Skip to main content
Download PDF

Nuclear heterogeneous nuclear ribonucleoprotein D is associated with poor prognosis and interactome analysis reveals its novel binding partners in oral cancer

Journal of Translational Medicine volume 13, Article number: 285 (2015) Cite this article

Abstract

Background

Post-transcriptional regulation by heterogeneous ribonucleoproteins (hnRNPs) is an important regulatory paradigm in cancer development. Our proteomic analysis revealed hnRNPD overexpression in oral dysplasia as compared with normal mucosa; its role in oral carcinogenesis remains unknown. Here in we determined the hnRNPD associated protein networks and its clinical significance in oral squamous cell carcinoma (OSCC).

Methods

Immunoprecipitation (IP) followed by tandem mass spectrometry was used to identify the binding partners of hnRNPD in oral cancer cell lines. Ingenuity pathway analysis (IPA) was carried out to unravel the protein interaction networks associated with hnRNPD and key interactions were confirmed by co-IP-western blotting. hnRNPD expression was analyzed in 183 OSCCs, 44 oral dysplasia and 106 normal tissues using immunohistochemistry (IHC) and correlated with clinico-pathological parameters and follow up data over a period of 91 months. Kaplan–Meier survival and Cox-multivariate-regression analyses were used to evaluate the prognostic significance of hnRNPD in OSCC.

Results

We identified 345 binding partners of hnRNPD in oral cancer cells. IPA unraveled novel protein–protein interaction networks associated with hnRNPD and suggested its involvement in multiple cellular processes: DNA repair, replication, chromatin remodeling, cellular proliferation, RNA splicing and stability, thereby directing the fate of oral cancer cells. Protein–protein interactions of hnRNPD with 14-3-3ζ, hnRNPK and S100A9 were confirmed using co-IP-western blotting. IHC analysis showed significant overexpression of nuclear hnRNPD in oral dysplasia [p = 0.001, Odds ratio (OR) = 5.1, 95 % CI = 2.1–11.1) and OSCCs (p = 0.001, OR = 8.1, 95 % CI = 4.5–14.4) in comparison with normal mucosa. OSCC patients showing nuclear hnRNPD overexpression had significantly reduced recurrence free survival [p = 0.026, Hazard ratio = 1.95, 95 % CI = 1.0–3.5] by Kaplan–Meier survival and Cox-multivariate-regression analyses and has potential to define a high-risk subgroup among OSCC patients with nodal negative disease.

Conclusions

Our findings suggest novel functions of hnRNPD in cellular proliferation and survival, besides RNA splicing and stability in oral cancer. Association of nuclear hnRNPD with poor prognosis in OSCC patients taken together with its associated protein networks in oral cancer warrant future studies designed to explore its potential as a plausible novel target for molecular therapeutics.

Background

Post-transcriptional regulation of mRNA stability and translation by RNA binding proteins (RBPs) is a key determinant of gene expression [1–3]. These RNA–protein interactions dictate the ultimate fate of the transcripts and are emerging as an important regulatory paradigm in cancer development [3, 4]. The mRNA decay kinetics is largely controlled by presence of specific cis-acting sequence and/or structural determinants within each transcript [5, 6]. About 16 % of all human protein coding genes are encoded by mRNAs that contain an adenylate-uridylate (AU)-rich element [ARE] motif within their 3′UTR [1, 2, 5, 6]. AU-rich RNA-binding factor (AUF1)/heterogeneous nuclear ribonucleoprotein D (hnRNPD) is an ARE-binding protein which regulates the mRNA stability of many genes involved in cell cycle, proliferation, survival, senescence and stress response [1, 2, 3, 4, 5, 7, 8, 9, 10, 11]. This protein harbors two RNA-binding domains arranged in tandem and a glycine-rich region in the C-terminus (2x RBD-Gly) and regulates the cellular half-life of many mRNAs by directly interacting with AREs in their 3′untranslated region [12–15]. Overexpression of hnRNPD in vivo resulted in deregulation of mRNAs including c-myc, c-jun, c-fos, and tumor necrosis factor-α (TNF-α) which promote tumorigenesis suggesting an oncogenic role of hnRNPD [1, 2, 3, 16, 17]. Increased hnRNPD expression also reduced the cell cycle checkpoint regulators p21 and p16Ink4a, a critical mediator of senescence [10, 18, 19]. Nuclear hnRNPD has been shown to activate the transcription promoter for telomerase catalytic subunit Tert, and links maintenance of telomere length and normal aging to attenuation of inflammatory cytokine expression and inhibition of cellular senescence [20].

Head and neck squamous cell carcinoma (HNSCC) ranks as the sixth leading cause of cancer related deaths worldwide [21]. HNSCCs often show heterogeneous pathologic and clinical features and diverse outcome [22, 23]. HNSCC is among the most morbid human malignancies and the quality of life in survivors is poor. Moreover, HNSCC patients often have recurrence of the tumor at the same site, or develop second primary tumors, frequently attributed to field cancerization [8]. Oral squamous cell carcinomas (OSCCs) comprise a large proportion of HNSCCs. The lack of clinically proven biomarkers limits therapeutic decisions to be solely based on tumor site and staging. However, tumors with similar clinical features can differ in disease outcome [24]. A better understanding of the molecular pathogenesis of OSCC is urgently needed for rigorous disease management. The development of OSCCs is often preceded by clinically distinct oral lesions such as leukoplakia or erythroplakia with histological evidence of squamous cell hyperplasia or dysplasia; on an average about one percent of these lesions transform to cancer annually. The oral lesions with histologically proven dysplasia are called Oral premalignant or potentially malignant lesions (OPLs). Identification of OPLs at high risk of progression to cancer is a high priority to enable early intervention, prior to development of frank malignancy for more effective disease management and improve the quality of life in survivors [25]. We reported overexpression of hnRNPD in human oral premalignant lesions by proteomic analysis [26]. In this study, interactome analysis was undertaken to gain an insight into hnRNPD associated protein–protein networks, by identifying its binding partners in oral cancer cells using immunoprecipitation followed by liquid chromatography—tandem mass spectrometry (LC–MS/MS). Bioinformatic analysis based cellular networks and pathways were identified and protein–protein interactions were confirmed using oral cancer cells. Further, we also determined the significance of hnRNPD overexpression in clinical specimens of oral dysplasia and cancer and correlated with disease outcome.

Methods

Cell culture

Oral squamous cell carcinoma (OSCC) cell line, SCC4 was obtained from American Type Culture Collection (ATCC), HSC2 (JCRB0622) from Health Science Research Resources Bank, Japan (HSRRB); Tu167 and MDA1986 were a kind gift from MD Anderson Cancer Centre (Houston, Texas). All cell lines were characterized using short tandem repeat polymorphism (STR) analysis. OSCC cells were grown in monolayer cultures in Dulbecco’s modified eagle medium (DMEM) (Sigma Aldrich, St. Louis, MO) supplemented with 10 % fetal bovine serum (FBS) (Sigma), 1 mM l-glutamine, 100 μg/ml streptomycin and 100 U/ml penicillin in a humidified incubator (5 % carbon-dioxide, 95 % air) at 37 °C as described previously [26, 27].

Patients, tissue specimens, clinicopathological data and follow-up

The Institutional Human Ethics Committee of All India Institute of Medical Sciences (AIIMS), New Delhi, India, approved this study prior to its commencement (NO.IESC/T-261/03.06.2011). Tissue specimens were obtained from patients with oral dysplasia (n = 44) as revealed by H&E staining from Department of Otorhinolaryngology, All India Institute of Medical Sciences (AIIMS) and from 183 OSCC patients undergoing curative cancer surgery during the period 2002–2008, after obtaining patients’ consent, while 106 non-malignant oral tissues with histological evidence of normal epithelium constituted the normal group. Patient demographic, clinical, and pathological data were recorded in a pre-designed performa [27].

Of the 183 OSCCs, 144 cases could be followed-up in the head-and-neck cancer follow-up clinic at regular time intervals up to a maximum period of 91 months as of May, 2013. The patients were revisited clinically on a regular basis and the time to recurrence was recorded. Of these 144 OSCC patients, loco-regional relapse was observed in 60 cases (41.7 %), while 14 patients died (9.7 %) as determined from follow-up reports. If a patient died, the survival time was censored at the time of death; the medical history, clinical examination, and radiological evaluation were used to determine whether the death had resulted from recurrent cancer (relapsing patients) or from any other causes. Recurrence-free survivors (RFS) were defined as patients free from clinical and radiological evidence of local or regional recurrence or death at the time of the last follow-up.

Real time-PCR analysis of hnRNPD mRNA levels in OSCCs and normal oral mucosa

For this study, hnRNPD mRNA level was determined in 12 paired tumor and normal tissue samples. Total RNA was extracted from a small portion of the biopsies OSCCs and normal oral tissues with Trizol reagent (Invitrogen, CA) according to the manufacturer’s protocol. The quality of the isolated RNA was tested by its optical density (260/280 ratio is 2.0). The expression of hnRNPD was quantified by real-time PCR (RT-qPCR). Total RNA (1 μg) was reverse-transcribed using Reverse transcriptase (Thermo Scientific, Waltham, MA, USA) using oligo-dT primers according to the manufacturer’s instructions. Real-time PCR reactions were performed and quantified by Maxima SYBR Green (Thermo Scientific, Waltham, MA, USA) using CFX96 Touch™ Real-Time PCR Detection System (BioRad, Hercules, CA, USA) using the ribosomal 18S gene as an internal control for normalisation. All assays were performed in triplicate in a 20 μl two-step reaction. The specificity of the amplified PCR products was assessed by melting curve analysis and agarose gel electrophoresis of a small aliquot of the reaction followed by staining with ethidium bromide. The efficiency of the qPCR reaction was measured in separate assays using cDNA obtained from total RNA of SCC4, HSC2, TU167 and MDA1986 oral cancer cell lines. The primer sequences are shown: hnRNPD–Sense: GCCTTTCTCCAGATACACCTGAAG; Antisense: CTTATTGGTCTTGTTGTCCA TGGG and 18S ribosomal–Sense: GTAACCCGTTGAACCCCATT, Antisense: CCA TCCAATCGGTAGTAGCG.

Immunoblotting

Whole-cell lysates were prepared from OSCC cells (SCC4/HSC2/Tu167/MDA1986), oral normal tissues (n = 4), dysplasia (n = 2), and OSCC (n = 8) by homogenization in RIPA lysis buffer [26, 27]. Equal amounts of proteins (60 μg/lane) were resolved and electro-transferred onto polyvinylidene-difluoride (PVDF) membrane. After blocking blots were incubated with rabbit polyclonal hnRNPD antibody at 4 °C overnight. β-actin served as a control for equal protein loading in each lane. Membranes were incubated with their respective HRP-conjugated secondary antibody (DAKO Cytomation, Glostrup, Denmark), diluted at an appropriate dilution in 1 % BSA, for 2 h at room temperature. Protein bands were detected by the enhanced chemiluminescence method (ECL, Pierce, IL) on XO-MAT film.

Immunoprecipitation

Oral cancer cells (SCC4/MDA1986) were lyzed in IP-lysis buffer as described [20]. Lysates were pre-cleared with Protein A-Sepharose (GE Healthcare Biosciences, Sweden), and immunecomplexes were obtained by incubation with polyclonal hnRNPD antibody and pulled down by incubating with Protein A-Sepharose. In negative controls, only Protein A Sepharose beads were added to eliminate proteins that bind non-specifically to the beads. Immunecomplexes were resolved on 10 % SDS-PAGE, stained with gel code blue and analyzed by reverse phase (RP)-liquid chromatography mass spectrometry (LC–MS/MS) as described [28, 29].

Reverse phase (RP)-liquid chromatography mass spectrometry (LC–MS/MS)

The proteins bands were excised from gels and digested with trypsin as described [28, 29]. The digested peptides from each band were analyzed in duplicates using a Nanobore LC system (LC Packings, Amsterdam, Netherlands) and a QSTAR Pulsar mass spectrometer (Applied Biosystems/MDS SCIEX, Foster City, CA) in positive ion mode, externally calibrated with bovine serum albumin tryptic peptides [28, 29]. MS data were acquired in information-dependent acquisition (IDA) mode using Analyst QS 1.1 software (Applied Biosystems/MDS SCIEX). The LC–MS/MS was performed using a 1 s TOF–MS survey scan from 400 to 1500 Da, followed by four, 2 s product-ion scans, from 80 to 2000 Da, of the five most-abundant peaks. The collision energy (CE) was automatically controlled by the IDA CE parameter script. Switching criteria were set for ions with m/z ≥ 400 and <1500, charge states of +2 to +4, and abundances of ≥10 counts. Former target ions were excluded for 30 s, and ions within a 100-ppm window were ignored. To minimize redundancy in subsequent iterations, precursor ion exclusion (PIE) list was added to LC–MS/MS method as described earlier [28, 29].

Identification of binding partners

LC–MS/MS data of each sample was used to identify proteins by searching a concatenated Swissprot/Panther database of 66082 distinct human protein entries (version June 2, 2010). The database was searched using Proteinpilot software, version 2.0.1 (AB SCIEX, Foster City), and the Paragon algorithm [30]. Protein identification was performed at a confidence threshold of 95 % (Proteinpilot Unused score ≥1.3) with methyl methanethiosulfonate (MMTS) selected as cysteine modification, and with the search option ‘emphasis on biological modifications’ checked. Peptide and protein summaries were generated. Only proteins identified with local false discovery rate (FDR) equal to, or less than, 5 % were considered for further analysis [28, 29]. Redundant proteins and peptides, proteins identified in reverse sequence and in negative controls (i.e. beads only) were removed from the list of identified proteins.

Confocal laser scan microscopy (CLSM)

For CLSM, 5 × 104 OSCC cells (SCC4/MDA1986) were plated on cover slips and grown for 24 h fixed in acetone: methanol mixture (1:1) at −20 °C for 20 min. [28]. Cells were permeabilized with PBS-0.1 % Tween 20, non-specific binding blocked with 5 % BSA for 1 h; cells were incubated with rabbit polyclonal hnRNPD (ab50692)/mouse monoclonal hnRNPK (ab23644, Abcam, CA) antibody at 4 °C overnight. Expression of proteins was determined using fluorescein isothiocyanate (FITC)/TRITC-labeled secondary antibodies (DAKO Cytomation, Denmark) [27].

Immunohistochemistry of hnRNPD, hnRNPK and 14-3-3ζ in oral tissues and scoring

Paraffin-embedded tissue sections were deparaffinized, antigen was retrieved, endogenous peroxidase activity was quenched with hydrogen peroxide (0.3 % v/v) and non-specific binding blocked with 1 % bovine serum albumin (BSA). The slides were incubated with either rabbit polyclonal anti-hnRNPD antibody (1 μg/ml, ab50692, Abcam, CA) or mouse monoclonal anti-hnRNPK antibody (ab23644) or rabbit polyclonal 14-3-3ζ antibody (sc-1019) for 16 h at 4 °C. The primary antibody was detected using the Dako Envision kit (Dako CYTOMATION, Glostrup, Denmark) with diaminobenzidine as the chromogen and counterstained with hematoxylin [26, 27]. The sections were evaluated by light microscopy and scored using a semi-quantitative scoring system for both staining intensity (nuclear/cytoplasmic) and percentage positivity as described earlier [26, 27]. The tissue sections were scored based on the % of immunostained cells as: 0–10 % = 0; >10–30 % = 1; >30–50 % = 2; >50–70 % = 3 and >70–100 % = 4. Sections were also scored semi-quantitatively on the basis of staining intensity as negative = 0; mild = 1; moderate = 2; intense = 3. Finally, a total score was obtained by adding the score of percentage positivity and intensity giving a score range from 0 to 7. IHC score thus obtained for different proteins were subjected to statistical analysis.

Statistical analysis

The immunohistochemical data were subjected to statistical analyses using the SPSS 20.0 software (Chicago, IL, USA). Sensitivity and specificity was calculated using receiver operating characteristic (ROC) analyses. Based on sensitivity and specificity values a cut-off ≥4 was defined as positive criterion for hnRNPD (nuclear/cytoplasmic). The relationships between hnRNPD and clinicopathological parameters were tested using Chi Square and Fischer’s exact test. Two-sided p-values were calculated and p < 0.05 was considered to be significant. Similarly, positive predictive value (PPV) and negative predictive value (NPV) were calculated for hnRNPD overexpression in oral lesions and OSCCs in comparison with normal oral mucosa. The correlation of hnRNPD staining with patient survival was evaluated using life tables constructed from survival data with Kaplan–Meier plots and Cox regression multivariate analysis. In order to confirm the association among hnRNPD, hnRNPK and 14-3-3ζ overexpression in clinical specimens of OSCCs, we performed Kappa analysis to determine the agreement of association between these proteins using their IHC scores. One of the most important features of the Kappa statistical analysis is its ability to measure the degree of agreement or reliability of agreement [26–28].

Results

Expression of hnRNPD in oral cancer cells and tissues

Real time PCR and Western blotting were performed to determine the expression of hnRNPD transcripts and protein expression levels respectively in oral cancer cells (SCC4, HSC2, Tu167 and MDA1986), OSCCs and normal oral mucosa tissues. Real time PCR analysis revealed increased hnRNPD transcript levels in oral cancer cell lines (SCC4, HSC2, Tu167 and MDA1986) and OSCC tissue samples in comparison with normal oral epithelium (Fig. 1a, p = 0.007). These data were further verified using Western blot analysis.

Fig. 1
figure 1

Analysis of hnRNPD expression in oral tissues. a Quantitative real time PCR (qPCR) analysis of hnRNPD transcripts in oral cancer cells, OSCCs and normal tissues. i Analysis of hnRNPD mRNA levels in oral cancer cell line. Total cellular RNA from various oral cancer cell lines (SCC-4, HSC-2, Tu-167, MDA-1986) were isolated, reverse transcribed and subjected to real time PCR analysis using specific hnRNPD primers. Simultaneously real time PCR for 18S ribosomal RNA was performed and served as an internal control for normalization. After real time PCR the 2−Δct value of hnRNPD mRNA obtained in SCC-4 cells was assigned a value of 1 and the fold increase in other cell lines was calculated relative to this. Histogram shows the relative abundance of hnRNPD transcripts in SCC4, HSC2, Tu167 and MDA1986. ii Expression of hnRNPD transcripts in 12 random OSCCs samples and their paired normal tissues. Total cellular RNA was isolated from OSCCs and their paired normal tissues, reverse transcribed, and subjected to real time PCR analysis using specific hnRNPD primers. Parallel real time PCR for 18S ribosomal RNA was performed which served as an internal control for normalization of hnRNPD mRNA levels in OSCC and paired normal tissues. After normalization the fold increase in the levels of hnRNPD transcripts in each OSCC sample over their respective paired normal tissue was calculated and plotted individually. hnRNPD mRNA levels were significantly higher in oral OSCCs patients as compared to their paired normal oral tissue samples (p = 0.007, Mann–Whitney U test). Bar graph data is represented by fold changes of OSCCs samples after normalization with paired normal tissue samples. iii A representation of scatter plot after normalized 2−Δct values of each OSCCs and paired normal tissue samples. b Western blot analysis. Photomicrograph showing protein expression of hnRNPD in (i) oral cancer cell lines (SCC4, HSC2, Tu167 and MDA1986); ii tissue lysates obtained from normal oral mucosa (n1–n4), oral dysplasia (d1, d2) and OSCCs (t1–t8). Panel shows increased expression of hnRNPD in dysplasia (d1, d2) and OSCCs (t1–t8) as compared to normal mucosa (n1–n4). Whole cell lysates prepared from SCC4 cells was used as a positive control. β-actin was used as loading control (lower panel)

Full size image

Western blot analysis showed a single intense band of 37 kDa in all the oral cancer cell lines tested (SCC4, HSC2, Tu167 and MDA167, Fig. 1b), dysplasia (d1, d2) and OSCCs (t1–t8) demonstrating the presence of only p37/AUF1 isoform of hnRNPD. Faint or no expression of hnRNPD was observed in normal oral tissues (n1–n4), while an intense band was observed in OSCCs, thus confirming hnRNPD protein overexpression in OSCCs (Fig. 1b).

Identification of binding partners of hnRNPD in OSCC cells

To gain an insight into the role of hnRNPD in OSCCs, we identified its binding partners in oral cancer cell lines (SCC4 and MDA1986). Immunoprecipitates obtained from SCC4 and MDA1986 cells using hnRNPD specific antibody were separated on 10 % SDS-PAGE, stained with gel-code blue, 35 protein bands were excised from the immunoprecipated sample and from the mock treated sample, digested with trypsin and subjected to RP-LC–MS/MS analysis for identification of proteins (Additional file 1: Figure S1A, Additional file 2: Figure S1B). Our novel approach using multiple iterations and development of precursor ion exclusion (PIE) list for protein identification revealed 345 binding partners of hnRNPD in oral cancer cell lines (Additional file 3: Table S1). Our approach revealed interactions of hnRNPD with 17 members of hnRNP family including hnRNPA2/B1, hnRNPK, hnRNPU, hnRNPG suggesting that hnRNPD forms heterodimers with its family members (Additional file 3: Table S1). hnRNPD also showed interactions with proteins involved in short-interfering-RNA (RNAi)-mediated gene silencing (EIF2C1, EIF2C2, EIF2C3), DNA repair (XRCC5, XRCC6), chromatin remodeling (SMARCC1, SMARCC2, SMARCB1; histone family of proteins including H1, H2A, H2B and H4), tumor protein 63 (TP63), transcription factors (zinc finger domain proteins, ZC3HAV1, ZCCHC8), cell signaling proteins (IGFBP, G3BP1, GNB2L1, NCL), nuclear-shuttling proteins (14-3-3ζ), S100A9 (calcium binding protein) and several other proteins involved in RNA splicing, stability and decay (ribosomal proteins 28S, 40S and 60S; ATP dependent RNA helicases, mRNA cap guanine-N7 methyltransferase, RNMT, RAE1) supporting its function in translation (Additional file 3: Table S1).

Network analysis of hnRNPD protein interactions

Ingenuity pathway analysis (IPA) was carried out to generate the network of proteins identified in the hnRNPD interactome analysis. The criteria applied for the search of major biological function categories were maximum number of proteins and a significant p value. Our network analysis revealed novel signaling proteins that may interact (directly/indirectly) with hnRNPD and/or regulate its associated networks (Fig. 2) in addition to the proteins identified in our proteomics analysis. IPA analysis revealed 90 canonical signaling pathways significantly associated with hnRNPD (p-value <0.001, Additional file 3: Table S2). The binding partners of hnRNPD identified herein were also classified on the basis of their cellular functions (Additional file 3: Figure S1B). Cleavage and polyadenylation of pre-mRNA, nucleotide excision repair pathway, EIF2 signaling, mammalian target of rapamycin (mTOR) signaling, regulation of eukaryotic initiation factor 4 (eIF4) and p70S6K signaling, nitric oxide synthase (NOS), and estrogen receptor signaling emerged as significant pathways associated with hnRNPD (Fig. 2; Additional file 3: Table S2).

Fig. 2
figure 2

IPA analysis based hnRNPD networks in oral cancer. Network analysis obtained using Ingenuity Pathway Analysis (IPA) demonstrating interactions (direct/indirect) of hnRNPD with proteins involved in cellular signaling pathways including mTOR and eNOS; Double strand DNA repair mechanism (XRCC5, XRCC6); Chromatin remodeling (SMARCC1, SMARCC2, SMARCB1, SMARCD1, SMARCD2, SMARCE1 and histone family of proteins including H1, H2A, H2B and H4); Telomere maintenance (hnRNPA2/B1, XRCC5, XRCC6, hnRNPA1); RISC (short-interfering-RNA-mediated gene silencing) (EIF2C1, EIF2C2, EIF2C3), RNA splicing, stability, translation and decay (ribosomal proteins 28S, 40S and 60S; ATP dependent RNA helicases, mRNA cap guanine-N7 methyltransferase, RNMT, RAE1, PTBP1, FIP1L1, DHX15, RSL1D1, RBMS1, RBM12B)

Full size image

Verification of interactions between hnRNPD and 14-3-3ζ, hnRNPK and S100A9

As a first step for verification of interactions between hnRNPD and 14-3-3ζ observed in proteomics analysis, we performed motif scan (14-3-3—Mode 1/Mode 2) using software available online at http://www.motifscan.mit.edu as described earlier [26]. Motif search showed the presence of 14-3-3 binding motif Mode1 (EDEGHSNSSPRHSEA) in hnRNPD protein (Fig. 3A, i). Co-immunoprecipitation assays followed by western blot analysis were performed for both hnRNPD and 14-3-3ζ protein to verify their direct interactions in oral cancer cells (SCC4/MDA1986). As shown in Fig. 3A, 14-3-3ζ was detected in immunocomplexes of hnRNPD obtained from SCC4 and MDA1986 cells. Similarly, using reverse-IP experiments, hnRNPD was detected in immunocomplexes of 14-3-3ζ obtained from both the oral cancer cell lines (SCC4/MDA1986), while no band was detected in negative controls (Fig. 3A, ii). This interaction was further evident by co-localization of both these proteins in oral cancer cells (Fig. 3A, iii). Further, co-IP assays followed by western blotting using phospho-specific hnRNPD (83Ser) antibody showed the presence of 14-3-3ζ in both the oral cancer cell lines (SCC4 and MDA1986, Fig. 3A, iv). In addition, our results also demonstrated presence of 14-3-3ζ protein in hnRNPD immunocomplexes, obtained from OSCC tissue lysates (Fig. 3A, v).

Fig. 3
figure 3

Verification of hnRNPD binding partners in oral cancer. A, i 14-3-3 binding motif of hnRNPD. Photomicrograph showing presence of 14-3-3 binding motif, Mode 1 in hnRNPD polypeptide sequence as revealed by http://www.motif.scan.mit.edu; ii Western blot showing presence of 14-3-3ζ and hnRNPD proteins in immunoprecipitates of hnRNPD/14-3-3ζ obtained from OSCC cells (SCC4 and MDA1986) while no band was seen in negative controls (i.e. beads only control). Input represents whole cell lysates from MDA1986 used as positive control for Western blotting; iii Confocal laser scan microscopy (CLSM) demonstrating nuclear and cytoplasmic expression of 14-3-3ζ (green, FITC) and hnRNPD (red, TRITC) in oral cancer cells a SCC4 and b MDA1986 cells. Blue colored DAPI was used as nuclear stain. Merged photomicrographs represent the co-localization of hnRNPD with 14-3-3ζ in oral cancer cells; iv Confirmation of binding of 14-3-3ζ at p-Ser83 of hnRNPD in oral cancer cells. Western blot revealed the presence of p-Ser83 of hnRNPD in immunoprecipitates obtained by using anti-14-3-3ζ antibody from SCC4 and MDA1986 cell line; B Western blot showing presence of hnRNPK and S100A9 proteins in immunoprecipitates of hnRNPD obtained from OSCC cells (SCC4 and MDA1986) while no band was seen in negative controls. Input represents whole cell lysates from MDA1986 used as positive controls; ii Confocal laser scan microscopy (CLSM) demonstrating nuclear and cytoplasmic expression of hnRNPK (green, FITC) and hnRNPD (red, TRITC) in oral cancer cells a SCC4 and b MDA1986 cells. Blue colored DAPI was used as nuclear stain. Merged photomicrographs represent the co-localization of hnRNPD with hnRNPK in oral cancer cells

Full size image

Using similar approach, we verified the interaction of hnRNPD with hnRNPK and S100A9 in oral cancer cells. Western blotting showed presence of hnRNPK and S100A9 in hnRNPD immunoprecipitates and these findings were also confirmed using reverse—IP (Fig. 3B, i). Confocal laser scan microscopy (CLSM) analysis confirmed cytoplasmic and nuclear co-localization of hnRNPD with hnRNPK in OSCC cell lines, SCC4 and MDA1986 (Fig. 3B, ii).

Immunohistochemical analysis of hnRNPD expression in oral normal mucosa, dysplasia and OSCCs

Further, we performed immunohistochemistry to evaluate the clinical relevance of hnRNPD overexpression in tissue specimens of oral dysplasia and OSCCs. We performed immunohistochemistry of hnRNPD protein in oral normal mucosa (n = 106), dysplasia (n = 44) and OSCC (n = 183) tissues and analyzed its expression separately in both nucleus and cytoplasm of epithelial cells in each tissue section. The immunoreactivity score of 4 was selected as the threshold of hnRNPD immune-positivity based on the high sensitivity and specificity (>75 %) obtained with this cut off score in ROC analysis. Notably, weak or no detectable nuclear hnRNPD immunostaining was observed in 86/106 cases (81.1 %) normal tissues (Fig. 4a), while 20 cases only (18.9 %) showed moderate nuclear expression in epithelial cells of basal/suprabasal layer. Increased nuclear expression of hnRNPD was observed in 54.5 % dysplasia (24 of 44 cases, p < 0.001). Among different grades of dysplasia, 62.5 % of mild, 33.3 % moderate and 33.3 % severe dysplasia showed overexpression of nuclear hnRNPD (Table 1, Fig. 4c). Of 183 OSCCs analyzed in this study, 65.6 % cases showed increased nuclear hnRNPD expression in tumor cells as compared to normal oral mucosa (p < 0.001, odds ratio (OR) = 8.1, 95 % CI = 4.6–14.5; Table 1 and Fig. 4d). Overexpression of nuclear hnRNPD showed significant correlation with increasing tumor size (p = 0.005, OR = 2.4, 95 % C.I. = 1.3–4.6) and tumor stage (p = 0.02, OR = 2.3, 95 % C.I. = 1.0–5.2, Table 1). Thirteen of 183 (7.1 %) OSCCs showed cytoplasmic immunostaining of hnRNPD (Fig. 4d), but no significant association of cytoplasmic hnRNPD was observed (data not shown). Lung cancer tissue sections used as positive controls showed strong nuclear hnRNPD expression (Fig. 4e), while no immunostaining was observed in tissue sections used as negative controls where the primary antibody was replaced by isotype specific IgG (Fig. 4f). No significant alterations were observed in cytoplasmic hnRNPD expression in these tissues (data not shown).

Fig. 4
figure 4

Immunohistochemical analysis of hnRNPD in oral tissues. Paraffin-embedded sections of histologically normal mucosa, oral dysplasia and OSCC were stained using anti-hnRNPD polyclonal antibody as described in “Methods” section. Panel represents a normal oral mucosa showing no hnRNPD immunostaining; b Dysplasia section illustrating nuclear hnRNPD staining in epithelial cells; c OSCC section illustrating nuclear hnRNPD staining in tumor cells; d OSCC section illustrating nuclear (N) and cytoplasmic (C) hnRNPD staining in tumor cells; e Lung cancer tissue section showing nuclear hnRNPD immunostaining; f OSCC section used as a negative control, showing no hnRNPD immunostaining in tumor cells; (a–e original magnification ×200)

Full size image
Table 1 Analysis of hnRNPD protein expression and correlation with clinicopathological parameters
Full size table

Evaluation of nuclear hnRNPD overexpression as a prognostic marker for OSCC

We determined association of nuclear hnRNPD with survival of OSCCs using Kaplan–Meier (KM) analysis followed by multivariate Cox regression analysis. Kaplan–Meier survival analysis showed significantly reduced recurrence-free survival (median RFS = 15 months, p = 0.013) in OSCC patients harboring increased nuclear hnRNPD expression as compared to median RFS of 69 months in patients showing no or low nuclear hnRNPD (Fig. 5a). Notably, among OSCC patients with negative nodal status (i.e. N0) hnRNPD nuclear expression emerged as a significant predictor for recurrence with median RFS = 22 months as compared to patients who were negative for histopathological involvement of nodes and showed low score on nuclear hnRNPD (median RFS = 69.0 months, p = 0.028, Fig. 5b). However, nuclear hnRNPD did not show any significant association with recurrence among OSCC patients with positive nodes at time of surgery (p = 0.141).

Fig. 5
figure 5

Evaluation of hnRNPD overexpression as a prognostic marker for OSCC. a Evaluation of nuclear hnRNPD as a prognostic marker. Based on sensitivity and specificity values a cut-off ≥4 was defined as positive criterion for hnRNPD (nuclear). Kaplan–Meier estimation of recurrence-free survival (RFS; no recurrence/metastasis) in OSCC patients showing nuclear immunostaining of hnRNPD was 15 months as compared to 69 months for the patients showing low scores for nuclear hnRNPD immunostaining (p = 0.013). b Kaplan–Meier estimation of recurrence-free survival, in node negative OSCC patients showing nuclear immunostaining of hnRNPD was median RFS = 22 months as compared to 69 months for the patients showing low scores for nuclear hnRNPD immunostaining and absence of node (p = 0.028). c Evaluation of nuclear hnRNPD as a diagnostic marker for distinguishing oral dysplasia and OSCCs from normal oral tissues. Panel shows ROC analysis for i Oral dysplasia vs. normal and ii OSCCs vs. normal oral tissues

Full size image

Cox regression multivariate analysis was carried out to determine the prognostic potential of nuclear hnRNPD for OSCCs in comparison with the other clinical parameters including age, gender, histological grade, tumor size, nodal status and stage (Table 2). Nuclear hnRNPD emerged as the most significant marker for predicting recurrence in OSCC patients [p = 0.026, Hazard ratio (HR) = 1.95, 95 % CI = 1.0–3.5].

Table 2 Evaluation of nuclear hnRNPD as a prognostic marker of OSCCs
Full size table

Further, ROC analysis showed an area under the curve (AUC) of 0.725 and 0.782 for dysplasia and OSCCs respectively for nuclear hnRNPD overexpression with high specificity, implicating its potential utility in distinguishing these tissues from normal epithelium (Table 3, Fig. 5c). Sensitivity, positive predictive value (PPV) and negative predictive value (NPV) for distinguishing dysplasia and OSCCs from normal oral mucosa are given in Table 3.

Table 3 Evaluation of hnRNPD as a diagnostic marker
Full size table

hnRNPD overexpression correlates with 14-3-3ζ and hnRNPK expression in OSCCs tissues

As shown above, both hnRNPK and 14-3-3ζ were identified in as interaction partners of hnRNPD in oral cancer cells and tissues. On the basis of IHC analysis, the immunoreactivity score ≥4 for both hnRNPD and hnRNPK, and a score ≥5 for 14-3-3ζ were considered as overexpression and were used in Kappa analysis. In order to confirm such association among clinical specimens of OSCCs, we performed Kappa analysis to determine the agreement of association between the hnRNPD, hnRNPK and 14-3-3ζ expressions in OSCCs using their IHC scores. One of the most important features of the Kappa statistics is that it is a measurement of the degree of agreement or reliability of agreement. Among OSCCs, 61 % agreement with a Kappa score (κ = 0.236) was observed between nuclear hnRNPD and hnRNPK (p = 0.0003) (Additional file 3: Table S3). Similar agreement with a Kappa score (κ = 0.248) was also observed between nuclear hnRNPD and 14-3-3ζ. This further strengthened our results of IP-LC–MS/MS. However, no significant agreement was observed between cytoplasmic expression of hnRNPD with hnRNPK or 14-3-3ζ in OSCCs.

Discussion

The ability of proteins to form complexes by physically binding to each other and alterations in sub-cellular distribution lead to perturbations in the cell circuitry underlying cancer development. In this study, we determined hnRNPD associated protein networks to get an insight in molecular pathogenesis of oral cancer. Our network analysis revealed involvement of hnRNPD in multiple cellular pathways involved in progression and metastasis of oral cancer. We identified novel binding partners of hnRNPD suggesting its involvement in DNA repair, chromatin remodeling, RNAi mediated gene silencing and several other cell signaling pathways involved in cellular proliferation and apoptosis, besides its role in RNA processing and turnover. Several reports have demonstrated involvement of different RNA-binding proteins (RBPs) in determining the cellular fate of mRNA transcripts in terms of stability and rate of translation [11, 22]. In this respect, we observed other members of the hnRNP family including hnRNPA2/B1, hnRNPK, hnRNPU, hnRNPG forming heterodimers with hnRNPD in oral cancer cells. In this support, interaction of hnRNPK, hnRNPC, hnRNPL and hnRNPA2/B1 with hnRNPD in cervical and lung cancer cells has been reported earlier [31–33]. In addition, our results also suggested interaction of hnRNPD with other RNA binding proteins (RBPs) such as ELAVL1, RALY, EWSR1 and FUS in oral cancer. The fate of RNAs regulated by these protein interactions among hnRNPD and other RNA binding proteins in oral cancer is currently under investigation. However, a recent study reported RNA—dependent direct physical interaction between ELAVL1 and hnRNPD in the nucleus influences the expression of cyclin D1 and p16, both of which are important for oral cancer development [34, 35]. Besides RBPs, microRNAs are also important contributors to the post-transcriptional control of gene expression [36]. miRNAs act preferentially by binding to 3′-UTR region of target mRNA and are also involved in ARE-mediated mRNA instability. Precursor miRNAs are processed to mature miRNAs by multiprotein complexes including Drosha and Dicer and then incorporated into RNA induced silencing complex (RISC) [37]. We identified RNA polymerase II, eIF4 and argonaute proteins (EIF2C1, EIF2C2 and EIF2C3) that are important components of RISC in our interactome analysis of hnRNPD in oral cancer. hnRNPD associates with endogenous DICER1 mRNA and destabilizes it; however knockdown of hnRNPD using siRNA increased half-life of DICER1 mRNA and elevated its expression, while overexpression of hnRNPD lowered DICER1 mRNA and protein levels [38].

