms and (b) the sample exhibiting mottle and crinkle symptoms. Red arrows indicate the viral particles.
Figure 2. Transmission electron micrographs of the particles of the cucumber mosaic virus from the crude extracts of (a) the sample showing mosaic symptoms and (b) the sample exhibiting mottle and crinkle symptoms. Red arrows indicate the viral particles.
Agronomy 14 01709 g002
Agronomy 14 01709 g003
Figure 3. Cucumber mosaic virus-induced symptoms on tested plants: (a) the crinkle and mosaic in the inoculated N. tabacum; (b) the leaf crinkle and distortion in the inoculated N. benthamiana; and (c) the leaf mottle and crinkle on the inoculated E. purpurea. The left of each figure is a healthy plant, and the right is the symptomatic plant.
Figure 3. Cucumber mosaic virus-induced symptoms on tested plants: (a) the crinkle and mosaic in the inoculated N. tabacum; (b) the leaf crinkle and distortion in the inoculated N. benthamiana; and (c) the leaf mottle and crinkle on the inoculated E. purpurea. The left of each figure is a healthy plant, and the right is the symptomatic plant.
Agronomy 14 01709 g003
Agronomy 14 01709 g004
Figure 4. Phylogeny tree for CMV isolates based on their coat protein gene sequences. The tree was reconstructed on MEGA11 using the neighbor-joining method with a bootstrap replicate of 1000. The CMV-SGJ detected in this work is in purple color.
Figure 4. Phylogeny tree for CMV isolates based on their coat protein gene sequences. The tree was reconstructed on MEGA11 using the neighbor-joining method with a bootstrap replicate of 1000. The CMV-SGJ detected in this work is in purple color.
Agronomy 14 01709 g004
Agronomy 14 01709 g005
Figure 5. Visual representation depicting pairwise nucleotide identities among 82 CMV isolates, including a percentage identity scale. CMV-SGJ is indicated by red arrows.
Figure 5. Visual representation depicting pairwise nucleotide identities among 82 CMV isolates, including a percentage identity scale. CMV-SGJ is indicated by red arrows.
Agronomy 14 01709 g005
Agronomy 14 01709 g006
Figure 6. Visual representation of pairwise amino acid identities among 82 CMV isolates, including a percentage identity scale. CMV-SGJ is indicated by red arrows.
Figure 6. Visual representation of pairwise amino acid identities among 82 CMV isolates, including a percentage identity scale. CMV-SGJ is indicated by red arrows.
Agronomy 14 01709 g006
Table 1. Three primer pairs designed based on the contig sequences.
Table 1. Three primer pairs designed based on the contig sequences.
Gene NamePrimer Sequence (5′–3′)
RNA1-FGAGCAATTACAGCATCAACGT
RNA1-RCGGACCGAAGTCCTTCCGAA
RNA2-FTACAAGAGCGTACGGTTCAACC
RNA2-RAGCAATACTGCCAACTCAGCTC
RNA3-FCGTCGTGTCGAGTCGTGTTGT
RNA3-RGCACGTTGTGCTAGAAGTACAC
Table 2. Description of RNA fragments of CMV-SGJ.
Table 2. Description of RNA fragments of CMV-SGJ.
RNAProteinProtein Length (aa)Starting Position (bp)Ending Position (bp)
RNA11a993703051
RNA22a858782654
2b11124132748
RNA3MP279120959
CP21812511907
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, B.; Chen, L.; Sun, P.; Li, Z.; Zhang, L. Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China. Agronomy 2024, 14, 1709. https://doi.org/10.3390/agronomy14081709

AMA Style

Zhang B, Chen L, Sun P, Li Z, Zhang L. Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China. Agronomy. 2024; 14(8):1709. https://doi.org/10.3390/agronomy14081709

Chicago/Turabian Style

Zhang, Bin, Liping Chen, Pingping Sun, Zhengnan Li, and Lei Zhang. 2024. "Biological and Molecular Characterization of the Cucumber Mosaic Virus Infecting Purple Coneflowers in China" Agronomy 14, no. 8: 1709. https://doi.org/10.3390/agronomy14081709

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop