PROP1

Acronym	Definition
PROP1	Proposition One (grassroots nuclear disarmament organization)

Suggest new definition

References in periodicals archive ?

PROP1 mutation screening detected a homozygous deletion of the entire PROP1 in three patients.

PROP1 gene was amplified using PCR primers: Forward (5' ACCTACACACACATTCAGAGAC 3'), Reverse (5' TGGAGCCTATGCTTTCAGC 3'), Forward (5' AAAGACTGGAGCAGCACAGG3'), Reverse (5' GGTGGTGAGATGAGGCCTGT 3'), and Forward (5' GCCTTGTGGAAGAGCTTTACTCC 3'), Reverse (5' CACCATGCATCTGCTTCACCC 3').

A Large PROP1 Gene Deletion in a Turkish Pedigree

PROP1 overexpression in corticotrophinomas: evidence for the role of PROP1 in the maintenance of cells committed to corticotrophic differentiation.

Molecular basis for pituitary dysfunction: Comparison of Prop1 and Pit1 mutant mice.

Novel nucleotide variations, haplotypes structure and associations with growth related traits of goat AT motif-binding factor (ATBF1) gene

prop1 stands for that P intends proposition "R believes p being hold at time [t.sub.p]" being hold.

Proactive communicating process with asymmetry in multiagent systems

Mutations of PROP1 are the most frequent genetic defect in non-syndromic combined pituitary hormone insufficiency and are characterized by growth hormone (GH), prolactin, TSH, and gonadotropin deficiency.

The most commonly recognized genetic defects associated with CPHD include mutations within PROP1, POU1F1, HESX1, LHX3, LHX4, OTX2, GLI2, and SOX3.

POU1F1 and PROP1 Gene Mutations in 4 Cases of Combined Pituitary Hormone Deficiency

HESX1, POU1F1, PROP1, LHX4, LHX3, and OTX2 genes have been associated with combined pituitary hormone deficiencies to date.

A Novel HESX1 Mutation in a Case with Panhypopituitarism

Because of the combination of central hypothyroidism, GH deficiency, low PRL status, and normal pituitary imaging, genetic testing of PROP1 and POU1F1 was performed, but no mutations were found.

Delayed Adrenarche may be an Additional Feature of Immunoglobulin Super Family Member 1 Deficiency Syndrome