Interestingly, we also identified an important nuclear-cytoplasmic shuttling protein, 14-3-3ζ, a member of 14-3-3 family of proteins, as a binding partner of hnRNPD and verified their interaction in oral cancer cells (SCC4/MDA1986). Moreover, both hnRNPD and 14-3-3ζ co-localization was observed in cytoplasm of OSCC cells, suggesting 14-3-3ζ retains cytoplasmic hnRNPD, similar to 14-3-3σ. 14-3-3 family of proteins is known for their overlapping functions in orchestrating their target proteins in cytoplasm. Our results also showed presence of 14-3-3 binding motif in hnRNPD polypeptide and verified the interaction of 14-3-3ζ with hnRNPD may be dependent on Ser83 phosphorylation (present in this motif), unlike its interaction with 14-3-3σ, as reported earlier [39, 40]. Previous reports have shown binding of 14-3-3σ to hnRNPD masks its nuclear localization signal, retaining it in cytoplasm and enhances the rapid turnover of its target protein expression [39, 40]. Further, hnRNPD demonstrated significant association with 14-3-3ζ expression in clinical specimens of OSCCs analyzed in this study. In thyroid cancer, cytoplasmic hnRNPD interacts with mRNAs encoding cyclins (A1, B1, D1 and E1) and cyclin-dependent kinase inhibitors [41]. Stimulation of melanoma cells and monocytes by lipopolysaccharide resulted in cytoplasmic translocation of hnRNPD from nucleus and reduced levels of IL-6, IL-10 and TNF-α following activation of MKP-1 (MAPK phosphatase-1) [42–47]. This scenario might explain how nuclear-cytoplasmic translocation of hnRNPD can influence the cytoplasmic fate of mRNA.

Together, our network analysis suggested an important role of hnRNPD overexpression and its associated networks including protein interactions (direct/indirect) and regulation among these pathways is likely to play important role in determining the clinical outcome of OSCC patients. Supporting this hypothesis, our clinical findings demonstrated increased nuclear hnRNPD expression in clinical specimens of oral dysplasia and OSCCs as compared to normal oral mucosa. Notably, OSCC patients showing increased expression of nuclear hnRNPD had significantly reduced recurrence free survival. Nuclear hnRNPD overexpression in OSCCs and its emergence as a predictor of recurrence free survival in multivariate analysis in comparison with clinical and pathological parameters is an important novel finding in oral cancer, even though previous studies reported its overexpression in other malignancies including thyroid, melanoma, breast, cervix and murine lung tumors [4, 7, 16, 18, 48, 49, 35]. hnRNPD nuclear expression emerged as a significant predictor for recurrence with median RFS of 22 months as compared to patients who were node negative and had lower nuclear hnRNPD (median RFS = 69.0 months, p = 0.028). However, nuclear hnRNPD did not show any significant association with recurrence among OSCC patients with positive nodes at time of surgery. Thus, hnRNPD expression is likely to have the potential to define a high-risk subgroup among OSCC patients with nodal negative disease and might address the urgent need for more effective risk stratification strategies to improve patient care for these patients.

Conclusions

Our interactome analysis of hnRNPD protein provided an insight into its novel functions in oral cancer cells. Further, nuclear hnRNPD emerged as a prognostic marker for evaluating the risk of recurrence in OSCC patients. Based on these results, we suggest nuclear hnRNPD as a potential target for molecular therapeutics for oral cancer in future.

References

  1. White EJ, Brewer G, Wilson GM. Post-transcriptional control of gene expression by AUF1: mechanisms, physiological targets, and regulation. Biochim Biophys Acta. 2013;1829:680–8.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  2. Gratacos FM, Brewer G. The role of AUF1 in regulated mRNA decay. Wiley Interdiscip Rev RNA. 2010;1:457–73.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  3. Benjamin D, Moroni C. mRNA stability and cancer: an emerging link? Expert Opin Biol Ther. 2007;7:1515–29.

    Article  CAS  PubMed  Google Scholar 

  4. Chen M, Zhang J, Manley JL. Turning on a fuel switch of cancer: hnRNP proteins regulate alternative splicing of pyruvate kinase mRNA. Cancer Res. 2010;70:8977–80.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  5. Barker A, Epis MR, Porter CJ, Hopkins BR, Wilce MC, et al. Sequence requirements for RNA binding by HuR and AUF1. J Biochem. 2012;151:423–37.

    Article  CAS  PubMed  Google Scholar 

  6. Gruber AR, Fallmann J, Kratochvill F, Kovarik P, Hofacker IL. AREsite: a database for the comprehensive investigation of AU-rich elements. Nucleic Acids Res. 2011;39:66–9.

    Article  Google Scholar 

  7. Blaxall BC, Dwyer-Nield LD, Bauer AK, Bohlmeyer TJ, Malkinson AM, et al. Differential expression and localization of the mRNA binding proteins, AU-rich element mRNA binding protein (AUF1) and Hu antigen R (HuR), in neoplastic lung tissue. Mol Carcinog. 2000;28:76–83.

    Article  CAS  PubMed  Google Scholar 

  8. Braakhuis BJ, Tabor MP, Kummer JA, Leemans CR, Brakenhoff RH. A genetic explanation of Slaughter’s concept of field cancerization: evidence and clinical implications. Cancer Res. 2003;63:1727–30.

    CAS  PubMed  Google Scholar 

  9. Lapucci A, Donnini M, Papucci L, Witort E, Tempestini A, et al. AUF1 Is a bcl-2 A + U-rich element-binding protein involved in bcl-2 mRNA destabilization during apoptosis. J Biol Chem. 2002;277:16139–46.

    Article  CAS  PubMed  Google Scholar 

  10. Wang W, Martindale JL, Yang X, Chrest FJ, Gorospe M. Increased stability of the p16 mRNA with replicative senescence. EMBO Rep. 2005;6:158–64.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  11. Moore AE, Chenette DM, Larkin LC, Schneider RJ. Physiological networks and disease functions of RNA-binding protein AUF1. Wiley Interdiscip Rev RNA. 2014;5:549–64.

    Article  CAS  PubMed  Google Scholar 

  12. Wagner BJ, DeMaria CT, Sun Y, Wilson GM, Brewer G. Structure and genomic organization of the human AUF1 gene: alternative pre-mRNA splicing generates four protein isoforms. Genomics. 1998;48:195–202.

    Article  CAS  PubMed  Google Scholar 

  13. DeMaria CT, Sun Y, Long L, Wagner BJ, Brewer G. Structural determinants in AUF1 required for high affinity binding to A + U-rich elements. J Biol Chem. 1997;272:27635–43.

    Article  CAS  PubMed  Google Scholar 

  14. Zhang W, Wagner BJ, Ehrenman K, Schaefer AW, DeMaria CT, et al. Purification, characterization, and cDNA cloning of an AU-rich element RNA-binding protein, AUF1. Mol Cell Biol. 1993;13:7652–65.

    PubMed Central  CAS  PubMed  Google Scholar 

  15. Zucconi BE, Wilson GM. Modulation of neoplastic gene regulatory pathways by the RNA-binding factor AUF1. Front Biosci. 2011;16:2307–25.

    Article  CAS  Google Scholar 

  16. Gouble A, Grazide S, Meggetto F, Mercier P, Delsol G, et al. A new player in oncogenesis: AUF1/hnRNPD overexpression leads to tumorigenesis in transgenic mice. Cancer Res. 2002;62:1489–95.

