baratron: (corrosive)
I have been "friended" by the worst Dreamwidth bot in history. I mean, is anyone going to be convinced by this rubbish?
I am a writer who uses written words in different writing styles and techniques to communicate ideas. I produce different forms of literary art and creative writing such as novels, short stories, books, poetry, travelogues, plays, screenplays, teleplays, songs, and essays as well as other (Spells to make him obsessed with you) reports and news articles that may be of interest to the general public. my' texts are published across a wide range of media. Skilled I am able to use language to express ideas well, often contributing significantly to the cultural content of a society.

The "Spells to make him obsessed with you" part is a link. I shall not link to the link for obvious reasons.

Is there anyone on the planet who can write all of those different types of creative writing well? Plenty of writers can do novels or short stories, but not both; and by the time we're onto poetry, travelogues and "teleplays" (what?) I pretty much fell off my chair laughing. Then the three grammatical errors in the last two sentences just made it.

Even worse, here are its interests:
folk, harry poter, reading, real word, shopping

I'm confident in my guess that the second one is supposed to be "Harry Potter", but what is "real word"?
baratron: (goggles)
Today, I find myself searching for an old livejournal userpic that some people had. It was animated and cycled through six pictures. Every other one was "Tea". It described various situations in which a stereotypical stoic British person would react by offering and drinking a cup of tea. The last one was something along the lines of "City blown up by terrorists? TEA!"

It probably dated from the 7/7/2005 London bombings, which was about a century ago in internet years, which is probably also why I can't find it on any of the journals which I thought had it. Still, if anyone knows what I'm talking about - and even better, if anyone still has the image - please post it for me!

In other news, it has been a decade in internet years since my last post here. I am currently significantly less ill than I have been for several months, but still nowhere near well. My mental health seems to have improved (in January? while housebound?!) but my chronic fatigue continues to be beyond awful. I seem to be having one or two days a week in which getting out of bed even to stagger to my computer desk doesn't seem to be possible. Hopefully somewhat on the mend though.

Also I need to cycle my own DJ userpics, very unhappy with the current selection!
baratron: (Default)
So, I officially Have Problems With Gluten.

The hospital consultant thinks that I don't have c[o]eliac disease because the two blood tests they did were both negative - but I've read online in peer-reviewed papers in journals like the United European Gastroenterology Journal that up to 10% of people with c[o]eliac don't show up on the blood screening for various reasons. So I've asked them to do a gut biopsy.

The problem with a gut biopsy is that I have to eat enough gluten to potentially cause the damage to the villi in my small intestine. So I am essentially POISONING MYSELF every day.

(In practice, I can't poison myself every day - after 2-3 days with gluten in my diet, the digestive TMI is so bad that I have to take a day off to let my gut settle. Not least of all because having everything go through my digestive system way too fast affects all of my physical and mental health, since I'm not getting anything like the correct dose of medications.)

This gut biopsy is supposed to be in January but I don't have a date for it yet, and the covid is on the rise again, which means it's likely to get delayed.

So my life right now is a complete source of AAAARRRGGGHHHH.

I have two nice partners and lots of nice plushies and an acceptable relationship with my parents and many nice friends, but being literally in pain all the time SUCKS.

The reason why I'm going through with this is that if I have c[o]eliac disease then I have to COMPLETELY avoid gluten, whereas if it's non-coeliac gluten sensitivity, then I can eat food which does not contain gluten as an ingredient but "may contain traces of gluten" from the factory in which it is made or packaged. That distinction is quite important.
baratron: (endurance)
I am once again being terrible at keeping up with Dreamwidth. Last time I was here, I was all "hey, come join me on Discord or Skype, I'll PM you there"... and that lasted about a week. I have good thoughts for all of you, I'm just SO FUCKING TIRED.

Well. It is allegedly Christmas in ten days - OMG I typed "ten years" the first time, and that's how I actually feel :D It is far too late for any Christmas cards that I send to get to anyone remotely on time, but that isn't my purpose for sending them. The purpose is to prove that my imaginary internet friends are real. Therefore they will be physical cards, and you will get them sometime in the next six weeks, when spoons and covid-hit postal services can cope.

Don't worry about the cost. Don't worry about my spoons - I'll send them when I can. Just tell me if you want a card, who I should address it to, and where you live. Offer restricted to people I actually know.

Poll #25004 h-l's 2020 Christmas card Poll-thing
Open to: Registered Users, detailed results viewable to: Just the Poll Creator, participants: 11

Do you want a Christmas card from me this year?

Yes please.
6 (54.5%)

No thank you.
2 (18.2%)

No, but I like to receive postcards so I'll give you my address anyway.
3 (27.3%)

The following partners, children, housemates and pets should be acknowledged on the card:



I normally have a question with comments like My address is: "The same as it has been for many years so I'm absolutely positive you have it", but let's just assume that I don't have ANYONE's address to hand right now. All comments are screened so you can include addresses safely.
baratron: (poly)
Happy Bi Visibility Day to all the bisexuals, pansexuals, & bi/panromantic asexuals here!
Tiny Klavier plants flowers in the shape of a bi pride flag.

I kinda slept through it in the UK but it's still going in North America and timezones to the west!
Tiny Klavier stands in the middle of a bi pride flag of flowers.
baratron: (aibo)
My health has been slowly breaking down over the past few months, and I don't just mean my mental health.

Just before the coronavirus really kicked in, I went to the US to attend PAX East and visit Grant. The convention itself was great, met several important friends, and hung out with some of the Elder Scrolls Online devs. Again. Given that I work for UESP they already have a pretty good idea who we are.

Me with Alarra and Shifty in our Airbnb in Boston.

Cut for more pictures. )

One of the important friends (Tatanko) drove Grant and I 8 hours across country to State College, PA, where he lives, from whence we hired a car and drove another 2 hours to Grant's grandmother's funeral. Which was fine. His dad was really pleased to see me/us. His mum and brother were a bit more surprised, but I think ultimately glad we made the effort, and I don't really care about anyone else.

Then I got home and had to go straight into isolation, because although I didn't get a letter telling me I had to, I take one of the inhalers on Asthma UK's list of "medications which imply your asthma is bad enough that you should be shielding". So over the past however many weeks since I got home, I have been out of the house 4 times - and 2 of those were for doctor's appointments. I am very lucky to have a Richard because I would have literally starved by now without his loving cooking.

Also... well, this story is long, and needs some privacy.
baratron: (poly)
Who is going to the London Bi Pride event on Saturday?

I was assuming that I was, but apparently there is an anti-Brexit rally in Parliament Square at 2pm, which is actually a sensible time for a rally to start (as opposed to all the other protests which insist on starting at 11am on a Saturday as if that's at all reasonable, goodness me). So I assume I'll be there first, then at the Bi Pride thing?

Of course, that's dependent on [a] whether I have spoons for both events and [b] whether I can get tickets for the Bi Pride thing... apparently there are a limited number of tickets, which is so unlike any other bi event I've ever been to as to have me quite confused.

Let me know if you're going, thanks xx
baratron: (endurance)
I did not go to Bicon for various reasons. So why do I have con crud? My throat is as itchy and scratchy as if I'd been snogging a whole load of interesting strangers with all sorts of exciting bacteria living on their tonsils, and I am as tired as if I'd spent the whole weekend partying instead of sleeping. Hmmm.

Fortunately, it doesn't actually seem to be oral thrush from my new inhaler. Pretty sure it's just some sort of viral or bacterial infection.

Though I am curious about how I could have caught a viral or bacterial infection when I have literally not left the house in a week. Richard's been in and out, but he hasn't been unwell for at least several weeks. I suppose he could theoretically be a disease vector without getting ill himself, but it seems unlikely.
baratron: (cute)
Today I had my asthma checkup and I learned a thing!

I've always wondered why my asthma symptoms are so different to those of most other people I know. I obviously HAVE asthma because I get wheezy and find it hard to breathe when I have a snot virus, or when I'm in the presence of triggers like cigarette, bonfire or barbecue smoke (or strong perfumes, or nail varnish solvent, or hairspray, or...)

But I don't get massive wheezing that you can hear, and my peak flow almost never changes. Some of my friends measure their peak flow every day to assess their lung health, but it's pointless for me. If my peak flow goes down from 410 units to 380 units on the EU scale, then I know I am very seriously ill and need to get oral steroids. For most people with asthma, that's a daily change.

Apparently what I actually have is called small airway asthma, i.e. it's mostly in the distal airways and alveoli rather than the bronchioles. That's why my symptoms are mostly snot and post-nasal drip.

Learning this is very interesting and in fact brings the diagnosis full circle. My excellent GP who retired noticed that I had bronchorrhea, which is apparently very unusual outside of end-stage lung cancer patients. Now I have an explanation for that. My asthma is mostly in the distal airways and has mostly been untreated despite high compliance with inhalers.

So I've been given a new and different inhaler to try. It has much finer aerosol particles so is supposed to get deeper inside the lung.

...I can't actually find anything online about small airways asthma other than scientific journal papers, which makes me suspect it's a very new diagnosis.
baratron: (cute)
We went to see Detective Pikachu last night. I wrote about it on Tumblr, which seems to be the appropriate place for fandom stuff.

It's set in Ryme City, and was filmed in London. You can SEE London under the CGI and it's amazing. But there is also a very important Content Warning for the plot, which can also be read on Dreamwidth.

Frustrating as all hell, because the movie otherwise does diversity very well.
baratron: (goggles)
I haven't written much lately because I don't have a lot of spare energy with which to say anything. I am spending 2-3 afternoons a week in the lab, which wipes me out for the rest of the week. My chronic fatigue is such that 4 hours in lab requires the rest of the evening and the entire next day to rest. I don't even have to stand or walk much - I'm working in a tiny little microbiology lab smaller than the top floor of my house, where it is entirely normal to sit to do experiments because it's the only way to reach your arms into the laminar flow hood. But having to use my brain and my hands for several hours at a time is enough effort that I'm pretty much useless afterwards.

So I have been working, and making a ton of mistakes, and having to redo just about every experiment twice. Pretty sure this is entirely normal though, since they have been mistakes of inexperience. Like the other day I ran the PCR machine and didn't screw down the blue dial on the top to make the lid extra tight, so some of my samples evaporated. They're the kind of mistakes that a person who learns the way I do needs to make once in order to not make again. But it means that my progress is immensely slow. It really feels like two steps forward and one step back.

Other than that, I'm working for UESP. You can watch me on video most Monday nights from 9-11pm EDT (Tuesday 1-3am GMT) on the UESPodcast. (Broadcast live on Twitch and later on the Unofficial Elder Scrolls Pages YouTube. It's also available audio-only on various podcast services.) Although it's a voluntary thing and I don't get paid (except for the occasional free meal), I realised that I'm picking up a ton of Transferrable Skills which will be useful on my CV when I eventually try to get a Real Job.

Grant arrives on Monday 10th June for two weeks, and then I will have Both my Men in my house.
baratron: (cute)
When I am in Rochester with Grant, we go to Community Christian Church which is, in my words, a "hippy church". The first thing you see when you enter the building is a sign saying "Refugees Welcome", and they actually mean it. The minister is a gay man married to his husband, some of the lay people who help with the services are visibly queer, and it's genuinely welcoming. Even though I'm not a Christian, I still feel more at home there than in the UU church we went to once, where people came up to us afterwards and enquired as to whether the service was the strangest thing we'd ever been to. The idea that we might be Unitarians already didn't seem to occur to anyone. (There is a second UU church in Rochester, and I might try it sometime, but I don't feel any particular need to.)

Some people from the church work for a charity which helps children who may have been abused (TW: site talks about child abuse). When they come for assessment, they can choose a plush friend to help them through the process. Apparently they get through 4 to 6 plushies per day, which is a lot of new referrals. One of these people, Bob, died recently and in his honour, the church decided to collect Bears for Bivona because it was alliterative.

When we arrived and saw a giant box of bears (and other soft toys), I decided to go through the box and hug them all. So I did so after the service. When people asked what I was doing, I explained that you can't just buy a teddy bear from a shop, stick it in a collection box, and expect it to be able to help a hurt child. You have to give it some love first. And Rev Steven considered this and decided to put the teddy bears out in church the following week.

At Community Christian Church, Rochester, NY, USA. 2019-04-14
(click through for bigger version)

So the bears sat through the church service and were filled with the love of the congregation. They were pointed out during the "share with children" part of the service and each child went to hug one of them. Then the bears were blessed so that they could bring joy to their new owners. If you get the impression that this is not exactly a standard, mainstream sort of church - you'd be right!

Also the sermon featured Banksy art. (Did you realise that Steve Jobs was the son of a Syrian migrant?)

More bear details. )
baratron: (endurance)
My apologies for the lack of updates. I have been eaten by chronic fatigue . Fortunately, I am staying with Grant, so I have access to an Emotional Support Alligator.

At some point I should write about things such as PAX East, Being a V.I.P. at Bethesda Game Days, and interviewing Todd Howard (yes, the Todd Howard), but I kinda have to get that interview typed up first. Our interview with Rich Lambert is online in video format and I'm 2/3 of the way through the transcription. Can you believe it takes an hour to transcribe 5 minutes of audio? It's nothing to do with how quickly a person types, it's the effort required to get all of the dialogue recorded perfectly. We tried an auto-transcriber and it had severe issues with all of the fantasy universe words. If you'd like a laugh... )

In other news, I believe there is a BiFest in Kingston today, which would be very convenient if only I was in Kingston instead of on another continent. I expect a full write-up (within session confidentiality rules) and lots of photos (with the consent of the people in the picture). Please.
baratron: (goggles)
I finally came up with a chemistry pun to explain how my gender works.

I've felt for a while like the cis/trans binary doesn't work for me. Despite being female assigned at birth, I'm not really cis because some of the time I don't feel female. But nor do I feel like I can call myself trans because I'm happy with my body at other times.

So I'm cis but prone to radical isomerisation.

It works because cis/trans isomerisation is a radical mechanism, but also because "radical" has a meaning in English outside of science.
baratron: (nick - srs bsns)
Gods. I'm supposed to be doing work for my degree, doing work for UESP, and writing a eulogy for my grandmother's funeral, and I'm sitting here watching the idiots in Parliament shuffle around pawns on a chessboard instead.

Comment from a friend - "Pretty sure chess is too advanced an analogy. They're moving the same two checkers back and forth endlessly."
baratron: (Default)
Gender Census 2019
A survey for everyone who doesn't fit into just one of the two boxes of "always, solely and completely a woman/girl" or "always, solely and completely a man/boy". Do the survey if that fits you, and pass it on to your friends.

I don't talk about my gender a lot on my journal. I've identified as bigender for - goodness - at least since September 2005, according to this old livejournal post. I explicitly came out and defined it in a footnote to a post in April 2017.
*I am bigender rather than non-binary or genderqueer, so I am female except when I'm not. I have somewhere between a few hours and a few days of raging gender dysphoria per month where my entire body is Wrong, and the (actually bi but scared of women) gay man in the back of my head comes out. And the rest of the time it's just fine and I want to be addressed as "she/her" and recognised as A Female Geek Doing Nerdy Things. The conclusion I've come to is that my social and political gender is female, but my sexual gender is male.

Lately, the raging gender dysphoria has been a lot more than "between a few hours and a few days" per month, and more like literally half the month or more. So I probably should talk about it a bit. Read more... )
baratron: (goggles)
There's nothing quite like searching files for things like TGATCGCGATGTCGTGGTAG.

And it's not immediately obvious when you're looking at two different documents that CTCGACTTCTTCGTCGCCTT and CTCACGCTCGACTTCTTCGT aren't the same, especially when the other primer is identical. I'm not even remotely dyslexic but I still get confused between CTCGAC and CTCACG, because my eyes blur after the first few bases.

(It's actually easier for that one if you start at the far end, or the 3' end if you know about DNA, since it's much easier to see that TT isn't GT than to have to skip the identical CTC bit.)

Where is my "bashes head against wall" emoji?
baratron: (Buttercup)
I wrote a really political story. I don't think it needs any knowledge of Ace Attorney, except perhaps the understanding that yes, this guy really is both a rock star and a prosecutor.

Why the Gavinners Aren't Playing at Pride This Year

Rock star Klavier Gavin is interviewed by his friend Jenny Lizst, a music journalist. She asks him about a rumour that the Gavinners wanted to play at the Los Angeles Pride Festival but were turned down. Klavier answers, but only off-the-record.

Set in 2024, during the Seven Year Gap. Inspired by real-life American and world politics in 2019.

Featuring awesome Gavinners OCs, bisexual erasure, mistrust of the police, young Klavier not understanding his own privilege, and a cheery discussion of how at least half the band would have been killed during the Holocaust. Also much gratuitous German.

(The German has not yet been checked by an actual German speaker so might be wrong.)

Fried

Feb. 15th, 2019 06:05 am
baratron: (goggles)
My brain is fried. My body is fried too.

The anxiety and depression seem to be better but I have EPIC levels of chronic fatigue instead. I slept from 7.30am until 3.30pm on Wednesday, then from 8pm until 1am on Thursday, then from 7am until 2pm on Thursday, then from 5pm until 11.15pm. All times approximate.

I am attempting to do work for my degree after not having been well enough for some time, and I'm doing a very good impression of this meme right now:

I have no idea what I'm doing

Next week I have to make do without a Richard because he is being sent to Munich for work. I have no idea how that's going to work, either. (Volunteers who can come to Kingston to feed me will be welcomed if I'm not asleep. The being asleep at awkward hours is going to make that really tricky.)
baratron: (willpower)
I need it!

I need to WORK for my DEGREE because I haven't done any in ages.
But all I feel like doing is working on my story.

Argh!

Profile

baratron: (Default)
baratron

March 2022

S M T W T F S
  12345
6789101112
1314151617 1819
20212223242526
2728293031  

Syndicate

RSS Atom

Most Popular Tags

Style Credit

Expand Cut Tags

No cut tags
Page generated Jan. 25th, 2026 06:48 am
Powered by Dreamwidth Studios