TTAT

AcronymDefinition
TTATTherapeutic Turnaround Time (diagnostic testing)
TTATTinplate Trackers of Austin, Texas (train club)
TTATTracy Technical Advisory Team (Tracy Fish Facility Improvement Program; California)
TTATTorpedo Tube Acceptance Trial
TTATTRADOC Training and Assessment Team
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
SCZ-9/###F: CCCAGGGACTGTTTCTTCAG###(TTAT)8 63.7 34###4###224-236 0.4706 0.5588 0.4965###0.036
SCZ-10/###F: ATTCAGAGCCAGGTTTGCTG###(TTAT)8 62.0 34###6###200-224 0.5000 0.6062 0.5320###0.201
Short Communication - Characterization of 22 New Polymorphic Microsatellite Loci from the Endangered Buff-Throated Partridge (Tetraophasis szechenyii) by using Next-Generation Sequencing
"There exists no pure, uninterpreted datum," writes Danish psychologist Steiner Kvale in TTAT, "all facts embody theory." Hence, there are no simple - or final - truths that exist independent of the people, the cultures, and the languages that produce them.
The Truth About Truth: De-Confusing and Re-Constructing the Postmodern World
a ttat lleal k The warning came a f t e administrators Duff & Phelps - who have been in place for days - allowed yet more time for a clear preferred bid to be defined.
70 DAYS IN LIMBO 48 HRS TO D-DAY; Financial whiz warns future is in doubt
Acronyms browser ?
Full browser ?