    CAS  PubMed  Google Scholar 

  17. Lu M, Pan C, Zhang L, Ding C, Chen F, et al. ING4 inhibits the translation of proto-oncogene MYC by interacting with AUF1. FEBS Lett. 2013;587:1597–604.

    Article  CAS  PubMed  Google Scholar 

  18. Al-Ansari MM, Hendrayani SF, Shehata AI, Aboussekhra A. p16(INK4A) represses the paracrine tumor-promoting effects of breast stromal fibroblasts. Oncogene. 2013;32:2356–64.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  19. Al-Khalaf HH, Colak D, Al-Saif M, Al-Bakheet A, Hendrayani SF, et al. p16(INK4a) positively regulates cyclin D1 and E2F1 through negative control of AUF1. PLoS One. 2011;6:e21111.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  20. Pont AR, Sadri N, Hsiao SJ, Smith S, Schneider RJ. mRNA decay factor AUF1 maintains normal aging, telomere maintenance, and suppression of senescence by activation of telomerase transcription. Mol Cell. 2012;47:5–15.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  21. Siegel R, DeSantis C, Virgo K, Stein K, Mariotto A, et al. Cancer treatment and survivorship statistics. CA Cancer J Clin. 2012;62:220–41.

    Article  PubMed  Google Scholar 

  22. Lucs AV, Saltman B, Chung CH, Steinberg BM, Schwartz DL. Opportunities and challenges facing biomarker development for personalized head and neck cancer treatment. Head Neck. 2013;35:294–306.

    Article  PubMed Central  PubMed  Google Scholar 

  23. Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer. 2012;11:9–22.

    Article  Google Scholar 

  24. Jemal A. Global burden of cancer: opportunities for prevention. Lancet. 2012;380:1797–9.

    Article  PubMed  Google Scholar 

  25. Ralhan R, Desouza LV, Matta A, Chandra Tripathi S, Ghanny S, et al. iTRAQ-multidimensional liquid chromatography and tandem mass spectrometry-based identification of potential biomarkers of oral epithelial dysplasia and novel networks between inflammation and premalignancy. J Proteome Res. 2009;8:300–9.

    Article  CAS  PubMed  Google Scholar 

  26. Matta A, DeSouza LV, Shukla NK, Gupta SD, Ralhan R, et al. Prognostic significance of head-and-neck cancer biomarkers previously discovered and identified using iTRAQ-labeling and multidimensional liquid chromatography-tandem mass spectrometry. J Proteome Res. 2008;7:2078–87.

    Article  CAS  PubMed  Google Scholar 

  27. Matta A, Tripathi SC, DeSouza LV, Grigull J, Kaur J, et al. Heterogeneous ribonucleoprotein K is a marker of oral leukoplakia and correlates with poor prognosis of squamous cell carcinoma. Int J Cancer. 2009;125:1398–406.

    Article  CAS  PubMed  Google Scholar 

  28. Masui O, White NM, DeSouza LV, Krakovska O, Matta A, et al. Quantitative proteomic analysis in metastatic renal cell carcinoma reveals a unique set of proteins with potential prognostic significance. Mol Cell Proteomics. 2013;12:132–44.

    Article  PubMed Central  PubMed  Google Scholar 

  29. Voisin SN, Krakovska O, Matta A, DeSouza LV, Romaschin AD, et al. Identification of novel molecular targets for endometrial cancer using a drill-down LC-MS/MS approach with iTRAQ. PLoS One. 2011;6:e16352.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  30. Shilov IV, Seymour SL, Patel AA, Loboda A, Tang WH, et al. The Paragon Algorithm, a next generation search engine that uses sequence temperature values and feature probabilities to identify peptides from tandem mass spectra. Mol Cell Proteomics. 2007;6:1638–55.

    Article  CAS  PubMed  Google Scholar 

  31. Mili S, Shu HJ, Zhao Y, Pinol-Roma S. Distinct RNP complexes of shuttling hnRNP proteins with pre-mRNA and mRNA: candidate intermediates in formation and export of mRNA. Mol Cell Biol. 2001;21:7307–19.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  32. Park HG, Yoon JY, Choi M. Heterogeneous nuclear ribonucleoprotein D/AUF1 interacts with heterogeneous nuclear ribonucleoprotein L. J Biosci. 2007;32:1263–72.

    Article  CAS  PubMed  Google Scholar 

  33. Li X, Johansson C, Glahder J, Mossberg AK, Schwartz S. Suppression of HPV-16 late L1 5′-splice site SD3632 by binding of hnRNP D proteins and hnRNP A2/B1 to upstream AUAGUA RNA motifs. Nucleic Acids Res. 2013;41:10488–508.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  34. Pascale A, Govoni S. The complex world of post-transcriptional mechanisms: is their deregulation a common link for diseases? Focus on ELAV-like RNA-binding proteins. Cell Mol Life Sci. 2012;69:501–17.

    Article  CAS  PubMed  Google Scholar 

  35. Sinha P, Bahadur S, Thakar A, Matta A, Macha M. Significance of promoter hypermethylation of p16 gene for margin assessment in carcinoma tongue. Head Neck. 2009;31:1423–30.

    Article  PubMed  Google Scholar 

  36. Wu X, Chesoni S, Rondeau G, Tempesta C, Patel R, et al. Combinatorial mRNA binding by AUF1 and Argonaute 2 controls decay of selected target mRNAs. Nucleic Acids Res. 2013;41:2644–58.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  37. Ying SY, Chang DC, Lin S. The MicroRNA. Methods Mol Biol. 2013;936:1–19.

    Article  CAS  PubMed  Google Scholar 

  38. Abdelmohsen K, Tominaga-Yamanaka K, Srikantan S, Yoon JH, Kang MJ, et al. RNA-binding protein AUF1 represses Dicer expression. Nucleic Acids Res. 2012;40:11531–44.

    PubMed Central  CAS  PubMed  Google Scholar 

  39. He C, Schneider R. 14-3-3 sigma is a p37 AUF1-binding protein that facilitates AUF1 transport and AU-rich mRNA decay. EMBO J. 2006;25:3823–31.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  40. Suzuki M, Iijima M, Nishimura A, Tomozoe Y, Kamei D, et al. Two separate regions essential for nuclear import of the hnRNP D nucleocytoplasmic shuttling sequence. FEBS J. 2005;272:3975–87.

    Article  CAS  PubMed  Google Scholar 

  41. Trojanowicz B, Brodauf L, Sekulla C, Lorenz K, Finke R. The role of AUF1 in thyroid carcinoma progression. Endocr Relat Cancer. 2009;16:857–71.

    Article  CAS  PubMed  Google Scholar 

  42. Langer CJ. Exploring biomarkers in head and neck cancer. Cancer. 2012;118:3882–92.

    Article  CAS  PubMed  Google Scholar 

  43. Sarkar S, Sinsimer KS, Foster RL, Brewer G, Pestka S. AUF1 isoform-specific regulation of anti-inflammatory IL10 expression in monocytes. J Interferon Cytokine Res. 2011;28:679–91.

    Article  Google Scholar 

  44. Paschoud S, Dogar AM, Kuntz C, Grisoni-Neupert B, Richman L, et al. Destabilization of interleukin-6 mRNA requires a putative RNA stem-loop structure, an AU-rich element, and the RNA-binding protein AUF1. Mol Cell Biol. 2006;26:8228–41.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  45. Palanisamy V, Park NJ, Wang J, Wong DT. AUF1 and HuR proteins stabilize interleukin-8 mRNA in human saliva. J Dent Res. 2008;87:772–6.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  46. Brewer G, Saccani S, Sarkar S, Lewis A, Pestka S. Increased interleukin-10 mRNA stability in melanoma cells is associated with decreased levels of A + U-rich element binding factor AUF1. J Interferon Cytokine Res. 2003;23:553–64.

    Article  CAS  PubMed  Google Scholar 

  47. Grosset C, Chen CY, Xu N, Sonenberg N, Jacquemin-Sablon H, et al. A mechanism for translationally coupled mRNA turnover: interaction between the poly(A) tail and a c-fos RNA coding determinant via a protein complex. Cell. 2000;103:29–40.

    Article  CAS  PubMed  Google Scholar 

  48. Abdelmohsen K, Kuwano Y, Kim HH, Gorospe M. Posttranscriptional gene regulation by RNA-binding proteins during oxidative stress: implications for cellular senescence. Biol Chem. 2008;389:243–55.

    Article  CAS  PubMed  Google Scholar 

  49. Kaur J, Matta A, Kak I, Srivastava G, Assi J, et al. S100A7 overexpression is a predictive marker for high risk of malignant transformation in oral dysplasia. Int J Cancer. 2013;134:1379–88.

    Article  PubMed  Google Scholar 

Download references

Authors’ contributions

RR and SSC conceptualized the study. RR, SSC and AM contributed to the study design and to the manuscript. MK, AM, and OM conducted the experimental work. MK performed the chart reviews for clinical data, follow-up and data collection and established the clinical database. AT, NKS and ARC provided the clinical samples, clinical parameters and the follow-up data. MK and MCS performed the histopathology reporting of all the patients’ tissues analyzed. MK, AM and JK did the statistical analysis and had access to the raw data. OM performed the proteomic analysis under the guidance of KWMS. GS and MK performed the confocal microscopy. AM, SSC and RR interpreted the data. RR, PGW and SSC provided the infrastructural support for this study. The manuscript was drafted by MK and AM, edited by SSC and RR, and submitted for comments to all the authors. All authors read and approved the final manuscript.

Acknowledgements

The study was supported by International Science and Technology Partnerships (ISTP), Canada—Department of Biotechnology (DBT), India grant to RR and SSC. RR gratefully acknowledges the financial support from Canadian Institutes of Health Research (CIHR) for CIHR Chair in Advanced Cancer Diagnostics and PGW acknowledges the financial support from Alex and Simona Shnaider Chair in Thyroid Cancer. MK is the recipient of Senior Research Fellowship (SRF), Council of Scientific and Industrial Research (CSIR), New Delhi, India.

Compliance with ethical guidelines

Competing interests The authors declare that they have no competing interests.

Author information

Author notes

    Authors and Affiliations

    1. Department of Biochemistry, All India Institute of Medical Sciences, Room No. 3009, New Delhi, 110029, India

      Manish Kumar, Jatinder Kaur & Shyam Singh Chauhan

    2. Alex and Simona Shnaider Laboratory of Molecular Oncology, Mount Sinai Hospital, 6-500, Toronto, ON, M5G 1X5, Canada

      Ajay Matta, Gunjan Srivastava, Paul G. Walfish & Ranju Ralhan

    3. Department of Chemistry, Centre for Research in Mass Spectrometry, York University, Toronto, ON, Canada

      Olena Masui & K. W. Michael Siu

    4. Department of Otorhinolaryngology, All India Institute of Medical Sciences, New Delhi, India

      Alok Thakar

    5. Department of Surgery, Dr. B. R. A. Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, New Delhi, India

      Nootan Kumar Shukla

    6. Department of Dental Surgery, All India Institute of Medical Sciences, New Delhi, India

      Ajoy RoyChoudhury

    7. Department of Pathology, All India Institute of Medical Sciences, New Delhi, India

      Meherchand Sharma

    8. Department of Otolaryngology-Head and Neck Surgery, Joseph and Mildred Sonshine Family Centre for Head and Neck Diseases, Mount Sinai Hospital, Toronto, ON, Canada

      Paul G. Walfish & Ranju Ralhan

    9. Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, Joseph & Wolf Lebovic Health Complex, Toronto, ON, M5G 1X5, Canada

      Paul G. Walfish & Ranju Ralhan

    10. Department of Otolaryngology-Head and Neck Surgery, University of Toronto, Toronto, ON, Canada

      Paul G. Walfish & Ranju Ralhan

    11. Department of Medicine, Endocrine Division, Mount Sinai Hospital and University of Toronto, Toronto, ON, Canada

      Paul G. Walfish

    12. Department of Chemistry, University of Windsor, Windsor, ON, Canada

      K. W. Michael Siu

    Authors
    1. Manish Kumar
      View author publications

      You can also search for this author in PubMed Google Scholar

    2. Ajay Matta
      View author publications

      You can also search for this author in PubMed Google Scholar

    3. Olena Masui
      View author publications

      You can also search for this author in PubMed Google Scholar

    4. Gunjan Srivastava
      View author publications

      You can also search for this author in PubMed Google Scholar

    5. Jatinder Kaur
      View author publications

      You can also search for this author in PubMed Google Scholar

    6. Alok Thakar
      View author publications

      You can also search for this author in PubMed Google Scholar

    7. Nootan Kumar Shukla
      View author publications

      You can also search for this author in PubMed Google Scholar

    8. Ajoy RoyChoudhury
      View author publications

      You can also search for this author in PubMed Google Scholar

    9. Meherchand Sharma
      View author publications

      You can also search for this author in PubMed Google Scholar

    10. Paul G. Walfish
      View author publications

      You can also search for this author in PubMed Google Scholar

    11. K. W. Michael Siu
      View author publications

      You can also search for this author in PubMed Google Scholar

    12. Shyam Singh Chauhan
      View author publications

      You can also search for this author in PubMed Google Scholar

    13. Ranju Ralhan
      View author publications

      You can also search for this author in PubMed Google Scholar

    Corresponding authors

    Correspondence to Shyam Singh Chauhan or Ranju Ralhan.

    Additional information

    Ranju Ralhan and Shyam Singh Chauhan are senior authors in this study

    Additional files

    Additional file 1:

    Figure S1. (A) SDS-PAGE analysis of hnRNPD immunoprecipitates from OSCC samples. Lanes shows separation of IP-hnRNPD from oral cancer cells SCC4 and MDA1986, and beads only; PMW is protein molecular weight marker. (B) Binding partners of hnRNPD classified on basis of cellular function. Pie-chart demonstrating the distribution of binding partners of hnRNPD identified using IP-LC–MS/MS on the basis of their cellular functions.

    Additional file 2:

    Figure S2. Spearman rank correlation co-efficient test:Graphs represent a positive correlation between (A) hnRNPD expression level and OSCC tumor size, (B) OSCC tumor stage.

    Additional file 3:

    Table S1. List of key proteins identified as binding partners of hnRNPD in OSCC cells (SCC-4 / MDA1986) using IP-LC-MS/MS.

    Rights and permissions

    Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

    Reprints and permissions

    About this article

    Check for updates. Verify currency and authenticity via CrossMark

    Cite this article

    Kumar, M., Matta, A., Masui, O. et al. Nuclear heterogeneous nuclear ribonucleoprotein D is associated with poor prognosis and interactome analysis reveals its novel binding partners in oral cancer. J Transl Med 13, 285 (2015). https://doi.org/10.1186/s12967-015-0637-3

    Download citation

    • Received:

    • Accepted:

    • Published:

    • DOI: https://doi.org/10.1186/s12967-015-0637-3

    Keywords

    Journal of Translational Medicine

    ISSN: 1479-5876

    Contact us